summaryrefslogtreecommitdiff
path: root/test
diff options
context:
space:
mode:
Diffstat (limited to 'test')
-rw-r--r--test/921-hello-failure/expected.txt8
-rw-r--r--test/921-hello-failure/src/Main.java14
-rw-r--r--test/921-hello-failure/src/MultiRetrans.java108
-rwxr-xr-xtest/930-hello-retransform/build17
-rw-r--r--test/930-hello-retransform/expected.txt2
-rw-r--r--test/930-hello-retransform/info.txt1
-rwxr-xr-xtest/930-hello-retransform/run19
-rw-r--r--test/930-hello-retransform/src/Main.java70
-rw-r--r--test/930-hello-retransform/src/Transform.java28
-rw-r--r--test/Android.run-test.mk1
-rw-r--r--test/ti-agent/common_helper.cc167
-rw-r--r--test/ti-agent/common_helper.h4
-rw-r--r--test/ti-agent/common_load.cc3
13 files changed, 432 insertions, 10 deletions
diff --git a/test/921-hello-failure/expected.txt b/test/921-hello-failure/expected.txt
index 1c1d4d9b80..9615e6b33d 100644
--- a/test/921-hello-failure/expected.txt
+++ b/test/921-hello-failure/expected.txt
@@ -21,3 +21,11 @@ hello2 - MultiRedef
Transformation error : java.lang.Exception(Failed to redefine classes <LTransform;, LTransform2;> due to JVMTI_ERROR_NAMES_DONT_MATCH)
hello - MultiRedef
hello2 - MultiRedef
+hello - MultiRetrans
+hello2 - MultiRetrans
+Transformation error : java.lang.Exception(Failed to retransform classes <LTransform2;, LTransform;> due to JVMTI_ERROR_NAMES_DONT_MATCH)
+hello - MultiRetrans
+hello2 - MultiRetrans
+Transformation error : java.lang.Exception(Failed to retransform classes <LTransform;, LTransform2;> due to JVMTI_ERROR_NAMES_DONT_MATCH)
+hello - MultiRetrans
+hello2 - MultiRetrans
diff --git a/test/921-hello-failure/src/Main.java b/test/921-hello-failure/src/Main.java
index 1fe259961d..43d6e9ed07 100644
--- a/test/921-hello-failure/src/Main.java
+++ b/test/921-hello-failure/src/Main.java
@@ -25,6 +25,7 @@ public class Main {
MissingInterface.doTest(new Transform2());
ReorderInterface.doTest(new Transform2());
MultiRedef.doTest(new Transform(), new Transform2());
+ MultiRetrans.doTest(new Transform(), new Transform2());
}
// Transforms the class. This throws an exception if something goes wrong.
@@ -47,7 +48,20 @@ public class Main {
dex_files.toArray(new byte[0][]));
}
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) throws Exception {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
byte[][] classfiles,
byte[][] dexfiles) throws Exception;
+ public static native void doCommonClassRetransformation(Class<?>... target) throws Exception;
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
}
diff --git a/test/921-hello-failure/src/MultiRetrans.java b/test/921-hello-failure/src/MultiRetrans.java
new file mode 100644
index 0000000000..95aaf074e9
--- /dev/null
+++ b/test/921-hello-failure/src/MultiRetrans.java
