summaryrefslogtreecommitdiff
path: root/test
diff options
context:
space:
mode:
Diffstat (limited to 'test')
-rw-r--r--test/623-checker-loop-regressions/src/Main.java24
-rw-r--r--test/902-hello-transformation/src/Main.java51
-rw-r--r--test/902-hello-transformation/src/Transform.java28
-rw-r--r--test/902-hello-transformation/src/art/Redefinition.java96
-rw-r--r--test/902-hello-transformation/src/art/Test902.java82
-rw-r--r--test/913-heaps/expected.txt169
-rw-r--r--test/913-heaps/heaps.cc111
-rw-r--r--test/913-heaps/src/art/Test913.java34
-rw-r--r--test/914-hello-obsolescence/src/Main.java58
-rw-r--r--test/914-hello-obsolescence/src/Transform.java30
-rw-r--r--test/914-hello-obsolescence/src/art/Redefinition.java96
-rw-r--r--test/914-hello-obsolescence/src/art/Test914.java86
-rw-r--r--test/915-obsolete-2/src/Main.java84
-rw-r--r--test/915-obsolete-2/src/art/Redefinition.java96
-rw-r--r--test/915-obsolete-2/src/art/Test915.java123
-rw-r--r--test/916-obsolete-jit/src/Main.java10
-rw-r--r--test/916-obsolete-jit/src/art/Redefinition.java96
-rw-r--r--test/917-fields-transformation/src/Main.java65
-rw-r--r--test/917-fields-transformation/src/Transform.java29
-rw-r--r--test/917-fields-transformation/src/art/Redefinition.java96
-rw-r--r--test/917-fields-transformation/src/art/Test917.java97
-rw-r--r--test/919-obsolete-fields/src/Main.java133
-rw-r--r--test/919-obsolete-fields/src/Transform.java42
-rw-r--r--test/919-obsolete-fields/src/art/Redefinition.java96
-rw-r--r--test/919-obsolete-fields/src/art/Test919.java173
-rw-r--r--test/921-hello-failure/src/Main.java68
-rw-r--r--test/921-hello-failure/src/art/Redefinition.java96
-rw-r--r--test/926-multi-obsolescence/src/CommonClassDefinition.java27
-rw-r--r--test/926-multi-obsolescence/src/Main.java113
-rw-r--r--test/926-multi-obsolescence/src/Transform.java30
-rw-r--r--test/926-multi-obsolescence/src/Transform2.java23
-rw-r--r--test/926-multi-obsolescence/src/art/Redefinition.java96
-rw-r--r--test/926-multi-obsolescence/src/art/Test926.java140
-rw-r--r--test/930-hello-retransform/src/Main.java55
-rw-r--r--test/930-hello-retransform/src/Transform.java28
-rw-r--r--test/930-hello-retransform/src/art/Redefinition.java96
-rw-r--r--test/930-hello-retransform/src/art/Test930.java78
-rw-r--r--test/932-transform-saves/src/Main.java101
-rw-r--r--test/932-transform-saves/src/Transform.java28
-rw-r--r--test/932-transform-saves/src/art/Redefinition.java96
-rw-r--r--test/932-transform-saves/src/art/Test932.java129
-rw-r--r--test/934-load-transform/src/Main.java11
-rw-r--r--test/934-load-transform/src/art/Redefinition.java96
-rw-r--r--test/935-non-retransformable/src/Main.java24
-rw-r--r--test/935-non-retransformable/src/art/Redefinition.java96
-rw-r--r--test/937-hello-retransform-package/src/Main.java16
-rw-r--r--test/937-hello-retransform-package/src/art/Redefinition.java96
-rw-r--r--test/938-load-transform-bcp/src/Main.java8
-rw-r--r--test/938-load-transform-bcp/src/art/Redefinition.java96
-rw-r--r--test/939-hello-transformation-bcp/src/Main.java7
-rw-r--r--test/939-hello-transformation-bcp/src/art/Redefinition.java96
-rw-r--r--test/940-recursive-obsolete/src/Main.java75
-rw-r--r--test/940-recursive-obsolete/src/Transform.java28
-rw-r--r--test/940-recursive-obsolete/src/art/Redefinition.java96
-rw-r--r--test/940-recursive-obsolete/src/art/Test940.java106
-rw-r--r--test/941-recurive-obsolete-jit/src/Main.java7
-rw-r--r--test/941-recurive-obsolete-jit/src/art/Redefinition.java96
-rw-r--r--test/942-private-recursive/src/Main.java80
-rw-r--r--test/942-private-recursive/src/art/Redefinition.java96
-rw-r--r--test/942-private-recursive/src/art/Test942.java115
-rw-r--r--test/943-private-recursive-jit/src/Main.java7
-rw-r--r--test/943-private-recursive-jit/src/art/Redefinition.java96
-rw-r--r--test/944-transform-classloaders/classloader.cc43
-rw-r--r--test/944-transform-classloaders/src/CommonClassDefinition.java27
-rw-r--r--test/944-transform-classloaders/src/Main.java248
-rw-r--r--test/944-transform-classloaders/src/Transform.java28
-rw-r--r--test/944-transform-classloaders/src/Transform2.java21
-rw-r--r--test/944-transform-classloaders/src/art/Redefinition.java96
-rw-r--r--test/944-transform-classloaders/src/art/Test944.java297
-rw-r--r--test/945-obsolete-native/obsolete_native.cc17
-rw-r--r--test/945-obsolete-native/src/Main.java63
-rw-r--r--test/945-obsolete-native/src/Transform.java25
-rw-r--r--test/945-obsolete-native/src/art/Redefinition.java96
-rw-r--r--test/945-obsolete-native/src/art/Test945.java96
-rw-r--r--test/946-obsolete-throw/expected.txt9
-rw-r--r--test/946-obsolete-throw/src/Main.java67
-rw-r--r--test/946-obsolete-throw/src/Transform.java30
-rw-r--r--test/946-obsolete-throw/src/art/Redefinition.java96
-rw-r--r--test/946-obsolete-throw/src/art/Test946.java95
-rw-r--r--test/947-reflect-method/src/Main.java56
-rw-r--r--test/947-reflect-method/src/Transform.java28
-rw-r--r--test/947-reflect-method/src/art/Redefinition.java96
-rw-r--r--test/947-reflect-method/src/art/Test947.java82
-rw-r--r--test/948-change-annotations/src/Main.java9
-rw-r--r--test/948-change-annotations/src/art/Redefinition.java96
-rw-r--r--test/949-in-memory-transform/src/Main.java106
-rw-r--r--test/949-in-memory-transform/src/art/Redefinition.java96
-rw-r--r--test/949-in-memory-transform/src/art/Test949.java123
-rw-r--r--test/950-redefine-intrinsic/src/Main.java6
-rw-r--r--test/950-redefine-intrinsic/src/art/Redefinition.java96
-rw-r--r--test/951-threaded-obsolete/src/Main.java82
-rw-r--r--test/951-threaded-obsolete/src/Transform.java30
-rw-r--r--test/951-threaded-obsolete/src/art/Redefinition.java96
-rw-r--r--test/951-threaded-obsolete/src/art/Test951.java108
-rwxr-xr-xtest/980-redefine-object/check2
-rw-r--r--test/980-redefine-object/expected.txt56
-rw-r--r--test/980-redefine-object/redefine_object.cc58
-rw-r--r--test/980-redefine-object/src-ex/TestWatcher.java60
-rw-r--r--test/980-redefine-object/src/Main.java45
-rw-r--r--test/980-redefine-object/src/art/Redefinition.java96
-rw-r--r--test/981-dedup-original-dex/src/Main.java188
-rw-r--r--test/981-dedup-original-dex/src/Transform.java21
-rw-r--r--test/981-dedup-original-dex/src/Transform2.java21
-rw-r--r--test/981-dedup-original-dex/src/art/Redefinition.java96
-rw-r--r--test/981-dedup-original-dex/src/art/Test981.java210
-rw-r--r--test/982-ok-no-retransform/src/Main.java20
-rw-r--r--test/982-ok-no-retransform/src/Transform.java28
-rw-r--r--test/982-ok-no-retransform/src/art/Redefinition.java96
-rw-r--r--test/982-ok-no-retransform/src/art/Test982.java (renamed from test/942-private-recursive/src/Transform.java)29
-rw-r--r--test/983-source-transform-verify/expected.txt2
-rw-r--r--test/983-source-transform-verify/src/Main.java21
-rw-r--r--test/983-source-transform-verify/src/Transform.java28
-rw-r--r--test/983-source-transform-verify/src/art/Redefinition.java96
-rw-r--r--test/983-source-transform-verify/src/art/Test983.java (renamed from test/915-obsolete-2/src/Transform.java)29
-rw-r--r--test/984-obsolete-invoke/obsolete_invoke.cc6
-rw-r--r--test/984-obsolete-invoke/src/Main.java94
-rw-r--r--test/984-obsolete-invoke/src/Transform.java25
-rw-r--r--test/984-obsolete-invoke/src/art/Redefinition.java96
-rw-r--r--test/984-obsolete-invoke/src/art/Test984.java122
-rw-r--r--test/Android.bp12
-rw-r--r--test/Android.run-test-jvmti-java-library.mk43
-rwxr-xr-xtest/etc/default-build2
-rw-r--r--test/knownfailures.json18
-rw-r--r--test/ti-agent/common_helper.cc129
-rw-r--r--test/ti-agent/common_load.cc14
125 files changed, 5965 insertions, 2819 deletions
diff --git a/test/623-checker-loop-regressions/src/Main.java b/test/623-checker-loop-regressions/src/Main.java
index f0b327840c..2b30986ab3 100644
--- a/test/623-checker-loop-regressions/src/Main.java
+++ b/test/623-checker-loop-regressions/src/Main.java
@@ -288,6 +288,28 @@ public class Main {
}
}
+ // A strange function that does not inline.
+ private static void $noinline$foo(boolean x, int n) {
+ if (n < 0)
+ throw new Error("oh no");
+ if (n > 100) {
+ $noinline$foo(!x, n - 1);
+ $noinline$foo(!x, n - 2);
+ $noinline$foo(!x, n - 3);
+ $noinline$foo(!x, n - 4);
+ }
+ }
+
+ // A loop with environment uses of x (the terminating condition). As exposed by bug
+ // b/37247891, the loop can be unrolled, but should handle the (unlikely, but clearly
+ // not impossible) environment uses of the terminating condition in a correct manner.
+ private static void envUsesInCond() {
+ boolean x = false;
+ for (int i = 0; !(x = i >= 1); i++) {
+ $noinline$foo(true, i);
+ }
+ }
+
public static void main(String[] args) {
expectEquals(10, earlyExitFirst(-1));
for (int i = 0; i <= 10; i++) {
@@ -369,6 +391,8 @@ public class Main {
expectEquals(aa[i], bb.charAt(i));
}
+ envUsesInCond();
+
System.out.println("passed");
}
diff --git a/test/902-hello-transformation/src/Main.java b/test/902-hello-transformation/src/Main.java
index ed8a5007c8..af49cb4eaa 100644
--- a/test/902-hello-transformation/src/Main.java
+++ b/test/902-hello-transformation/src/Main.java
@@ -1,5 +1,5 @@
/*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
@@ -14,53 +14,8 @@
* limitations under the License.
*/
-import java.util.Base64;
public class Main {
-
- /**
- * base64 encoded class/dex file for
- * class Transform {
- * public void sayHi() {
- * System.out.println("Goodbye");
- * }
- * }
- */
- private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
- "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
- "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
- "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
- "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
- "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" +
- "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
- "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0=");
- private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
- "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
- "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
- "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
- "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
- "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
- "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
- "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
- "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
- "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
- "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
- "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
- "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
- "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
-
- public static void main(String[] args) {
- art.Main.bindAgentJNIForClass(Main.class);
- doTest(new Transform());
+ public static void main(String[] args) throws Exception {
+ art.Test902.run();
}
-
- public static void doTest(Transform t) {
- t.sayHi();
- doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
- t.sayHi();
- }
-
- // Transforms the class
- private static native void doCommonClassRedefinition(Class<?> target,
- byte[] class_file,
- byte[] dex_file);
}
diff --git a/test/902-hello-transformation/src/Transform.java b/test/902-hello-transformation/src/Transform.java
deleted file mode 100644
index 8e8af355da..0000000000
--- a/test/902-hello-transformation/src/Transform.java
+++ /dev/null
@@ -1,28 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
- public void sayHi() {
- // Use lower 'h' to make sure the string will have a different string id
- // than the transformation (the transformation code is the same except
- // the actual printed String, which was making the test inacurately passing
- // in JIT mode when loading the string from the dex cache, as the string ids
- // of the two different strings were the same).
- // We know the string ids will be different because lexicographically:
- // "Goodbye" < "LTransform;" < "hello".
- System.out.println("hello");
- }
-}
diff --git a/test/902-hello-transformation/src/art/Redefinition.java b/test/902-hello-transformation/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/902-hello-transformation/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/902-hello-transformation/src/art/Test902.java b/test/902-hello-transformation/src/art/Test902.java
new file mode 100644
index 0000000000..e95558f7c7
--- /dev/null
+++ b/test/902-hello-transformation/src/art/Test902.java
@@ -0,0 +1,82 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.Base64;
+public class Test902 {
+
+ static class Transform {
+ public void sayHi() {
+ // Use lower 'h' to make sure the string will have a different string id
+ // than the transformation (the transformation code is the same except
+ // the actual printed String, which was making the test inacurately passing
+ // in JIT mode when loading the string from the dex cache, as the string ids
+ // of the two different strings were the same).
+ // We know the string ids will be different because lexicographically:
+ // "Goodbye" < "LTransform;" < "hello".
+ System.out.println("hello");
+ }
+ }
+
+ /**
+ * base64 encoded class/dex file for
+ * class Transform {
+ * public void sayHi() {
+ * System.out.println("Goodbye");
+ * }
+ * }
+ */
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAIAoABgAOCQAPABAIABEKABIAEwcAFQcAGAEABjxpbml0PgEAAygpVgEABENvZGUB" +
+ "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAAxUZXN0OTAyLmphdmEMAAcA" +
+ "CAcAGQwAGgAbAQAHR29vZGJ5ZQcAHAwAHQAeBwAfAQAVYXJ0L1Rlc3Q5MDIkVHJhbnNmb3JtAQAJ" +
+ "VHJhbnNmb3JtAQAMSW5uZXJDbGFzc2VzAQAQamF2YS9sYW5nL09iamVjdAEAEGphdmEvbGFuZy9T" +
+ "eXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsBABNqYXZhL2lvL1ByaW50U3RyZWFt" +
+ "AQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgEAC2FydC9UZXN0OTAyACAABQAGAAAA" +
+ "AAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAJQABAAsACAABAAkA" +
+ "AAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAAnAAgAKAACAAwAAAACAA0AFwAAAAoA" +
+ "AQAFABQAFgAI");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQCpghS3AAAAAAAAAAAAAAAAAAAAAAAAAAC4AwAAcAAAAHhWNBIAAAAAAAAAAPQCAAAU" +
+ "AAAAcAAAAAkAAADAAAAAAgAAAOQAAAABAAAA/AAAAAQAAAAEAQAAAQAAACQBAAB0AgAARAEAAEQB" +
+ "AABMAQAAVQEAAG4BAAB9AQAAoQEAAMEBAADYAQAA7AEAAAACAAAUAgAAIgIAAC0CAAAwAgAANAIA" +
+ "AEECAABHAgAATAIAAFUCAABcAgAAAgAAAAMAAAAEAAAABQAAAAYAAAAHAAAACAAAAAkAAAAMAAAA" +
+ "DAAAAAgAAAAAAAAADQAAAAgAAABkAgAABwAEABAAAAAAAAAAAAAAAAAAAAASAAAABAABABEAAAAF" +
+ "AAAAAAAAAAAAAAAAAAAABQAAAAAAAAAKAAAA5AIAALgCAAAAAAAABjxpbml0PgAHR29vZGJ5ZQAX" +
+ "TGFydC9UZXN0OTAyJFRyYW5zZm9ybTsADUxhcnQvVGVzdDkwMjsAIkxkYWx2aWsvYW5ub3RhdGlv" +
+ "bi9FbmNsb3NpbmdDbGFzczsAHkxkYWx2aWsvYW5ub3RhdGlvbi9Jbm5lckNsYXNzOwAVTGphdmEv" +
+ "aW8vUHJpbnRTdHJlYW07ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwAS" +
+ "TGphdmEvbGFuZy9TeXN0ZW07AAxUZXN0OTAyLmphdmEACVRyYW5zZm9ybQABVgACVkwAC2FjY2Vz" +
+ "c0ZsYWdzAARuYW1lAANvdXQAB3ByaW50bG4ABXNheUhpAAV2YWx1ZQAAAQAAAAYAAAAlAAcOACcA" +
+ "Bw4BCA8AAAAAAQABAAEAAABsAgAABAAAAHAQAwAAAA4AAwABAAIAAABxAgAACQAAAGIAAAAbAQEA" +
+ "AABuIAIAEAAOAAAAAAABAQCAgAT8BAEBlAUAAAICARMYAQIDAg4ECA8XCwACAAAAyAIAAM4CAADY" +
+ "AgAAAAAAAAAAAAAAAAAAEAAAAAAAAAABAAAAAAAAAAEAAAAUAAAAcAAAAAIAAAAJAAAAwAAAAAMA" +
+ "AAACAAAA5AAAAAQAAAABAAAA/AAAAAUAAAAEAAAABAEAAAYAAAABAAAAJAEAAAIgAAAUAAAARAEA" +
+ "AAEQAAABAAAAZAIAAAMgAAACAAAAbAIAAAEgAAACAAAAfAIAAAAgAAABAAAAuAIAAAQgAAACAAAA" +
+ "yAIAAAMQAAABAAAA2AIAAAYgAAABAAAA5AIAAAAQAAABAAAA9AIAAA==");
+
+ public static void run() {
+ Redefinition.setTestConfiguration(Redefinition.Config.COMMON_REDEFINE);
+ doTest(new Transform());
+ }
+
+ public static void doTest(Transform t) {
+ t.sayHi();
+ Redefinition.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+ t.sayHi();
+ }
+}
diff --git a/test/913-heaps/expected.txt b/test/913-heaps/expected.txt
index 2a183ee06b..702b247819 100644
--- a/test/913-heaps/expected.txt
+++ b/test/913-heaps/expected.txt
@@ -1,9 +1,10 @@
---
true true
+root@root --(jni-local[id=1,tag=3000,depth=0,method=followReferences])--> 3000@0 [size=136, length=-1]
root@root --(stack-local[id=1,tag=3000,depth=2,method=doFollowReferencesTestNonRoot,vreg=13,location= 32])--> 1@1000 [size=16, length=-1]
-root@root --(stack-local[id=1,tag=3000,depth=3,method=doFollowReferencesTest,vreg=1,location= 28])--> 3000@0 [size=132, length=-1]
-root@root --(thread)--> 3000@0 [size=132, length=-1]
-0@0 --(array-element@0)--> 1@1000 [size=16, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=3,method=doFollowReferencesTest,vreg=1,location= 28])--> 3000@0 [size=136, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=5,method=run,vreg=2,location= 0])--> 3000@0 [size=136, length=-1]
+root@root --(thread)--> 3000@0 [size=136, length=-1]
1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
1002@0 --(interface)--> 2001@0 [size=124, length=-1]
1002@0 --(superclass)--> 1001@0 [size=123, length=-1]
@@ -14,11 +15,13 @@ root@root --(thread)--> 3000@0 [size=132, length=-1]
2@1000 --(class)--> 1000@0 [size=123, length=-1]
3@1001 --(class)--> 1001@0 [size=123, length=-1]
3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-3@1001 --(field@5)--> 5@1002 [size=32, length=-1]
+3@1001 --(field@5)--> 5@1002 [size=36, length=-1]
4@1000 --(class)--> 1000@0 [size=123, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
5@1002 --(class)--> 1002@0 [size=123, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@8)--> 500@0 [size=20, length=2]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
6@1000 --(class)--> 1000@0 [size=123, length=-1]
---
1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
@@ -31,20 +34,24 @@ root@root --(thread)--> 3000@0 [size=132, length=-1]
2@1000 --(class)--> 1000@0 [size=123, length=-1]
3@1001 --(class)--> 1001@0 [size=123, length=-1]
3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-3@1001 --(field@5)--> 5@1002 [size=32, length=-1]
+3@1001 --(field@5)--> 5@1002 [size=36, length=-1]
4@1000 --(class)--> 1000@0 [size=123, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
5@1002 --(class)--> 1002@0 [size=123, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@8)--> 500@0 [size=20, length=2]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
6@1000 --(class)--> 1000@0 [size=123, length=-1]
---
root@root --(jni-global)--> 1@1000 [size=16, length=-1]
root@root --(jni-local[id=1,tag=3000,depth=0,method=followReferences])--> 1@1000 [size=16, length=-1]
+root@root --(jni-local[id=1,tag=3000,depth=0,method=followReferences])--> 3000@0 [size=136, length=-1]
root@root --(stack-local[id=1,tag=3000,depth=1,method=doFollowReferencesTestImpl,vreg=13,location= 10])--> 1@1000 [size=16, length=-1]
root@root --(stack-local[id=1,tag=3000,depth=1,method=doFollowReferencesTestImpl,vreg=5,location= 10])--> 1@1000 [size=16, length=-1]
root@root --(stack-local[id=1,tag=3000,depth=2,method=doFollowReferencesTestRoot,vreg=4,location= 19])--> 1@1000 [size=16, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=5,method=run,vreg=2,location= 0])--> 3000@0 [size=136, length=-1]
root@root --(thread)--> 1@1000 [size=16, length=-1]
-root@root --(thread)--> 3000@0 [size=132, length=-1]
+root@root --(thread)--> 3000@0 [size=136, length=-1]
1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
1002@0 --(interface)--> 2001@0 [size=124, length=-1]
1002@0 --(superclass)--> 1001@0 [size=123, length=-1]
@@ -55,11 +62,13 @@ root@root --(thread)--> 3000@0 [size=132, length=-1]
2@1000 --(class)--> 1000@0 [size=123, length=-1]
3@1001 --(class)--> 1001@0 [size=123, length=-1]
3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-3@1001 --(field@5)--> 5@1002 [size=32, length=-1]
+3@1001 --(field@5)--> 5@1002 [size=36, length=-1]
4@1000 --(class)--> 1000@0 [size=123, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
5@1002 --(class)--> 1002@0 [size=123, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@8)--> 500@0 [size=20, length=2]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
6@1000 --(class)--> 1000@0 [size=123, length=-1]
---
1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
@@ -72,43 +81,48 @@ root@root --(thread)--> 3000@0 [size=132, length=-1]
2@1000 --(class)--> 1000@0 [size=123, length=-1]
3@1001 --(class)--> 1001@0 [size=123, length=-1]
3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-3@1001 --(field@5)--> 5@1002 [size=32, length=-1]
+3@1001 --(field@5)--> 5@1002 [size=36, length=-1]
4@1000 --(class)--> 1000@0 [size=123, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
5@1002 --(class)--> 1002@0 [size=123, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@8)--> 500@0 [size=20, length=2]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
6@1000 --(class)--> 1000@0 [size=123, length=-1]
---
-root@root --(thread)--> 3000@0 [size=132, length=-1]
+root@root --(thread)--> 3000@0 [size=136, length=-1]
---
3@1001 --(class)--> 1001@0 [size=123, length=-1]
---
-root@root --(thread)--> 3000@0 [size=132, length=-1]
+root@root --(thread)--> 3000@0 [size=136, length=-1]
---
3@1001 --(class)--> 1001@0 [size=123, length=-1]
---
+root@root --(jni-local[id=1,tag=3000,depth=0,method=followReferences])--> 3000@0 [size=136, length=-1]
root@root --(stack-local[id=1,tag=3000,depth=2,method=doFollowReferencesTestNonRoot,vreg=13,location= 32])--> 1@1000 [size=16, length=-1]
-root@root --(stack-local[id=1,tag=3000,depth=3,method=doFollowReferencesTest,vreg=1,location= 28])--> 3000@0 [size=132, length=-1]
-root@root --(thread)--> 3000@0 [size=132, length=-1]
-0@0 --(array-element@0)--> 1@1000 [size=16, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=3,method=doFollowReferencesTest,vreg=1,location= 28])--> 3000@0 [size=136, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=5,method=run,vreg=2,location= 0])--> 3000@0 [size=136, length=-1]
+root@root --(thread)--> 3000@0 [size=136, length=-1]
---
1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
3@1001 --(class)--> 1001@0 [size=123, length=-1]
3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-3@1001 --(field@5)--> 5@1002 [size=32, length=-1]
+3@1001 --(field@5)--> 5@1002 [size=36, length=-1]
---
root@root --(jni-global)--> 1@1000 [size=16, length=-1]
root@root --(jni-local[id=1,tag=3000,depth=0,method=followReferences])--> 1@1000 [size=16, length=-1]
+root@root --(jni-local[id=1,tag=3000,depth=0,method=followReferences])--> 3000@0 [size=136, length=-1]
root@root --(stack-local[id=1,tag=3000,depth=1,method=doFollowReferencesTestImpl,vreg=13,location= 10])--> 1@1000 [size=16, length=-1]
root@root --(stack-local[id=1,tag=3000,depth=1,method=doFollowReferencesTestImpl,vreg=5,location= 10])--> 1@1000 [size=16, length=-1]
root@root --(stack-local[id=1,tag=3000,depth=2,method=doFollowReferencesTestRoot,vreg=4,location= 19])--> 1@1000 [size=16, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=5,method=run,vreg=2,location= 0])--> 3000@0 [size=136, length=-1]
root@root --(thread)--> 1@1000 [size=16, length=-1]
-root@root --(thread)--> 3000@0 [size=132, length=-1]
+root@root --(thread)--> 3000@0 [size=136, length=-1]
---
1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
3@1001 --(class)--> 1001@0 [size=123, length=-1]
3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-3@1001 --(field@5)--> 5@1002 [size=32, length=-1]
+3@1001 --(field@5)--> 5@1002 [size=36, length=-1]
---
[1@0 (32, 'HelloWorld'), 2@0 (16, '')]
2
@@ -148,16 +162,17 @@ root@root --(thread)--> 3000@0 [size=132, length=-1]
10008
--- klass ---
root@root --(stack-local[id=1,tag=3000,depth=2,method=doFollowReferencesTestNonRoot,vreg=13,location= 32])--> 1@1000 [size=16, length=-1]
-0@0 --(array-element@0)--> 1@1000 [size=16, length=-1]
1@1000 --(field@2)--> 2@1000 [size=16, length=-1]
3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
---
1@1000 --(field@2)--> 2@1000 [size=16, length=-1]
3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
---
root@root --(jni-global)--> 1@1000 [size=16, length=-1]
root@root --(jni-local[id=1,tag=3000,depth=0,method=followReferences])--> 1@1000 [size=16, length=-1]
@@ -167,13 +182,15 @@ root@root --(stack-local[id=1,tag=3000,depth=2,method=doFollowReferencesTestRoot
root@root --(thread)--> 1@1000 [size=16, length=-1]
1@1000 --(field@2)--> 2@1000 [size=16, length=-1]
3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
---
1@1000 --(field@2)--> 2@1000 [size=16, length=-1]
3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
---
--- heap_filter ---
---- tagged objects
@@ -182,10 +199,11 @@ root@root --(thread)--> 1@1000 [size=16, length=-1]
---
---
---- untagged objects
+root@root --(jni-local[id=1,tag=3000,depth=0,method=followReferences])--> 3000@0 [size=136, length=-1]
root@root --(stack-local[id=1,tag=3000,depth=2,method=doFollowReferencesTestNonRoot,vreg=13,location= 32])--> 1@1000 [size=16, length=-1]
-root@root --(stack-local[id=1,tag=3000,depth=3,method=doFollowReferencesTest,vreg=1,location= 28])--> 3000@0 [size=132, length=-1]
-root@root --(thread)--> 3000@0 [size=132, length=-1]
-0@0 --(array-element@0)--> 1@1000 [size=16, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=3,method=doFollowReferencesTest,vreg=1,location= 28])--> 3000@0 [size=136, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=5,method=run,vreg=2,location= 0])--> 3000@0 [size=136, length=-1]
+root@root --(thread)--> 3000@0 [size=136, length=-1]
1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
1002@0 --(interface)--> 2001@0 [size=124, length=-1]
1002@0 --(superclass)--> 1001@0 [size=123, length=-1]
@@ -196,11 +214,13 @@ root@root --(thread)--> 3000@0 [size=132, length=-1]
2@1000 --(class)--> 1000@0 [size=123, length=-1]
3@1001 --(class)--> 1001@0 [size=123, length=-1]
3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-3@1001 --(field@5)--> 5@1002 [size=32, length=-1]
+3@1001 --(field@5)--> 5@1002 [size=36, length=-1]
4@1000 --(class)--> 1000@0 [size=123, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
5@1002 --(class)--> 1002@0 [size=123, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@8)--> 500@0 [size=20, length=2]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
6@1000 --(class)--> 1000@0 [size=123, length=-1]
---
1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
@@ -213,20 +233,24 @@ root@root --(thread)--> 3000@0 [size=132, length=-1]
2@1000 --(class)--> 1000@0 [size=123, length=-1]
3@1001 --(class)--> 1001@0 [size=123, length=-1]
3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-3@1001 --(field@5)--> 5@1002 [size=32, length=-1]
+3@1001 --(field@5)--> 5@1002 [size=36, length=-1]
4@1000 --(class)--> 1000@0 [size=123, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
5@1002 --(class)--> 1002@0 [size=123, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@8)--> 500@0 [size=20, length=2]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
6@1000 --(class)--> 1000@0 [size=123, length=-1]
---
root@root --(jni-global)--> 1@1000 [size=16, length=-1]
root@root --(jni-local[id=1,tag=3000,depth=0,method=followReferences])--> 1@1000 [size=16, length=-1]
+root@root --(jni-local[id=1,tag=3000,depth=0,method=followReferences])--> 3000@0 [size=136, length=-1]
root@root --(stack-local[id=1,tag=3000,depth=1,method=doFollowReferencesTestImpl,vreg=13,location= 10])--> 1@1000 [size=16, length=-1]
root@root --(stack-local[id=1,tag=3000,depth=1,method=doFollowReferencesTestImpl,vreg=5,location= 10])--> 1@1000 [size=16, length=-1]
root@root --(stack-local[id=1,tag=3000,depth=2,method=doFollowReferencesTestRoot,vreg=4,location= 19])--> 1@1000 [size=16, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=5,method=run,vreg=2,location= 0])--> 3000@0 [size=136, length=-1]
root@root --(thread)--> 1@1000 [size=16, length=-1]
-root@root --(thread)--> 3000@0 [size=132, length=-1]
+root@root --(thread)--> 3000@0 [size=136, length=-1]
1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
1002@0 --(interface)--> 2001@0 [size=124, length=-1]
1002@0 --(superclass)--> 1001@0 [size=123, length=-1]
@@ -237,11 +261,13 @@ root@root --(thread)--> 3000@0 [size=132, length=-1]
2@1000 --(class)--> 1000@0 [size=123, length=-1]
3@1001 --(class)--> 1001@0 [size=123, length=-1]
3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-3@1001 --(field@5)--> 5@1002 [size=32, length=-1]
+3@1001 --(field@5)--> 5@1002 [size=36, length=-1]
4@1000 --(class)--> 1000@0 [size=123, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
5@1002 --(class)--> 1002@0 [size=123, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@8)--> 500@0 [size=20, length=2]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
6@1000 --(class)--> 1000@0 [size=123, length=-1]
---
1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
@@ -254,16 +280,20 @@ root@root --(thread)--> 3000@0 [size=132, length=-1]
2@1000 --(class)--> 1000@0 [size=123, length=-1]
3@1001 --(class)--> 1001@0 [size=123, length=-1]
3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-3@1001 --(field@5)--> 5@1002 [size=32, length=-1]
+3@1001 --(field@5)--> 5@1002 [size=36, length=-1]
4@1000 --(class)--> 1000@0 [size=123, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
5@1002 --(class)--> 1002@0 [size=123, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@8)--> 500@0 [size=20, length=2]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
6@1000 --(class)--> 1000@0 [size=123, length=-1]
---
---- tagged classes
-root@root --(stack-local[id=1,tag=3000,depth=3,method=doFollowReferencesTest,vreg=1,location= 28])--> 3000@0 [size=132, length=-1]
-root@root --(thread)--> 3000@0 [size=132, length=-1]
+root@root --(jni-local[id=1,tag=3000,depth=0,method=followReferences])--> 3000@0 [size=136, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=3,method=doFollowReferencesTest,vreg=1,location= 28])--> 3000@0 [size=136, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=5,method=run,vreg=2,location= 0])--> 3000@0 [size=136, length=-1]
+root@root --(thread)--> 3000@0 [size=136, length=-1]
1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
1002@0 --(interface)--> 2001@0 [size=124, length=-1]
1002@0 --(superclass)--> 1001@0 [size=123, length=-1]
@@ -273,6 +303,7 @@ root@root --(thread)--> 3000@0 [size=132, length=-1]
3@1001 --(class)--> 1001@0 [size=123, length=-1]
4@1000 --(class)--> 1000@0 [size=123, length=-1]
5@1002 --(class)--> 1002@0 [size=123, length=-1]
+5@1002 --(field@8)--> 500@0 [size=20, length=2]
6@1000 --(class)--> 1000@0 [size=123, length=-1]
---
1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
@@ -284,9 +315,12 @@ root@root --(thread)--> 3000@0 [size=132, length=-1]
3@1001 --(class)--> 1001@0 [size=123, length=-1]
4@1000 --(class)--> 1000@0 [size=123, length=-1]
5@1002 --(class)--> 1002@0 [size=123, length=-1]
+5@1002 --(field@8)--> 500@0 [size=20, length=2]
6@1000 --(class)--> 1000@0 [size=123, length=-1]
---
-root@root --(thread)--> 3000@0 [size=132, length=-1]
+root@root --(jni-local[id=1,tag=3000,depth=0,method=followReferences])--> 3000@0 [size=136, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=5,method=run,vreg=2,location= 0])--> 3000@0 [size=136, length=-1]
+root@root --(thread)--> 3000@0 [size=136, length=-1]
1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
1002@0 --(interface)--> 2001@0 [size=124, length=-1]
1002@0 --(superclass)--> 1001@0 [size=123, length=-1]
@@ -296,6 +330,7 @@ root@root --(thread)--> 3000@0 [size=132, length=-1]
3@1001 --(class)--> 1001@0 [size=123, length=-1]
4@1000 --(class)--> 1000@0 [size=123, length=-1]
5@1002 --(class)--> 1002@0 [size=123, length=-1]
+5@1002 --(field@8)--> 500@0 [size=20, length=2]
6@1000 --(class)--> 1000@0 [size=123, length=-1]
---
1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
@@ -307,24 +342,26 @@ root@root --(thread)--> 3000@0 [size=132, length=-1]
3@1001 --(class)--> 1001@0 [size=123, length=-1]
4@1000 --(class)--> 1000@0 [size=123, length=-1]
5@1002 --(class)--> 1002@0 [size=123, length=-1]
+5@1002 --(field@8)--> 500@0 [size=20, length=2]
6@1000 --(class)--> 1000@0 [size=123, length=-1]
---
---- untagged classes
root@root --(stack-local[id=1,tag=3000,depth=2,method=doFollowReferencesTestNonRoot,vreg=13,location= 32])--> 1@1000 [size=16, length=-1]
-0@0 --(array-element@0)--> 1@1000 [size=16, length=-1]
1@1000 --(field@2)--> 2@1000 [size=16, length=-1]
1@1000 --(field@3)--> 3@1001 [size=24, length=-1]
3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-3@1001 --(field@5)--> 5@1002 [size=32, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+3@1001 --(field@5)--> 5@1002 [size=36, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
---
1@1000 --(field@2)--> 2@1000 [size=16, length=-1]
1@1000 --(field@3)--> 3@1001 [size=24, length=-1]
3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-3@1001 --(field@5)--> 5@1002 [size=32, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+3@1001 --(field@5)--> 5@1002 [size=36, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
---
root@root --(jni-global)--> 1@1000 [size=16, length=-1]
root@root --(jni-local[id=1,tag=3000,depth=0,method=followReferences])--> 1@1000 [size=16, length=-1]
@@ -335,14 +372,16 @@ root@root --(thread)--> 1@1000 [size=16, length=-1]
1@1000 --(field@2)--> 2@1000 [size=16, length=-1]
1@1000 --(field@3)--> 3@1001 [size=24, length=-1]
3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-3@1001 --(field@5)--> 5@1002 [size=32, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+3@1001 --(field@5)--> 5@1002 [size=36, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
---
1@1000 --(field@2)--> 2@1000 [size=16, length=-1]
1@1000 --(field@3)--> 3@1001 [size=24, length=-1]
3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-3@1001 --(field@5)--> 5@1002 [size=32, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+3@1001 --(field@5)--> 5@1002 [size=36, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
---
diff --git a/test/913-heaps/heaps.cc b/test/913-heaps/heaps.cc
index 6a06b29152..19e12ae731 100644
--- a/test/913-heaps/heaps.cc
+++ b/test/913-heaps/heaps.cc
@@ -19,40 +19,35 @@
#include <string.h>
#include <iostream>
+#include <sstream>
#include <vector>
#include "android-base/macros.h"
#include "android-base/logging.h"
#include "android-base/stringprintf.h"
-#include "jit/jit.h"
#include "jni.h"
-#include "native_stack_dump.h"
#include "jvmti.h"
-#include "runtime.h"
-#include "scoped_thread_state_change-inl.h"
-#include "thread-inl.h"
-#include "thread_list.h"
// Test infrastructure
#include "jni_helper.h"
#include "jvmti_helper.h"
#include "test_env.h"
+#include "ti_utf.h"
namespace art {
namespace Test913Heaps {
using android::base::StringPrintf;
+#define FINAL final
+#define OVERRIDE override
+#define UNREACHABLE __builtin_unreachable
+
extern "C" JNIEXPORT void JNICALL Java_art_Test913_forceGarbageCollection(
- JNIEnv* env ATTRIBUTE_UNUSED, jclass klass ATTRIBUTE_UNUSED) {
+ JNIEnv* env, jclass klass ATTRIBUTE_UNUSED) {
jvmtiError ret = jvmti_env->ForceGarbageCollection();
- if (ret != JVMTI_ERROR_NONE) {
- char* err;
- jvmti_env->GetErrorName(ret, &err);
- printf("Error forcing a garbage collection: %s\n", err);
- jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(err));
- }
+ JvmtiErrorToException(env, jvmti_env, ret);
}
class IterationConfig {
@@ -92,7 +87,8 @@ static jint JNICALL HeapReferenceCallback(jvmtiHeapReferenceKind reference_kind,
user_data);
}
-static bool Run(jint heap_filter,
+static bool Run(JNIEnv* env,
+ jint heap_filter,
jclass klass_filter,
jobject initial_object,
IterationConfig* config) {
@@ -105,14 +101,7 @@ static bool Run(jint heap_filter,
initial_object,
&callbacks,
config);
- if (ret != JVMTI_ERROR_NONE) {
- char* err;
- jvmti_env->GetErrorName(ret, &err);
- printf("Failure running FollowReferences: %s\n", err);
- jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(err));
- return false;
- }
- return true;
+ return !JvmtiErrorToException(env, jvmti_env, ret);
}
extern "C" JNIEXPORT jobjectArray JNICALL Java_art_Test913_followReferences(
@@ -142,6 +131,27 @@ extern "C" JNIEXPORT jobjectArray JNICALL Java_art_Test913_followReferences(
jint length,
void* user_data ATTRIBUTE_UNUSED) OVERRIDE {
jlong tag = *tag_ptr;
+
+ // Ignore any jni-global roots with untagged classes. These can be from the environment,
+ // or the JIT.