@@ -0,0 +1,108 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+
+class MultiRetrans {
+
+ // class NotTransform {
+ // public void sayHi(String name) {
+ // throw new Error("Should not be called!");
+ // }
+ // }
+ private static CommonClassDefinition INVALID_DEFINITION_T1 = new CommonClassDefinition(
+ Transform.class,
+ Base64.getDecoder().decode(
+ "yv66vgAAADQAFQoABgAPBwAQCAARCgACABIHABMHABQBAAY8aW5pdD4BAAMoKVYBAARDb2RlAQAP" +
+ "TGluZU51bWJlclRhYmxlAQAFc2F5SGkBABUoTGphdmEvbGFuZy9TdHJpbmc7KVYBAApTb3VyY2VG" +
+ "aWxlAQARTm90VHJhbnNmb3JtLmphdmEMAAcACAEAD2phdmEvbGFuZy9FcnJvcgEAFVNob3VsZCBu" +
+ "b3QgYmUgY2FsbGVkIQwABwAMAQAMTm90VHJhbnNmb3JtAQAQamF2YS9sYW5nL09iamVjdAAgAAUA" +
+ "BgAAAAAAAgAAAAcACAABAAkAAAAdAAEAAQAAAAUqtwABsQAAAAEACgAAAAYAAQAAAAEAAQALAAwA" +
+ "AQAJAAAAIgADAAIAAAAKuwACWRIDtwAEvwAAAAEACgAAAAYAAQAAAAMAAQANAAAAAgAO"),
+ Base64.getDecoder().decode(
+ "ZGV4CjAzNQDLV95i5xnv6iUi6uIeDoY5jP5Xe9NP1AiYAgAAcAAAAHhWNBIAAAAAAAAAAAQCAAAL" +
+ "AAAAcAAAAAUAAACcAAAAAgAAALAAAAAAAAAAAAAAAAQAAADIAAAAAQAAAOgAAACQAQAACAEAAEoB" +
+ "AABSAQAAYgEAAHUBAACJAQAAnQEAALABAADHAQAAygEAAM4BAADiAQAAAQAAAAIAAAADAAAABAAA" +
+ "AAcAAAAHAAAABAAAAAAAAAAIAAAABAAAAEQBAAAAAAAAAAAAAAAAAQAKAAAAAQABAAAAAAACAAAA" +
+ "AAAAAAAAAAAAAAAAAgAAAAAAAAAFAAAAAAAAAPQBAAAAAAAAAQABAAEAAADpAQAABAAAAHAQAwAA" +
+ "AA4ABAACAAIAAADuAQAACQAAACIAAQAbAQYAAABwIAIAEAAnAAAAAQAAAAMABjxpbml0PgAOTE5v" +
+ "dFRyYW5zZm9ybTsAEUxqYXZhL2xhbmcvRXJyb3I7ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZh" +
+ "L2xhbmcvU3RyaW5nOwARTm90VHJhbnNmb3JtLmphdmEAFVNob3VsZCBub3QgYmUgY2FsbGVkIQAB" +
+ "VgACVkwAEmVtaXR0ZXI6IGphY2stNC4yMAAFc2F5SGkAAQAHDgADAQAHDgAAAAEBAICABIgCAQGg" +
+ "AgAADAAAAAAAAAABAAAAAAAAAAEAAAALAAAAcAAAAAIAAAAFAAAAnAAAAAMAAAACAAAAsAAAAAUA" +
+ "AAAEAAAAyAAAAAYAAAABAAAA6AAAAAEgAAACAAAACAEAAAEQAAABAAAARAEAAAIgAAALAAAASgEA" +
+ "AAMgAAACAAAA6QEAAAAgAAABAAAA9AEAAAAQAAABAAAABAIAAA=="));
+
+ // Valid redefinition of Transform2
+ // class Transform2 implements Iface1, Iface2 {
+ // public void sayHi(String name) {
+ // throw new Error("Should not be called!");
+ // }
+ // }
+ private static CommonClassDefinition VALID_DEFINITION_T2 = new CommonClassDefinition(
+ Transform2.class,
+ Base64.getDecoder().decode(
+ "yv66vgAAADQAGQoABgARBwASCAATCgACABQHABUHABYHABcHABgBAAY8aW5pdD4BAAMoKVYBAARD" +
+ "b2RlAQAPTGluZU51bWJlclRhYmxlAQAFc2F5SGkBABUoTGphdmEvbGFuZy9TdHJpbmc7KVYBAApT" +
+ "b3VyY2VGaWxlAQAPVHJhbnNmb3JtMi5qYXZhDAAJAAoBAA9qYXZhL2xhbmcvRXJyb3IBABVTaG91" +
+ "bGQgbm90IGJlIGNhbGxlZCEMAAkADgEAClRyYW5zZm9ybTIBABBqYXZhL2xhbmcvT2JqZWN0AQAG" +
+ "SWZhY2UxAQAGSWZhY2UyACAABQAGAAIABwAIAAAAAgAAAAkACgABAAsAAAAdAAEAAQAAAAUqtwAB" +
+ "sQAAAAEADAAAAAYAAQAAAAEAAQANAA4AAQALAAAAIgADAAIAAAAKuwACWRIDtwAEvwAAAAEADAAA" +
+ "AAYAAQAAAAMAAQAPAAAAAgAQ"),
+ Base64.getDecoder().decode(
+ "ZGV4CjAzNQDSWls05CPkX+gbTGMVRvx9dc9vozzVbu7AAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAN" +