+ if (reference_kind == JVMTI_HEAP_REFERENCE_JNI_GLOBAL && class_tag == 0) {
+ return 0;
+ }
+ // Ignore classes (1000-1002@0) for thread objects. These can be held by the JIT.
+ if (reference_kind == JVMTI_HEAP_REFERENCE_THREAD && class_tag == 0 &&
+ (1000 <= *tag_ptr && *tag_ptr <= 1002)) {
+ return 0;
+ }
+ // Ignore stack-locals of untagged threads. That is the environment.
+ if (reference_kind == JVMTI_HEAP_REFERENCE_STACK_LOCAL &&
+ reference_info->stack_local.thread_tag != 3000) {
+ return 0;
+ }
+ // Ignore array elements with an untagged source. These are from the environment.
+ if (reference_kind == JVMTI_HEAP_REFERENCE_ARRAY_ELEMENT && *referrer_tag_ptr == 0) {
+ return 0;
+ }
+
// Only check tagged objects.
if (tag == 0) {
return JVMTI_VISIT_OBJECTS;
@@ -201,10 +211,6 @@ extern "C" JNIEXPORT jobjectArray JNICALL Java_art_Test913_followReferences(
reference_info,
adapted_size,
length));
-
- if (reference_kind == JVMTI_HEAP_REFERENCE_THREAD && *tag_ptr == 1000) {
- DumpStacks();
- }
}
std::vector<std::string> GetLines() const {
@@ -259,9 +265,15 @@ extern "C" JNIEXPORT jobjectArray JNICALL Java_art_Test913_followReferences(
if (info_.jni_local.method != nullptr) {
jvmti_env->GetMethodName(info_.jni_local.method, &name, nullptr, nullptr);
}
+ // Normalize the thread id, as this depends on the number of other threads
+ // and which thread is running the test. Should be:
+ // jlong thread_id = info_.jni_local.thread_id;
+ // TODO: A pre-pass before the test should be able fetch this number, so it can
+ // be compared explicitly.
+ jlong thread_id = 1;
std::string ret = StringPrintf("jni-local[id=%" PRId64 ",tag=%" PRId64 ",depth=%d,"
"method=%s]",
- info_.jni_local.thread_id,
+ thread_id,
info_.jni_local.thread_tag,
info_.jni_local.depth,
name == nullptr ? "<null>" : name);
@@ -284,13 +296,12 @@ extern "C" JNIEXPORT jobjectArray JNICALL Java_art_Test913_followReferences(
jlong size,
jint length,
const jvmtiHeapReferenceInfo* reference_info)
- REQUIRES_SHARED(Locks::mutator_lock_)
: Elem(referrer, referree, size, length) {
memcpy(&info_, reference_info, sizeof(jvmtiHeapReferenceInfo));
- // Debug stack trace for failure condition. Remove when done.
- if (info_.stack_local.depth == 3 && info_.stack_local.slot == 13) {
- DumpNativeStack(std::cerr, GetTid());
- Thread::Current()->DumpJavaStack(std::cerr, false, false);
+
+ // Debug code. Try to figure out where bad depth is coming from.
+ if (reference_info->stack_local.depth == 6) {
+ LOG(FATAL) << "Unexpected depth of 6";
}
}
@@ -300,9 +311,15 @@ extern "C" JNIEXPORT jobjectArray JNICALL Java_art_Test913_followReferences(
if (info_.stack_local.method != nullptr) {
jvmti_env->GetMethodName(info_.stack_local.method, &name, nullptr, nullptr);
}
+ // Normalize the thread id, as this depends on the number of other threads
+ // and which thread is running the test. Should be:
+ // jlong thread_id = info_.stack_local.thread_id;
+ // TODO: A pre-pass before the test should be able fetch this number, so it can
+ // be compared explicitly.
+ jlong thread_id = 1;
std::string ret = StringPrintf("stack-local[id=%" PRId64 ",tag=%" PRId64 ",depth=%d,"
"method=%s,vreg=%d,location=% " PRId64 "]",
- info_.stack_local.thread_id,
+ thread_id,
info_.stack_local.thread_tag,
info_.stack_local.depth,
name == nullptr ? "<null>" : name,
@@ -361,7 +378,13 @@ extern "C" JNIEXPORT jobjectArray JNICALL Java_art_Test913_followReferences(
tmp));
}
case JVMTI_HEAP_REFERENCE_ARRAY_ELEMENT: {
- std::string tmp = StringPrintf("array-element@%d", reference_info->array.index);
+ jint index = reference_info->array.index;
+ // Normalize if it's "0@0" -> "3000@1".
+ // TODO: A pre-pass could probably give us this index to check explicitly.
+ if (referrer == "0@0" && referree == "3000@0") {
+ index = 0;
+ }
+ std::string tmp = StringPrintf("array-element@%d", index);
return std::unique_ptr<Elem>(new StringElement(referrer,
referree,
size,
@@ -459,16 +482,6 @@ extern "C" JNIEXPORT jobjectArray JNICALL Java_art_Test913_followReferences(
UNREACHABLE();
}
- static void DumpStacks() NO_THREAD_SAFETY_ANALYSIS {
- auto dump_function = [](art::Thread* t, void* data ATTRIBUTE_UNUSED) {
- std::string name;
- t->GetThreadName(name);
- LOG(ERROR) << name;
- art::DumpNativeStack(LOG_STREAM(ERROR), t->GetTid());
- };
- art::Runtime::Current()->GetThreadList()->ForEach(dump_function, nullptr);
- }
-
jint counter_;
const jint stop_after_;
const jint follow_set_;
@@ -476,8 +489,6 @@ extern "C" JNIEXPORT jobjectArray JNICALL Java_art_Test913_followReferences(
std::vector<std::unique_ptr<Elem>> lines_;
};
- jit::ScopedJitSuspend sjs; // Wait to avoid JIT influence (e.g., JNI globals).
-
// If jniRef isn't null, add a local and a global ref.
ScopedLocalRef<jobject> jni_local_ref(env, nullptr);
jobject jni_global_ref = nullptr;
@@ -487,7 +498,9 @@ extern "C" JNIEXPORT jobjectArray JNICALL Java_art_Test913_followReferences(
}
PrintIterationConfig config(stop_after, follow_set);
- Run(heap_filter, klass_filter, initial_object, &config);
+ if (!Run(env, heap_filter, klass_filter, initial_object, &config)) {
+ return nullptr;
+ }
std::vector<std::string> lines = config.GetLines();
jobjectArray ret = CreateObjectArray(env,
@@ -528,10 +541,10 @@ extern "C" JNIEXPORT jobjectArray JNICALL Java_art_Test913_followReferencesStrin
void* user_data) {
FindStringCallbacks* p = reinterpret_cast<FindStringCallbacks*>(user_data);
if (*tag_ptr != 0) {
- size_t utf_byte_count = CountUtf8Bytes(value, value_length);
+ size_t utf_byte_count = ti::CountUtf8Bytes(value, value_length);
std::unique_ptr<char[]> mod_utf(new char[utf_byte_count + 1]);
memset(mod_utf.get(), 0, utf_byte_count + 1);
- ConvertUtf16ToModifiedUtf8(mod_utf.get(), utf_byte_count, value, value_length);
+ ti::ConvertUtf16ToModifiedUtf8(mod_utf.get(), utf_byte_count, value, value_length);
p->data.push_back(android::base::StringPrintf("%" PRId64 "@%" PRId64 " (%" PRId64 ", '%s')",
*tag_ptr,
class_tag,
diff --git a/test/913-heaps/src/art/Test913.java b/test/913-heaps/src/art/Test913.java
index c54ecb049f..d3b29cf2b5 100644
--- a/test/913-heaps/src/art/Test913.java
+++ b/test/913-heaps/src/art/Test913.java
@@ -21,12 +21,34 @@ import java.util.Arrays;
import java.util.Collections;
import java.util.HashMap;
import java.util.HashSet;
+import java.util.concurrent.CountDownLatch;
public class Test913 {
public static void run() throws Exception {
Main.bindAgentJNIForClass(Test913.class);
doTest();
+
+ // Use a countdown latch for synchronization, as join() will introduce more roots.
+ final CountDownLatch cdl1 = new CountDownLatch(1);
+
+ // Run the follow-references tests on a dedicated thread so we know the specific Thread type.
+ Thread t = new Thread() {
+ @Override
+ public void run() {
+ try {
+ Test913.runFollowReferences();
+ } catch (Exception e) {
+ throw new RuntimeException(e);
+ }
+ cdl1.countDown();
+ }
+ };
+ t.start();
+ cdl1.await();
+ }
+
+ public static void runFollowReferences() throws Exception {
new TestConfig().doFollowReferencesTest();
Runtime.getRuntime().gc();
@@ -349,6 +371,14 @@ public class Test913 {
cInst.baz2 = aInst;
v.add(cInstStr, aInstStr); // C -->(field) --> A.
+ A[] aArray = new A[2];
+ setTag(aArray, 500);
+ aArray[1] = a2Inst;
+ cInst.array = aArray;
+ String aArrayStr = "500@0";
+ v.add(cInstStr, aArrayStr);
+ v.add(aArrayStr, a2InstStr);
+
return aInst;
}
}
@@ -386,6 +416,7 @@ public class Test913 {
public static class C extends B implements I2 {
public A baz;
public A baz2;
+ public A[] array;
public C() {}
public C(A a, A b) {
@@ -481,7 +512,8 @@ public class Test913 {
if (currentHead == null) {
currentHead = referrer;
} else {
- if (!currentHead.equals(referrer)) {
+ // Ignore 0@0, as it can happen at any time (as it stands for all other objects).
+ if (!currentHead.equals(referrer) && !referrer.equals("0@0")) {
completedReferrers.add(currentHead);
currentHead = referrer;
if (completedReferrers.contains(referrer)) {
diff --git a/test/914-hello-obsolescence/src/Main.java b/test/914-hello-obsolescence/src/Main.java
index 2ec7664f0f..ab5c7f421f 100644
--- a/test/914-hello-obsolescence/src/Main.java
+++ b/test/914-hello-obsolescence/src/Main.java
@@ -1,5 +1,5 @@
/*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
@@ -14,60 +14,8 @@
* limitations under the License.
*/
-import java.util.Base64;
-
public class Main {
- // class Transform {
- // public void sayHi(Runnable r) {
- // System.out.println("Hello - Transformed");
- // r.run();
- // System.out.println("Goodbye - Transformed");
- // }
- // }
- private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
- "yv66vgAAADQAJAoACAARCQASABMIABQKABUAFgsAFwAYCAAZBwAaBwAbAQAGPGluaXQ+AQADKClW" +
- "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
- "KVYBAApTb3VyY2VGaWxlAQAOVHJhbnNmb3JtLmphdmEMAAkACgcAHAwAHQAeAQATSGVsbG8gLSBU" +
- "cmFuc2Zvcm1lZAcAHwwAIAAhBwAiDAAjAAoBABVHb29kYnllIC0gVHJhbnNmb3JtZWQBAAlUcmFu" +
- "c2Zvcm0BABBqYXZhL2xhbmcvT2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZh" +
- "L2lvL1ByaW50U3RyZWFtOwEAE2phdmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZh" +
- "L2xhbmcvU3RyaW5nOylWAQASamF2YS9sYW5nL1J1bm5hYmxlAQADcnVuACAABwAIAAAAAAACAAAA" +
- "CQAKAAEACwAAAB0AAQABAAAABSq3AAGxAAAAAQAMAAAABgABAAAAAQABAA0ADgABAAsAAAA7AAIA" +
- "AgAAABeyAAISA7YABCu5AAUBALIAAhIGtgAEsQAAAAEADAAAABIABAAAAAMACAAEAA4ABQAWAAYA" +
- "AQAPAAAAAgAQ");
- private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
- "ZGV4CjAzNQAYeAMMXgYWxoeSHAS9EWKCCtVRSAGpqZVQAwAAcAAAAHhWNBIAAAAAAAAAALACAAAR" +
- "AAAAcAAAAAcAAAC0AAAAAwAAANAAAAABAAAA9AAAAAUAAAD8AAAAAQAAACQBAAAMAgAARAEAAKIB" +
- "AACqAQAAwQEAANYBAADjAQAA+gEAAA4CAAAkAgAAOAIAAEwCAABcAgAAXwIAAGMCAAB3AgAAfAIA" +
- "AIUCAACKAgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACgAAAAoAAAAGAAAAAAAAAAsAAAAGAAAA" +
- "lAEAAAsAAAAGAAAAnAEAAAUAAQANAAAAAAAAAAAAAAAAAAEAEAAAAAEAAgAOAAAAAgAAAAAAAAAD" +
- "AAAADwAAAAAAAAAAAAAAAgAAAAAAAAAJAAAAAAAAAJ8CAAAAAAAAAQABAAEAAACRAgAABAAAAHAQ" +
- "AwAAAA4ABAACAAIAAACWAgAAFAAAAGIAAAAbAQIAAABuIAIAEAByEAQAAwBiAAAAGwEBAAAAbiAC" +
- "ABAADgABAAAAAwAAAAEAAAAEAAY8aW5pdD4AFUdvb2RieWUgLSBUcmFuc2Zvcm1lZAATSGVsbG8g" +
- "LSBUcmFuc2Zvcm1lZAALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwASTGphdmEv" +
- "bGFuZy9PYmplY3Q7ABRMamF2YS9sYW5nL1J1bm5hYmxlOwASTGphdmEvbGFuZy9TdHJpbmc7ABJM" +
- "amF2YS9sYW5nL1N5c3RlbTsADlRyYW5zZm9ybS5qYXZhAAFWAAJWTAASZW1pdHRlcjogamFjay00" +
- "LjEzAANvdXQAB3ByaW50bG4AA3J1bgAFc2F5SGkAAQAHDgADAQAHDoc8hwAAAAEBAICABMQCAQHc" +
- "AgAAAA0AAAAAAAAAAQAAAAAAAAABAAAAEQAAAHAAAAACAAAABwAAALQAAAADAAAAAwAAANAAAAAE" +
- "AAAAAQAAAPQAAAAFAAAABQAAAPwAAAAGAAAAAQAAACQBAAABIAAAAgAAAEQBAAABEAAAAgAAAJQB" +
- "AAACIAAAEQAAAKIBAAADIAAAAgAAAJECAAAAIAAAAQAAAJ8CAAAAEAAAAQAAALACAAA=");
-
- public static void main(String[] args) {
- art.Main.bindAgentJNIForClass(Main.class);
- doTest(new Transform());
+ public static void main(String[] args) throws Exception {
+ art.Test914.run();
}
-
- public static void doTest(Transform t) {
- t.sayHi(() -> { System.out.println("Not doing anything here"); });
- t.sayHi(() -> {
- System.out.println("transforming calling function");
- doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
- });
- t.sayHi(() -> { System.out.println("Not doing anything here"); });
- }
-
- // Transforms the class
- private static native void doCommonClassRedefinition(Class<?> target,
- byte[] classfile,
- byte[] dexfile);
}
diff --git a/test/914-hello-obsolescence/src/Transform.java b/test/914-hello-obsolescence/src/Transform.java
deleted file mode 100644
index 8cda6cdf53..0000000000
--- a/test/914-hello-obsolescence/src/Transform.java
+++ /dev/null
@@ -1,30 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
- public void sayHi(Runnable r) {
- // Use lower 'h' to make sure the string will have a different string id
- // than the transformation (the transformation code is the same except
- // the actual printed String, which was making the test inacurately passing
- // in JIT mode when loading the string from the dex cache, as the string ids
- // of the two different strings were the same).
- // We know the string ids will be different because lexicographically:
- // "Hello" < "LTransform;" < "hello".
- System.out.println("hello");
- r.run();
- System.out.println("goodbye");
- }
-}
diff --git a/test/914-hello-obsolescence/src/art/Redefinition.java b/test/914-hello-obsolescence/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/914-hello-obsolescence/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/914-hello-obsolescence/src/art/Test914.java b/test/914-hello-obsolescence/src/art/Test914.java
new file mode 100644
index 0000000000..ef2710da5b
--- /dev/null
+++ b/test/914-hello-obsolescence/src/art/Test914.java
@@ -0,0 +1,86 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.Base64;
+
+public class Test914 {
+
+ // The class we will be transforming.
+ static class Transform {
+ public void sayHi(Runnable r) {
+ System.out.println("hello");
+ r.run();
+ System.out.println("goodbye");
+ }
+ }
+
+ // static class Transform {
+ // public void sayHi(Runnable r) {
+ // System.out.println("Hello - Transformed");
+ // r.run();
+ // System.out.println("Goodbye - Transformed");
+ // }
+ // }
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAKAoACAARCQASABMIABQKABUAFgsAFwAYCAAZBwAbBwAeAQAGPGluaXQ+AQADKClW" +
+ "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
+ "KVYBAApTb3VyY2VGaWxlAQAMVGVzdDkxNC5qYXZhDAAJAAoHAB8MACAAIQEAE0hlbGxvIC0gVHJh" +
+ "bnNmb3JtZWQHACIMACMAJAcAJQwAJgAKAQAVR29vZGJ5ZSAtIFRyYW5zZm9ybWVkBwAnAQAVYXJ0" +
+ "L1Rlc3Q5MTQkVHJhbnNmb3JtAQAJVHJhbnNmb3JtAQAMSW5uZXJDbGFzc2VzAQAQamF2YS9sYW5n" +
+ "L09iamVjdAEAEGphdmEvbGFuZy9TeXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsB" +
+ "ABNqYXZhL2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgEA" +
+ "EmphdmEvbGFuZy9SdW5uYWJsZQEAA3J1bgEAC2FydC9UZXN0OTE0ACAABwAIAAAAAAACAAAACQAK" +
+ "AAEACwAAAB0AAQABAAAABSq3AAGxAAAAAQAMAAAABgABAAAABQABAA0ADgABAAsAAAA7AAIAAgAA" +
+ "ABeyAAISA7YABCu5AAUBALIAAhIGtgAEsQAAAAEADAAAABIABAAAAAcACAAIAA4ACQAWAAoAAgAP" +
+ "AAAAAgAQAB0AAAAKAAEABwAaABwACA==");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQBlmxNYAAAAAAAAAAAAAAAAAAAAAAAAAAA8BAAAcAAAAHhWNBIAAAAAAAAAAHgDAAAX" +
+ "AAAAcAAAAAoAAADMAAAAAwAAAPQAAAABAAAAGAEAAAUAAAAgAQAAAQAAAEgBAADUAgAAaAEAAGgB" +
+ "AABwAQAAhwEAAJwBAAC1AQAAxAEAAOgBAAAIAgAAHwIAADMCAABJAgAAXQIAAHECAAB/AgAAigIA" +
+ "AI0CAACRAgAAngIAAKQCAACpAgAAsgIAALcCAAC+AgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAA" +
+ "CQAAAAoAAAALAAAADgAAAA4AAAAJAAAAAAAAAA8AAAAJAAAAyAIAAA8AAAAJAAAA0AIAAAgABAAS" +
+ "AAAAAAAAAAAAAAAAAAEAFQAAAAQAAgATAAAABQAAAAAAAAAGAAAAFAAAAAAAAAAAAAAABQAAAAAA" +
+ "AAAMAAAAaAMAADwDAAAAAAAABjxpbml0PgAVR29vZGJ5ZSAtIFRyYW5zZm9ybWVkABNIZWxsbyAt" +
+ "IFRyYW5zZm9ybWVkABdMYXJ0L1Rlc3Q5MTQkVHJhbnNmb3JtOwANTGFydC9UZXN0OTE0OwAiTGRh" +
+ "bHZpay9hbm5vdGF0aW9uL0VuY2xvc2luZ0NsYXNzOwAeTGRhbHZpay9hbm5vdGF0aW9uL0lubmVy" +
+ "Q2xhc3M7ABVMamF2YS9pby9QcmludFN0cmVhbTsAEkxqYXZhL2xhbmcvT2JqZWN0OwAUTGphdmEv" +
+ "bGFuZy9SdW5uYWJsZTsAEkxqYXZhL2xhbmcvU3RyaW5nOwASTGphdmEvbGFuZy9TeXN0ZW07AAxU" +
+ "ZXN0OTE0LmphdmEACVRyYW5zZm9ybQABVgACVkwAC2FjY2Vzc0ZsYWdzAARuYW1lAANvdXQAB3By" +
+ "aW50bG4AA3J1bgAFc2F5SGkABXZhbHVlAAAAAAEAAAAGAAAAAQAAAAcAAAAFAAcOAAcBAAcOAQgP" +
+ "AQMPAQgPAAEAAQABAAAA2AIAAAQAAABwEAMAAAAOAAQAAgACAAAA3QIAABQAAABiAAAAGwECAAAA" +
+ "biACABAAchAEAAMAYgAAABsBAQAAAG4gAgAQAA4AAAABAQCAgATsBQEBhAYAAAICARYYAQIDAhAE" +
+ "CBEXDQACAAAATAMAAFIDAABcAwAAAAAAAAAAAAAAAAAAEAAAAAAAAAABAAAAAAAAAAEAAAAXAAAA" +
+ "cAAAAAIAAAAKAAAAzAAAAAMAAAADAAAA9AAAAAQAAAABAAAAGAEAAAUAAAAFAAAAIAEAAAYAAAAB" +
+ "AAAASAEAAAIgAAAXAAAAaAEAAAEQAAACAAAAyAIAAAMgAAACAAAA2AIAAAEgAAACAAAA7AIAAAAg" +
+ "AAABAAAAPAMAAAQgAAACAAAATAMAAAMQAAABAAAAXAMAAAYgAAABAAAAaAMAAAAQAAABAAAAeAMA" +
+ "AA==");
+
+ public static void run() {
+ Redefinition.setTestConfiguration(Redefinition.Config.COMMON_REDEFINE);
+ doTest(new Transform());
+ }
+
+ public static void doTest(Transform t) {
+ t.sayHi(() -> { System.out.println("Not doing anything here"); });
+ t.sayHi(() -> {
+ System.out.println("transforming calling function");
+ Redefinition.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+ });
+ t.sayHi(() -> { System.out.println("Not doing anything here"); });
+ }
+}
diff --git a/test/915-obsolete-2/src/Main.java b/test/915-obsolete-2/src/Main.java
index fc73ee86fc..be51234c87 100644
--- a/test/915-obsolete-2/src/Main.java
+++ b/test/915-obsolete-2/src/Main.java
@@ -1,5 +1,5 @@
/*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
@@ -14,86 +14,8 @@
* limitations under the License.
*/
-import java.util.Base64;
-
public class Main {
- // class Transform {
- // private void Start() {
- // System.out.println("Hello - private - Transformed");
- // }
- //
- // private void Finish() {
- // System.out.println("Goodbye - private - Transformed");
- // }
- //
- // public void sayHi(Runnable r) {
- // System.out.println("Pre Start private method call - Transformed");
- // Start();
- // System.out.println("Post Start private method call - Transformed");
- // r.run();
- // System.out.println("Pre Finish private method call - Transformed");
- // Finish();
- // System.out.println("Post Finish private method call - Transformed");
- // }
- // }
- private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
- "yv66vgAAADQAMgoADgAZCQAaABsIABwKAB0AHggAHwgAIAoADQAhCAAiCwAjACQIACUKAA0AJggA" +
- "JwcAKAcAKQEABjxpbml0PgEAAygpVgEABENvZGUBAA9MaW5lTnVtYmVyVGFibGUBAAVTdGFydAEA" +
- "BkZpbmlzaAEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7KVYBAApTb3VyY2VGaWxlAQAO" +
- "VHJhbnNmb3JtLmphdmEMAA8AEAcAKgwAKwAsAQAdSGVsbG8gLSBwcml2YXRlIC0gVHJhbnNmb3Jt" +
- "ZWQHAC0MAC4ALwEAH0dvb2RieWUgLSBwcml2YXRlIC0gVHJhbnNmb3JtZWQBACtQcmUgU3RhcnQg" +
- "cHJpdmF0ZSBtZXRob2QgY2FsbCAtIFRyYW5zZm9ybWVkDAATABABACxQb3N0IFN0YXJ0IHByaXZh" +
- "dGUgbWV0aG9kIGNhbGwgLSBUcmFuc2Zvcm1lZAcAMAwAMQAQAQAsUHJlIEZpbmlzaCBwcml2YXRl" +
- "IG1ldGhvZCBjYWxsIC0gVHJhbnNmb3JtZWQMABQAEAEALVBvc3QgRmluaXNoIHByaXZhdGUgbWV0" +
- "aG9kIGNhbGwgLSBUcmFuc2Zvcm1lZAEACVRyYW5zZm9ybQEAEGphdmEvbGFuZy9PYmplY3QBABBq" +
- "YXZhL2xhbmcvU3lzdGVtAQADb3V0AQAVTGphdmEvaW8vUHJpbnRTdHJlYW07AQATamF2YS9pby9Q" +
- "cmludFN0cmVhbQEAB3ByaW50bG4BABUoTGphdmEvbGFuZy9TdHJpbmc7KVYBABJqYXZhL2xhbmcv" +
- "UnVubmFibGUBAANydW4AIAANAA4AAAAAAAQAAAAPABAAAQARAAAAHQABAAEAAAAFKrcAAbEAAAAB" +
- "ABIAAAAGAAEAAAABAAIAEwAQAAEAEQAAACUAAgABAAAACbIAAhIDtgAEsQAAAAEAEgAAAAoAAgAA" +
- "AAMACAAEAAIAFAAQAAEAEQAAACUAAgABAAAACbIAAhIFtgAEsQAAAAEAEgAAAAoAAgAAAAcACAAI" +
- "AAEAFQAWAAEAEQAAAGMAAgACAAAAL7IAAhIGtgAEKrcAB7IAAhIItgAEK7kACQEAsgACEgq2AAQq" +
- "twALsgACEgy2AASxAAAAAQASAAAAIgAIAAAACwAIAAwADAANABQADgAaAA8AIgAQACYAEQAuABIA" +
- "AQAXAAAAAgAY");
- private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
- "ZGV4CjAzNQCM0QYTJmX+NsZXkImojgSkJtXyuew3oaXcBAAAcAAAAHhWNBIAAAAAAAAAADwEAAAX" +
- "AAAAcAAAAAcAAADMAAAAAwAAAOgAAAABAAAADAEAAAcAAAAUAQAAAQAAAEwBAABwAwAAbAEAAD4C" +
- "AABGAgAATgIAAG8CAACOAgAAmwIAALICAADGAgAA3AIAAPACAAAEAwAAMwMAAGEDAACPAwAAvAMA" +
- "AMMDAADTAwAA1gMAANoDAADuAwAA8wMAAPwDAAABBAAABAAAAAUAAAAGAAAABwAAAAgAAAAJAAAA" +
- "EAAAABAAAAAGAAAAAAAAABEAAAAGAAAAMAIAABEAAAAGAAAAOAIAAAUAAQATAAAAAAAAAAAAAAAA" +
- "AAAAAQAAAAAAAAAOAAAAAAABABYAAAABAAIAFAAAAAIAAAAAAAAAAwAAABUAAAAAAAAAAAAAAAIA" +
- "AAAAAAAADwAAAAAAAAAmBAAAAAAAAAEAAQABAAAACAQAAAQAAABwEAUAAAAOAAMAAQACAAAADQQA" +
- "AAkAAABiAAAAGwECAAAAbiAEABAADgAAAAMAAQACAAAAEwQAAAkAAABiAAAAGwEDAAAAbiAEABAA" +
- "DgAAAAQAAgACAAAAGQQAACoAAABiAAAAGwENAAAAbiAEABAAcBACAAIAYgAAABsBCwAAAG4gBAAQ" +
- "AHIQBgADAGIAAAAbAQwAAABuIAQAEABwEAEAAgBiAAAAGwEKAAAAbiAEABAADgABAAAAAwAAAAEA" +
- "AAAEAAY8aW5pdD4ABkZpbmlzaAAfR29vZGJ5ZSAtIHByaXZhdGUgLSBUcmFuc2Zvcm1lZAAdSGVs" +
- "bG8gLSBwcml2YXRlIC0gVHJhbnNmb3JtZWQAC0xUcmFuc2Zvcm07ABVMamF2YS9pby9QcmludFN0" +
- "cmVhbTsAEkxqYXZhL2xhbmcvT2JqZWN0OwAUTGphdmEvbGFuZy9SdW5uYWJsZTsAEkxqYXZhL2xh" +
- "bmcvU3RyaW5nOwASTGphdmEvbGFuZy9TeXN0ZW07AC1Qb3N0IEZpbmlzaCBwcml2YXRlIG1ldGhv" +
- "ZCBjYWxsIC0gVHJhbnNmb3JtZWQALFBvc3QgU3RhcnQgcHJpdmF0ZSBtZXRob2QgY2FsbCAtIFRy" +
- "YW5zZm9ybWVkACxQcmUgRmluaXNoIHByaXZhdGUgbWV0aG9kIGNhbGwgLSBUcmFuc2Zvcm1lZAAr" +
- "UHJlIFN0YXJ0IHByaXZhdGUgbWV0aG9kIGNhbGwgLSBUcmFuc2Zvcm1lZAAFU3RhcnQADlRyYW5z" +
- "Zm9ybS5qYXZhAAFWAAJWTAASZW1pdHRlcjogamFjay00LjEzAANvdXQAB3ByaW50bG4AA3J1bgAF" +
- "c2F5SGkAAQAHDgAHAAcOhwADAAcOhwALAQAHDoc8hzyHPIcAAAADAQCAgATsAgEChAMBAqgDAwHM" +
- "Aw0AAAAAAAAAAQAAAAAAAAABAAAAFwAAAHAAAAACAAAABwAAAMwAAAADAAAAAwAAAOgAAAAEAAAA" +
- "AQAAAAwBAAAFAAAABwAAABQBAAAGAAAAAQAAAEwBAAABIAAABAAAAGwBAAABEAAAAgAAADACAAAC" +
- "IAAAFwAAAD4CAAADIAAABAAAAAgEAAAAIAAAAQAAACYEAAAAEAAAAQAAADwEAAA=");
-
- public static void main(String[] args) {
- art.Main.bindAgentJNIForClass(Main.class);
- doTest(new Transform());
+ public static void main(String[] args) throws Exception {
+ art.Test915.run();
}
-
- public static void doTest(Transform t) {
- t.sayHi(() -> { System.out.println("Not doing anything here"); });
- t.sayHi(() -> {
- System.out.println("transforming calling function");
- doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
- });
- t.sayHi(() -> { System.out.println("Not doing anything here"); });
- }
-
- // Transforms the class
- private static native void doCommonClassRedefinition(Class<?> target,
- byte[] classfile,
- byte[] dexfile);
}
diff --git a/test/915-obsolete-2/src/art/Redefinition.java b/test/915-obsolete-2/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/915-obsolete-2/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/915-obsolete-2/src/art/Test915.java b/test/915-obsolete-2/src/art/Test915.java
new file mode 100644
index 0000000000..63c7f344dd
--- /dev/null
+++ b/test/915-obsolete-2/src/art/Test915.java
@@ -0,0 +1,123 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.Base64;
+
+public class Test915 {
+
+ static class Transform {
+ private void Start() {
+ System.out.println("hello - private");
+ }
+
+ private void Finish() {
+ System.out.println("goodbye - private");
+ }
+
+ public void sayHi(Runnable r) {
+ System.out.println("Pre Start private method call");
+ Start();
+ System.out.println("Post Start private method call");
+ r.run();
+ System.out.println("Pre Finish private method call");
+ Finish();
+ System.out.println("Post Finish private method call");
+ }
+ }
+
+ // static class Transform {
+ // private void Start() {
+ // System.out.println("Hello - private - Transformed");
+ // }
+ //
+ // private void Finish() {
+ // System.out.println("Goodbye - private - Transformed");
+ // }
+ //
+ // public void sayHi(Runnable r) {
+ // System.out.println("Pre Start private method call - Transformed");
+ // Start();
+ // System.out.println("Post Start private method call - Transformed");
+ // r.run();
+ // System.out.println("Pre Finish private method call - Transformed");
+ // Finish();
+ // System.out.println("Post Finish private method call - Transformed");
+ // }
+ // }
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQANgoADgAZCQAaABsIABwKAB0AHggAHwgAIAoADQAhCAAiCwAjACQIACUKAA0AJggA" +
+ "JwcAKQcALAEABjxpbml0PgEAAygpVgEABENvZGUBAA9MaW5lTnVtYmVyVGFibGUBAAVTdGFydAEA" +
+ "BkZpbmlzaAEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7KVYBAApTb3VyY2VGaWxlAQAM" +
+ "VGVzdDkxNS5qYXZhDAAPABAHAC0MAC4ALwEAHUhlbGxvIC0gcHJpdmF0ZSAtIFRyYW5zZm9ybWVk" +
+ "BwAwDAAxADIBAB9Hb29kYnllIC0gcHJpdmF0ZSAtIFRyYW5zZm9ybWVkAQArUHJlIFN0YXJ0IHBy" +
+ "aXZhdGUgbWV0aG9kIGNhbGwgLSBUcmFuc2Zvcm1lZAwAEwAQAQAsUG9zdCBTdGFydCBwcml2YXRl" +
+ "IG1ldGhvZCBjYWxsIC0gVHJhbnNmb3JtZWQHADMMADQAEAEALFByZSBGaW5pc2ggcHJpdmF0ZSBt" +
+ "ZXRob2QgY2FsbCAtIFRyYW5zZm9ybWVkDAAUABABAC1Qb3N0IEZpbmlzaCBwcml2YXRlIG1ldGhv" +
+ "ZCBjYWxsIC0gVHJhbnNmb3JtZWQHADUBABVhcnQvVGVzdDkxNSRUcmFuc2Zvcm0BAAlUcmFuc2Zv" +
+ "cm0BAAxJbm5lckNsYXNzZXMBABBqYXZhL2xhbmcvT2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEA" +
+ "A291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2phdmEvaW8vUHJpbnRTdHJlYW0BAAdwcmlu" +
+ "dGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWAQASamF2YS9sYW5nL1J1bm5hYmxlAQADcnVuAQAL" +
+ "YXJ0L1Rlc3Q5MTUAIAANAA4AAAAAAAQAAAAPABAAAQARAAAAHQABAAEAAAAFKrcAAbEAAAABABIA" +
+ "AAAGAAEAAAAFAAIAEwAQAAEAEQAAACUAAgABAAAACbIAAhIDtgAEsQAAAAEAEgAAAAoAAgAAAAcA" +
+ "CAAIAAIAFAAQAAEAEQAAACUAAgABAAAACbIAAhIFtgAEsQAAAAEAEgAAAAoAAgAAAAoACAALAAEA" +
+ "FQAWAAEAEQAAAGMAAgACAAAAL7IAAhIGtgAEKrcAB7IAAhIItgAEK7kACQEAsgACEgq2AAQqtwAL" +
+ "sgACEgy2AASxAAAAAQASAAAAIgAIAAAADQAIAA4ADAAPABQAEAAaABEAIgASACYAEwAuABQAAgAX" +
+ "AAAAAgAYACsAAAAKAAEADQAoACoACA==");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQAQ+GYcAAAAAAAAAAAAAAAAAAAAAAAAAADUBQAAcAAAAHhWNBIAAAAAAAAAABAFAAAd" +
+ "AAAAcAAAAAoAAADkAAAAAwAAAAwBAAABAAAAMAEAAAcAAAA4AQAAAQAAAHABAABEBAAAkAEAAJAB" +
+ "AACYAQAAoAEAAMEBAADgAQAA+QEAAAgCAAAsAgAATAIAAGMCAAB3AgAAjQIAAKECAAC1AgAA5AIA" +
+ "ABIDAABAAwAAbQMAAHQDAACCAwAAjQMAAJADAACUAwAAoQMAAKcDAACsAwAAtQMAALoDAADBAwAA" +
+ "BAAAAAUAAAAGAAAABwAAAAgAAAAJAAAACgAAAAsAAAAMAAAAFAAAABQAAAAJAAAAAAAAABUAAAAJ" +
+ "AAAA0AMAABUAAAAJAAAAyAMAAAgABAAYAAAAAAAAAAAAAAAAAAAAAQAAAAAAAAARAAAAAAABABsA" +
+ "AAAEAAIAGQAAAAUAAAAAAAAABgAAABoAAAAAAAAAAAAAAAUAAAAAAAAAEgAAAAAFAADMBAAAAAAA" +
+ "AAY8aW5pdD4ABkZpbmlzaAAfR29vZGJ5ZSAtIHByaXZhdGUgLSBUcmFuc2Zvcm1lZAAdSGVsbG8g" +
+ "LSBwcml2YXRlIC0gVHJhbnNmb3JtZWQAF0xhcnQvVGVzdDkxNSRUcmFuc2Zvcm07AA1MYXJ0L1Rl" +
+ "c3Q5MTU7ACJMZGFsdmlrL2Fubm90YXRpb24vRW5jbG9zaW5nQ2xhc3M7AB5MZGFsdmlrL2Fubm90" +
+ "YXRpb24vSW5uZXJDbGFzczsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwASTGphdmEvbGFuZy9PYmpl" +
+ "Y3Q7ABRMamF2YS9sYW5nL1J1bm5hYmxlOwASTGphdmEvbGFuZy9TdHJpbmc7ABJMamF2YS9sYW5n" +
+ "L1N5c3RlbTsALVBvc3QgRmluaXNoIHByaXZhdGUgbWV0aG9kIGNhbGwgLSBUcmFuc2Zvcm1lZAAs" +
+ "UG9zdCBTdGFydCBwcml2YXRlIG1ldGhvZCBjYWxsIC0gVHJhbnNmb3JtZWQALFByZSBGaW5pc2gg" +
+ "cHJpdmF0ZSBtZXRob2QgY2FsbCAtIFRyYW5zZm9ybWVkACtQcmUgU3RhcnQgcHJpdmF0ZSBtZXRo" +
+ "b2QgY2FsbCAtIFRyYW5zZm9ybWVkAAVTdGFydAAMVGVzdDkxNS5qYXZhAAlUcmFuc2Zvcm0AAVYA" +
+ "AlZMAAthY2Nlc3NGbGFncwAEbmFtZQADb3V0AAdwcmludGxuAANydW4ABXNheUhpAAV2YWx1ZQAB" +
+ "AAAABwAAAAEAAAAGAAAABQAHDgAKAAcOAQgPAAcABw4BCA8ADQEABw4BCA8BAw8BCA8BAw8BCA8B" +
+ "Aw8BCA8AAQABAAEAAADYAwAABAAAAHAQBQAAAA4AAwABAAIAAADdAwAACQAAAGIAAAAbAQIAAABu" +
+ "IAQAEAAOAAAAAwABAAIAAADlAwAACQAAAGIAAAAbAQMAAABuIAQAEAAOAAAABAACAAIAAADtAwAA" +
+ "KgAAAGIAAAAbARAAAABuIAQAEABwEAIAAgBiAAAAGwEOAAAAbiAEABAAchAGAAMAYgAAABsBDwAA" +
+ "AG4gBAAQAHAQAQACAGIAAAAbAQ0AAABuIAQAEAAOAAAAAwEAgIAEiAgBAqAIAQLECAMB6AgAAAIC" +
+ "ARwYAQIDAhYECBcXEwACAAAA5AQAAOoEAAD0BAAAAAAAAAAAAAAAAAAAEAAAAAAAAAABAAAAAAAA" +
+ "AAEAAAAdAAAAcAAAAAIAAAAKAAAA5AAAAAMAAAADAAAADAEAAAQAAAABAAAAMAEAAAUAAAAHAAAA" +
+ "OAEAAAYAAAABAAAAcAEAAAIgAAAdAAAAkAEAAAEQAAACAAAAyAMAAAMgAAAEAAAA2AMAAAEgAAAE" +
+ "AAAACAQAAAAgAAABAAAAzAQAAAQgAAACAAAA5AQAAAMQAAABAAAA9AQAAAYgAAABAAAAAAUAAAAQ" +
+ "AAABAAAAEAUAAA==");
+
+ public static void run() {
+ Redefinition.setTestConfiguration(Redefinition.Config.COMMON_REDEFINE);
+ doTest(new Transform());
+ }
+
+ public static void doTest(Transform t) {
+ t.sayHi(() -> { System.out.println("Not doing anything here"); });
+ t.sayHi(() -> {
+ System.out.println("transforming calling function");
+ Redefinition.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+ });
+ t.sayHi(() -> { System.out.println("Not doing anything here"); });
+ }
+}
diff --git a/test/916-obsolete-jit/src/Main.java b/test/916-obsolete-jit/src/Main.java
index 3453261f44..cb202e400d 100644
--- a/test/916-obsolete-jit/src/Main.java
+++ b/test/916-obsolete-jit/src/Main.java
@@ -14,6 +14,9 @@
* limitations under the License.
*/
+
+import art.Redefinition;
+
import java.util.function.Consumer;
import java.lang.reflect.Method;
import java.util.Base64;
@@ -144,7 +147,7 @@ public class Main {
// Actually do the redefinition. The stack looks good.
retry = false;
w.accept("transforming calling function");
- doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+ Redefinition.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
}
};
// This just prints something out to show we are running the Runnable.
@@ -168,9 +171,4 @@ public class Main {
private static native boolean isInterpretedFunction(Method m, boolean require_deoptimizable);
private static native void ensureJitCompiled(Class c, String name);
-
- // Transforms the class
- private static native void doCommonClassRedefinition(Class<?> target,
- byte[] classfile,
- byte[] dexfile);
}
diff --git a/test/916-obsolete-jit/src/art/Redefinition.java b/test/916-obsolete-jit/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/916-obsolete-jit/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/917-fields-transformation/src/Main.java b/test/917-fields-transformation/src/Main.java
index 588af49cca..289b89f2f6 100644
--- a/test/917-fields-transformation/src/Main.java
+++ b/test/917-fields-transformation/src/Main.java
@@ -1,5 +1,5 @@
/*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
@@ -14,67 +14,8 @@
* limitations under the License.
*/
-import java.util.Base64;
public class Main {
-
- // base64 encoded class/dex file for
- // class Transform {
- // public String take1;
- // public String take2;
- //
- // public Transform(String a, String b) {
- // take1 = a;
- // take2 = b;
- // }
- //
- // public String getResult() {
- // return take2;
- // }
- // }
- private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
- "yv66vgAAADQAFwoABQARCQAEABIJAAQAEwcAFAcAFQEABXRha2UxAQASTGphdmEvbGFuZy9TdHJp" +
- "bmc7AQAFdGFrZTIBAAY8aW5pdD4BACcoTGphdmEvbGFuZy9TdHJpbmc7TGphdmEvbGFuZy9TdHJp" +
- "bmc7KVYBAARDb2RlAQAPTGluZU51bWJlclRhYmxlAQAJZ2V0UmVzdWx0AQAUKClMamF2YS9sYW5n" +
- "L1N0cmluZzsBAApTb3VyY2VGaWxlAQAOVHJhbnNmb3JtLmphdmEMAAkAFgwABgAHDAAIAAcBAAlU" +
- "cmFuc2Zvcm0BABBqYXZhL2xhbmcvT2JqZWN0AQADKClWACAABAAFAAAAAgABAAYABwAAAAEACAAH" +
- "AAAAAgABAAkACgABAAsAAAAzAAIAAwAAAA8qtwABKiu1AAIqLLUAA7EAAAABAAwAAAASAAQAAAAU" +
- "AAQAFQAJABYADgAXAAEADQAOAAEACwAAAB0AAQABAAAABSq0AAOwAAAAAQAMAAAABgABAAAAGgAB" +
- "AA8AAAACABA=");
- private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
- "ZGV4CjAzNQAGUTBb4jIABRlaI9rejdk7RCfyqR2kmNSkAgAAcAAAAHhWNBIAAAAAAAAAAAQCAAAM" +
- "AAAAcAAAAAQAAACgAAAAAwAAALAAAAACAAAA1AAAAAMAAADkAAAAAQAAAPwAAACIAQAAHAEAAFwB" +
- "AABkAQAAZwEAAHQBAACIAQAAnAEAAKwBAACvAQAAtAEAAMgBAADTAQAA2gEAAAIAAAADAAAABAAA" +
- "AAYAAAABAAAAAgAAAAAAAAAGAAAAAwAAAAAAAAAHAAAAAwAAAFQBAAAAAAIACgAAAAAAAgALAAAA" +
- "AAACAAAAAAAAAAAACQAAAAEAAQAAAAAAAAAAAAAAAAABAAAAAAAAAAUAAAAAAAAA8AEAAAAAAAAD" +
- "AAMAAQAAAOEBAAAIAAAAcBACAAAAWwEAAFsCAQAOAAIAAQAAAAAA6wEAAAMAAABUEAEAEQAAAAIA" +
- "AAACAAIABjxpbml0PgABTAALTFRyYW5zZm9ybTsAEkxqYXZhL2xhbmcvT2JqZWN0OwASTGphdmEv" +
- "bGFuZy9TdHJpbmc7AA5UcmFuc2Zvcm0uamF2YQABVgADVkxMABJlbWl0dGVyOiBqYWNrLTQuMTkA" +
- "CWdldFJlc3VsdAAFdGFrZTEABXRha2UyABQCAAAHDjwtLQAaAAcOAAACAQEAAQEBAIGABJwCAQG8" +
- "AgAADQAAAAAAAAABAAAAAAAAAAEAAAAMAAAAcAAAAAIAAAAEAAAAoAAAAAMAAAADAAAAsAAAAAQA" +
- "AAACAAAA1AAAAAUAAAADAAAA5AAAAAYAAAABAAAA/AAAAAEgAAACAAAAHAEAAAEQAAABAAAAVAEA" +
- "AAIgAAAMAAAAXAEAAAMgAAACAAAA4QEAAAAgAAABAAAA8AEAAAAQAAABAAAABAIAAA==");
-
- public static void main(String[] args) {
- art.Main.bindAgentJNIForClass(Main.class);
- doTest(new Transform("Hello", "Goodbye"),
- new Transform("start", "end"));
- }
-
- private static void printTransform(Transform t) {
- System.out.println("Result is " + t.getResult());
- System.out.println("take1 is " + t.take1);
- System.out.println("take2 is " + t.take2);
- }
- public static void doTest(Transform t1, Transform t2) {
- printTransform(t1);
- printTransform(t2);
- doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
- printTransform(t1);
- printTransform(t2);
+ public static void main(String[] args) throws Exception {
+ art.Test917.run();
}
-
- // Transforms the class
- private static native void doCommonClassRedefinition(Class<?> target,
- byte[] class_file,
- byte[] dex_file);
}
diff --git a/test/917-fields-transformation/src/Transform.java b/test/917-fields-transformation/src/Transform.java
deleted file mode 100644
index 6fe6223776..0000000000
--- a/test/917-fields-transformation/src/Transform.java
+++ /dev/null
@@ -1,29 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
- public String take1;
- public String take2;
-
- public Transform(String take1, String take2) {
- this.take1 = take1;
- this.take2 = take2;
- }
-
- public String getResult() {
- return take1;
- }
-}
diff --git a/test/917-fields-transformation/src/art/Redefinition.java b/test/917-fields-transformation/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/917-fields-transformation/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/917-fields-transformation/src/art/Test917.java b/test/917-fields-transformation/src/art/Test917.java
new file mode 100644
index 0000000000..245e92e200
--- /dev/null
+++ b/test/917-fields-transformation/src/art/Test917.java
@@ -0,0 +1,97 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.Base64;
+public class Test917 {
+
+ static class Transform {
+ public String take1;
+ public String take2;
+
+ public Transform(String take1, String take2) {
+ this.take1 = take1;
+ this.take2 = take2;
+ }
+
+ public String getResult() {
+ return take1;
+ }
+ }
+
+
+ // base64 encoded class/dex file for
+ // static class Transform {
+ // public String take1;
+ // public String take2;
+ //
+ // public Transform(String a, String b) {
+ // take1 = a;
+ // take2 = b;
+ // }
+ //
+ // public String getResult() {
+ // return take2;
+ // }
+ // }
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAGwoABQARCQAEABIJAAQAEwcAFQcAGAEABXRha2UxAQASTGphdmEvbGFuZy9TdHJp" +
+ "bmc7AQAFdGFrZTIBAAY8aW5pdD4BACcoTGphdmEvbGFuZy9TdHJpbmc7TGphdmEvbGFuZy9TdHJp" +
+ "bmc7KVYBAARDb2RlAQAPTGluZU51bWJlclRhYmxlAQAJZ2V0UmVzdWx0AQAUKClMamF2YS9sYW5n" +
+ "L1N0cmluZzsBAApTb3VyY2VGaWxlAQAMVGVzdDkxNy5qYXZhDAAJABkMAAYABwwACAAHBwAaAQAV" +
+ "YXJ0L1Rlc3Q5MTckVHJhbnNmb3JtAQAJVHJhbnNmb3JtAQAMSW5uZXJDbGFzc2VzAQAQamF2YS9s" +
+ "YW5nL09iamVjdAEAAygpVgEAC2FydC9UZXN0OTE3ACAABAAFAAAAAgABAAYABwAAAAEACAAHAAAA" +
+ "AgABAAkACgABAAsAAAAzAAIAAwAAAA8qtwABKiu1AAIqLLUAA7EAAAABAAwAAAASAAQAAAAJAAQA" +
+ "CgAJAAsADgAMAAEADQAOAAEACwAAAB0AAQABAAAABSq0AAOwAAAAAQAMAAAABgABAAAADwACAA8A" +
+ "AAACABAAFwAAAAoAAQAEABQAFgAI");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQBdcPySAAAAAAAAAAAAAAAAAAAAAAAAAACQAwAAcAAAAHhWNBIAAAAAAAAAAMwCAAAS" +
+ "AAAAcAAAAAcAAAC4AAAAAwAAANQAAAACAAAA+AAAAAMAAAAIAQAAAQAAACABAABQAgAAQAEAAEAB" +
+ "AABIAQAASwEAAGQBAABzAQAAlwEAALcBAADLAQAA3wEAAO0BAAD4AQAA+wEAAAACAAANAgAAGAIA" +
+ "AB4CAAAlAgAALAIAAAIAAAADAAAABAAAAAUAAAAGAAAABwAAAAoAAAABAAAABQAAAAAAAAAKAAAA" +
+ "BgAAAAAAAAALAAAABgAAADQCAAAAAAUADwAAAAAABQAQAAAAAAACAAAAAAAAAAAADQAAAAQAAQAA" +
+ "AAAAAAAAAAAAAAAEAAAAAAAAAAgAAAC8AgAAjAIAAAAAAAAGPGluaXQ+AAFMABdMYXJ0L1Rlc3Q5" +
+ "MTckVHJhbnNmb3JtOwANTGFydC9UZXN0OTE3OwAiTGRhbHZpay9hbm5vdGF0aW9uL0VuY2xvc2lu" +
+ "Z0NsYXNzOwAeTGRhbHZpay9hbm5vdGF0aW9uL0lubmVyQ2xhc3M7ABJMamF2YS9sYW5nL09iamVj" +
+ "dDsAEkxqYXZhL2xhbmcvU3RyaW5nOwAMVGVzdDkxNy5qYXZhAAlUcmFuc2Zvcm0AAVYAA1ZMTAAL" +
+ "YWNjZXNzRmxhZ3MACWdldFJlc3VsdAAEbmFtZQAFdGFrZTEABXRha2UyAAV2YWx1ZQAAAgAAAAUA" +
+ "BQAJAgAABw4BAw8BAg8BAg8ADwAHDgAAAAADAAMAAQAAADwCAAAIAAAAcBACAAAAWwEAAFsCAQAO" +
+ "AAIAAQAAAAAATAIAAAMAAABUEAEAEQAAAAACAQEAAQEBAIGABNQEAQH0BAAAAgIBERgBAgMCDAQI" +
+ "DhcJAAIAAACgAgAApgIAALACAAAAAAAAAAAAAAAAAAAQAAAAAAAAAAEAAAAAAAAAAQAAABIAAABw" +
+ "AAAAAgAAAAcAAAC4AAAAAwAAAAMAAADUAAAABAAAAAIAAAD4AAAABQAAAAMAAAAIAQAABgAAAAEA" +
+ "AAAgAQAAAiAAABIAAABAAQAAARAAAAEAAAA0AgAAAyAAAAIAAAA8AgAAASAAAAIAAABUAgAAACAA" +
+ "AAEAAACMAgAABCAAAAIAAACgAgAAAxAAAAEAAACwAgAABiAAAAEAAAC8AgAAABAAAAEAAADMAgAA");
+
+ public static void run() {
+ Redefinition.setTestConfiguration(Redefinition.Config.COMMON_REDEFINE);
+ doTest(new Transform("Hello", "Goodbye"),
+ new Transform("start", "end"));
+ }
+
+ private static void printTransform(Transform t) {
+ System.out.println("Result is " + t.getResult());
+ System.out.println("take1 is " + t.take1);
+ System.out.println("take2 is " + t.take2);
+ }
+ public static void doTest(Transform t1, Transform t2) {
+ printTransform(t1);
+ printTransform(t2);
+ Redefinition.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+ printTransform(t1);
+ printTransform(t2);
+ }
+}
diff --git a/test/919-obsolete-fields/src/Main.java b/test/919-obsolete-fields/src/Main.java
index 34ee2a97f5..10eadb271e 100644
--- a/test/919-obsolete-fields/src/Main.java
+++ b/test/919-obsolete-fields/src/Main.java
@@ -1,5 +1,5 @@
/*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
@@ -14,135 +14,8 @@
* limitations under the License.