+ "AAAAcAAAAAcAAACkAAAAAgAAAMAAAAAAAAAAAAAAAAQAAADYAAAAAQAAAPgAAACoAQAAGAEAAGIB" +
+ "AABqAQAAdAEAAH4BAACMAQAAnwEAALMBAADHAQAA3gEAAO8BAADyAQAA9gEAAAoCAAABAAAAAgAA" +
+ "AAMAAAAEAAAABQAAAAYAAAAJAAAACQAAAAYAAAAAAAAACgAAAAYAAABcAQAAAgAAAAAAAAACAAEA" +
+ "DAAAAAMAAQAAAAAABAAAAAAAAAACAAAAAAAAAAQAAABUAQAACAAAAAAAAAAcAgAAAAAAAAEAAQAB" +
+ "AAAAEQIAAAQAAABwEAMAAAAOAAQAAgACAAAAFgIAAAkAAAAiAAMAGwEHAAAAcCACABAAJwAAAAIA" +
+ "AAAAAAEAAQAAAAUABjxpbml0PgAITElmYWNlMTsACExJZmFjZTI7AAxMVHJhbnNmb3JtMjsAEUxq" +
+ "YXZhL2xhbmcvRXJyb3I7ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwAV" +
+ "U2hvdWxkIG5vdCBiZSBjYWxsZWQhAA9UcmFuc2Zvcm0yLmphdmEAAVYAAlZMABJlbWl0dGVyOiBq" +
+ "YWNrLTQuMjAABXNheUhpAAEABw4AAwEABw4AAAABAQCAgASYAgEBsAIAAAwAAAAAAAAAAQAAAAAA" +
+ "AAABAAAADQAAAHAAAAACAAAABwAAAKQAAAADAAAAAgAAAMAAAAAFAAAABAAAANgAAAAGAAAAAQAA" +
+ "APgAAAABIAAAAgAAABgBAAABEAAAAgAAAFQBAAACIAAADQAAAGIBAAADIAAAAgAAABECAAAAIAAA" +
+ "AQAAABwCAAAAEAAAAQAAACwCAAA="));
+
+ public static void doTest(Transform t1, Transform2 t2) {
+ t1.sayHi("MultiRetrans");
+ t2.sayHi("MultiRetrans");
+ try {
+ Main.addMultiTransformationResults(VALID_DEFINITION_T2, INVALID_DEFINITION_T1);
+ Main.enableCommonRetransformation(true);
+ Main.doCommonClassRetransformation(Transform2.class, Transform.class);
+ } catch (Exception e) {
+ System.out.println(
+ "Transformation error : " + e.getClass().getName() + "(" + e.getMessage() + ")");
+ } finally {
+ Main.enableCommonRetransformation(false);
+ }
+ t1.sayHi("MultiRetrans");
+ t2.sayHi("MultiRetrans");
+ try {
+ Main.addMultiTransformationResults(VALID_DEFINITION_T2, INVALID_DEFINITION_T1);
+ Main.enableCommonRetransformation(true);
+ Main.doCommonClassRetransformation(Transform.class, Transform2.class);
+ } catch (Exception e) {
+ System.out.println(
+ "Transformation error : " + e.getClass().getName() + "(" + e.getMessage() + ")");
+ } finally {
+ Main.enableCommonRetransformation(false);
+ }
+ t1.sayHi("MultiRetrans");
+ t2.sayHi("MultiRetrans");
+ }
+}
diff --git a/test/930-hello-retransform/build b/test/930-hello-retransform/build
new file mode 100755
index 0000000000..898e2e54a2
--- /dev/null
+++ b/test/930-hello-retransform/build
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-build "$@" --experimental agents
diff --git a/test/930-hello-retransform/expected.txt b/test/930-hello-retransform/expected.txt
new file mode 100644
index 0000000000..4774b81b49
--- /dev/null
+++ b/test/930-hello-retransform/expected.txt
@@ -0,0 +1,2 @@
+hello
+Goodbye
diff --git a/test/930-hello-retransform/info.txt b/test/930-hello-retransform/info.txt
new file mode 100644
index 0000000000..875a5f6ec1
--- /dev/null
+++ b/test/930-hello-retransform/info.txt
@@ -0,0 +1 @@
+Tests basic functions in the jvmti plugin.