*/
-import java.util.function.Consumer;
-import java.util.Base64;
-
public class Main {
-
- // What follows is the base64 encoded representation of the following class:
- //
- // import java.util.function.Consumer;
- //
- // class Transform {
- // private Consumer<String> reporter;
- // public Transform(Consumer<String> reporter) {
- // this.reporter = reporter;
- // }
- //
- // private void Start() {
- // reporter.accept("Hello - private - Transformed");
- // }
- //
- // private void Finish() {
- // reporter.accept("Goodbye - private - Transformed");
- // }
- //
- // public void sayHi(Runnable r) {
- // reporter.accept("pre Start private method call - Transformed");
- // Start();
- // reporter.accept("post Start private method call - Transformed");
- // r.run();
- // reporter.accept("pre Finish private method call - Transformed");
- // Finish();
- // reporter.accept("post Finish private method call - Transformed");
- // }
- // }
- private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
- "yv66vgAAADQANAoADgAfCQANACAIACELACIAIwgAJAgAJQoADQAmCAAnCwAoACkIACoKAA0AKwgA" +
- "LAcALQcALgEACHJlcG9ydGVyAQAdTGphdmEvdXRpbC9mdW5jdGlvbi9Db25zdW1lcjsBAAlTaWdu" +
- "YXR1cmUBADFMamF2YS91dGlsL2Z1bmN0aW9uL0NvbnN1bWVyPExqYXZhL2xhbmcvU3RyaW5nOz47" +
- "AQAGPGluaXQ+AQAgKExqYXZhL3V0aWwvZnVuY3Rpb24vQ29uc3VtZXI7KVYBAARDb2RlAQAPTGlu" +
- "ZU51bWJlclRhYmxlAQA0KExqYXZhL3V0aWwvZnVuY3Rpb24vQ29uc3VtZXI8TGphdmEvbGFuZy9T" +
- "dHJpbmc7PjspVgEABVN0YXJ0AQADKClWAQAGRmluaXNoAQAFc2F5SGkBABcoTGphdmEvbGFuZy9S" +
- "dW5uYWJsZTspVgEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwAEwAZDAAPABABAB1IZWxs" +
- "byAtIHByaXZhdGUgLSBUcmFuc2Zvcm1lZAcALwwAMAAxAQAfR29vZGJ5ZSAtIHByaXZhdGUgLSBU" +
- "cmFuc2Zvcm1lZAEAK3ByZSBTdGFydCBwcml2YXRlIG1ldGhvZCBjYWxsIC0gVHJhbnNmb3JtZWQM" +
- "ABgAGQEALHBvc3QgU3RhcnQgcHJpdmF0ZSBtZXRob2QgY2FsbCAtIFRyYW5zZm9ybWVkBwAyDAAz" +
- "ABkBACxwcmUgRmluaXNoIHByaXZhdGUgbWV0aG9kIGNhbGwgLSBUcmFuc2Zvcm1lZAwAGgAZAQAt" +
- "cG9zdCBGaW5pc2ggcHJpdmF0ZSBtZXRob2QgY2FsbCAtIFRyYW5zZm9ybWVkAQAJVHJhbnNmb3Jt" +
- "AQAQamF2YS9sYW5nL09iamVjdAEAG2phdmEvdXRpbC9mdW5jdGlvbi9Db25zdW1lcgEABmFjY2Vw" +
- "dAEAFShMamF2YS9sYW5nL09iamVjdDspVgEAEmphdmEvbGFuZy9SdW5uYWJsZQEAA3J1bgAgAA0A" +
- "DgAAAAEAAgAPABAAAQARAAAAAgASAAQAAQATABQAAgAVAAAAKgACAAIAAAAKKrcAASortQACsQAA" +
- "AAEAFgAAAA4AAwAAABUABAAWAAkAFwARAAAAAgAXAAIAGAAZAAEAFQAAACgAAgABAAAADCq0AAIS" +
- "A7kABAIAsQAAAAEAFgAAAAoAAgAAABoACwAbAAIAGgAZAAEAFQAAACgAAgABAAAADCq0AAISBbkA" +
- "BAIAsQAAAAEAFgAAAAoAAgAAAB4ACwAfAAEAGwAcAAEAFQAAAG8AAgACAAAAOyq0AAISBrkABAIA" +
- "KrcAByq0AAISCLkABAIAK7kACQEAKrQAAhIKuQAEAgAqtwALKrQAAhIMuQAEAgCxAAAAAQAWAAAA" +
- "IgAIAAAAIgALACMADwAkABoAJQAgACYAKwAnAC8AKAA6ACkAAQAdAAAAAgAe");
- private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
- "ZGV4CjAzNQAw/b59wCwTlSVDmuhPEezuK3oe0rtT4ujMBQAAcAAAAHhWNBIAAAAAAAAAAAgFAAAd" +
- "AAAAcAAAAAYAAADkAAAABAAAAPwAAAABAAAALAEAAAcAAAA0AQAAAQAAAGwBAABABAAAjAEAAJoC" +
- "AACdAgAAoAIAAKgCAACsAgAAsgIAALoCAADbAgAA+gIAAAcDAAAmAwAAOgMAAFADAABkAwAAggMA" +
- "AKEDAACoAwAAuAMAALsDAAC/AwAAxwMAANsDAAAKBAAAOAQAAGYEAACTBAAAnQQAAKIEAACpBAAA" +
- "CAAAAAkAAAAKAAAACwAAAA4AAAARAAAAEQAAAAUAAAAAAAAAEgAAAAUAAACEAgAAEgAAAAUAAACM" +
- "AgAAEgAAAAUAAACUAgAAAAAEABkAAAAAAAMAAgAAAAAAAAAFAAAAAAAAAA8AAAAAAAIAGwAAAAIA" +
- "AAACAAAAAwAAABoAAAAEAAEAEwAAAAAAAAAAAAAAAgAAAAAAAAAQAAAAZAIAAO8EAAAAAAAAAQAA" +
- "ANEEAAABAAAA3wQAAAIAAgABAAAAsAQAAAYAAABwEAQAAABbAQAADgADAAEAAgAAALgEAAAJAAAA" +
- "VCAAABsBBgAAAHIgBgAQAA4AAAADAAEAAgAAAL4EAAAJAAAAVCAAABsBBwAAAHIgBgAQAA4AAAAE" +
- "AAIAAgAAAMQEAAAqAAAAVCAAABsBGAAAAHIgBgAQAHAQAgACAFQgAAAbARYAAAByIAYAEAByEAUA" +
- "AwBUIAAAGwEXAAAAciAGABAAcBABAAIAVCAAABsBFQAAAHIgBgAQAA4AAAAAAAEAAAABAAAAAAAA" +
- "AAAAAACMAQAAAAAAAJQBAAABAAAAAgAAAAEAAAADAAAAAQAAAAQAASgAATwABjxpbml0PgACPjsA" +
- "BD47KVYABkZpbmlzaAAfR29vZGJ5ZSAtIHByaXZhdGUgLSBUcmFuc2Zvcm1lZAAdSGVsbG8gLSBw" +
- "cml2YXRlIC0gVHJhbnNmb3JtZWQAC0xUcmFuc2Zvcm07AB1MZGFsdmlrL2Fubm90YXRpb24vU2ln" +
- "bmF0dXJlOwASTGphdmEvbGFuZy9PYmplY3Q7ABRMamF2YS9sYW5nL1J1bm5hYmxlOwASTGphdmEv" +
- "bGFuZy9TdHJpbmc7ABxMamF2YS91dGlsL2Z1bmN0aW9uL0NvbnN1bWVyAB1MamF2YS91dGlsL2Z1" +
- "bmN0aW9uL0NvbnN1bWVyOwAFU3RhcnQADlRyYW5zZm9ybS5qYXZhAAFWAAJWTAAGYWNjZXB0ABJl" +
- "bWl0dGVyOiBqYWNrLTQuMTkALXBvc3QgRmluaXNoIHByaXZhdGUgbWV0aG9kIGNhbGwgLSBUcmFu" +
- "c2Zvcm1lZAAscG9zdCBTdGFydCBwcml2YXRlIG1ldGhvZCBjYWxsIC0gVHJhbnNmb3JtZWQALHBy" +
- "ZSBGaW5pc2ggcHJpdmF0ZSBtZXRob2QgY2FsbCAtIFRyYW5zZm9ybWVkACtwcmUgU3RhcnQgcHJp" +
- "dmF0ZSBtZXRob2QgY2FsbCAtIFRyYW5zZm9ybWVkAAhyZXBvcnRlcgADcnVuAAVzYXlIaQAFdmFs" +
- "dWUAFQEABw48LQAeAAcOhwAaAAcOhwAiAQAHDoc8hzyHPIcAAgEBHBwEFw0XARcMFwMCAQEcHAUX" +
- "ABcNFwEXDBcEAAEDAQACAIGABJwDAQK4AwEC3AMDAYAEABAAAAAAAAAAAQAAAAAAAAABAAAAHQAA" +
- "AHAAAAACAAAABgAAAOQAAAADAAAABAAAAPwAAAAEAAAAAQAAACwBAAAFAAAABwAAADQBAAAGAAAA" +
- "AQAAAGwBAAADEAAAAgAAAIwBAAABIAAABAAAAJwBAAAGIAAAAQAAAGQCAAABEAAAAwAAAIQCAAAC" +
- "IAAAHQAAAJoCAAADIAAABAAAALAEAAAEIAAAAgAAANEEAAAAIAAAAQAAAO8EAAAAEAAAAQAAAAgF" +
- "AAA=");
-
- // A class that we can use to keep track of the output of this test.
- private static class TestWatcher implements Consumer<String> {
- private StringBuilder sb;
- public TestWatcher() {
- sb = new StringBuilder();
- }
-
- @Override
- public void accept(String s) {
- sb.append(s);
- sb.append('\n');
- }
-
- public String getOutput() {
- return sb.toString();
- }
- }
-
- public static void main(String[] args) {
- art.Main.bindAgentJNIForClass(Main.class);
- TestWatcher w = new TestWatcher();
- doTest(new Transform(w), w);
+ public static void main(String[] args) throws Exception {
+ art.Test919.run();
}
-
- private static boolean interpreting = true;
- private static boolean retry = false;
-
- public static void doTest(Transform t, TestWatcher w) {
- Runnable do_redefinition = () -> {
- w.accept("transforming calling function");
- doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
- };
- // This just prints something out to show we are running the Runnable.
- Runnable say_nothing = () -> { w.accept("Not doing anything here"); };
-
- // Try and redefine.
- t.sayHi(say_nothing);
- t.sayHi(do_redefinition);
- t.sayHi(say_nothing);
-
- // Print output of last run.
- System.out.print(w.getOutput());
- }
-
- // Transforms the class
- private static native void doCommonClassRedefinition(Class<?> target,
- byte[] classfile,
- byte[] dexfile);
}
diff --git a/test/919-obsolete-fields/src/Transform.java b/test/919-obsolete-fields/src/Transform.java
deleted file mode 100644
index c8e3cbd934..0000000000
--- a/test/919-obsolete-fields/src/Transform.java
+++ /dev/null
@@ -1,42 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-import java.util.function.Consumer;
-
-class Transform {
- private Consumer<String> reporter;
- public Transform(Consumer<String> reporter) {
- this.reporter = reporter;
- }
-
- private void Start() {
- reporter.accept("hello - private");
- }
-
- private void Finish() {
- reporter.accept("goodbye - private");
- }
-
- public void sayHi(Runnable r) {
- reporter.accept("Pre Start private method call");
- Start();
- reporter.accept("Post Start private method call");
- r.run();
- reporter.accept("Pre Finish private method call");
- Finish();
- reporter.accept("Post Finish private method call");
- }
-}
diff --git a/test/919-obsolete-fields/src/art/Redefinition.java b/test/919-obsolete-fields/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/919-obsolete-fields/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/919-obsolete-fields/src/art/Test919.java b/test/919-obsolete-fields/src/art/Test919.java
new file mode 100644
index 0000000000..11971ef2e8
--- /dev/null
+++ b/test/919-obsolete-fields/src/art/Test919.java
@@ -0,0 +1,173 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.function.Consumer;
+import java.util.Base64;
+
+public class Test919 {
+
+ static class Transform {
+ private Consumer<String> reporter;
+ public Transform(Consumer<String> reporter) {
+ this.reporter = reporter;
+ }
+
+ private void Start() {
+ reporter.accept("hello - private");
+ }
+
+ private void Finish() {
+ reporter.accept("goodbye - private");
+ }
+
+ public void sayHi(Runnable r) {
+ reporter.accept("Pre Start private method call");
+ Start();
+ reporter.accept("Post Start private method call");
+ r.run();
+ reporter.accept("Pre Finish private method call");
+ Finish();
+ reporter.accept("Post Finish private method call");
+ }
+ }
+
+
+ // What follows is the base64 encoded representation of the following class:
+ //
+ // import java.util.function.Consumer;
+ //
+ // static class Transform {
+ // private Consumer<String> reporter;
+ // public Transform(Consumer<String> reporter) {
+ // this.reporter = reporter;
+ // }
+ //
+ // private void Start() {
+ // reporter.accept("Hello - private - Transformed");
+ // }
+ //
+ // private void Finish() {
+ // reporter.accept("Goodbye - private - Transformed");
+ // }
+ //
+ // public void sayHi(Runnable r) {
+ // reporter.accept("pre Start private method call - Transformed");
+ // Start();
+ // reporter.accept("post Start private method call - Transformed");
+ // r.run();
+ // reporter.accept("pre Finish private method call - Transformed");
+ // Finish();
+ // reporter.accept("post Finish private method call - Transformed");
+ // }
+ // }
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAOAoADgAfCQANACAIACELACIAIwgAJAgAJQoADQAmCAAnCwAoACkIACoKAA0AKwgA" +
+ "LAcALgcAMQEACHJlcG9ydGVyAQAdTGphdmEvdXRpbC9mdW5jdGlvbi9Db25zdW1lcjsBAAlTaWdu" +
+ "YXR1cmUBADFMamF2YS91dGlsL2Z1bmN0aW9uL0NvbnN1bWVyPExqYXZhL2xhbmcvU3RyaW5nOz47" +
+ "AQAGPGluaXQ+AQAgKExqYXZhL3V0aWwvZnVuY3Rpb24vQ29uc3VtZXI7KVYBAARDb2RlAQAPTGlu" +
+ "ZU51bWJlclRhYmxlAQA0KExqYXZhL3V0aWwvZnVuY3Rpb24vQ29uc3VtZXI8TGphdmEvbGFuZy9T" +
+ "dHJpbmc7PjspVgEABVN0YXJ0AQADKClWAQAGRmluaXNoAQAFc2F5SGkBABcoTGphdmEvbGFuZy9S" +
+ "dW5uYWJsZTspVgEAClNvdXJjZUZpbGUBAAxUZXN0OTE5LmphdmEMABMAGQwADwAQAQAdSGVsbG8g" +
+ "LSBwcml2YXRlIC0gVHJhbnNmb3JtZWQHADIMADMANAEAH0dvb2RieWUgLSBwcml2YXRlIC0gVHJh" +
+ "bnNmb3JtZWQBACtwcmUgU3RhcnQgcHJpdmF0ZSBtZXRob2QgY2FsbCAtIFRyYW5zZm9ybWVkDAAY" +
+ "ABkBACxwb3N0IFN0YXJ0IHByaXZhdGUgbWV0aG9kIGNhbGwgLSBUcmFuc2Zvcm1lZAcANQwANgAZ" +
+ "AQAscHJlIEZpbmlzaCBwcml2YXRlIG1ldGhvZCBjYWxsIC0gVHJhbnNmb3JtZWQMABoAGQEALXBv" +
+ "c3QgRmluaXNoIHByaXZhdGUgbWV0aG9kIGNhbGwgLSBUcmFuc2Zvcm1lZAcANwEAFWFydC9UZXN0" +
+ "OTE5JFRyYW5zZm9ybQEACVRyYW5zZm9ybQEADElubmVyQ2xhc3NlcwEAEGphdmEvbGFuZy9PYmpl" +
+ "Y3QBABtqYXZhL3V0aWwvZnVuY3Rpb24vQ29uc3VtZXIBAAZhY2NlcHQBABUoTGphdmEvbGFuZy9P" +
+ "YmplY3Q7KVYBABJqYXZhL2xhbmcvUnVubmFibGUBAANydW4BAAthcnQvVGVzdDkxOQAgAA0ADgAA" +
+ "AAEAAgAPABAAAQARAAAAAgASAAQAAQATABQAAgAVAAAAKgACAAIAAAAKKrcAASortQACsQAAAAEA" +
+ "FgAAAA4AAwAAAAgABAAJAAkACgARAAAAAgAXAAIAGAAZAAEAFQAAACgAAgABAAAADCq0AAISA7kA" +
+ "BAIAsQAAAAEAFgAAAAoAAgAAAA0ACwAOAAIAGgAZAAEAFQAAACgAAgABAAAADCq0AAISBbkABAIA" +
+ "sQAAAAEAFgAAAAoAAgAAABEACwASAAEAGwAcAAEAFQAAAG8AAgACAAAAOyq0AAISBrkABAIAKrcA" +
+ "Byq0AAISCLkABAIAK7kACQEAKrQAAhIKuQAEAgAqtwALKrQAAhIMuQAEAgCxAAAAAQAWAAAAIgAI" +
+ "AAAAFQALABYADwAXABoAGAAgABkAKwAaAC8AGwA6ABwAAgAdAAAAAgAeADAAAAAKAAEADQAtAC8A" +
+ "CA==");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQBeEZYBAAAAAAAAAAAAAAAAAAAAAAAAAACMBgAAcAAAAHhWNBIAAAAAAAAAAMgFAAAi" +
+ "AAAAcAAAAAkAAAD4AAAABAAAABwBAAABAAAATAEAAAcAAABUAQAAAQAAAIwBAADgBAAArAEAAKwB" +
+ "AACvAQAAsgEAALoBAAC+AQAAxAEAAMwBAADtAQAADAIAACUCAAA0AgAAWAIAAHgCAACXAgAAqwIA" +
+ "AMECAADVAgAA8wIAABIDAAAZAwAAJwMAADIDAAA1AwAAOQMAAEEDAABOAwAAVAMAAIMDAACxAwAA" +
+ "3wMAAAwEAAAWBAAAGwQAACIEAAAIAAAACQAAAAoAAAALAAAADAAAAA0AAAAOAAAAEQAAABUAAAAV" +
+ "AAAACAAAAAAAAAAWAAAACAAAADQEAAAWAAAACAAAADwEAAAWAAAACAAAACwEAAAAAAcAHgAAAAAA" +
+ "AwACAAAAAAAAAAUAAAAAAAAAEgAAAAAAAgAgAAAABQAAAAIAAAAGAAAAHwAAAAcAAQAXAAAAAAAA" +
+ "AAAAAAAFAAAAAAAAABMAAACoBQAARAUAAAAAAAABKAABPAAGPGluaXQ+AAI+OwAEPjspVgAGRmlu" +
+ "aXNoAB9Hb29kYnllIC0gcHJpdmF0ZSAtIFRyYW5zZm9ybWVkAB1IZWxsbyAtIHByaXZhdGUgLSBU" +
+ "cmFuc2Zvcm1lZAAXTGFydC9UZXN0OTE5JFRyYW5zZm9ybTsADUxhcnQvVGVzdDkxOTsAIkxkYWx2" +
+ "aWsvYW5ub3RhdGlvbi9FbmNsb3NpbmdDbGFzczsAHkxkYWx2aWsvYW5ub3RhdGlvbi9Jbm5lckNs" +
+ "YXNzOwAdTGRhbHZpay9hbm5vdGF0aW9uL1NpZ25hdHVyZTsAEkxqYXZhL2xhbmcvT2JqZWN0OwAU" +
+ "TGphdmEvbGFuZy9SdW5uYWJsZTsAEkxqYXZhL2xhbmcvU3RyaW5nOwAcTGphdmEvdXRpbC9mdW5j" +
+ "dGlvbi9Db25zdW1lcgAdTGphdmEvdXRpbC9mdW5jdGlvbi9Db25zdW1lcjsABVN0YXJ0AAxUZXN0" +
+ "OTE5LmphdmEACVRyYW5zZm9ybQABVgACVkwABmFjY2VwdAALYWNjZXNzRmxhZ3MABG5hbWUALXBv" +
+ "c3QgRmluaXNoIHByaXZhdGUgbWV0aG9kIGNhbGwgLSBUcmFuc2Zvcm1lZAAscG9zdCBTdGFydCBw" +
+ "cml2YXRlIG1ldGhvZCBjYWxsIC0gVHJhbnNmb3JtZWQALHByZSBGaW5pc2ggcHJpdmF0ZSBtZXRo" +
+ "b2QgY2FsbCAtIFRyYW5zZm9ybWVkACtwcmUgU3RhcnQgcHJpdmF0ZSBtZXRob2QgY2FsbCAtIFRy" +
+ "YW5zZm9ybWVkAAhyZXBvcnRlcgADcnVuAAVzYXlIaQAFdmFsdWUAAAAAAQAAAAcAAAABAAAABQAA" +
+ "AAEAAAAGAAAACAEABw4BAw8BAg8AEQAHDgEIDwANAAcOAQgPABUBAAcOAQgPAQMPAQgPAQMPAQgP" +
+ "AQMPAQgPAAACAAIAAQAAAEQEAAAGAAAAcBAEAAAAWwEAAA4AAwABAAIAAABQBAAACQAAAFQgAAAb" +
+ "AQYAAAByIAYAEAAOAAAAAwABAAIAAABYBAAACQAAAFQgAAAbAQcAAAByIAYAEAAOAAAABAACAAIA" +
+ "AABgBAAAKgAAAFQgAAAbAR0AAAByIAYAEABwEAIAAgBUIAAAGwEbAAAAciAGABAAchAFAAMAVCAA" +
+ "ABsBHAAAAHIgBgAQAHAQAQACAFQgAAAbARoAAAByIAYAEAAOAAABAwEAAgCBgAT8CAECmAkBArwJ" +
+ "AwHgCQICASEYAQIDAhgECBkXFAIEASEcBBcQFwEXDxcDAgQBIRwFFwAXEBcBFw8XBAAAAAIAAABc" +
+ "BQAAYgUAAAEAAABrBQAAAQAAAHkFAACMBQAAAQAAAAEAAAAAAAAAAAAAAJgFAAAAAAAAoAUAABAA" +
+ "AAAAAAAAAQAAAAAAAAABAAAAIgAAAHAAAAACAAAACQAAAPgAAAADAAAABAAAABwBAAAEAAAAAQAA" +
+ "AEwBAAAFAAAABwAAAFQBAAAGAAAAAQAAAIwBAAACIAAAIgAAAKwBAAABEAAAAwAAACwEAAADIAAA" +
+ "BAAAAEQEAAABIAAABAAAAHwEAAAAIAAAAQAAAEQFAAAEIAAABAAAAFwFAAADEAAAAwAAAIwFAAAG" +
+ "IAAAAQAAAKgFAAAAEAAAAQAAAMgFAAA=");
+
+ // A class that we can use to keep track of the output of this test.
+ private static class TestWatcher implements Consumer<String> {
+ private StringBuilder sb;
+ public TestWatcher() {
+ sb = new StringBuilder();
+ }
+
+ @Override
+ public void accept(String s) {
+ sb.append(s);
+ sb.append('\n');
+ }
+
+ public String getOutput() {
+ return sb.toString();
+ }
+ }
+
+ public static void run() {
+ Redefinition.setTestConfiguration(Redefinition.Config.COMMON_REDEFINE);
+ TestWatcher w = new TestWatcher();
+ doTest(new Transform(w), w);
+ }
+
+ public static void doTest(Transform t, TestWatcher w) {
+ Runnable do_redefinition = () -> {
+ w.accept("transforming calling function");
+ Redefinition.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+ };
+ // This just prints something out to show we are running the Runnable.
+ Runnable say_nothing = () -> { w.accept("Not doing anything here"); };
+
+ // Try and redefine.
+ t.sayHi(say_nothing);
+ t.sayHi(do_redefinition);
+ t.sayHi(say_nothing);
+
+ // Print output of last run.
+ System.out.print(w.getOutput());
+ }
+}
diff --git a/test/921-hello-failure/src/Main.java b/test/921-hello-failure/src/Main.java
index d9a49489f0..cfdcdc250f 100644
--- a/test/921-hello-failure/src/Main.java
+++ b/test/921-hello-failure/src/Main.java
@@ -14,12 +14,12 @@
* limitations under the License.
*/
-import java.util.ArrayList;
+import art.Redefinition;
+import java.util.Arrays;
+
public class Main {
public static void main(String[] args) {
- art.Main.bindAgentJNIForClass(Main.class);
-
Verification.doTest(new Transform());
NewName.doTest(new Transform());
DifferentAccess.doTest(new Transform());
@@ -37,40 +37,40 @@ public class Main {
Unmodifiable.doTest(new Transform[] { new Transform(), });
}
- // Transforms the class. This throws an exception if something goes wrong.
- public static native void doCommonClassRedefinition(Class<?> target,
- byte[] classfile,
- byte[] dexfile) throws Exception;
-
- public static void doMultiClassRedefinition(CommonClassDefinition... defs) throws Exception {
- ArrayList<Class<?>> classes = new ArrayList<>();
- ArrayList<byte[]> class_files = new ArrayList<>();
- ArrayList<byte[]> dex_files = new ArrayList<>();
+ // TODO Replace this shim with a better re-write of this test.
+ private static Redefinition.CommonClassDefinition mapCCD(CommonClassDefinition d) {
+ return new Redefinition.CommonClassDefinition(d.target, d.class_file_bytes, d.dex_file_bytes);
+ }
- for (CommonClassDefinition d : defs) {
- classes.add(d.target);
- class_files.add(d.class_file_bytes);
- dex_files.add(d.dex_file_bytes);
- }
- doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
- class_files.toArray(new byte[0][]),
- dex_files.toArray(new byte[0][]));
+ private static Redefinition.CommonClassDefinition[] toCCDA(CommonClassDefinition[] ds) {
+ return Arrays.stream(ds).map(Main::mapCCD).toArray(Redefinition.CommonClassDefinition[]::new);
}
+ public static void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile) throws Exception {
+ Redefinition.doCommonClassRedefinition(target, classfile, dexfile);
+ }
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) throws Exception {
+ Redefinition.doMultiClassRedefinition(toCCDA(defs));
+ }
public static void addMultiTransformationResults(CommonClassDefinition... defs) throws Exception {
- for (CommonClassDefinition d : defs) {
- addCommonTransformationResult(d.target.getCanonicalName(),
- d.class_file_bytes,
- d.dex_file_bytes);
- }
+ Redefinition.addMultiTransformationResults(toCCDA(defs));
+ }
+ public static void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles) throws Exception {
+ Redefinition.doCommonMultiClassRedefinition(targets, classfiles, dexfiles);
+ }
+ public static void doCommonClassRetransformation(Class<?>... target) throws Exception {
+ Redefinition.doCommonClassRetransformation(target);
+ }
+ public static void enableCommonRetransformation(boolean enable) {
+ Redefinition.enableCommonRetransformation(enable);
+ }
+ public static void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes) {
+ Redefinition.addCommonTransformationResult(target_name, class_bytes, dex_bytes);
}
-
- public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
- byte[][] classfiles,
- byte[][] dexfiles) throws Exception;
- public static native void doCommonClassRetransformation(Class<?>... target) throws Exception;
- public static native void enableCommonRetransformation(boolean enable);
- public static native void addCommonTransformationResult(String target_name,
- byte[] class_bytes,
- byte[] dex_bytes);
}
diff --git a/test/921-hello-failure/src/art/Redefinition.java b/test/921-hello-failure/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/921-hello-failure/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/926-multi-obsolescence/src/CommonClassDefinition.java b/test/926-multi-obsolescence/src/CommonClassDefinition.java
deleted file mode 100644
index 62602a02e9..0000000000
--- a/test/926-multi-obsolescence/src/CommonClassDefinition.java
+++ /dev/null
@@ -1,27 +0,0 @@
-/*
- * Copyright (C) 2017 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class CommonClassDefinition {
- public final Class<?> target;
- public final byte[] class_file_bytes;
- public final byte[] dex_file_bytes;
-
- CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
- this.target = target;
- this.class_file_bytes = class_file_bytes;
- this.dex_file_bytes = dex_file_bytes;
- }
-}
diff --git a/test/926-multi-obsolescence/src/Main.java b/test/926-multi-obsolescence/src/Main.java
index 2440908c07..8e21b8f633 100644
--- a/test/926-multi-obsolescence/src/Main.java
+++ b/test/926-multi-obsolescence/src/Main.java
@@ -1,5 +1,5 @@
/*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
@@ -14,115 +14,8 @@
* limitations under the License.
*/
-import java.util.ArrayList;
-import java.util.Base64;
-
public class Main {
- // class Transform {
- // public void sayHi(Runnable r) {
- // System.out.println("Hello - Transformed");
- // r.run();
- // System.out.println("Goodbye - Transformed");
- // }
- // }
- private static CommonClassDefinition VALID_DEFINITION_T1 = new CommonClassDefinition(
- Transform.class,
- Base64.getDecoder().decode(
- "yv66vgAAADQAJAoACAARCQASABMIABQKABUAFgsAFwAYCAAZBwAaBwAbAQAGPGluaXQ+AQADKClW" +
- "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
- "KVYBAApTb3VyY2VGaWxlAQAOVHJhbnNmb3JtLmphdmEMAAkACgcAHAwAHQAeAQATSGVsbG8gLSBU" +
- "cmFuc2Zvcm1lZAcAHwwAIAAhBwAiDAAjAAoBABVHb29kYnllIC0gVHJhbnNmb3JtZWQBAAlUcmFu" +
- "c2Zvcm0BABBqYXZhL2xhbmcvT2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZh" +
- "L2lvL1ByaW50U3RyZWFtOwEAE2phdmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZh" +
- "L2xhbmcvU3RyaW5nOylWAQASamF2YS9sYW5nL1J1bm5hYmxlAQADcnVuACAABwAIAAAAAAACAAAA" +
- "CQAKAAEACwAAAB0AAQABAAAABSq3AAGxAAAAAQAMAAAABgABAAAAAQABAA0ADgABAAsAAAA7AAIA" +
- "AgAAABeyAAISA7YABCu5AAUBALIAAhIGtgAEsQAAAAEADAAAABIABAAAAAMACAAEAA4ABQAWAAYA" +
- "AQAPAAAAAgAQ"),
- Base64.getDecoder().decode(
- "ZGV4CjAzNQAYeAMMXgYWxoeSHAS9EWKCCtVRSAGpqZVQAwAAcAAAAHhWNBIAAAAAAAAAALACAAAR" +
- "AAAAcAAAAAcAAAC0AAAAAwAAANAAAAABAAAA9AAAAAUAAAD8AAAAAQAAACQBAAAMAgAARAEAAKIB" +
- "AACqAQAAwQEAANYBAADjAQAA+gEAAA4CAAAkAgAAOAIAAEwCAABcAgAAXwIAAGMCAAB3AgAAfAIA" +
- "AIUCAACKAgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACgAAAAoAAAAGAAAAAAAAAAsAAAAGAAAA" +
- "lAEAAAsAAAAGAAAAnAEAAAUAAQANAAAAAAAAAAAAAAAAAAEAEAAAAAEAAgAOAAAAAgAAAAAAAAAD" +
- "AAAADwAAAAAAAAAAAAAAAgAAAAAAAAAJAAAAAAAAAJ8CAAAAAAAAAQABAAEAAACRAgAABAAAAHAQ" +
- "AwAAAA4ABAACAAIAAACWAgAAFAAAAGIAAAAbAQIAAABuIAIAEAByEAQAAwBiAAAAGwEBAAAAbiAC" +
- "ABAADgABAAAAAwAAAAEAAAAEAAY8aW5pdD4AFUdvb2RieWUgLSBUcmFuc2Zvcm1lZAATSGVsbG8g" +
- "LSBUcmFuc2Zvcm1lZAALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwASTGphdmEv" +
- "bGFuZy9PYmplY3Q7ABRMamF2YS9sYW5nL1J1bm5hYmxlOwASTGphdmEvbGFuZy9TdHJpbmc7ABJM" +
- "amF2YS9sYW5nL1N5c3RlbTsADlRyYW5zZm9ybS5qYXZhAAFWAAJWTAASZW1pdHRlcjogamFjay00" +
- "LjEzAANvdXQAB3ByaW50bG4AA3J1bgAFc2F5SGkAAQAHDgADAQAHDoc8hwAAAAEBAICABMQCAQHc" +
- "AgAAAA0AAAAAAAAAAQAAAAAAAAABAAAAEQAAAHAAAAACAAAABwAAALQAAAADAAAAAwAAANAAAAAE" +
- "AAAAAQAAAPQAAAAFAAAABQAAAPwAAAAGAAAAAQAAACQBAAABIAAAAgAAAEQBAAABEAAAAgAAAJQB" +
- "AAACIAAAEQAAAKIBAAADIAAAAgAAAJECAAAAIAAAAQAAAJ8CAAAAEAAAAQAAALACAAA="));
- // class Transform2 {
- // public void sayHi(Runnable r) {
- // System.out.println("Hello 2 - Transformed");
- // r.run();
- // System.out.println("Goodbye 2 - Transformed");
- // }
- // }
- private static CommonClassDefinition VALID_DEFINITION_T2 = new CommonClassDefinition(
- Transform2.class,
- Base64.getDecoder().decode(
- "yv66vgAAADQAJAoACAARCQASABMIABQKABUAFgsAFwAYCAAZBwAaBwAbAQAGPGluaXQ+AQADKClW" +
- "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
- "KVYBAApTb3VyY2VGaWxlAQAPVHJhbnNmb3JtMi5qYXZhDAAJAAoHABwMAB0AHgEAFUhlbGxvIDIg" +
- "LSBUcmFuc2Zvcm1lZAcAHwwAIAAhBwAiDAAjAAoBABdHb29kYnllIDIgLSBUcmFuc2Zvcm1lZAEA" +
- "ClRyYW5zZm9ybTIBABBqYXZhL2xhbmcvT2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEA" +
- "FUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2phdmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAV" +
- "KExqYXZhL2xhbmcvU3RyaW5nOylWAQASamF2YS9sYW5nL1J1bm5hYmxlAQADcnVuACAABwAIAAAA" +
- "AAACAAAACQAKAAEACwAAAB0AAQABAAAABSq3AAGxAAAAAQAMAAAABgABAAAAAQABAA0ADgABAAsA" +
- "AAA7AAIAAgAAABeyAAISA7YABCu5AAUBALIAAhIGtgAEsQAAAAEADAAAABIABAAAAAMACAAEAA4A" +
- "BQAWAAYAAQAPAAAAAgAQ"),
- Base64.getDecoder().decode(
- "ZGV4CjAzNQCee5Z6+AuFcjnPjjn7QYgZmKSmFQCO4nxUAwAAcAAAAHhWNBIAAAAAAAAAALQCAAAR" +
- "AAAAcAAAAAcAAAC0AAAAAwAAANAAAAABAAAA9AAAAAUAAAD8AAAAAQAAACQBAAAQAgAARAEAAKIB" +
- "AACqAQAAwwEAANoBAADoAQAA/wEAABMCAAApAgAAPQIAAFECAABiAgAAZQIAAGkCAAB9AgAAggIA" +
- "AIsCAACQAgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACgAAAAoAAAAGAAAAAAAAAAsAAAAGAAAA" +
- "lAEAAAsAAAAGAAAAnAEAAAUAAQANAAAAAAAAAAAAAAAAAAEAEAAAAAEAAgAOAAAAAgAAAAAAAAAD" +
- "AAAADwAAAAAAAAAAAAAAAgAAAAAAAAAJAAAAAAAAAKUCAAAAAAAAAQABAAEAAACXAgAABAAAAHAQ" +
- "AwAAAA4ABAACAAIAAACcAgAAFAAAAGIAAAAbAQIAAABuIAIAEAByEAQAAwBiAAAAGwEBAAAAbiAC" +
- "ABAADgABAAAAAwAAAAEAAAAEAAY8aW5pdD4AF0dvb2RieWUgMiAtIFRyYW5zZm9ybWVkABVIZWxs" +
- "byAyIC0gVHJhbnNmb3JtZWQADExUcmFuc2Zvcm0yOwAVTGphdmEvaW8vUHJpbnRTdHJlYW07ABJM" +
- "amF2YS9sYW5nL09iamVjdDsAFExqYXZhL2xhbmcvUnVubmFibGU7ABJMamF2YS9sYW5nL1N0cmlu" +
- "ZzsAEkxqYXZhL2xhbmcvU3lzdGVtOwAPVHJhbnNmb3JtMi5qYXZhAAFWAAJWTAASZW1pdHRlcjog" +
- "amFjay00LjIwAANvdXQAB3ByaW50bG4AA3J1bgAFc2F5SGkAAQAHDgADAQAHDoc8hwAAAAEBAICA" +
- "BMQCAQHcAgANAAAAAAAAAAEAAAAAAAAAAQAAABEAAABwAAAAAgAAAAcAAAC0AAAAAwAAAAMAAADQ" +
- "AAAABAAAAAEAAAD0AAAABQAAAAUAAAD8AAAABgAAAAEAAAAkAQAAASAAAAIAAABEAQAAARAAAAIA" +
- "AACUAQAAAiAAABEAAACiAQAAAyAAAAIAAACXAgAAACAAAAEAAAClAgAAABAAAAEAAAC0AgAA"));
-
- public static void main(String[] args) {
- art.Main.bindAgentJNIForClass(Main.class);
- doTest(new Transform(), new Transform2());
- }
-
- public static void doTest(final Transform t1, final Transform2 t2) {
- t1.sayHi(() -> { t2.sayHi(() -> { System.out.println("Not doing anything here"); }); });
- t1.sayHi(() -> {
- t2.sayHi(() -> {
- System.out.println("transforming calling functions");
- doMultiClassRedefinition(VALID_DEFINITION_T1, VALID_DEFINITION_T2);
- });
- });
- t1.sayHi(() -> { t2.sayHi(() -> { System.out.println("Not doing anything here"); }); });
+ public static void main(String[] args) throws Exception {
+ art.Test926.run();
}
-
- public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
- ArrayList<Class<?>> classes = new ArrayList<>();
- ArrayList<byte[]> class_files = new ArrayList<>();
- ArrayList<byte[]> dex_files = new ArrayList<>();
-
- for (CommonClassDefinition d : defs) {
- classes.add(d.target);
- class_files.add(d.class_file_bytes);
- dex_files.add(d.dex_file_bytes);
- }
- doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
- class_files.toArray(new byte[0][]),
- dex_files.toArray(new byte[0][]));
- }
-
- public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
- byte[][] classfiles,
- byte[][] dexfiles);
}
diff --git a/test/926-multi-obsolescence/src/Transform.java b/test/926-multi-obsolescence/src/Transform.java
deleted file mode 100644
index 8cda6cdf53..0000000000
--- a/test/926-multi-obsolescence/src/Transform.java
+++ /dev/null
@@ -1,30 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
- public void sayHi(Runnable r) {
- // Use lower 'h' to make sure the string will have a different string id
- // than the transformation (the transformation code is the same except
- // the actual printed String, which was making the test inacurately passing
- // in JIT mode when loading the string from the dex cache, as the string ids
- // of the two different strings were the same).
- // We know the string ids will be different because lexicographically:
- // "Hello" < "LTransform;" < "hello".
- System.out.println("hello");
- r.run();
- System.out.println("goodbye");
- }
-}
diff --git a/test/926-multi-obsolescence/src/Transform2.java b/test/926-multi-obsolescence/src/Transform2.java
deleted file mode 100644
index 4877f8455b..0000000000
--- a/test/926-multi-obsolescence/src/Transform2.java
+++ /dev/null
@@ -1,23 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform2 {
- public void sayHi(Runnable r) {
- System.out.println("hello - 2");
- r.run();
- System.out.println("goodbye - 2");
- }
-}
diff --git a/test/926-multi-obsolescence/src/art/Redefinition.java b/test/926-multi-obsolescence/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/926-multi-obsolescence/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/926-multi-obsolescence/src/art/Test926.java b/test/926-multi-obsolescence/src/art/Test926.java
new file mode 100644
index 0000000000..843d05c3fc
--- /dev/null
+++ b/test/926-multi-obsolescence/src/art/Test926.java
@@ -0,0 +1,140 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import static art.Redefinition.CommonClassDefinition;
+import java.util.ArrayList;
+import java.util.Base64;
+
+public class Test926 {
+
+ static class Transform {
+ public void sayHi(Runnable r) {
+ System.out.println("hello");
+ r.run();
+ System.out.println("goodbye");
+ }
+ }
+
+ static class Transform2 {
+ public void sayHi(Runnable r) {
+ System.out.println("hello - 2");
+ r.run();
+ System.out.println("goodbye - 2");
+ }
+ }
+ // static class Transform {
+ // public void sayHi(Runnable r) {
+ // System.out.println("Hello - Transformed");
+ // r.run();
+ // System.out.println("Goodbye - Transformed");
+ // }
+ // }
+ private static CommonClassDefinition VALID_DEFINITION_T1 = new CommonClassDefinition(
+ Transform.class,
+ Base64.getDecoder().decode(
+ "yv66vgAAADQAKAoACAARCQASABMIABQKABUAFgsAFwAYCAAZBwAbBwAeAQAGPGluaXQ+AQADKClW" +
+ "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
+ "KVYBAApTb3VyY2VGaWxlAQAMVGVzdDkyNi5qYXZhDAAJAAoHAB8MACAAIQEAE0hlbGxvIC0gVHJh" +
+ "bnNmb3JtZWQHACIMACMAJAcAJQwAJgAKAQAVR29vZGJ5ZSAtIFRyYW5zZm9ybWVkBwAnAQAVYXJ0" +
+ "L1Rlc3Q5MjYkVHJhbnNmb3JtAQAJVHJhbnNmb3JtAQAMSW5uZXJDbGFzc2VzAQAQamF2YS9sYW5n" +
+ "L09iamVjdAEAEGphdmEvbGFuZy9TeXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsB" +
+ "ABNqYXZhL2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgEA" +
+ "EmphdmEvbGFuZy9SdW5uYWJsZQEAA3J1bgEAC2FydC9UZXN0OTI2ACAABwAIAAAAAAACAAAACQAK" +
+ "AAEACwAAAB0AAQABAAAABSq3AAGxAAAAAQAMAAAABgABAAAADAABAA0ADgABAAsAAAA7AAIAAgAA" +
+ "ABeyAAISA7YABCu5AAUBALIAAhIGtgAEsQAAAAEADAAAABIABAAAAA4ACAAPAA4AEAAWABEAAgAP" +
+ "AAAAAgAQAB0AAAAKAAEABwAaABwACA=="),
+ Base64.getDecoder().decode(
+ "ZGV4CjAzNQB8m+R/AAAAAAAAAAAAAAAAAAAAAAAAAAA8BAAAcAAAAHhWNBIAAAAAAAAAAHgDAAAX" +
+ "AAAAcAAAAAoAAADMAAAAAwAAAPQAAAABAAAAGAEAAAUAAAAgAQAAAQAAAEgBAADUAgAAaAEAAGgB" +
+ "AABwAQAAhwEAAJwBAAC1AQAAxAEAAOgBAAAIAgAAHwIAADMCAABJAgAAXQIAAHECAAB/AgAAigIA" +
+ "AI0CAACRAgAAngIAAKQCAACpAgAAsgIAALcCAAC+AgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAA" +
+ "CQAAAAoAAAALAAAADgAAAA4AAAAJAAAAAAAAAA8AAAAJAAAAyAIAAA8AAAAJAAAA0AIAAAgABAAS" +
+ "AAAAAAAAAAAAAAAAAAEAFQAAAAQAAgATAAAABQAAAAAAAAAGAAAAFAAAAAAAAAAAAAAABQAAAAAA" +
+ "AAAMAAAAaAMAADwDAAAAAAAABjxpbml0PgAVR29vZGJ5ZSAtIFRyYW5zZm9ybWVkABNIZWxsbyAt" +
+ "IFRyYW5zZm9ybWVkABdMYXJ0L1Rlc3Q5MjYkVHJhbnNmb3JtOwANTGFydC9UZXN0OTI2OwAiTGRh" +
+ "bHZpay9hbm5vdGF0aW9uL0VuY2xvc2luZ0NsYXNzOwAeTGRhbHZpay9hbm5vdGF0aW9uL0lubmVy" +
+ "Q2xhc3M7ABVMamF2YS9pby9QcmludFN0cmVhbTsAEkxqYXZhL2xhbmcvT2JqZWN0OwAUTGphdmEv" +
+ "bGFuZy9SdW5uYWJsZTsAEkxqYXZhL2xhbmcvU3RyaW5nOwASTGphdmEvbGFuZy9TeXN0ZW07AAxU" +
+ "ZXN0OTI2LmphdmEACVRyYW5zZm9ybQABVgACVkwAC2FjY2Vzc0ZsYWdzAARuYW1lAANvdXQAB3By" +
+ "aW50bG4AA3J1bgAFc2F5SGkABXZhbHVlAAAAAAEAAAAGAAAAAQAAAAcAAAAMAAcOAA4BAAcOAQgP" +
+ "AQMPAQgPAAEAAQABAAAA2AIAAAQAAABwEAMAAAAOAAQAAgACAAAA3QIAABQAAABiAAAAGwECAAAA" +
+ "biACABAAchAEAAMAYgAAABsBAQAAAG4gAgAQAA4AAAABAQCAgATsBQEBhAYAAAICARYYAQIDAhAE" +
+ "CBEXDQACAAAATAMAAFIDAABcAwAAAAAAAAAAAAAAAAAAEAAAAAAAAAABAAAAAAAAAAEAAAAXAAAA" +
+ "cAAAAAIAAAAKAAAAzAAAAAMAAAADAAAA9AAAAAQAAAABAAAAGAEAAAUAAAAFAAAAIAEAAAYAAAAB" +
+ "AAAASAEAAAIgAAAXAAAAaAEAAAEQAAACAAAAyAIAAAMgAAACAAAA2AIAAAEgAAACAAAA7AIAAAAg" +
+ "AAABAAAAPAMAAAQgAAACAAAATAMAAAMQAAABAAAAXAMAAAYgAAABAAAAaAMAAAAQAAABAAAAeAMA" +
+ "AA=="));
+ // static class Transform2 {
+ // public void sayHi(Runnable r) {
+ // System.out.println("Hello 2 - Transformed");
+ // r.run();
+ // System.out.println("Goodbye 2 - Transformed");
+ // }
+ // }
+ private static CommonClassDefinition VALID_DEFINITION_T2 = new CommonClassDefinition(
+ Transform2.class,
+ Base64.getDecoder().decode(
+ "yv66vgAAADQAKAoACAARCQASABMIABQKABUAFgsAFwAYCAAZBwAbBwAeAQAGPGluaXQ+AQADKClW" +
+ "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
+ "KVYBAApTb3VyY2VGaWxlAQAMVGVzdDkyNi5qYXZhDAAJAAoHAB8MACAAIQEAFUhlbGxvIDIgLSBU" +
+ "cmFuc2Zvcm1lZAcAIgwAIwAkBwAlDAAmAAoBABdHb29kYnllIDIgLSBUcmFuc2Zvcm1lZAcAJwEA" +
+ "FmFydC9UZXN0OTI2JFRyYW5zZm9ybTIBAApUcmFuc2Zvcm0yAQAMSW5uZXJDbGFzc2VzAQAQamF2" +
+ "YS9sYW5nL09iamVjdAEAEGphdmEvbGFuZy9TeXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0" +
+ "cmVhbTsBABNqYXZhL2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmlu" +
+ "ZzspVgEAEmphdmEvbGFuZy9SdW5uYWJsZQEAA3J1bgEAC2FydC9UZXN0OTI2ACAABwAIAAAAAAAC" +
+ "AAAACQAKAAEACwAAAB0AAQABAAAABSq3AAGxAAAAAQAMAAAABgABAAAABQABAA0ADgABAAsAAAA7" +
+ "AAIAAgAAABeyAAISA7YABCu5AAUBALIAAhIGtgAEsQAAAAEADAAAABIABAAAAAcACAAIAA4ACQAW" +
+ "AAoAAgAPAAAAAgAQAB0AAAAKAAEABwAaABwACA=="),
+ Base64.getDecoder().decode(
+ "ZGV4CjAzNQBCnaUuAAAAAAAAAAAAAAAAAAAAAAAAAABABAAAcAAAAHhWNBIAAAAAAAAAAHwDAAAX" +
+ "AAAAcAAAAAoAAADMAAAAAwAAAPQAAAABAAAAGAEAAAUAAAAgAQAAAQAAAEgBAADYAgAAaAEAAGgB" +
+ "AABwAQAAiQEAAKABAAC6AQAAyQEAAO0BAAANAgAAJAIAADgCAABOAgAAYgIAAHYCAACEAgAAkAIA" +
+ "AJMCAACXAgAApAIAAKoCAACvAgAAuAIAAL0CAADEAgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAA" +
+ "CQAAAAoAAAALAAAADgAAAA4AAAAJAAAAAAAAAA8AAAAJAAAAzAIAAA8AAAAJAAAA1AIAAAgABAAS" +
+ "AAAAAAAAAAAAAAAAAAEAFQAAAAQAAgATAAAABQAAAAAAAAAGAAAAFAAAAAAAAAAAAAAABQAAAAAA" +
+ "AAAMAAAAbAMAAEADAAAAAAAABjxpbml0PgAXR29vZGJ5ZSAyIC0gVHJhbnNmb3JtZWQAFUhlbGxv" +
+ "IDIgLSBUcmFuc2Zvcm1lZAAYTGFydC9UZXN0OTI2JFRyYW5zZm9ybTI7AA1MYXJ0L1Rlc3Q5MjY7" +
+ "ACJMZGFsdmlrL2Fubm90YXRpb24vRW5jbG9zaW5nQ2xhc3M7AB5MZGFsdmlrL2Fubm90YXRpb24v" +
+ "SW5uZXJDbGFzczsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABRM" +
+ "amF2YS9sYW5nL1J1bm5hYmxlOwASTGphdmEvbGFuZy9TdHJpbmc7ABJMamF2YS9sYW5nL1N5c3Rl" +
+ "bTsADFRlc3Q5MjYuamF2YQAKVHJhbnNmb3JtMgABVgACVkwAC2FjY2Vzc0ZsYWdzAARuYW1lAANv" +
+ "dXQAB3ByaW50bG4AA3J1bgAFc2F5SGkABXZhbHVlAAABAAAABgAAAAEAAAAHAAAABQAHDgAHAQAH" +
+ "DgEIDwEDDwEIDwABAAEAAQAAANwCAAAEAAAAcBADAAAADgAEAAIAAgAAAOECAAAUAAAAYgAAABsB" +
+ "AgAAAG4gAgAQAHIQBAADAGIAAAAbAQEAAABuIAIAEAAOAAAAAQEAgIAE8AUBAYgGAAACAgEWGAEC" +
+ "AwIQBAgRFw0AAgAAAFADAABWAwAAYAMAAAAAAAAAAAAAAAAAABAAAAAAAAAAAQAAAAAAAAABAAAA" +
+ "FwAAAHAAAAACAAAACgAAAMwAAAADAAAAAwAAAPQAAAAEAAAAAQAAABgBAAAFAAAABQAAACABAAAG" +
+ "AAAAAQAAAEgBAAACIAAAFwAAAGgBAAABEAAAAgAAAMwCAAADIAAAAgAAANwCAAABIAAAAgAAAPAC" +
+ "AAAAIAAAAQAAAEADAAAEIAAAAgAAAFADAAADEAAAAQAAAGADAAAGIAAAAQAAAGwDAAAAEAAAAQAA" +
+ "AHwDAAA="));
+
+ public static void run() throws Exception {
+ Redefinition.setTestConfiguration(Redefinition.Config.COMMON_REDEFINE);
+ doTest(new Transform(), new Transform2());
+ }
+
+ public static void doTest(final Transform t1, final Transform2 t2) throws Exception {
+ t1.sayHi(() -> { t2.sayHi(() -> { System.out.println("Not doing anything here"); }); });
+ t1.sayHi(() -> {
+ t2.sayHi(() -> {
+ System.out.println("transforming calling functions");
+ Redefinition.doMultiClassRedefinition(VALID_DEFINITION_T1, VALID_DEFINITION_T2);
+ });
+ });
+ t1.sayHi(() -> { t2.sayHi(() -> { System.out.println("Not doing anything here"); }); });
+ }
+}
diff --git a/test/930-hello-retransform/src/Main.java b/test/930-hello-retransform/src/Main.java
index da59c7440b..38c1d363b6 100644
--- a/test/930-hello-retransform/src/Main.java
+++ b/test/930-hello-retransform/src/Main.java
@@ -1,5 +1,5 @@
/*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
@@ -14,57 +14,8 @@
* limitations under the License.
*/
-import java.util.Base64;
public class Main {
-
- /**
- * base64 encoded class/dex file for
- * class Transform {
- * public void sayHi() {
- * System.out.println("Goodbye");
- * }
- * }
- */
- private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
- "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
- "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
- "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
- "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
- "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" +
- "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
- "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0=");
- private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
- "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
- "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
- "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
- "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
- "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
- "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
- "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
- "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
- "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
- "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
- "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
- "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
- "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
-
- public static void main(String[] args) {
- art.Main.bindAgentJNIForClass(Main.class);
- doTest(new Transform());
+ public static void main(String[] args) throws Exception {
+ art.Test930.run();
}
-
- public static void doTest(Transform t) {
- t.sayHi();
- addCommonTransformationResult("Transform", CLASS_BYTES, DEX_BYTES);
- enableCommonRetransformation(true);
- doCommonClassRetransformation(Transform.class);
- t.sayHi();
- }
-
- // Transforms the class
- private static native void doCommonClassRetransformation(Class<?>... target);
- private static native void enableCommonRetransformation(boolean enable);
- private static native void addCommonTransformationResult(String target_name,
- byte[] class_bytes,
- byte[] dex_bytes);
}
diff --git a/test/930-hello-retransform/src/Transform.java b/test/930-hello-retransform/src/Transform.java
deleted file mode 100644
index 8e8af355da..0000000000
--- a/test/930-hello-retransform/src/Transform.java
+++ /dev/null
@@ -1,28 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
- public void sayHi() {
- // Use lower 'h' to make sure the string will have a different string id
- // than the transformation (the transformation code is the same except
- // the actual printed String, which was making the test inacurately passing
- // in JIT mode when loading the string from the dex cache, as the string ids
- // of the two different strings were the same).
- // We know the string ids will be different because lexicographically:
- // "Goodbye" < "LTransform;" < "hello".
- System.out.println("hello");
- }
-}
diff --git a/test/930-hello-retransform/src/art/Redefinition.java b/test/930-hello-retransform/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/930-hello-retransform/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/930-hello-retransform/src/art/Test930.java b/test/930-hello-retransform/src/art/Test930.java
new file mode 100644
index 0000000000..6c0fc16dad
--- /dev/null
+++ b/test/930-hello-retransform/src/art/Test930.java
@@ -0,0 +1,78 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.Base64;
+public class Test930 {
+
+ static class Transform {
+ public void sayHi() {
+ System.out.println("hello");
+ }
+ }
+
+
+ /**
+ * base64 encoded class/dex file for
+ * static class Transform {
+ * public void sayHi() {
+ * System.out.println("Goodbye");
+ * }
+ * }
+ */
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAIAoABgAOCQAPABAIABEKABIAEwcAFQcAGAEABjxpbml0PgEAAygpVgEABENvZGUB" +
+ "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAAxUZXN0OTMwLmphdmEMAAcA" +
+ "CAcAGQwAGgAbAQAHR29vZGJ5ZQcAHAwAHQAeBwAfAQAVYXJ0L1Rlc3Q5MzAkVHJhbnNmb3JtAQAJ" +
+ "VHJhbnNmb3JtAQAMSW5uZXJDbGFzc2VzAQAQamF2YS9sYW5nL09iamVjdAEAEGphdmEvbGFuZy9T" +
+ "eXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsBABNqYXZhL2lvL1ByaW50U3RyZWFt" +
+ "AQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgEAC2FydC9UZXN0OTMwACAABQAGAAAA" +
+ "AAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAABQABAAsACAABAAkA" +
+ "AAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAAHAAgACAACAAwAAAACAA0AFwAAAAoA" +
+ "AQAFABQAFgAI");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQBsgu9qAAAAAAAAAAAAAAAAAAAAAAAAAAC4AwAAcAAAAHhWNBIAAAAAAAAAAPQCAAAU" +
+ "AAAAcAAAAAkAAADAAAAAAgAAAOQAAAABAAAA/AAAAAQAAAAEAQAAAQAAACQBAAB0AgAARAEAAEQB" +
+ "AABMAQAAVQEAAG4BAAB9AQAAoQEAAMEBAADYAQAA7AEAAAACAAAUAgAAIgIAAC0CAAAwAgAANAIA" +
+ "AEECAABHAgAATAIAAFUCAABcAgAAAgAAAAMAAAAEAAAABQAAAAYAAAAHAAAACAAAAAkAAAAMAAAA" +
+ "DAAAAAgAAAAAAAAADQAAAAgAAABkAgAABwAEABAAAAAAAAAAAAAAAAAAAAASAAAABAABABEAAAAF" +
+ "AAAAAAAAAAAAAAAAAAAABQAAAAAAAAAKAAAA5AIAALgCAAAAAAAABjxpbml0PgAHR29vZGJ5ZQAX" +
+ "TGFydC9UZXN0OTMwJFRyYW5zZm9ybTsADUxhcnQvVGVzdDkzMDsAIkxkYWx2aWsvYW5ub3RhdGlv" +
+ "bi9FbmNsb3NpbmdDbGFzczsAHkxkYWx2aWsvYW5ub3RhdGlvbi9Jbm5lckNsYXNzOwAVTGphdmEv" +
+ "aW8vUHJpbnRTdHJlYW07ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwAS" +
+ "TGphdmEvbGFuZy9TeXN0ZW07AAxUZXN0OTMwLmphdmEACVRyYW5zZm9ybQABVgACVkwAC2FjY2Vz" +
+ "c0ZsYWdzAARuYW1lAANvdXQAB3ByaW50bG4ABXNheUhpAAV2YWx1ZQAAAQAAAAYAAAAFAAcOAAcA" +
+ "Bw4BCA8AAAAAAQABAAEAAABsAgAABAAAAHAQAwAAAA4AAwABAAIAAABxAgAACQAAAGIAAAAbAQEA" +
+ "AABuIAIAEAAOAAAAAAABAQCAgAT8BAEBlAUAAAICARMYAQIDAg4ECA8XCwACAAAAyAIAAM4CAADY" +
+ "AgAAAAAAAAAAAAAAAAAAEAAAAAAAAAABAAAAAAAAAAEAAAAUAAAAcAAAAAIAAAAJAAAAwAAAAAMA" +
+ "AAACAAAA5AAAAAQAAAABAAAA/AAAAAUAAAAEAAAABAEAAAYAAAABAAAAJAEAAAIgAAAUAAAARAEA" +
+ "AAEQAAABAAAAZAIAAAMgAAACAAAAbAIAAAEgAAACAAAAfAIAAAAgAAABAAAAuAIAAAQgAAACAAAA" +
+ "yAIAAAMQAAABAAAA2AIAAAYgAAABAAAA5AIAAAAQAAABAAAA9AIAAA==");
+
+ public static void run() {
+ Redefinition.setTestConfiguration(Redefinition.Config.COMMON_RETRANSFORM);
+ doTest(new Transform());
+ }
+
+ public static void doTest(Transform t) {
+ t.sayHi();
+ Redefinition.addCommonTransformationResult("art/Test930$Transform", CLASS_BYTES, DEX_BYTES);
+ Redefinition.enableCommonRetransformation(true);
+ Redefinition.doCommonClassRetransformation(Transform.class);
+ t.sayHi();
+ }
+}
diff --git a/test/932-transform-saves/src/Main.java b/test/932-transform-saves/src/Main.java
index 14e5da0d91..fba40f6828 100644
--- a/test/932-transform-saves/src/Main.java
+++ b/test/932-transform-saves/src/Main.java
@@ -1,5 +1,5 @@
/*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
@@ -14,103 +14,8 @@
* limitations under the License.
*/
-import java.util.Base64;
public class Main {
- /**
- * base64 encoded class/dex file for
- * class Transform {
- * public void sayHi() {
- * System.out.println("hello");
- * }
- * }
- */
- private static final byte[] CLASS_BYTES_A = Base64.getDecoder().decode(
- "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
- "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
- "BwAIBwAWDAAXABgBAAVoZWxsbwcAGQwAGgAbAQAJVHJhbnNmb3JtAQAQamF2YS9sYW5nL09iamVj" +
- "dAEAEGphdmEvbGFuZy9TeXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsBABNqYXZh" +
- "L2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgAgAAUABgAA" +
- "AAAAAgAAAAcACAABAAkAAAAdAAEAAQAAAAUqtwABsQAAAAEACgAAAAYAAQAAABEAAQALAAgAAQAJ" +
- "AAAAJQACAAEAAAAJsgACEgO2AASxAAAAAQAKAAAACgACAAAAGgAIABsAAQAMAAAAAgAN");
- private static final byte[] DEX_BYTES_A = Base64.getDecoder().decode(
- "ZGV4CjAzNQC6XWInnnDd1H4NdQ3P3inH8eCVmQI6W7LMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
- "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
- "AABqAQAAdwEAAI4BAACiAQAAtgEAAMoBAADaAQAA3QEAAOEBAAD1AQAA/AEAAAECAAAKAgAAAQAA" +
- "AAIAAAADAAAABAAAAAUAAAAHAAAABwAAAAUAAAAAAAAACAAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
- "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAGAAAAAAAAABwCAAAA" +
- "AAAAAQABAAEAAAARAgAABAAAAHAQAwAAAA4AAwABAAIAAAAWAgAACQAAAGIAAAAbAQoAAABuIAIA" +
- "EAAOAAAAAQAAAAMABjxpbml0PgALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwAS" +
- "TGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xhbmcvU3lzdGVt" +
- "OwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTQuMjIABWhlbGxvAANvdXQA" +
- "B3ByaW50bG4ABXNheUhpABEABw4AGgAHDocAAAABAQCAgASgAgEBuAIAAA0AAAAAAAAAAQAAAAAA" +
- "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
- "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
- "AgAAABECAAAAIAAAAQAAABwCAAAAEAAAAQAAACwCAAA=");
-
- /**
- * base64 encoded class/dex file for
- * class Transform {
- * public void sayHi() {
- * System.out.println("Goodbye");
- * }
- * }
- */
- private static final byte[] CLASS_BYTES_B = Base64.getDecoder().decode(
- "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
- "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
- "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
- "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
- "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" +
- "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
- "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0=");
- private static final byte[] DEX_BYTES_B = Base64.getDecoder().decode(
- "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
- "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
- "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
- "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
- "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
- "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
- "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
- "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
- "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
- "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
- "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
- "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
- "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
-
- public static void main(String[] args) {
- art.Main.bindAgentJNIForClass(Main.class);
- doTest(new Transform());
+ public static void main(String[] args) throws Exception {
+ art.Test932.run();
}
-
- public static void doTest(Transform t) {
- // TODO We currently need to do this transform call since we don't have any way to make the
- // original-dex-file a single-class dex-file letting us restore it easily. We should use the
- // manipulation library that is being made when we store the original dex file.
- // TODO REMOVE this theoretically does nothing but it ensures the original-dex-file we have set
- // is one we can return to unaltered.
- doCommonClassRedefinition(Transform.class, CLASS_BYTES_A, DEX_BYTES_A);
- t.sayHi();
-
- // Now turn it into DEX_BYTES_B so it says 'Goodbye'
- addCommonTransformationResult("Transform", CLASS_BYTES_B, DEX_BYTES_B);
- enableCommonRetransformation(true);
- doCommonClassRetransformation(Transform.class);
- t.sayHi();
-
- // Now turn it back to normal by removing the load-hook and transforming again.
- enableCommonRetransformation(false);
- doCommonClassRetransformation(Transform.class);
- t.sayHi();
- }
-
- // Transforms the class
- private static native void doCommonClassRedefinition(Class<?> target,
- byte[] class_bytes,
- byte[] dex_bytes);
- private static native void doCommonClassRetransformation(Class<?>... target);
- private static native void enableCommonRetransformation(boolean enable);
- private static native void addCommonTransformationResult(String target_name,
- byte[] class_bytes,
- byte[] dex_bytes);
}
diff --git a/test/932-transform-saves/src/Transform.java b/test/932-transform-saves/src/Transform.java
deleted file mode 100644
index 83f7aa4b4d..0000000000
--- a/test/932-transform-saves/src/Transform.java
+++ /dev/null
@@ -1,28 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
- public void sayHi() {
- // Use lower 'h' to make sure the string will have a different string id
- // than the transformation (the transformation code is the same except
- // the actual printed String, which was making the test inacurately passing
- // in JIT mode when loading the string from the dex cache, as the string ids
- // of the two different strings were the same).
- // We know the string ids will be different because lexicographically:
- // "Goodbye" < "LTransform;" < "hello".
- System.out.println("foobar");
- }
-}
diff --git a/test/932-transform-saves/src/art/Redefinition.java b/test/932-transform-saves/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/932-transform-saves/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/932-transform-saves/src/art/Test932.java b/test/932-transform-saves/src/art/Test932.java
new file mode 100644
index 0000000000..3a622322aa
--- /dev/null
+++ b/test/932-transform-saves/src/art/Test932.java
@@ -0,0 +1,129 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.Base64;
+public class Test932 {
+
+ // This class is never used so just have it print out a bogus value so we can detect if something
+ // goes very wrong.