diff --git a/test/930-hello-retransform/run b/test/930-hello-retransform/run
new file mode 100755
index 0000000000..4379349cb2
--- /dev/null
+++ b/test/930-hello-retransform/run
@@ -0,0 +1,19 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-run "$@" --experimental agents \
+ --experimental runtime-plugins \
+ --jvmti
diff --git a/test/930-hello-retransform/src/Main.java b/test/930-hello-retransform/src/Main.java
new file mode 100644
index 0000000000..12194c3235
--- /dev/null
+++ b/test/930-hello-retransform/src/Main.java
@@ -0,0 +1,70 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+public class Main {
+
+ /**
+ * base64 encoded class/dex file for
+ * class Transform {
+ * public void sayHi() {
+ * System.out.println("Goodbye");
+ * }
+ * }
+ */
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+ "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
+ "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
+ "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
+ "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" +
+ "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
+ "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0=");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+ "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+ "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
+ "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+ "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
+ "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
+ "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
+ "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
+ "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
+ "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
+ "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+ "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+ "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
+
+ public static void main(String[] args) {
+ System.loadLibrary(args[1]);
+ doTest(new Transform());
+ }
+
+ public static void doTest(Transform t) {
+ t.sayHi();
+ addCommonTransformationResult("Transform", CLASS_BYTES, DEX_BYTES);
+ enableCommonRetransformation(true);
+ doCommonClassRetransformation(Transform.class);
+ t.sayHi();
+ }
+
+ // Transforms the class
+ private static native void doCommonClassRetransformation(Class<?>... target);
+ private static native void enableCommonRetransformation(boolean enable);
+ private static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/930-hello-retransform/src/Transform.java b/test/930-hello-retransform/src/Transform.java
new file mode 100644
index 0000000000..8e8af355da
--- /dev/null
+++ b/test/930-hello-retransform/src/Transform.java
@@ -0,0 +1,28 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Transform {
+ public void sayHi() {
+ // Use lower 'h' to make sure the string will have a different string id
+ // than the transformation (the transformation code is the same except
+ // the actual printed String, which was making the test inacurately passing
+ // in JIT mode when loading the string from the dex cache, as the string ids
+ // of the two different strings were the same).
+ // We know the string ids will be different because lexicographically:
+ // "Goodbye" < "LTransform;" < "hello".
+ System.out.println("hello");
+ }
+}
diff --git a/test/Android.run-test.mk b/test/Android.run-test.mk
index e604c93c72..38b88e44a6 100644
--- a/test/Android.run-test.mk
+++ b/test/Android.run-test.mk
@@ -309,6 +309,7 @@ TEST_ART_BROKEN_TARGET_TESTS += \
927-timers \
928-jni-table \
929-search \
+ 930-hello-retransform \
ifneq (,$(filter target,$(TARGET_TYPES)))
ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,target,$(RUN_TYPES),$(PREBUILD_TYPES), \
diff --git a/test/ti-agent/common_helper.cc b/test/ti-agent/common_helper.cc
index 2c6d3eda00..8799c9188b 100644
--- a/test/ti-agent/common_helper.cc
+++ b/test/ti-agent/common_helper.cc
@@ -18,6 +18,7 @@
#include <stdio.h>
#include <sstream>
+#include <deque>
#include "art_method.h"
#include "jni.h"
@@ -60,17 +61,17 @@ bool JvmtiErrorToException(JNIEnv* env, jvmtiError error) {
return true;
}
-namespace common_redefine {
-static void throwRedefinitionError(jvmtiEnv* jvmti,
- JNIEnv* env,
- jint num_targets,
- jclass* target,
- jvmtiError res) {
+template <bool is_redefine>
+static void throwCommonRedefinitionError(jvmtiEnv* jvmti,
+ JNIEnv* env,
+ jint num_targets,
+ jclass* target,
+ jvmtiError res) {
std::stringstream err;
char* error = nullptr;
jvmti->GetErrorName(res, &error);
- err << "Failed to redefine class";
+ err << "Failed to " << (is_redefine ? "redefine" : "retransform") << " class";
if (num_targets > 1) {
err << "es";
}
@@ -92,6 +93,16 @@ static void throwRedefinitionError(jvmtiEnv* jvmti,
env->ThrowNew(env->FindClass("java/lang/Exception"), message.c_str());
}
+namespace common_redefine {
+
+static void throwRedefinitionError(jvmtiEnv* jvmti,
+ JNIEnv* env,
+ jint num_targets,
+ jclass* target,
+ jvmtiError res) {
+ return throwCommonRedefinitionError<true>(jvmti, env, num_targets, target, res);
+}
+
static void DoMultiClassRedefine(jvmtiEnv* jvmti_env,
JNIEnv* env,
jint num_redefines,
@@ -161,7 +172,7 @@ extern "C" JNIEXPORT void JNICALL Java_Main_doCommonMultiClassRedefinition(
dex_files.data());
}
-// Don't do anything
+// Get all capabilities except those related to retransformation.