+ static class Transform {
+ public void sayHi() {
+ System.out.println("foobar");
+ }
+ }
+
+ /**
+ * base64 encoded class/dex file for
+ * static class Transform {
+ * public void sayHi() {
+ * System.out.println("hello");
+ * }
+ * }
+ */
+ private static final byte[] CLASS_BYTES_A = Base64.getDecoder().decode(
+ "yv66vgAAADQAIAoABgAOCQAPABAIABEKABIAEwcAFQcAGAEABjxpbml0PgEAAygpVgEABENvZGUB" +
+ "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAAxUZXN0OTMyLmphdmEMAAcA" +
+ "CAcAGQwAGgAbAQAFaGVsbG8HABwMAB0AHgcAHwEAFWFydC9UZXN0OTMyJFRyYW5zZm9ybQEACVRy" +
+ "YW5zZm9ybQEADElubmVyQ2xhc3NlcwEAEGphdmEvbGFuZy9PYmplY3QBABBqYXZhL2xhbmcvU3lz" +
+ "dGVtAQADb3V0AQAVTGphdmEvaW8vUHJpbnRTdHJlYW07AQATamF2YS9pby9QcmludFN0cmVhbQEA" +
+ "B3ByaW50bG4BABUoTGphdmEvbGFuZy9TdHJpbmc7KVYBAAthcnQvVGVzdDkzMgAgAAUABgAAAAAA" +
+ "AgAAAAcACAABAAkAAAAdAAEAAQAAAAUqtwABsQAAAAEACgAAAAYAAQAAAAUAAQALAAgAAQAJAAAA" +
+ "JQACAAEAAAAJsgACEgO2AASxAAAAAQAKAAAACgACAAAABwAIAAgAAgAMAAAAAgANABcAAAAKAAEA" +
+ "BQAUABYACA==");
+ private static final byte[] DEX_BYTES_A = Base64.getDecoder().decode(
+ "ZGV4CjAzNQAngjnzAAAAAAAAAAAAAAAAAAAAAAAAAAC4AwAAcAAAAHhWNBIAAAAAAAAAAPQCAAAU" +
+ "AAAAcAAAAAkAAADAAAAAAgAAAOQAAAABAAAA/AAAAAQAAAAEAQAAAQAAACQBAAB0AgAARAEAAEQB" +
+ "AABMAQAAZQEAAHQBAACYAQAAuAEAAM8BAADjAQAA9wEAAAsCAAAZAgAAJAIAACcCAAArAgAAOAIA" +
+ "AD8CAABFAgAASgIAAFMCAABaAgAAAQAAAAIAAAADAAAABAAAAAUAAAAGAAAABwAAAAgAAAALAAAA" +
+ "CwAAAAgAAAAAAAAADAAAAAgAAABkAgAABwAEABAAAAAAAAAAAAAAAAAAAAASAAAABAABABEAAAAF" +
+ "AAAAAAAAAAAAAAAAAAAABQAAAAAAAAAJAAAA5AIAALgCAAAAAAAABjxpbml0PgAXTGFydC9UZXN0" +
+ "OTMyJFRyYW5zZm9ybTsADUxhcnQvVGVzdDkzMjsAIkxkYWx2aWsvYW5ub3RhdGlvbi9FbmNsb3Np" +
+ "bmdDbGFzczsAHkxkYWx2aWsvYW5ub3RhdGlvbi9Jbm5lckNsYXNzOwAVTGphdmEvaW8vUHJpbnRT" +
+ "dHJlYW07ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwASTGphdmEvbGFu" +
+ "Zy9TeXN0ZW07AAxUZXN0OTMyLmphdmEACVRyYW5zZm9ybQABVgACVkwAC2FjY2Vzc0ZsYWdzAAVo" +
+ "ZWxsbwAEbmFtZQADb3V0AAdwcmludGxuAAVzYXlIaQAFdmFsdWUAAAAAAQAAAAYAAAAFAAcOAAcA" +
+ "Bw4BCA8AAAAAAQABAAEAAABsAgAABAAAAHAQAwAAAA4AAwABAAIAAABxAgAACQAAAGIAAAAbAQ4A" +
+ "AABuIAIAEAAOAAAAAAABAQCAgAT8BAEBlAUAAAICARMYAQIDAg0ECA8XCgACAAAAyAIAAM4CAADY" +
+ "AgAAAAAAAAAAAAAAAAAAEAAAAAAAAAABAAAAAAAAAAEAAAAUAAAAcAAAAAIAAAAJAAAAwAAAAAMA" +
+ "AAACAAAA5AAAAAQAAAABAAAA/AAAAAUAAAAEAAAABAEAAAYAAAABAAAAJAEAAAIgAAAUAAAARAEA" +
+ "AAEQAAABAAAAZAIAAAMgAAACAAAAbAIAAAEgAAACAAAAfAIAAAAgAAABAAAAuAIAAAQgAAACAAAA" +
+ "yAIAAAMQAAABAAAA2AIAAAYgAAABAAAA5AIAAAAQAAABAAAA9AIAAA==");
+
+ /**
+ * base64 encoded class/dex file for
+ * static class Transform {
+ * public void sayHi() {
+ * System.out.println("Goodbye");
+ * }
+ * }
+ */
+ private static final byte[] CLASS_BYTES_B = Base64.getDecoder().decode(
+ "yv66vgAAADQAIAoABgAOCQAPABAIABEKABIAEwcAFQcAGAEABjxpbml0PgEAAygpVgEABENvZGUB" +
+ "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAAxUZXN0OTMyLmphdmEMAAcA" +
+ "CAcAGQwAGgAbAQAHR29vZGJ5ZQcAHAwAHQAeBwAfAQAVYXJ0L1Rlc3Q5MzIkVHJhbnNmb3JtAQAJ" +
+ "VHJhbnNmb3JtAQAMSW5uZXJDbGFzc2VzAQAQamF2YS9sYW5nL09iamVjdAEAEGphdmEvbGFuZy9T" +
+ "eXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsBABNqYXZhL2lvL1ByaW50U3RyZWFt" +
+ "AQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgEAC2FydC9UZXN0OTMyACAABQAGAAAA" +
+ "AAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAABQABAAsACAABAAkA" +
+ "AAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAAHAAgACAACAAwAAAACAA0AFwAAAAoA" +
+ "AQAFABQAFgAI");
+ private static final byte[] DEX_BYTES_B = Base64.getDecoder().decode(
+ "ZGV4CjAzNQByglN3AAAAAAAAAAAAAAAAAAAAAAAAAAC4AwAAcAAAAHhWNBIAAAAAAAAAAPQCAAAU" +
+ "AAAAcAAAAAkAAADAAAAAAgAAAOQAAAABAAAA/AAAAAQAAAAEAQAAAQAAACQBAAB0AgAARAEAAEQB" +
+ "AABMAQAAVQEAAG4BAAB9AQAAoQEAAMEBAADYAQAA7AEAAAACAAAUAgAAIgIAAC0CAAAwAgAANAIA" +
+ "AEECAABHAgAATAIAAFUCAABcAgAAAgAAAAMAAAAEAAAABQAAAAYAAAAHAAAACAAAAAkAAAAMAAAA" +
+ "DAAAAAgAAAAAAAAADQAAAAgAAABkAgAABwAEABAAAAAAAAAAAAAAAAAAAAASAAAABAABABEAAAAF" +
+ "AAAAAAAAAAAAAAAAAAAABQAAAAAAAAAKAAAA5AIAALgCAAAAAAAABjxpbml0PgAHR29vZGJ5ZQAX" +
+ "TGFydC9UZXN0OTMyJFRyYW5zZm9ybTsADUxhcnQvVGVzdDkzMjsAIkxkYWx2aWsvYW5ub3RhdGlv" +
+ "bi9FbmNsb3NpbmdDbGFzczsAHkxkYWx2aWsvYW5ub3RhdGlvbi9Jbm5lckNsYXNzOwAVTGphdmEv" +
+ "aW8vUHJpbnRTdHJlYW07ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwAS" +
+ "TGphdmEvbGFuZy9TeXN0ZW07AAxUZXN0OTMyLmphdmEACVRyYW5zZm9ybQABVgACVkwAC2FjY2Vz" +
+ "c0ZsYWdzAARuYW1lAANvdXQAB3ByaW50bG4ABXNheUhpAAV2YWx1ZQAAAQAAAAYAAAAFAAcOAAcA" +
+ "Bw4BCA8AAAAAAQABAAEAAABsAgAABAAAAHAQAwAAAA4AAwABAAIAAABxAgAACQAAAGIAAAAbAQEA" +
+ "AABuIAIAEAAOAAAAAAABAQCAgAT8BAEBlAUAAAICARMYAQIDAg4ECA8XCwACAAAAyAIAAM4CAADY" +
+ "AgAAAAAAAAAAAAAAAAAAEAAAAAAAAAABAAAAAAAAAAEAAAAUAAAAcAAAAAIAAAAJAAAAwAAAAAMA" +
+ "AAACAAAA5AAAAAQAAAABAAAA/AAAAAUAAAAEAAAABAEAAAYAAAABAAAAJAEAAAIgAAAUAAAARAEA" +
+ "AAEQAAABAAAAZAIAAAMgAAACAAAAbAIAAAEgAAACAAAAfAIAAAAgAAABAAAAuAIAAAQgAAACAAAA" +
+ "yAIAAAMQAAABAAAA2AIAAAYgAAABAAAA5AIAAAAQAAABAAAA9AIAAA==");
+
+ public static void run() {
+ Redefinition.setTestConfiguration(Redefinition.Config.COMMON_RETRANSFORM);
+ doTest(new Transform());
+ }
+
+ public static void doTest(Transform t) {
+ // TODO We currently need to do this transform call since we don't have any way to make the
+ // original-dex-file a single-class dex-file letting us restore it easily. We should use the
+ // manipulation library that is being made when we store the original dex file.
+ // TODO REMOVE this theoretically does nothing but it ensures the original-dex-file we have set
+ // is one we can return to unaltered.
+ Redefinition.doCommonClassRedefinition(Transform.class, CLASS_BYTES_A, DEX_BYTES_A);
+ t.sayHi();
+
+ // Now turn it into DEX_BYTES_B so it says 'Goodbye'
+ Redefinition.addCommonTransformationResult("art/Test932$Transform", CLASS_BYTES_B, DEX_BYTES_B);
+ Redefinition.enableCommonRetransformation(true);
+ Redefinition.doCommonClassRetransformation(Transform.class);
+ t.sayHi();
+
+ // Now turn it back to normal by removing the load-hook and transforming again.
+ Redefinition.enableCommonRetransformation(false);
+ Redefinition.doCommonClassRetransformation(Transform.class);
+ t.sayHi();
+ }
+}
diff --git a/test/934-load-transform/src/Main.java b/test/934-load-transform/src/Main.java
index 606ce78a5b..69c839fdb2 100644
--- a/test/934-load-transform/src/Main.java
+++ b/test/934-load-transform/src/Main.java
@@ -14,6 +14,10 @@
* limitations under the License.
*/
+import static art.Redefinition.addCommonTransformationResult;
+import static art.Redefinition.enableCommonRetransformation;
+import static art.Redefinition.setPopRetransformations;
+
import java.lang.reflect.*;
import java.util.Base64;
@@ -86,11 +90,4 @@ class Main {
e.printStackTrace();
}
}
-
- private static native void setPopRetransformations(boolean should_pop);
- // Transforms the class
- private static native void enableCommonRetransformation(boolean enable);
- private static native void addCommonTransformationResult(String target_name,
- byte[] class_bytes,
- byte[] dex_bytes);
}
diff --git a/test/934-load-transform/src/art/Redefinition.java b/test/934-load-transform/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/934-load-transform/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/935-non-retransformable/src/Main.java b/test/935-non-retransformable/src/Main.java
index df92561784..f240224977 100644
--- a/test/935-non-retransformable/src/Main.java
+++ b/test/935-non-retransformable/src/Main.java
@@ -17,6 +17,8 @@
import java.lang.reflect.*;
import java.util.Base64;
+import art.Redefinition;
+
class Main {
public static String TEST_NAME = "935-non-retransformable";
@@ -74,10 +76,9 @@ class Main {
}
public static void main(String[] args) {
- art.Main.bindAgentJNIForClass(Main.class);
- setPopRetransformations(false);
- addCommonTransformationResult("Transform", CLASS_BYTES, DEX_BYTES);
- enableCommonRetransformation(true);
+ Redefinition.setPopRetransformations(false);
+ Redefinition.addCommonTransformationResult("Transform", CLASS_BYTES, DEX_BYTES);
+ Redefinition.enableCommonRetransformation(true);
try {
/* this is the "alternate" DEX/Jar file */
ClassLoader new_loader = getClassLoaderFor(System.getenv("DEX_LOCATION"));
@@ -89,23 +90,14 @@ class Main {
run_test.invoke(null);
// Remove the original transformation. It has been used by now.
- popTransformationFor("Transform");
+ Redefinition.popTransformationFor("Transform");
// Make sure we don't get called for transformation again.
- addCommonTransformationResult("Transform", new byte[0], new byte[0]);
- doCommonClassRetransformation(new_loader.loadClass("Transform"));
+ Redefinition.addCommonTransformationResult("Transform", new byte[0], new byte[0]);
+ Redefinition.doCommonClassRetransformation(new_loader.loadClass("Transform"));
run_test.invoke(null);
} catch (Exception e) {
System.out.println(e.toString());
e.printStackTrace();
}
}
-
- // Transforms the class
- private static native void doCommonClassRetransformation(Class<?>... classes);
- private static native void enableCommonRetransformation(boolean enable);
- private static native void addCommonTransformationResult(String target_name,
- byte[] class_bytes,
- byte[] dex_bytes);
- private static native void setPopRetransformations(boolean should_pop);
- private static native void popTransformationFor(String target_name);
}
diff --git a/test/935-non-retransformable/src/art/Redefinition.java b/test/935-non-retransformable/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/935-non-retransformable/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/937-hello-retransform-package/src/Main.java b/test/937-hello-retransform-package/src/Main.java
index 866f75d5e6..eef56c2c34 100644
--- a/test/937-hello-retransform-package/src/Main.java
+++ b/test/937-hello-retransform-package/src/Main.java
@@ -17,6 +17,8 @@
import java.util.Base64;
import testing.*;
+import art.Redefinition;
+
public class Main {
/**
@@ -53,22 +55,14 @@ public class Main {
"YgEAAAMgAAACAAAAGwIAAAAgAAABAAAAJgIAAAAQAAABAAAANAIAAA==");
public static void main(String[] args) {
- art.Main.bindAgentJNIForClass(Main.class);
doTest(new Transform());
}
public static void doTest(Transform t) {
t.sayHi();
- addCommonTransformationResult("testing/Transform", CLASS_BYTES, DEX_BYTES);
- enableCommonRetransformation(true);
- doCommonClassRetransformation(Transform.class);
+ Redefinition.addCommonTransformationResult("testing/Transform", CLASS_BYTES, DEX_BYTES);
+ Redefinition.enableCommonRetransformation(true);
+ Redefinition.doCommonClassRetransformation(Transform.class);
t.sayHi();
}
-
- // Transforms the class
- private static native void doCommonClassRetransformation(Class<?>... target);
- private static native void enableCommonRetransformation(boolean enable);
- private static native void addCommonTransformationResult(String target_name,
- byte[] class_bytes,
- byte[] dex_bytes);
}
diff --git a/test/937-hello-retransform-package/src/art/Redefinition.java b/test/937-hello-retransform-package/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/937-hello-retransform-package/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/938-load-transform-bcp/src/Main.java b/test/938-load-transform-bcp/src/Main.java
index 21b841f06a..e560942729 100644
--- a/test/938-load-transform-bcp/src/Main.java
+++ b/test/938-load-transform-bcp/src/Main.java
@@ -14,6 +14,7 @@
* limitations under the License.
*/
+import static art.Redefinition.*;
import java.lang.reflect.*;
import java.util.Base64;
@@ -114,11 +115,4 @@ class Main {
e.printStackTrace();
}
}
-
- private static native void setPopRetransformations(boolean should_pop);
- // Transforms the class
- private static native void enableCommonRetransformation(boolean enable);
- private static native void addCommonTransformationResult(String target_name,
- byte[] class_bytes,
- byte[] dex_bytes);
}
diff --git a/test/938-load-transform-bcp/src/art/Redefinition.java b/test/938-load-transform-bcp/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/938-load-transform-bcp/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/939-hello-transformation-bcp/src/Main.java b/test/939-hello-transformation-bcp/src/Main.java
index 0e1f845ab9..7bda667357 100644
--- a/test/939-hello-transformation-bcp/src/Main.java
+++ b/test/939-hello-transformation-bcp/src/Main.java
@@ -14,6 +14,7 @@
* limitations under the License.
*/
+import static art.Redefinition.doCommonClassRedefinition;
import java.util.Base64;
import java.util.OptionalLong;
public class Main {
@@ -110,7 +111,6 @@ public class Main {
"AABHBgAABCAAAAIAAACVBgAAACAAAAEAAACtBgAAABAAAAEAAAD4BgAA");
public static void main(String[] args) {
- art.Main.bindAgentJNIForClass(Main.class);
// OptionalLong is a class that is unlikely to be used by the time this test starts and is not
// likely to be changed in any meaningful way in the future.
OptionalLong ol = OptionalLong.of(0xDEADBEEF);
@@ -119,9 +119,4 @@ public class Main {
doCommonClassRedefinition(OptionalLong.class, CLASS_BYTES, DEX_BYTES);
System.out.println("ol.toString() -> '" + ol.toString() + "'");
}
-
- // Transforms the class
- private static native void doCommonClassRedefinition(Class<?> target,
- byte[] class_file,
- byte[] dex_file);
}
diff --git a/test/939-hello-transformation-bcp/src/art/Redefinition.java b/test/939-hello-transformation-bcp/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/939-hello-transformation-bcp/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/940-recursive-obsolete/src/Main.java b/test/940-recursive-obsolete/src/Main.java
index 724f82de27..0b0211c2c3 100644
--- a/test/940-recursive-obsolete/src/Main.java
+++ b/test/940-recursive-obsolete/src/Main.java
@@ -1,5 +1,5 @@
/*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
@@ -14,77 +14,8 @@
* limitations under the License.
*/
-import java.util.Base64;
-
public class Main {
-
- // class Transform {
- // public void sayHi(int recur, Runnable r) {
- // System.out.println("Hello" + recur + " - transformed");
- // if (recur == 1) {
- // r.run();
- // sayHi(recur - 1, r);
- // } else if (recur != 0) {
- // sayHi(recur - 1, r);
- // }
- // System.out.println("Goodbye" + recur + " - transformed");
- // }
- // }
- private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
- "yv66vgAAADQANwoADwAZCQAaABsHABwKAAMAGQgAHQoAAwAeCgADAB8IACAKAAMAIQoAIgAjCwAk" +
- "ACUKAA4AJggAJwcAKAcAKQEABjxpbml0PgEAAygpVgEABENvZGUBAA9MaW5lTnVtYmVyVGFibGUB" +
- "AAVzYXlIaQEAGChJTGphdmEvbGFuZy9SdW5uYWJsZTspVgEADVN0YWNrTWFwVGFibGUBAApTb3Vy" +
- "Y2VGaWxlAQAOVHJhbnNmb3JtLmphdmEMABAAEQcAKgwAKwAsAQAXamF2YS9sYW5nL1N0cmluZ0J1" +
- "aWxkZXIBAAVIZWxsbwwALQAuDAAtAC8BAA4gLSB0cmFuc2Zvcm1lZAwAMAAxBwAyDAAzADQHADUM" +
- "ADYAEQwAFAAVAQAHR29vZGJ5ZQEACVRyYW5zZm9ybQEAEGphdmEvbGFuZy9PYmplY3QBABBqYXZh" +
- "L2xhbmcvU3lzdGVtAQADb3V0AQAVTGphdmEvaW8vUHJpbnRTdHJlYW07AQAGYXBwZW5kAQAtKExq" +
- "YXZhL2xhbmcvU3RyaW5nOylMamF2YS9sYW5nL1N0cmluZ0J1aWxkZXI7AQAcKEkpTGphdmEvbGFu" +
- "Zy9TdHJpbmdCdWlsZGVyOwEACHRvU3RyaW5nAQAUKClMamF2YS9sYW5nL1N0cmluZzsBABNqYXZh" +
- "L2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgEAEmphdmEv" +
- "bGFuZy9SdW5uYWJsZQEAA3J1bgAgAA4ADwAAAAAAAgAAABAAEQABABIAAAAdAAEAAQAAAAUqtwAB" +
- "sQAAAAEAEwAAAAYAAQAAAAEAAQAUABUAAQASAAAAnQADAAMAAABfsgACuwADWbcABBIFtgAGG7YA" +
- "BxIItgAGtgAJtgAKGwSgABQsuQALAQAqGwRkLLYADKcADxuZAAsqGwRkLLYADLIAArsAA1m3AAQS" +
- "DbYABhu2AAcSCLYABrYACbYACrEAAAACABMAAAAiAAgAAAADAB4ABAAjAAUAKQAGADQABwA4AAgA" +
- "QAAKAF4ACwAWAAAABAACNAsAAQAXAAAAAgAY");
- private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
- "ZGV4CjAzNQA3pkIgnymz2/eri+mp2dyZo3jolQmaRPKEBAAAcAAAAHhWNBIAAAAAAAAAAOQDAAAa" +
- "AAAAcAAAAAkAAADYAAAABgAAAPwAAAABAAAARAEAAAkAAABMAQAAAQAAAJQBAADQAgAAtAEAAJwC" +
- "AACsAgAAtAIAAL0CAADEAgAAxwIAAMoCAADOAgAA0gIAAN8CAAD2AgAACgMAACADAAA0AwAATwMA" +
- "AGMDAABzAwAAdgMAAHsDAAB/AwAAhwMAAJsDAACgAwAAqQMAAK4DAAC1AwAABAAAAAgAAAAJAAAA" +
- "CgAAAAsAAAAMAAAADQAAAA4AAAAQAAAABQAAAAUAAAAAAAAABgAAAAYAAACEAgAABwAAAAYAAACM" +
- "AgAAEAAAAAgAAAAAAAAAEQAAAAgAAACUAgAAEgAAAAgAAACMAgAABwACABUAAAABAAMAAQAAAAEA" +
- "BAAYAAAAAgAFABYAAAADAAMAAQAAAAQAAwAXAAAABgADAAEAAAAGAAEAEwAAAAYAAgATAAAABgAA" +
- "ABkAAAABAAAAAAAAAAMAAAAAAAAADwAAAAAAAADWAwAAAAAAAAEAAQABAAAAvwMAAAQAAABwEAMA" +
- "AAAOAAYAAwADAAAAxAMAAFQAAABiAAAAIgEGAHAQBQABABsCAwAAAG4gBwAhAAwBbiAGAEEADAEb" +
- "AgAAAABuIAcAIQAMAW4QCAABAAwBbiACABAAEhAzBCsAchAEAAUA2AAE/24wAQADBWIAAAAiAQYA" +
- "cBAFAAEAGwICAAAAbiAHACEADAFuIAYAQQAMARsCAAAAAG4gBwAhAAwBbhAIAAEADAFuIAIAEAAO" +
- "ADgE3//YAAT/bjABAAMFKNgBAAAAAAAAAAEAAAAFAAAAAgAAAAAABAAOIC0gdHJhbnNmb3JtZWQA" +
- "Bjxpbml0PgAHR29vZGJ5ZQAFSGVsbG8AAUkAAUwAAkxJAAJMTAALTFRyYW5zZm9ybTsAFUxqYXZh" +
- "L2lvL1ByaW50U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABRMamF2YS9sYW5nL1J1bm5hYmxl" +
- "OwASTGphdmEvbGFuZy9TdHJpbmc7ABlMamF2YS9sYW5nL1N0cmluZ0J1aWxkZXI7ABJMamF2YS9s" +
- "YW5nL1N5c3RlbTsADlRyYW5zZm9ybS5qYXZhAAFWAANWSUwAAlZMAAZhcHBlbmQAEmVtaXR0ZXI6" +
- "IGphY2stNC4yNAADb3V0AAdwcmludGxuAANydW4ABXNheUhpAAh0b1N0cmluZwABAAcOAAMCAAAH" +
- "DgEgDzw8XQEgDxktAAAAAQEAgIAEtAMBAcwDDQAAAAAAAAABAAAAAAAAAAEAAAAaAAAAcAAAAAIA" +
- "AAAJAAAA2AAAAAMAAAAGAAAA/AAAAAQAAAABAAAARAEAAAUAAAAJAAAATAEAAAYAAAABAAAAlAEA" +
- "AAEgAAACAAAAtAEAAAEQAAADAAAAhAIAAAIgAAAaAAAAnAIAAAMgAAACAAAAvwMAAAAgAAABAAAA" +
- "1gMAAAAQAAABAAAA5AMAAA==");
-
- public static void main(String[] args) {
- art.Main.bindAgentJNIForClass(Main.class);
- doTest(new Transform());
+ public static void main(String[] args) throws Exception {
+ art.Test940.run();
}
-
- public static void doTest(Transform t) {
- t.sayHi(2, () -> { System.out.println("Not doing anything here"); });
- t.sayHi(2, () -> {
- System.out.println("transforming calling function");
- doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
- });
- t.sayHi(2, () -> { System.out.println("Not doing anything here"); });
- }
-
- // Transforms the class
- private static native void doCommonClassRedefinition(Class<?> target,
- byte[] classfile,
- byte[] dexfile);
}
diff --git a/test/940-recursive-obsolete/src/Transform.java b/test/940-recursive-obsolete/src/Transform.java
deleted file mode 100644
index 97522cddf6..0000000000
--- a/test/940-recursive-obsolete/src/Transform.java
+++ /dev/null
@@ -1,28 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
- public void sayHi(int recur, Runnable r) {
- System.out.println("hello" + recur);
- if (recur == 1) {
- r.run();
- sayHi(recur - 1, r);
- } else if (recur != 0) {
- sayHi(recur - 1, r);
- }
- System.out.println("goodbye" + recur);
- }
-}
diff --git a/test/940-recursive-obsolete/src/art/Redefinition.java b/test/940-recursive-obsolete/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/940-recursive-obsolete/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/940-recursive-obsolete/src/art/Test940.java b/test/940-recursive-obsolete/src/art/Test940.java
new file mode 100644
index 0000000000..d67d7726da
--- /dev/null
+++ b/test/940-recursive-obsolete/src/art/Test940.java
@@ -0,0 +1,106 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.Base64;
+
+public class Test940 {
+
+ static class Transform {
+ public void sayHi(int recur, Runnable r) {
+ System.out.println("hello" + recur);
+ if (recur == 1) {
+ r.run();
+ sayHi(recur - 1, r);
+ } else if (recur != 0) {
+ sayHi(recur - 1, r);
+ }
+ System.out.println("goodbye" + recur);
+ }
+ }
+
+
+ // static class Transform {
+ // public void sayHi(int recur, Runnable r) {
+ // System.out.println("Hello" + recur + " - transformed");
+ // if (recur == 1) {
+ // r.run();
+ // sayHi(recur - 1, r);
+ // } else if (recur != 0) {
+ // sayHi(recur - 1, r);
+ // }
+ // System.out.println("Goodbye" + recur + " - transformed");
+ // }
+ // }
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAOwoADwAZCQAaABsHABwKAAMAGQgAHQoAAwAeCgADAB8IACAKAAMAIQoAIgAjCwAk" +
+ "ACUKAA4AJggAJwcAKQcALAEABjxpbml0PgEAAygpVgEABENvZGUBAA9MaW5lTnVtYmVyVGFibGUB" +
+ "AAVzYXlIaQEAGChJTGphdmEvbGFuZy9SdW5uYWJsZTspVgEADVN0YWNrTWFwVGFibGUBAApTb3Vy" +
+ "Y2VGaWxlAQAMVGVzdDk0MC5qYXZhDAAQABEHAC0MAC4ALwEAF2phdmEvbGFuZy9TdHJpbmdCdWls" +
+ "ZGVyAQAFSGVsbG8MADAAMQwAMAAyAQAOIC0gdHJhbnNmb3JtZWQMADMANAcANQwANgA3BwA4DAA5" +
+ "ABEMABQAFQEAB0dvb2RieWUHADoBABVhcnQvVGVzdDk0MCRUcmFuc2Zvcm0BAAlUcmFuc2Zvcm0B" +
+ "AAxJbm5lckNsYXNzZXMBABBqYXZhL2xhbmcvT2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291" +
+ "dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEABmFwcGVuZAEALShMamF2YS9sYW5nL1N0cmluZzsp" +
+ "TGphdmEvbGFuZy9TdHJpbmdCdWlsZGVyOwEAHChJKUxqYXZhL2xhbmcvU3RyaW5nQnVpbGRlcjsB" +
+ "AAh0b1N0cmluZwEAFCgpTGphdmEvbGFuZy9TdHJpbmc7AQATamF2YS9pby9QcmludFN0cmVhbQEA" +
+ "B3ByaW50bG4BABUoTGphdmEvbGFuZy9TdHJpbmc7KVYBABJqYXZhL2xhbmcvUnVubmFibGUBAANy" +
+ "dW4BAAthcnQvVGVzdDk0MAAgAA4ADwAAAAAAAgAAABAAEQABABIAAAAdAAEAAQAAAAUqtwABsQAA" +
+ "AAEAEwAAAAYAAQAAAAUAAQAUABUAAQASAAAAnQADAAMAAABfsgACuwADWbcABBIFtgAGG7YABxII" +
+ "tgAGtgAJtgAKGwSgABQsuQALAQAqGwRkLLYADKcADxuZAAsqGwRkLLYADLIAArsAA1m3AAQSDbYA" +
+ "Bhu2AAcSCLYABrYACbYACrEAAAACABMAAAAiAAgAAAAHAB4ACAAjAAkAKQAKADQACwA4AAwAQAAO" +
+ "AF4ADwAWAAAABAACNAsAAgAXAAAAAgAYACsAAAAKAAEADgAoACoACA==");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQDQv3jgAAAAAAAAAAAAAAAAAAAAAAAAAAB8BQAAcAAAAHhWNBIAAAAAAAAAALgEAAAg" +
+ "AAAAcAAAAAwAAADwAAAABgAAACABAAABAAAAaAEAAAkAAABwAQAAAQAAALgBAACkAwAA2AEAANgB" +
+ "AADoAQAA8AEAAPkBAAAAAgAAAwIAAAYCAAAKAgAADgIAACcCAAA2AgAAWgIAAHoCAACRAgAApQIA" +
+ "ALsCAADPAgAA6gIAAP4CAAAMAwAAFwMAABoDAAAfAwAAIwMAADADAAA4AwAAPgMAAEMDAABMAwAA" +
+ "UQMAAFgDAABiAwAABAAAAAgAAAAJAAAACgAAAAsAAAAMAAAADQAAAA4AAAAPAAAAEAAAABEAAAAU" +
+ "AAAABQAAAAgAAAAAAAAABgAAAAkAAAB8AwAABwAAAAkAAAB0AwAAFAAAAAsAAAAAAAAAFQAAAAsA" +
+ "AABsAwAAFgAAAAsAAAB0AwAACgAFABoAAAABAAMAAQAAAAEABAAdAAAABQAFABsAAAAGAAMAAQAA" +
+ "AAcAAwAcAAAACQADAAEAAAAJAAEAGAAAAAkAAgAYAAAACQAAAB4AAAABAAAAAAAAAAYAAAAAAAAA" +
+ "EgAAAKgEAAB8BAAAAAAAAA4gLSB0cmFuc2Zvcm1lZAAGPGluaXQ+AAdHb29kYnllAAVIZWxsbwAB" +
+ "SQABTAACTEkAAkxMABdMYXJ0L1Rlc3Q5NDAkVHJhbnNmb3JtOwANTGFydC9UZXN0OTQwOwAiTGRh" +
+ "bHZpay9hbm5vdGF0aW9uL0VuY2xvc2luZ0NsYXNzOwAeTGRhbHZpay9hbm5vdGF0aW9uL0lubmVy" +
+ "Q2xhc3M7ABVMamF2YS9pby9QcmludFN0cmVhbTsAEkxqYXZhL2xhbmcvT2JqZWN0OwAUTGphdmEv" +
+ "bGFuZy9SdW5uYWJsZTsAEkxqYXZhL2xhbmcvU3RyaW5nOwAZTGphdmEvbGFuZy9TdHJpbmdCdWls" +
+ "ZGVyOwASTGphdmEvbGFuZy9TeXN0ZW07AAxUZXN0OTQwLmphdmEACVRyYW5zZm9ybQABVgADVklM" +
+ "AAJWTAALYWNjZXNzRmxhZ3MABmFwcGVuZAAEbmFtZQADb3V0AAdwcmludGxuAANydW4ABXNheUhp" +
+ "AAh0b1N0cmluZwAFdmFsdWUAAAAAAgAAAAAABwABAAAACAAAAAEAAAAAAAAABQAHDgAHAgAABw4B" +
+ "IA8BAw8BAw8BBRIBIA8BAQoBAg8AAAAAAQABAAEAAACEAwAABAAAAHAQAwAAAA4ABgADAAMAAACJ" +
+ "AwAAVQAAAGIAAAAiAQkAcBAFAAEAGwIDAAAAbiAHACEADAFuIAYAQQAMARsCAAAAAG4gBwAhAAwB" +
+ "bhAIAAEADAFuIAIAEAASEDMEKwByEAQABQDYAAT/bjABAAMFYgAAACIBCQBwEAUAAQAbAgIAAABu" +
+ "IAcAIQAMAW4gBgBBAAwBGwIAAAAAbiAHACEADAFuEAgAAQAMAW4gAgAQAA4AOATf/9gABP9uMAEA" +
+ "AwUpANj/AAAAAAEBAICABKgHAQHABwAAAgMBHxgCAgQCFwQIGRcTAAIAAACMBAAAkgQAAJwEAAAA" +
+ "AAAAAAAAAAAAAAAQAAAAAAAAAAEAAAAAAAAAAQAAACAAAABwAAAAAgAAAAwAAADwAAAAAwAAAAYA" +
+ "AAAgAQAABAAAAAEAAABoAQAABQAAAAkAAABwAQAABgAAAAEAAAC4AQAAAiAAACAAAADYAQAAARAA" +
+ "AAMAAABsAwAAAyAAAAIAAACEAwAAASAAAAIAAACoAwAAACAAAAEAAAB8BAAABCAAAAIAAACMBAAA" +
+ "AxAAAAEAAACcBAAABiAAAAEAAACoBAAAABAAAAEAAAC4BAAA");
+
+ public static void run() {
+ Redefinition.setTestConfiguration(Redefinition.Config.COMMON_REDEFINE);
+ doTest(new Transform());
+ }
+
+ public static void doTest(Transform t) {
+ t.sayHi(2, () -> { System.out.println("Not doing anything here"); });
+ t.sayHi(2, () -> {
+ System.out.println("transforming calling function");
+ Redefinition.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+ });
+ t.sayHi(2, () -> { System.out.println("Not doing anything here"); });
+ }
+}
diff --git a/test/941-recurive-obsolete-jit/src/Main.java b/test/941-recurive-obsolete-jit/src/Main.java
index d88bb9b722..1c391a4db5 100644
--- a/test/941-recurive-obsolete-jit/src/Main.java
+++ b/test/941-recurive-obsolete-jit/src/Main.java
@@ -14,6 +14,8 @@
* limitations under the License.