jint OnLoad(JavaVM* vm,
char* options ATTRIBUTE_UNUSED,
void* reserved ATTRIBUTE_UNUSED) {
@@ -169,10 +180,148 @@ jint OnLoad(JavaVM* vm,
printf("Unable to get jvmti env!\n");
return 1;
}
- SetAllCapabilities(jvmti_env);
+ jvmtiCapabilities caps;
+ jvmti_env->GetPotentialCapabilities(&caps);
+ caps.can_retransform_classes = 0;
+ caps.can_retransform_any_class = 0;
+ jvmti_env->AddCapabilities(&caps);
return 0;
}
} // namespace common_redefine
+namespace common_retransform {
+
+struct CommonTransformationResult {
+ std::vector<unsigned char> class_bytes;
+ std::vector<unsigned char> dex_bytes;
+
+ CommonTransformationResult(size_t class_size, size_t dex_size)
+ : class_bytes(class_size), dex_bytes(dex_size) {}
+
+ CommonTransformationResult() = default;
+ CommonTransformationResult(CommonTransformationResult&&) = default;
+ CommonTransformationResult(CommonTransformationResult&) = default;
+};
+
+// Map from class name to transformation result.
+std::map<std::string, std::deque<CommonTransformationResult>> gTransformations;
+
+extern "C" JNIEXPORT void JNICALL Java_Main_addCommonTransformationResult(JNIEnv* env,
+ jclass,
+ jstring class_name,
+ jbyteArray class_array,
+ jbyteArray dex_array) {
+ const char* name_chrs = env->GetStringUTFChars(class_name, nullptr);
+ std::string name_str(name_chrs);
+ env->ReleaseStringUTFChars(class_name, name_chrs);
+ CommonTransformationResult trans(env->GetArrayLength(class_array),
+ env->GetArrayLength(dex_array));
+ if (env->ExceptionOccurred()) {
+ return;
+ }
+ env->GetByteArrayRegion(class_array,
+ 0,
+ env->GetArrayLength(class_array),
+ reinterpret_cast<jbyte*>(trans.class_bytes.data()));
+ if (env->ExceptionOccurred()) {
+ return;
+ }
+ env->GetByteArrayRegion(dex_array,
+ 0,
+ env->GetArrayLength(dex_array),
+ reinterpret_cast<jbyte*>(trans.dex_bytes.data()));
+ if (env->ExceptionOccurred()) {
+ return;
+ }
+ if (gTransformations.find(name_str) == gTransformations.end()) {
+ std::deque<CommonTransformationResult> list;
+ gTransformations[name_str] = std::move(list);
+ }
+ gTransformations[name_str].push_back(std::move(trans));
+}
+
+// The hook we are using.
+void JNICALL CommonClassFileLoadHookRetransformable(jvmtiEnv* jvmti_env,
+ JNIEnv* jni_env ATTRIBUTE_UNUSED,
+ jclass class_being_redefined ATTRIBUTE_UNUSED,
+ jobject loader ATTRIBUTE_UNUSED,
+ const char* name,
+ jobject protection_domain ATTRIBUTE_UNUSED,
+ jint class_data_len ATTRIBUTE_UNUSED,
+ const unsigned char* class_dat ATTRIBUTE_UNUSED,
+ jint* new_class_data_len,
+ unsigned char** new_class_data) {
+ std::string name_str(name);
+ if (gTransformations.find(name_str) != gTransformations.end()) {
+ CommonTransformationResult& res = gTransformations[name_str][0];
+ const std::vector<unsigned char>& desired_array = IsJVM() ? res.class_bytes : res.dex_bytes;
+ unsigned char* new_data;
+ jvmti_env->Allocate(desired_array.size(), &new_data);
+ memcpy(new_data, desired_array.data(), desired_array.size());
+ *new_class_data = new_data;
+ *new_class_data_len = desired_array.size();
+ gTransformations[name_str].pop_front();
+ }
+}
+
+extern "C" JNIEXPORT void Java_Main_enableCommonRetransformation(JNIEnv* env,
+ jclass,
+ jboolean enable) {
+ jvmtiError res = jvmti_env->SetEventNotificationMode(enable ? JVMTI_ENABLE : JVMTI_DISABLE,
+ JVMTI_EVENT_CLASS_FILE_LOAD_HOOK,
+ nullptr);
+ if (res != JVMTI_ERROR_NONE) {
+ JvmtiErrorToException(env, res);
+ }
+}
+
+static void throwRetransformationError(jvmtiEnv* jvmti,
+ JNIEnv* env,
+ jint num_targets,
+ jclass* targets,
+ jvmtiError res) {
+ return throwCommonRedefinitionError<false>(jvmti, env, num_targets, targets, res);
+}
+
+static void DoClassRetransformation(jvmtiEnv* jvmti_env, JNIEnv* env, jobjectArray targets) {
+ std::vector<jclass> classes;
+ jint len = env->GetArrayLength(targets);
+ for (jint i = 0; i < len; i++) {
+ classes.push_back(static_cast<jclass>(env->GetObjectArrayElement(targets, i)));
+ }
+ jvmtiError res = jvmti_env->RetransformClasses(len, classes.data());
+ if (res != JVMTI_ERROR_NONE) {
+ throwRetransformationError(jvmti_env, env, len, classes.data(), res);
+ }
+}
+
+// TODO Write something useful.
+extern "C" JNIEXPORT void JNICALL Java_Main_doCommonClassRetransformation(JNIEnv* env,
+ jclass,
+ jobjectArray targets) {
+ DoClassRetransformation(jvmti_env, env, targets);
+}
+
+// Get all capabilities except those related to retransformation.
+jint OnLoad(JavaVM* vm,
+ char* options ATTRIBUTE_UNUSED,
+ void* reserved ATTRIBUTE_UNUSED) {
+ if (vm->GetEnv(reinterpret_cast<void**>(&jvmti_env), JVMTI_VERSION_1_0)) {
+ printf("Unable to get jvmti env!\n");
+ return 1;
+ }
+ SetAllCapabilities(jvmti_env);
+ jvmtiEventCallbacks cb;
+ memset(&cb, 0, sizeof(cb));
+ cb.ClassFileLoadHook = CommonClassFileLoadHookRetransformable;
+ if (jvmti_env->SetEventCallbacks(&cb, sizeof(cb)) != JVMTI_ERROR_NONE) {
+ printf("Unable to set class file load hook cb!\n");
+ return 1;
+ }
+ return 0;
+}
+
+} // namespace common_retransform
+
} // namespace art
diff --git a/test/ti-agent/common_helper.h b/test/ti-agent/common_helper.h
index 642ca03274..8599fc4d6c 100644
--- a/test/ti-agent/common_helper.h
+++ b/test/ti-agent/common_helper.h
@@ -27,6 +27,10 @@ namespace common_redefine {
jint OnLoad(JavaVM* vm, char* options, void* reserved);
} // namespace common_redefine
+namespace common_retransform {
+jint OnLoad(JavaVM* vm, char* options, void* reserved);
+} // namespace common_retransform
+
extern bool RuntimeIsJVM;
diff --git a/test/ti-agent/common_load.cc b/test/ti-agent/common_load.cc
index 521e672330..1b11442092 100644
--- a/test/ti-agent/common_load.cc
+++ b/test/ti-agent/common_load.cc
@@ -64,8 +64,9 @@ AgentLib agents[] = {
{ "916-obsolete-jit", common_redefine::OnLoad, nullptr },
{ "917-fields-transformation", common_redefine::OnLoad, nullptr },
{ "919-obsolete-fields", common_redefine::OnLoad, nullptr },
- { "921-hello-failure", common_redefine::OnLoad, nullptr },
+ { "921-hello-failure", common_retransform::OnLoad, nullptr },
{ "926-multi-obsolescence", common_redefine::OnLoad, nullptr },
+ { "930-hello-retransform", common_retransform::OnLoad, nullptr },
};
static AgentLib* FindAgent(char* name) {
generated by cgit v1.2.3-59-g8ed1b (git 2.39.0) at 2026-01-10 17:12:36 +0000