*/
+import static art.Redefinition.doCommonClassRedefinition;
+
import java.util.Base64;
import java.util.function.Consumer;
import java.lang.reflect.Method;
@@ -148,9 +150,4 @@ public class Main {
private static native boolean isInterpretedFunction(Method m, boolean require_deoptimizable);
private static native void ensureJitCompiled(Class c, String name);
-
- // Transforms the class
- private static native void doCommonClassRedefinition(Class<?> target,
- byte[] classfile,
- byte[] dexfile);
}
diff --git a/test/941-recurive-obsolete-jit/src/art/Redefinition.java b/test/941-recurive-obsolete-jit/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/941-recurive-obsolete-jit/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/942-private-recursive/src/Main.java b/test/942-private-recursive/src/Main.java
index cac75c02f8..8a1f7c6e04 100644
--- a/test/942-private-recursive/src/Main.java
+++ b/test/942-private-recursive/src/Main.java
@@ -1,5 +1,5 @@
/*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
@@ -14,82 +14,8 @@
* limitations under the License.
*/
-import java.util.Base64;
-
public class Main {
-
- // class Transform {
- // public void sayHi(int recur, Runnable r) {
- // privateSayHi(recur, r);
- // }
- // private void privateSayHi(int recur, Runnable r) {
- // System.out.println("Hello" + recur + " - transformed");
- // if (recur == 1) {
- // r.run();
- // privateSayHi(recur - 1, r);
- // } else if (recur != 0) {
- // privateSayHi(recur - 1, r);
- // }
- // System.out.println("Goodbye" + recur + " - transformed");
- // }
- // }
- private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
- "yv66vgAAADQAOAoADwAaCgAOABsJABwAHQcAHgoABAAaCAAfCgAEACAKAAQAIQgAIgoABAAjCgAk" +
- "ACULACYAJwgAKAcAKQcAKgEABjxpbml0PgEAAygpVgEABENvZGUBAA9MaW5lTnVtYmVyVGFibGUB" +
- "AAVzYXlIaQEAGChJTGphdmEvbGFuZy9SdW5uYWJsZTspVgEADHByaXZhdGVTYXlIaQEADVN0YWNr" +
- "TWFwVGFibGUBAApTb3VyY2VGaWxlAQAOVHJhbnNmb3JtLmphdmEMABAAEQwAFgAVBwArDAAsAC0B" +
- "ABdqYXZhL2xhbmcvU3RyaW5nQnVpbGRlcgEABUhlbGxvDAAuAC8MAC4AMAEADiAtIHRyYW5zZm9y" +
- "bWVkDAAxADIHADMMADQANQcANgwANwARAQAHR29vZGJ5ZQEACVRyYW5zZm9ybQEAEGphdmEvbGFu" +
- "Zy9PYmplY3QBABBqYXZhL2xhbmcvU3lzdGVtAQADb3V0AQAVTGphdmEvaW8vUHJpbnRTdHJlYW07" +
- "AQAGYXBwZW5kAQAtKExqYXZhL2xhbmcvU3RyaW5nOylMamF2YS9sYW5nL1N0cmluZ0J1aWxkZXI7" +
- "AQAcKEkpTGphdmEvbGFuZy9TdHJpbmdCdWlsZGVyOwEACHRvU3RyaW5nAQAUKClMamF2YS9sYW5n" +
- "L1N0cmluZzsBABNqYXZhL2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0" +
- "cmluZzspVgEAEmphdmEvbGFuZy9SdW5uYWJsZQEAA3J1bgAgAA4ADwAAAAAAAwAAABAAEQABABIA" +
- "AAAdAAEAAQAAAAUqtwABsQAAAAEAEwAAAAYAAQAAAAEAAQAUABUAAQASAAAAIwADAAMAAAAHKhss" +
- "twACsQAAAAEAEwAAAAoAAgAAAAMABgAEAAIAFgAVAAEAEgAAAJ0AAwADAAAAX7IAA7sABFm3AAUS" +
- "BrYABxu2AAgSCbYAB7YACrYACxsEoAAULLkADAEAKhsEZCy3AAKnAA8bmQALKhsEZCy3AAKyAAO7" +
- "AARZtwAFEg22AAcbtgAIEgm2AAe2AAq2AAuxAAAAAgATAAAAIgAIAAAABgAeAAcAIwAIACkACQA0" +
- "AAoAOAALAEAADQBeAA4AFwAAAAQAAjQLAAEAGAAAAAIAGQ==");
- private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
- "ZGV4CjAzNQBQqwVIiZvIuS8j1HDurKbXZEV62Mnug5PEBAAAcAAAAHhWNBIAAAAAAAAAACQEAAAb" +
- "AAAAcAAAAAkAAADcAAAABgAAAAABAAABAAAASAEAAAoAAABQAQAAAQAAAKABAAAEAwAAwAEAAMAC" +
- "AADQAgAA2AIAAOECAADoAgAA6wIAAO4CAADyAgAA9gIAAAMDAAAaAwAALgMAAEQDAABYAwAAcwMA" +
- "AIcDAACXAwAAmgMAAJ8DAACjAwAAqwMAAL8DAADEAwAAzQMAANsDAADgAwAA5wMAAAQAAAAIAAAA" +
- "CQAAAAoAAAALAAAADAAAAA0AAAAOAAAAEAAAAAUAAAAFAAAAAAAAAAYAAAAGAAAAqAIAAAcAAAAG" +
- "AAAAsAIAABAAAAAIAAAAAAAAABEAAAAIAAAAuAIAABIAAAAIAAAAsAIAAAcAAgAVAAAAAQADAAEA" +
- "AAABAAQAFwAAAAEABAAZAAAAAgAFABYAAAADAAMAAQAAAAQAAwAYAAAABgADAAEAAAAGAAEAEwAA" +
- "AAYAAgATAAAABgAAABoAAAABAAAAAAAAAAMAAAAAAAAADwAAAAAAAAAQBAAAAAAAAAEAAQABAAAA" +
- "8QMAAAQAAABwEAQAAAAOAAYAAwADAAAA9gMAAFQAAABiAAAAIgEGAHAQBgABABsCAwAAAG4gCAAh" +
- "AAwBbiAHAEEADAEbAgAAAABuIAgAIQAMAW4QCQABAAwBbiADABAAEhAzBCsAchAFAAUA2AAE/3Aw" +
- "AQADBWIAAAAiAQYAcBAGAAEAGwICAAAAbiAIACEADAFuIAcAQQAMARsCAAAAAG4gCAAhAAwBbhAJ" +
- "AAEADAFuIAMAEAAOADgE3//YAAT/cDABAAMFKNgDAAMAAwAAAAgEAAAEAAAAcDABABACDgABAAAA" +
- "AAAAAAEAAAAFAAAAAgAAAAAABAAOIC0gdHJhbnNmb3JtZWQABjxpbml0PgAHR29vZGJ5ZQAFSGVs" +
- "bG8AAUkAAUwAAkxJAAJMTAALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwASTGph" +
- "dmEvbGFuZy9PYmplY3Q7ABRMamF2YS9sYW5nL1J1bm5hYmxlOwASTGphdmEvbGFuZy9TdHJpbmc7" +
- "ABlMamF2YS9sYW5nL1N0cmluZ0J1aWxkZXI7ABJMamF2YS9sYW5nL1N5c3RlbTsADlRyYW5zZm9y" +
- "bS5qYXZhAAFWAANWSUwAAlZMAAZhcHBlbmQAEmVtaXR0ZXI6IGphY2stNC4yNAADb3V0AAdwcmlu" +
- "dGxuAAxwcml2YXRlU2F5SGkAA3J1bgAFc2F5SGkACHRvU3RyaW5nAAEABw4ABgIAAAcOASAPPDxd" +
- "ASAPGS0AAwIAAAcOPAAAAAIBAICABMADAQLYAwIBkAUAAA0AAAAAAAAAAQAAAAAAAAABAAAAGwAA" +
- "AHAAAAACAAAACQAAANwAAAADAAAABgAAAAABAAAEAAAAAQAAAEgBAAAFAAAACgAAAFABAAAGAAAA" +
- "AQAAAKABAAABIAAAAwAAAMABAAABEAAAAwAAAKgCAAACIAAAGwAAAMACAAADIAAAAwAAAPEDAAAA" +
- "IAAAAQAAABAEAAAAEAAAAQAAACQEAAA=");
-
- public static void main(String[] args) {
- art.Main.bindAgentJNIForClass(Main.class);
- doTest(new Transform());
+ public static void main(String[] args) throws Exception {
+ art.Test942.run();
}
-
- public static void doTest(Transform t) {
- t.sayHi(2, () -> { System.out.println("Not doing anything here"); });
- t.sayHi(2, () -> {
- System.out.println("transforming calling function");
- doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
- });
- t.sayHi(2, () -> { System.out.println("Not doing anything here"); });
- }
-
- // Transforms the class
- private static native void doCommonClassRedefinition(Class<?> target,
- byte[] classfile,
- byte[] dexfile);
}
diff --git a/test/942-private-recursive/src/art/Redefinition.java b/test/942-private-recursive/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/942-private-recursive/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/942-private-recursive/src/art/Test942.java b/test/942-private-recursive/src/art/Test942.java
new file mode 100644
index 0000000000..cccc2fd9e0
--- /dev/null
+++ b/test/942-private-recursive/src/art/Test942.java
@@ -0,0 +1,115 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.Base64;
+
+public class Test942 {
+
+ static class Transform {
+ private void privateSayHi(int recur, Runnable r) {
+ System.out.println("hello" + recur);
+ if (recur == 1) {
+ r.run();
+ privateSayHi(recur - 1, r);
+ } else if (recur != 0) {
+ privateSayHi(recur - 1, r);
+ }
+ System.out.println("goodbye" + recur);
+ }
+
+ public void sayHi(int recur, Runnable r) {
+ privateSayHi(recur, r);
+ }
+ }
+
+
+ // static class Transform {
+ // public void sayHi(int recur, Runnable r) {
+ // privateSayHi(recur, r);
+ // }
+ // private void privateSayHi(int recur, Runnable r) {
+ // System.out.println("Hello" + recur + " - transformed");
+ // if (recur == 1) {
+ // r.run();
+ // privateSayHi(recur - 1, r);
+ // } else if (recur != 0) {
+ // privateSayHi(recur - 1, r);
+ // }
+ // System.out.println("Goodbye" + recur + " - transformed");
+ // }
+ // }
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAPAoADwAaCgAOABsJABwAHQcAHgoABAAaCAAfCgAEACAKAAQAIQgAIgoABAAjCgAk" +
+ "ACULACYAJwgAKAcAKgcALQEABjxpbml0PgEAAygpVgEABENvZGUBAA9MaW5lTnVtYmVyVGFibGUB" +
+ "AAVzYXlIaQEAGChJTGphdmEvbGFuZy9SdW5uYWJsZTspVgEADHByaXZhdGVTYXlIaQEADVN0YWNr" +
+ "TWFwVGFibGUBAApTb3VyY2VGaWxlAQAMVGVzdDk0Mi5qYXZhDAAQABEMABYAFQcALgwALwAwAQAX" +
+ "amF2YS9sYW5nL1N0cmluZ0J1aWxkZXIBAAVIZWxsbwwAMQAyDAAxADMBAA4gLSB0cmFuc2Zvcm1l" +
+ "ZAwANAA1BwA2DAA3ADgHADkMADoAEQEAB0dvb2RieWUHADsBABVhcnQvVGVzdDk0MiRUcmFuc2Zv" +
+ "cm0BAAlUcmFuc2Zvcm0BAAxJbm5lckNsYXNzZXMBABBqYXZhL2xhbmcvT2JqZWN0AQAQamF2YS9s" +
+ "YW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEABmFwcGVuZAEALShMamF2" +
+ "YS9sYW5nL1N0cmluZzspTGphdmEvbGFuZy9TdHJpbmdCdWlsZGVyOwEAHChJKUxqYXZhL2xhbmcv" +
+ "U3RyaW5nQnVpbGRlcjsBAAh0b1N0cmluZwEAFCgpTGphdmEvbGFuZy9TdHJpbmc7AQATamF2YS9p" +
+ "by9QcmludFN0cmVhbQEAB3ByaW50bG4BABUoTGphdmEvbGFuZy9TdHJpbmc7KVYBABJqYXZhL2xh" +
+ "bmcvUnVubmFibGUBAANydW4BAAthcnQvVGVzdDk0MgAgAA4ADwAAAAAAAwAAABAAEQABABIAAAAd" +
+ "AAEAAQAAAAUqtwABsQAAAAEAEwAAAAYAAQAAAAUAAQAUABUAAQASAAAAIwADAAMAAAAHKhsstwAC" +
+ "sQAAAAEAEwAAAAoAAgAAAAcABgAIAAIAFgAVAAEAEgAAAJ0AAwADAAAAX7IAA7sABFm3AAUSBrYA" +
+ "Bxu2AAgSCbYAB7YACrYACxsEoAAULLkADAEAKhsEZCy3AAKnAA8bmQALKhsEZCy3AAKyAAO7AARZ" +
+ "twAFEg22AAcbtgAIEgm2AAe2AAq2AAuxAAAAAgATAAAAIgAIAAAACgAeAAsAIwAMACkADQA0AA4A" +
+ "OAAPAEAAEQBeABIAFwAAAAQAAjQLAAIAGAAAAAIAGQAsAAAACgABAA4AKQArAAg=");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQDiy6hGAAAAAAAAAAAAAAAAAAAAAAAAAAC4BQAAcAAAAHhWNBIAAAAAAAAAAPQEAAAh" +
+ "AAAAcAAAAAwAAAD0AAAABgAAACQBAAABAAAAbAEAAAoAAAB0AQAAAQAAAMQBAADUAwAA5AEAAOQB" +
+ "AAD0AQAA/AEAAAUCAAAMAgAADwIAABICAAAWAgAAGgIAADMCAABCAgAAZgIAAIYCAACdAgAAsQIA" +
+ "AMcCAADbAgAA9gIAAAoDAAAYAwAAIwMAACYDAAArAwAALwMAADwDAABEAwAASgMAAE8DAABYAwAA" +
+ "ZgMAAGsDAAByAwAAfAMAAAQAAAAIAAAACQAAAAoAAAALAAAADAAAAA0AAAAOAAAADwAAABAAAAAR" +
+ "AAAAFAAAAAUAAAAIAAAAAAAAAAYAAAAJAAAAlAMAAAcAAAAJAAAAjAMAABQAAAALAAAAAAAAABUA" +
+ "AAALAAAAhAMAABYAAAALAAAAjAMAAAoABQAaAAAAAQADAAEAAAABAAQAHAAAAAEABAAeAAAABQAF" +
+ "ABsAAAAGAAMAAQAAAAcAAwAdAAAACQADAAEAAAAJAAEAGAAAAAkAAgAYAAAACQAAAB8AAAABAAAA" +
+ "AAAAAAYAAAAAAAAAEgAAAOQEAAC0BAAAAAAAAA4gLSB0cmFuc2Zvcm1lZAAGPGluaXQ+AAdHb29k" +
+ "YnllAAVIZWxsbwABSQABTAACTEkAAkxMABdMYXJ0L1Rlc3Q5NDIkVHJhbnNmb3JtOwANTGFydC9U" +
+ "ZXN0OTQyOwAiTGRhbHZpay9hbm5vdGF0aW9uL0VuY2xvc2luZ0NsYXNzOwAeTGRhbHZpay9hbm5v" +
+ "dGF0aW9uL0lubmVyQ2xhc3M7ABVMamF2YS9pby9QcmludFN0cmVhbTsAEkxqYXZhL2xhbmcvT2Jq" +
+ "ZWN0OwAUTGphdmEvbGFuZy9SdW5uYWJsZTsAEkxqYXZhL2xhbmcvU3RyaW5nOwAZTGphdmEvbGFu" +
+ "Zy9TdHJpbmdCdWlsZGVyOwASTGphdmEvbGFuZy9TeXN0ZW07AAxUZXN0OTQyLmphdmEACVRyYW5z" +
+ "Zm9ybQABVgADVklMAAJWTAALYWNjZXNzRmxhZ3MABmFwcGVuZAAEbmFtZQADb3V0AAdwcmludGxu" +
+ "AAxwcml2YXRlU2F5SGkAA3J1bgAFc2F5SGkACHRvU3RyaW5nAAV2YWx1ZQAAAgAAAAAABwABAAAA" +
+ "CAAAAAEAAAAAAAAABQAHDgAKAgAABw4BIA8BAw8BAw8BBRIBIA8BAQoBAg8ABwIAAAcOAQMPAAAB" +
+ "AAEAAQAAAJwDAAAEAAAAcBAEAAAADgAGAAMAAwAAAKEDAABVAAAAYgAAACIBCQBwEAYAAQAbAgMA" +
+ "AABuIAgAIQAMAW4gBwBBAAwBGwIAAAAAbiAIACEADAFuEAkAAQAMAW4gAwAQABIQMwQrAHIQBQAF" +
+ "ANgABP9wMAEAAwViAAAAIgEJAHAQBgABABsCAgAAAG4gCAAhAAwBbiAHAEEADAEbAgAAAABuIAgA" +
+ "IQAMAW4QCQABAAwBbiADABAADgA4BN//2AAE/3AwAQADBSkA2P8AAAMAAwADAAAAvQMAAAQAAABw" +
+ "MAEAEAIOAAAAAgEAgIAEyAcBAuAHAgGcCQAAAgMBIBgCAgQCFwQIGRcTAAIAAADIBAAAzgQAANgE" +
+ "AAAAAAAAAAAAAAAAAAAQAAAAAAAAAAEAAAAAAAAAAQAAACEAAABwAAAAAgAAAAwAAAD0AAAAAwAA" +
+ "AAYAAAAkAQAABAAAAAEAAABsAQAABQAAAAoAAAB0AQAABgAAAAEAAADEAQAAAiAAACEAAADkAQAA" +
+ "ARAAAAMAAACEAwAAAyAAAAMAAACcAwAAASAAAAMAAADIAwAAACAAAAEAAAC0BAAABCAAAAIAAADI" +
+ "BAAAAxAAAAEAAADYBAAABiAAAAEAAADkBAAAABAAAAEAAAD0BAAA");
+
+ public static void run() {
+ Redefinition.setTestConfiguration(Redefinition.Config.COMMON_REDEFINE);
+ doTest(new Transform());
+ }
+
+ public static void doTest(Transform t) {
+ t.sayHi(2, () -> { System.out.println("Not doing anything here"); });
+ t.sayHi(2, () -> {
+ System.out.println("transforming calling function");
+ Redefinition.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+ });
+ t.sayHi(2, () -> { System.out.println("Not doing anything here"); });
+ }
+}
diff --git a/test/943-private-recursive-jit/src/Main.java b/test/943-private-recursive-jit/src/Main.java
index f380c062d1..01760ad0c1 100644
--- a/test/943-private-recursive-jit/src/Main.java
+++ b/test/943-private-recursive-jit/src/Main.java
@@ -14,6 +14,8 @@
* limitations under the License.
*/
+import static art.Redefinition.doCommonClassRedefinition;
+
import java.util.Base64;
import java.util.function.Consumer;
import java.lang.reflect.Method;
@@ -164,9 +166,4 @@ public class Main {
private static native boolean isInterpretedFunction(Method m, boolean require_deoptimizable);
private static native void ensureJitCompiled(Class c, String name);
-
- // Transforms the class
- private static native void doCommonClassRedefinition(Class<?> target,
- byte[] classfile,
- byte[] dexfile);
}
diff --git a/test/943-private-recursive-jit/src/art/Redefinition.java b/test/943-private-recursive-jit/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/943-private-recursive-jit/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/944-transform-classloaders/classloader.cc b/test/944-transform-classloaders/classloader.cc
deleted file mode 100644
index 698e023771..0000000000
--- a/test/944-transform-classloaders/classloader.cc
+++ /dev/null
@@ -1,43 +0,0 @@
-/*
- * Copyright (C) 2017 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-#include "android-base/macros.h"
-#include "jni.h"
-#include "jvmti.h"
-#include "mirror/class-inl.h"
-#include "scoped_local_ref.h"
-
-// Test infrastructure
-#include "test_env.h"
-
-namespace art {
-namespace Test944TransformClassloaders {
-
-extern "C" JNIEXPORT jlong JNICALL Java_Main_getDexFilePointer(JNIEnv* env, jclass, jclass klass) {
- if (Runtime::Current() == nullptr) {
- env->ThrowNew(env->FindClass("java/lang/Exception"),
- "We do not seem to be running in ART! Unable to get dex file.");
- return 0;
- }
- ScopedObjectAccess soa(env);
- // This sequence of casts must be the same as those done in
- // runtime/native/dalvik_system_DexFile.cc in order to ensure that we get the same results.
- return static_cast<jlong>(reinterpret_cast<uintptr_t>(
- &soa.Decode<mirror::Class>(klass)->GetDexFile()));
-}
-
-} // namespace Test944TransformClassloaders
-} // namespace art
diff --git a/test/944-transform-classloaders/src/CommonClassDefinition.java b/test/944-transform-classloaders/src/CommonClassDefinition.java
deleted file mode 100644
index 62602a02e9..0000000000
--- a/test/944-transform-classloaders/src/CommonClassDefinition.java
+++ /dev/null
@@ -1,27 +0,0 @@
-/*
- * Copyright (C) 2017 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class CommonClassDefinition {
- public final Class<?> target;
- public final byte[] class_file_bytes;
- public final byte[] dex_file_bytes;
-
- CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
- this.target = target;
- this.class_file_bytes = class_file_bytes;
- this.dex_file_bytes = dex_file_bytes;
- }
-}
diff --git a/test/944-transform-classloaders/src/Main.java b/test/944-transform-classloaders/src/Main.java
index b558660cfd..3d76d237ea 100644
--- a/test/944-transform-classloaders/src/Main.java
+++ b/test/944-transform-classloaders/src/Main.java
@@ -14,254 +14,8 @@
* limitations under the License.
*/
-import java.util.Arrays;
-import java.util.ArrayList;
-import java.util.Base64;
-import java.lang.reflect.*;
public class Main {
-
- /**
- * base64 encoded class/dex file for
- * class Transform {
- * public void sayHi() {
- * System.out.println("Goodbye");
- * }
- * }
- */
- private static CommonClassDefinition TRANSFORM_DEFINITION = new CommonClassDefinition(
- Transform.class,
- Base64.getDecoder().decode(
- "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
- "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
- "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
- "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
- "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" +
- "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
- "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0="),
- Base64.getDecoder().decode(
- "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
- "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
- "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
- "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
- "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
- "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
- "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
- "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
- "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
- "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
- "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
- "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
- "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA="));
-
- /**
- * base64 encoded class/dex file for
- * class Transform2 {
- * public void sayHi() {
- * System.out.println("Goodbye2");
- * }
- * }
- */
- private static CommonClassDefinition TRANSFORM2_DEFINITION = new CommonClassDefinition(
- Transform2.class,
- Base64.getDecoder().decode(
- "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
- "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA9UcmFuc2Zvcm0yLmphdmEM" +
- "AAcACAcAFgwAFwAYAQAIR29vZGJ5ZTIHABkMABoAGwEAClRyYW5zZm9ybTIBABBqYXZhL2xhbmcv" +
- "T2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEA" +
- "E2phdmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAA" +
- "BQAGAAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAAQABAAsA" +
- "CAABAAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAADAAgABAABAAwAAAACAA0="),
- Base64.getDecoder().decode(
- "ZGV4CjAzNQABX6vL8OT7aGLjbzFBEfCM9Aaz+zzGzVnQAgAAcAAAAHhWNBIAAAAAAAAAADACAAAO" +
- "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACwAQAAIAEAAGIB" +
- "AABqAQAAdAEAAIIBAACZAQAArQEAAMEBAADVAQAA5gEAAOkBAADtAQAAAQIAAAYCAAAPAgAAAgAA" +
- "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
- "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAACECAAAA" +
- "AAAAAQABAAEAAAAWAgAABAAAAHAQAwAAAA4AAwABAAIAAAAbAgAACQAAAGIAAAAbAQEAAABuIAIA" +
- "EAAOAAAAAQAAAAMABjxpbml0PgAIR29vZGJ5ZTIADExUcmFuc2Zvcm0yOwAVTGphdmEvaW8vUHJp" +
- "bnRTdHJlYW07ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwASTGphdmEv" +
- "bGFuZy9TeXN0ZW07AA9UcmFuc2Zvcm0yLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTQuMjQA" +
- "A291dAAHcHJpbnRsbgAFc2F5SGkAAQAHDgADAAcOhwAAAAEBAICABKACAQG4AgANAAAAAAAAAAEA" +
- "AAAAAAAAAQAAAA4AAABwAAAAAgAAAAYAAACoAAAAAwAAAAIAAADAAAAABAAAAAEAAADYAAAABQAA" +
- "AAQAAADgAAAABgAAAAEAAAAAAQAAASAAAAIAAAAgAQAAARAAAAEAAABcAQAAAiAAAA4AAABiAQAA" +
- "AyAAAAIAAAAWAgAAACAAAAEAAAAhAgAAABAAAAEAAAAwAgAA"));
-
public static void main(String[] args) throws Exception {
- doTest();
- System.out.println("Passed");
- }
-
- private static void checkIsInstance(Class<?> klass, Object o) throws Exception {
- if (!klass.isInstance(o)) {
- throw new Exception(klass + " is not the class of " + o);
- }
- }
-
- private static boolean arrayContains(long[] arr, long value) {
- if (arr == null) {
- return false;
- }
- for (int i = 0; i < arr.length; i++) {
- if (arr[i] == value) {
- return true;
- }
- }
- return false;
+ art.Test944.run();
}
-
- /**
- * Checks that we can find the dex-file for the given class in its classloader.
- *
- * Throws if it fails.
- */
- private static void checkDexFileInClassLoader(Class<?> klass) throws Exception {
- // If all the android BCP classes were availible when compiling this test and access checks
- // weren't a thing this function would be written as follows:
- //
- // long dexFilePtr = getDexFilePointer(klass);
- // dalvik.system.BaseDexClassLoader loader =
- // (dalvik.system.BaseDexClassLoader)klass.getClassLoader();
- // dalvik.system.DexPathList pathListValue = loader.pathList;
- // dalvik.system.DexPathList.Element[] elementArrayValue = pathListValue.dexElements;
- // int array_length = elementArrayValue.length;
- // for (int i = 0; i < array_length; i++) {
- // dalvik.system.DexPathList.Element curElement = elementArrayValue[i];
- // dalvik.system.DexFile curDexFile = curElement.dexFile;
- // if (curDexFile == null) {
- // continue;
- // }
- // long[] curCookie = (long[])curDexFile.mCookie;
- // long[] curInternalCookie = (long[])curDexFile.mInternalCookie;
- // if (arrayContains(curCookie, dexFilePtr) || arrayContains(curInternalCookie, dexFilePtr)) {
- // return;
- // }
- // }
- // throw new Exception(
- // "Unable to find dex file pointer " + dexFilePtr + " in class loader for " + klass);
-
- // Get all the fields and classes we need by reflection.
- Class<?> baseDexClassLoaderClass = Class.forName("dalvik.system.BaseDexClassLoader");
- Field pathListField = baseDexClassLoaderClass.getDeclaredField("pathList");
-
- Class<?> dexPathListClass = Class.forName("dalvik.system.DexPathList");
- Field elementArrayField = dexPathListClass.getDeclaredField("dexElements");
-
- Class<?> dexPathListElementClass = Class.forName("dalvik.system.DexPathList$Element");
- Field dexFileField = dexPathListElementClass.getDeclaredField("dexFile");
-
- Class<?> dexFileClass = Class.forName("dalvik.system.DexFile");
- Field dexFileCookieField = dexFileClass.getDeclaredField("mCookie");
- Field dexFileInternalCookieField = dexFileClass.getDeclaredField("mInternalCookie");
-
- // Make all the fields accessible
- AccessibleObject.setAccessible(new AccessibleObject[] { pathListField,
- elementArrayField,
- dexFileField,
- dexFileCookieField,
- dexFileInternalCookieField }, true);
-
- long dexFilePtr = getDexFilePointer(klass);
-
- ClassLoader loader = klass.getClassLoader();
- checkIsInstance(baseDexClassLoaderClass, loader);
- // DexPathList pathListValue = ((BaseDexClassLoader) loader).pathList;
- Object pathListValue = pathListField.get(loader);
-
- checkIsInstance(dexPathListClass, pathListValue);
-
- // DexPathList.Element[] elementArrayValue = pathListValue.dexElements;
- Object elementArrayValue = elementArrayField.get(pathListValue);
- if (!elementArrayValue.getClass().isArray() ||
- elementArrayValue.getClass().getComponentType() != dexPathListElementClass) {
- throw new Exception("elementArrayValue is not an " + dexPathListElementClass + " array!");
- }
- // int array_length = elementArrayValue.length;
- int array_length = Array.getLength(elementArrayValue);
- for (int i = 0; i < array_length; i++) {
- // DexPathList.Element curElement = elementArrayValue[i];
- Object curElement = Array.get(elementArrayValue, i);
- checkIsInstance(dexPathListElementClass, curElement);
-
- // DexFile curDexFile = curElement.dexFile;
- Object curDexFile = dexFileField.get(curElement);
- if (curDexFile == null) {
- continue;
- }
- checkIsInstance(dexFileClass, curDexFile);
-
- // long[] curCookie = (long[])curDexFile.mCookie;
- long[] curCookie = (long[])dexFileCookieField.get(curDexFile);
- // long[] curInternalCookie = (long[])curDexFile.mInternalCookie;
- long[] curInternalCookie = (long[])dexFileInternalCookieField.get(curDexFile);
-
- if (arrayContains(curCookie, dexFilePtr) || arrayContains(curInternalCookie, dexFilePtr)) {
- return;
- }
- }
- throw new Exception(
- "Unable to find dex file pointer " + dexFilePtr + " in class loader for " + klass);
- }
-
- private static void doTest() throws Exception {
- art.Main.bindAgentJNIForClass(Main.class);
-
- Transform t = new Transform();
- Transform2 t2 = new Transform2();
-
- long initial_t1_dex = getDexFilePointer(Transform.class);
- long initial_t2_dex = getDexFilePointer(Transform2.class);
- if (initial_t2_dex != initial_t1_dex) {
- throw new Exception("The classes " + Transform.class + " and " + Transform2.class + " " +
- "have different initial dex files!");
- }
- checkDexFileInClassLoader(Transform.class);
- checkDexFileInClassLoader(Transform2.class);
-
- // Make sure they are loaded
- t.sayHi();
- t2.sayHi();
- // Redefine both of the classes.
- doMultiClassRedefinition(TRANSFORM_DEFINITION, TRANSFORM2_DEFINITION);
- // Make sure we actually transformed them!
- t.sayHi();
- t2.sayHi();
-
- long final_t1_dex = getDexFilePointer(Transform.class);
- long final_t2_dex = getDexFilePointer(Transform2.class);
- if (final_t2_dex == final_t1_dex) {
- throw new Exception("The classes " + Transform.class + " and " + Transform2.class + " " +
- "have the same initial dex files!");
- } else if (final_t1_dex == initial_t1_dex) {
- throw new Exception("The class " + Transform.class + " did not get a new dex file!");
- } else if (final_t2_dex == initial_t2_dex) {
- throw new Exception("The class " + Transform2.class + " did not get a new dex file!");
- }
- // Check to make sure the new dex files are in the class loader.
- checkDexFileInClassLoader(Transform.class);
- checkDexFileInClassLoader(Transform2.class);
- }
-
- private static void doMultiClassRedefinition(CommonClassDefinition... defs) {
- ArrayList<Class<?>> classes = new ArrayList<>();
- ArrayList<byte[]> class_files = new ArrayList<>();
- ArrayList<byte[]> dex_files = new ArrayList<>();
-
- for (CommonClassDefinition d : defs) {
- classes.add(d.target);
- class_files.add(d.class_file_bytes);
- dex_files.add(d.dex_file_bytes);
- }
- doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
- class_files.toArray(new byte[0][]),
- dex_files.toArray(new byte[0][]));
- }
-
- // Gets the 'long' (really a native pointer) that is stored in the ClassLoader representing the
- // DexFile a class is loaded from. This is converted from the DexFile* in the same way it is done
- // in runtime/native/dalvik_system_DexFile.cc
- private static native long getDexFilePointer(Class<?> target);
- // Transforms the classes
- private static native void doCommonMultiClassRedefinition(Class<?>[] targets,
- byte[][] classfiles,
- byte[][] dexfiles);
}
diff --git a/test/944-transform-classloaders/src/Transform.java b/test/944-transform-classloaders/src/Transform.java
deleted file mode 100644
index 8e8af355da..0000000000
--- a/test/944-transform-classloaders/src/Transform.java
+++ /dev/null
@@ -1,28 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
- public void sayHi() {
- // Use lower 'h' to make sure the string will have a different string id
- // than the transformation (the transformation code is the same except
- // the actual printed String, which was making the test inacurately passing
- // in JIT mode when loading the string from the dex cache, as the string ids
- // of the two different strings were the same).
- // We know the string ids will be different because lexicographically:
- // "Goodbye" < "LTransform;" < "hello".
- System.out.println("hello");
- }
-}
diff --git a/test/944-transform-classloaders/src/Transform2.java b/test/944-transform-classloaders/src/Transform2.java
deleted file mode 100644
index eb22842184..0000000000
--- a/test/944-transform-classloaders/src/Transform2.java
+++ /dev/null
@@ -1,21 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform2 {
- public void sayHi() {
- System.out.println("hello2");
- }
-}
diff --git a/test/944-transform-classloaders/src/art/Redefinition.java b/test/944-transform-classloaders/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/944-transform-classloaders/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/944-transform-classloaders/src/art/Test944.java b/test/944-transform-classloaders/src/art/Test944.java
new file mode 100644
index 0000000000..fe1c024ec4
--- /dev/null
+++ b/test/944-transform-classloaders/src/art/Test944.java
@@ -0,0 +1,297 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import static art.Redefinition.CommonClassDefinition;
+
+import java.util.Arrays;
+import java.util.ArrayList;
+import java.util.Base64;
+import java.lang.reflect.*;
+public class Test944 {
+
+ static class Transform {
+ public void sayHi() {
+ System.out.println("hello");
+ }
+ }
+
+ static class Transform2 {
+ public void sayHi() {
+ System.out.println("hello2");
+ }
+ }
+
+ /**
+ * base64 encoded class/dex file for
+ * static class Transform {
+ * public void sayHi() {
+ * System.out.println("Goodbye");
+ * }
+ * }
+ */
+ private static CommonClassDefinition TRANSFORM_DEFINITION = new CommonClassDefinition(
+ Transform.class,
+ Base64.getDecoder().decode(
+ "yv66vgAAADQAIAoABgAOCQAPABAIABEKABIAEwcAFQcAGAEABjxpbml0PgEAAygpVgEABENvZGUB" +
+ "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAAxUZXN0OTQ0LmphdmEMAAcA" +
+ "CAcAGQwAGgAbAQAHR29vZGJ5ZQcAHAwAHQAeBwAfAQAVYXJ0L1Rlc3Q5NDQkVHJhbnNmb3JtAQAJ" +
+ "VHJhbnNmb3JtAQAMSW5uZXJDbGFzc2VzAQAQamF2YS9sYW5nL09iamVjdAEAEGphdmEvbGFuZy9T" +
+ "eXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsBABNqYXZhL2lvL1ByaW50U3RyZWFt" +
+ "AQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgEAC2FydC9UZXN0OTQ0ACAABQAGAAAA" +
+ "AAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAACgABAAsACAABAAkA" +
+ "AAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAAMAAgADQACAAwAAAACAA0AFwAAAAoA" +
+ "AQAFABQAFgAI"),
+ Base64.getDecoder().decode(
+ "ZGV4CjAzNQCFgsuWAAAAAAAAAAAAAAAAAAAAAAAAAAC4AwAAcAAAAHhWNBIAAAAAAAAAAPQCAAAU" +
+ "AAAAcAAAAAkAAADAAAAAAgAAAOQAAAABAAAA/AAAAAQAAAAEAQAAAQAAACQBAAB0AgAARAEAAEQB" +
+ "AABMAQAAVQEAAG4BAAB9AQAAoQEAAMEBAADYAQAA7AEAAAACAAAUAgAAIgIAAC0CAAAwAgAANAIA" +
+ "AEECAABHAgAATAIAAFUCAABcAgAAAgAAAAMAAAAEAAAABQAAAAYAAAAHAAAACAAAAAkAAAAMAAAA" +
+ "DAAAAAgAAAAAAAAADQAAAAgAAABkAgAABwAEABAAAAAAAAAAAAAAAAAAAAASAAAABAABABEAAAAF" +
+ "AAAAAAAAAAAAAAAAAAAABQAAAAAAAAAKAAAA5AIAALgCAAAAAAAABjxpbml0PgAHR29vZGJ5ZQAX" +
+ "TGFydC9UZXN0OTQ0JFRyYW5zZm9ybTsADUxhcnQvVGVzdDk0NDsAIkxkYWx2aWsvYW5ub3RhdGlv" +
+ "bi9FbmNsb3NpbmdDbGFzczsAHkxkYWx2aWsvYW5ub3RhdGlvbi9Jbm5lckNsYXNzOwAVTGphdmEv" +
+ "aW8vUHJpbnRTdHJlYW07ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwAS" +
+ "TGphdmEvbGFuZy9TeXN0ZW07AAxUZXN0OTQ0LmphdmEACVRyYW5zZm9ybQABVgACVkwAC2FjY2Vz" +
+ "c0ZsYWdzAARuYW1lAANvdXQAB3ByaW50bG4ABXNheUhpAAV2YWx1ZQAAAQAAAAYAAAAKAAcOAAwA" +
+ "Bw4BCA8AAAAAAQABAAEAAABsAgAABAAAAHAQAwAAAA4AAwABAAIAAABxAgAACQAAAGIAAAAbAQEA" +
+ "AABuIAIAEAAOAAAAAAABAQCAgAT8BAEBlAUAAAICARMYAQIDAg4ECA8XCwACAAAAyAIAAM4CAADY" +
+ "AgAAAAAAAAAAAAAAAAAAEAAAAAAAAAABAAAAAAAAAAEAAAAUAAAAcAAAAAIAAAAJAAAAwAAAAAMA" +
+ "AAACAAAA5AAAAAQAAAABAAAA/AAAAAUAAAAEAAAABAEAAAYAAAABAAAAJAEAAAIgAAAUAAAARAEA" +
+ "AAEQAAABAAAAZAIAAAMgAAACAAAAbAIAAAEgAAACAAAAfAIAAAAgAAABAAAAuAIAAAQgAAACAAAA" +
+ "yAIAAAMQAAABAAAA2AIAAAYgAAABAAAA5AIAAAAQAAABAAAA9AIAAA=="));
+
+ /**
+ * base64 encoded class/dex file for
+ * static class Transform2 {
+ * public void sayHi() {
+ * System.out.println("Goodbye2");
+ * }
+ * }
+ */
+ private static CommonClassDefinition TRANSFORM2_DEFINITION = new CommonClassDefinition(
+ Transform2.class,
+ Base64.getDecoder().decode(
+ "yv66vgAAADQAIAoABgAOCQAPABAIABEKABIAEwcAFQcAGAEABjxpbml0PgEAAygpVgEABENvZGUB" +
+ "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAAxUZXN0OTQ0LmphdmEMAAcA" +
+ "CAcAGQwAGgAbAQAIR29vZGJ5ZTIHABwMAB0AHgcAHwEAFmFydC9UZXN0OTQ0JFRyYW5zZm9ybTIB" +
+ "AApUcmFuc2Zvcm0yAQAMSW5uZXJDbGFzc2VzAQAQamF2YS9sYW5nL09iamVjdAEAEGphdmEvbGFu" +
+ "Zy9TeXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsBABNqYXZhL2lvL1ByaW50U3Ry" +
+ "ZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgEAC2FydC9UZXN0OTQ0ACAABQAG" +
+ "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAABQABAAsACAAB" +
+ "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAAHAAgACAACAAwAAAACAA0AFwAA" +
+ "AAoAAQAFABQAFgAI"),
+ Base64.getDecoder().decode(
+ "ZGV4CjAzNQAUg8BCAAAAAAAAAAAAAAAAAAAAAAAAAAC8AwAAcAAAAHhWNBIAAAAAAAAAAPgCAAAU" +
+ "AAAAcAAAAAkAAADAAAAAAgAAAOQAAAABAAAA/AAAAAQAAAAEAQAAAQAAACQBAAB4AgAARAEAAEQB" +
+ "AABMAQAAVgEAAHABAAB/AQAAowEAAMMBAADaAQAA7gEAAAICAAAWAgAAJAIAADACAAAzAgAANwIA" +
+ "AEQCAABKAgAATwIAAFgCAABfAgAAAgAAAAMAAAAEAAAABQAAAAYAAAAHAAAACAAAAAkAAAAMAAAA" +
+ "DAAAAAgAAAAAAAAADQAAAAgAAABoAgAABwAEABAAAAAAAAAAAAAAAAAAAAASAAAABAABABEAAAAF" +
+ "AAAAAAAAAAAAAAAAAAAABQAAAAAAAAAKAAAA6AIAALwCAAAAAAAABjxpbml0PgAIR29vZGJ5ZTIA" +
+ "GExhcnQvVGVzdDk0NCRUcmFuc2Zvcm0yOwANTGFydC9UZXN0OTQ0OwAiTGRhbHZpay9hbm5vdGF0" +
+ "aW9uL0VuY2xvc2luZ0NsYXNzOwAeTGRhbHZpay9hbm5vdGF0aW9uL0lubmVyQ2xhc3M7ABVMamF2" +
+ "YS9pby9QcmludFN0cmVhbTsAEkxqYXZhL2xhbmcvT2JqZWN0OwASTGphdmEvbGFuZy9TdHJpbmc7" +
+ "ABJMamF2YS9sYW5nL1N5c3RlbTsADFRlc3Q5NDQuamF2YQAKVHJhbnNmb3JtMgABVgACVkwAC2Fj" +
+ "Y2Vzc0ZsYWdzAARuYW1lAANvdXQAB3ByaW50bG4ABXNheUhpAAV2YWx1ZQAAAAEAAAAGAAAABQAH" +
+ "DgAHAAcOAQgPAAAAAAEAAQABAAAAcAIAAAQAAABwEAMAAAAOAAMAAQACAAAAdQIAAAkAAABiAAAA" +
+ "GwEBAAAAbiACABAADgAAAAAAAQEAgIAEgAUBAZgFAAACAgETGAECAwIOBAgPFwsAAgAAAMwCAADS" +
+ "AgAA3AIAAAAAAAAAAAAAAAAAABAAAAAAAAAAAQAAAAAAAAABAAAAFAAAAHAAAAACAAAACQAAAMAA" +
+ "AAADAAAAAgAAAOQAAAAEAAAAAQAAAPwAAAAFAAAABAAAAAQBAAAGAAAAAQAAACQBAAACIAAAFAAA" +
+ "AEQBAAABEAAAAQAAAGgCAAADIAAAAgAAAHACAAABIAAAAgAAAIACAAAAIAAAAQAAALwCAAAEIAAA" +
+ "AgAAAMwCAAADEAAAAQAAANwCAAAGIAAAAQAAAOgCAAAAEAAAAQAAAPgCAAA="));
+
+ public static void run() throws Exception {
+ Redefinition.setTestConfiguration(Redefinition.Config.COMMON_REDEFINE);
+ doTest();
+ System.out.println("Passed");
+ }
+
+ private static void checkIsInstance(Class<?> klass, Object o) throws Exception {
+ if (!klass.isInstance(o)) {
+ throw new Exception(klass + " is not the class of " + o);
+ }
+ }
+
+ private static boolean arrayContains(long[] arr, long value) {
+ if (arr == null) {
+ return false;
+ }
+ for (int i = 0; i < arr.length; i++) {
+ if (arr[i] == value) {
+ return true;
+ }
+ }
+ return false;
+ }
+
+ /**
+ * Checks that we can find the dex-file for the given class in its classloader.
+ *
+ * Throws if it fails.
+ */
+ private static void checkDexFileInClassLoader(Class<?> klass) throws Exception {
+ // If all the android BCP classes were availible when compiling this test and access checks
+ // weren't a thing this function would be written as follows:
+ //
+ // long dexFilePtr = getDexFilePointer(klass);
+ // dalvik.system.BaseDexClassLoader loader =
+ // (dalvik.system.BaseDexClassLoader)klass.getClassLoader();
+ // dalvik.system.DexPathList pathListValue = loader.pathList;
+ // dalvik.system.DexPathList.Element[] elementArrayValue = pathListValue.dexElements;
+ // int array_length = elementArrayValue.length;
+ // for (int i = 0; i < array_length; i++) {
+ // dalvik.system.DexPathList.Element curElement = elementArrayValue[i];
+ // dalvik.system.DexFile curDexFile = curElement.dexFile;
+ // if (curDexFile == null) {
+ // continue;
+ // }
+ // long[] curCookie = (long[])curDexFile.mCookie;
+ // long[] curInternalCookie = (long[])curDexFile.mInternalCookie;
+ // if (arrayContains(curCookie, dexFilePtr) || arrayContains(curInternalCookie, dexFilePtr)) {
+ // return;
+ // }
+ // }
+ // throw new Exception(
+ // "Unable to find dex file pointer " + dexFilePtr + " in class loader for " + klass);
+
+ // Get all the fields and classes we need by reflection.
+ Class<?> baseDexClassLoaderClass = Class.forName("dalvik.system.BaseDexClassLoader");
+ Field pathListField = baseDexClassLoaderClass.getDeclaredField("pathList");
+
+ Class<?> dexPathListClass = Class.forName("dalvik.system.DexPathList");
+ Field elementArrayField = dexPathListClass.getDeclaredField("dexElements");
+
+ Class<?> dexPathListElementClass = Class.forName("dalvik.system.DexPathList$Element");
+ Field dexFileField = dexPathListElementClass.getDeclaredField("dexFile");
+
+ Class<?> dexFileClass = Class.forName("dalvik.system.DexFile");
+ Field dexFileCookieField = dexFileClass.getDeclaredField("mCookie");
+ Field dexFileInternalCookieField = dexFileClass.getDeclaredField("mInternalCookie");
+
+ // Make all the fields accessible
+ AccessibleObject.setAccessible(new AccessibleObject[] { pathListField,
+ elementArrayField,
+ dexFileField,
+ dexFileCookieField,
+ dexFileInternalCookieField }, true);
+
+ long dexFilePtr = getDexFilePointer(klass);
+
+ ClassLoader loader = klass.getClassLoader();
+ checkIsInstance(baseDexClassLoaderClass, loader);
+ // DexPathList pathListValue = ((BaseDexClassLoader) loader).pathList;
+ Object pathListValue = pathListField.get(loader);
+
+ checkIsInstance(dexPathListClass, pathListValue);
+
+ // DexPathList.Element[] elementArrayValue = pathListValue.dexElements;
+ Object elementArrayValue = elementArrayField.get(pathListValue);
+ if (!elementArrayValue.getClass().isArray() ||
+ elementArrayValue.getClass().getComponentType() != dexPathListElementClass) {
+ throw new Exception("elementArrayValue is not an " + dexPathListElementClass + " array!");
+ }
+ // int array_length = elementArrayValue.length;
+ int array_length = Array.getLength(elementArrayValue);
+ for (int i = 0; i < array_length; i++) {
+ // DexPathList.Element curElement = elementArrayValue[i];
+ Object curElement = Array.get(elementArrayValue, i);
+ checkIsInstance(dexPathListElementClass, curElement);
+
+ // DexFile curDexFile = curElement.dexFile;
+ Object curDexFile = dexFileField.get(curElement);
+ if (curDexFile == null) {
+ continue;
+ }
+ checkIsInstance(dexFileClass, curDexFile);
+
+ // long[] curCookie = (long[])curDexFile.mCookie;
+ long[] curCookie = (long[])dexFileCookieField.get(curDexFile);
+ // long[] curInternalCookie = (long[])curDexFile.mInternalCookie;
+ long[] curInternalCookie = (long[])dexFileInternalCookieField.get(curDexFile);
+
+ if (arrayContains(curCookie, dexFilePtr) || arrayContains(curInternalCookie, dexFilePtr)) {
+ return;
+ }
+ }
+ throw new Exception(
+ "Unable to find dex file pointer " + dexFilePtr + " in class loader for " + klass);
+ }
+
+ private static void doTest() throws Exception {
+ Transform t = new Transform();
+ Transform2 t2 = new Transform2();
+
+ long initial_t1_dex = getDexFilePointer(Transform.class);
+ long initial_t2_dex = getDexFilePointer(Transform2.class);
+ if (initial_t2_dex != initial_t1_dex) {
+ throw new Exception("The classes " + Transform.class + " and " + Transform2.class + " " +
+ "have different initial dex files!");
+ }
+ checkDexFileInClassLoader(Transform.class);
+ checkDexFileInClassLoader(Transform2.class);
+
+ // Make sure they are loaded
+ t.sayHi();
+ t2.sayHi();
+ // Redefine both of the classes.
+ Redefinition.doMultiClassRedefinition(TRANSFORM_DEFINITION, TRANSFORM2_DEFINITION);
+ // Make sure we actually transformed them!
+ t.sayHi();
+ t2.sayHi();
+
+ long final_t1_dex = getDexFilePointer(Transform.class);
+ long final_t2_dex = getDexFilePointer(Transform2.class);
+ if (final_t2_dex == final_t1_dex) {
+ throw new Exception("The classes " + Transform.class + " and " + Transform2.class + " " +
+ "have the same initial dex files!");
+ } else if (final_t1_dex == initial_t1_dex) {
+ throw new Exception("The class " + Transform.class + " did not get a new dex file!");
+ } else if (final_t2_dex == initial_t2_dex) {
+ throw new Exception("The class " + Transform2.class + " did not get a new dex file!");
+ }
+ // Check to make sure the new dex files are in the class loader.
+ checkDexFileInClassLoader(Transform.class);
+ checkDexFileInClassLoader(Transform2.class);
+ }
+
+ // Gets the 'long' (really a native pointer) that is stored in the ClassLoader representing the
+ // DexFile a class is loaded from. This is plucked out of the internal DexCache object associated
+ // with the class.
+ private static long getDexFilePointer(Class<?> target) throws Exception {
+ // If all the android BCP classes were available when compiling this test and access checks
+ // weren't a thing this function would be written as follows:
+ //
+ // java.lang.DexCache dexCacheObject = target.dexCache;
+ // if (dexCacheObject == null) {
+ // return 0;
+ // }
+ // return dexCacheObject.dexFile;
+ Field dexCacheField = Class.class.getDeclaredField("dexCache");
+
+ Class<?> dexCacheClass = Class.forName("java.lang.DexCache");
+ Field dexFileField = dexCacheClass.getDeclaredField("dexFile");
+
+ AccessibleObject.setAccessible(new AccessibleObject[] { dexCacheField, dexFileField }, true);
+
+ Object dexCacheObject = dexCacheField.get(target);
+ if (dexCacheObject == null) {
+ return 0;
+ }
+ checkIsInstance(dexCacheClass, dexCacheObject);
+ return dexFileField.getLong(dexCacheObject);
+ }
+}
diff --git a/test/945-obsolete-native/obsolete_native.cc b/test/945-obsolete-native/obsolete_native.cc
index ee653a4a12..e3090f5906 100644
--- a/test/945-obsolete-native/obsolete_native.cc
+++ b/test/945-obsolete-native/obsolete_native.cc
@@ -19,31 +19,20 @@
#include <stdio.h>
#include "android-base/stringprintf.h"
-
-#include "android-base/stringprintf.h"
-#include "base/logging.h"
-#include "base/macros.h"
#include "jni.h"
#include "jvmti.h"
-#include "scoped_local_ref.h"
// Test infrastructure
#include "jni_binder.h"
#include "test_env.h"
+#include "scoped_local_ref.h"
namespace art {
namespace Test945ObsoleteNative {
-extern "C" JNIEXPORT void JNICALL Java_Main_bindTest945ObsoleteNative(
- JNIEnv* env, jclass klass ATTRIBUTE_UNUSED) {
- BindFunctions(jvmti_env, env, "Transform");
-}
-
-extern "C" JNIEXPORT void JNICALL Java_Transform_doExecute(JNIEnv* env,
- jclass klass ATTRIBUTE_UNUSED,
- jobject runnable) {
+extern "C" JNIEXPORT void JNICALL Java_art_Test945_00024Transform_doExecute(
+ JNIEnv* env, jclass klass ATTRIBUTE_UNUSED, jobject runnable) {
jclass runnable_klass = env->FindClass("java/lang/Runnable");
- DCHECK(runnable_klass != nullptr);
jmethodID run_method = env->GetMethodID(runnable_klass, "run", "()V");
env->CallVoidMethod(runnable, run_method);
}
diff --git a/test/945-obsolete-native/src/Main.java b/test/945-obsolete-native/src/Main.java
index a7901cd2bb..c94bc2206c 100644
--- a/test/945-obsolete-native/src/Main.java
+++ b/test/945-obsolete-native/src/Main.java
@@ -1,5 +1,5 @@
/*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
@@ -14,65 +14,8 @@
* limitations under the License.
*/
-import java.util.Base64;
-
public class Main {
- // class Transform {
- // public void sayHi(Runnable r) {
- // System.out.println("Hello - Transformed");
- // doExecute(r);
- // System.out.println("Goodbye - Transformed");
- // }
- //
- // private static native void doExecute(Runnable r);
- // }
- private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
- "yv66vgAAADQAIgoACAASCQATABQIABUKABYAFwoABwAYCAAZBwAaBwAbAQAGPGluaXQ+AQADKClW" +
- "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
- "KVYBAAlkb0V4ZWN1dGUBAApTb3VyY2VGaWxlAQAOVHJhbnNmb3JtLmphdmEMAAkACgcAHAwAHQAe" +
- "AQATSGVsbG8gLSBUcmFuc2Zvcm1lZAcAHwwAIAAhDAAPAA4BABVHb29kYnllIC0gVHJhbnNmb3Jt" +
- "ZWQBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291" +
- "dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2phdmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxu" +
- "AQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABwAIAAAAAAADAAAACQAKAAEACwAAAB0AAQABAAAA" +
- "BSq3AAGxAAAAAQAMAAAABgABAAAAEQABAA0ADgABAAsAAAA5AAIAAgAAABWyAAISA7YABCu4AAWy" +
- "AAISBrYABLEAAAABAAwAAAASAAQAAAATAAgAFAAMABUAFAAWAQoADwAOAAAAAQAQAAAAAgAR");
- private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
- "ZGV4CjAzNQB1fZcJR/opPuXacK8mIla5shH0LSg72qJYAwAAcAAAAHhWNBIAAAAAAAAAALgCAAAR" +
- "AAAAcAAAAAcAAAC0AAAAAwAAANAAAAABAAAA9AAAAAUAAAD8AAAAAQAAACQBAAAUAgAARAEAAKIB" +
- "AACqAQAAwQEAANYBAADjAQAA+gEAAA4CAAAkAgAAOAIAAEwCAABcAgAAXwIAAGMCAABuAgAAggIA" +
- "AIcCAACQAgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACgAAAAoAAAAGAAAAAAAAAAsAAAAGAAAA" +
- "lAEAAAsAAAAGAAAAnAEAAAUAAQAOAAAAAAAAAAAAAAAAAAEADAAAAAAAAQAQAAAAAQACAA8AAAAC" +
- "AAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAJAAAAAAAAAKUCAAAAAAAAAQABAAEAAACXAgAABAAAAHAQ" +
- "BAAAAA4ABAACAAIAAACcAgAAFAAAAGIAAAAbAQIAAABuIAMAEABxEAEAAwBiAAAAGwEBAAAAbiAD" +
- "ABAADgABAAAAAwAAAAEAAAAEAAY8aW5pdD4AFUdvb2RieWUgLSBUcmFuc2Zvcm1lZAATSGVsbG8g" +
- "LSBUcmFuc2Zvcm1lZAALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwASTGphdmEv" +
- "bGFuZy9PYmplY3Q7ABRMamF2YS9sYW5nL1J1bm5hYmxlOwASTGphdmEvbGFuZy9TdHJpbmc7ABJM" +
- "amF2YS9sYW5nL1N5c3RlbTsADlRyYW5zZm9ybS5qYXZhAAFWAAJWTAAJZG9FeGVjdXRlABJlbWl0" +
- "dGVyOiBqYWNrLTQuMjUAA291dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAQAHDoc8hwAAAAIBAICA" +
- "BMQCAYoCAAIB3AIADQAAAAAAAAABAAAAAAAAAAEAAAARAAAAcAAAAAIAAAAHAAAAtAAAAAMAAAAD" +
- "AAAA0AAAAAQAAAABAAAA9AAAAAUAAAAFAAAA/AAAAAYAAAABAAAAJAEAAAEgAAACAAAARAEAAAEQ" +
- "AAACAAAAlAEAAAIgAAARAAAAogEAAAMgAAACAAAAlwIAAAAgAAABAAAApQIAAAAQAAABAAAAuAIA" +
- "AA==");
-
- public static void main(String[] args) {
- art.Main.bindAgentJNIForClass(Main.class);
- bindTest945ObsoleteNative();
- doTest(new Transform());
- }
-
- public static void doTest(Transform t) {
- t.sayHi(() -> { System.out.println("Not doing anything here"); });
- t.sayHi(() -> {
- System.out.println("transforming calling function");
- doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
- });
- t.sayHi(() -> { System.out.println("Not doing anything here"); });
+ public static void main(String[] args) throws Exception {
+ art.Test945.run();
}
-
- // Transforms the class
- private static native void doCommonClassRedefinition(Class<?> target,
- byte[] classfile,
- byte[] dexfile);
-
- private static native void bindTest945ObsoleteNative();
}
diff --git a/test/945-obsolete-native/src/Transform.java b/test/945-obsolete-native/src/Transform.java
deleted file mode 100644
index 2b7cc1b3a1..0000000000
--- a/test/945-obsolete-native/src/Transform.java
+++ /dev/null
@@ -1,25 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
- public void sayHi(Runnable r) {
- System.out.println("hello");
- doExecute(r);
- System.out.println("goodbye");
- }
-
- private static native void doExecute(Runnable r);
-}
diff --git a/test/945-obsolete-native/src/art/Redefinition.java b/test/945-obsolete-native/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/945-obsolete-native/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/945-obsolete-native/src/art/Test945.java b/test/945-obsolete-native/src/art/Test945.java
new file mode 100644
index 0000000000..6cf31f6d05
--- /dev/null
+++ b/test/945-obsolete-native/src/art/Test945.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.Base64;
+
+public class Test945 {
+
+ static class Transform {
+ static {
+ art.Main.bindAgentJNIForClass(Transform.class);
+ }
+
+ public void sayHi(Runnable r) {
+ System.out.println("hello");
+ doExecute(r);
+ System.out.println("goodbye");
+ }
+
+ private static native void doExecute(Runnable r);
+ }
+
+ // static class Transform {
+ // static { }
+ // public void sayHi(Runnable r) {
+ // System.out.println("Hello - Transformed");
+ // doExecute(r);
+ // System.out.println("Goodbye - Transformed");
+ // }
+ //
+ // private static native void doExecute(Runnable r);
+ // }
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAJwoACAATCQAUABUIABYKABcAGAoABwAZCAAaBwAcBwAfAQAGPGluaXQ+AQADKClW" +
+ "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
+ "KVYBAAlkb0V4ZWN1dGUBAAg8Y2xpbml0PgEAClNvdXJjZUZpbGUBAAxUZXN0OTQ1LmphdmEMAAkA" +
+ "CgcAIAwAIQAiAQATSGVsbG8gLSBUcmFuc2Zvcm1lZAcAIwwAJAAlDAAPAA4BABVHb29kYnllIC0g" +
+ "VHJhbnNmb3JtZWQHACYBABVhcnQvVGVzdDk0NSRUcmFuc2Zvcm0BAAlUcmFuc2Zvcm0BAAxJbm5l" +
+ "ckNsYXNzZXMBABBqYXZhL2xhbmcvT2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxq" +
+ "YXZhL2lvL1ByaW50U3RyZWFtOwEAE2phdmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExq" +
+ "YXZhL2xhbmcvU3RyaW5nOylWAQALYXJ0L1Rlc3Q5NDUAIAAHAAgAAAAAAAQAAAAJAAoAAQALAAAA" +
+ "HQABAAEAAAAFKrcAAbEAAAABAAwAAAAGAAEAAAAFAAEADQAOAAEACwAAADkAAgACAAAAFbIAAhID" +
+ "tgAEK7gABbIAAhIGtgAEsQAAAAEADAAAABIABAAAAAgACAAJAAwACgAUAAsBCgAPAA4AAAAIABAA" +
+ "CgABAAsAAAAZAAAAAAAAAAGxAAAAAQAMAAAABgABAAAABgACABEAAAACABIAHgAAAAoAAQAHABsA" +
+ "HQAI");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQAFqcJFAAAAAAAAAAAAAAAAAAAAAAAAAAB8BAAAcAAAAHhWNBIAAAAAAAAAALgDAAAY" +
+ "AAAAcAAAAAoAAADQAAAAAwAAAPgAAAABAAAAHAEAAAYAAAAkAQAAAQAAAFQBAAAIAwAAdAEAAHQB" +
+ "AAB+AQAAhgEAAJ0BAACyAQAAywEAANoBAAD+AQAAHgIAADUCAABJAgAAXwIAAHMCAACHAgAAlQIA" +
+ "AKACAACjAgAApwIAALQCAAC/AgAAxQIAAMoCAADTAgAA2gIAAAQAAAAFAAAABgAAAAcAAAAIAAAA" +
+ "CQAAAAoAAAALAAAADAAAAA8AAAAPAAAACQAAAAAAAAAQAAAACQAAAOQCAAAQAAAACQAAAOwCAAAI" +
+ "AAQAFAAAAAAAAAAAAAAAAAAAAAEAAAAAAAEAEgAAAAAAAQAWAAAABAACABUAAAAFAAAAAQAAAAAA" +
+ "AAAAAAAABQAAAAAAAAANAAAAqAMAAHQDAAAAAAAACDxjbGluaXQ+AAY8aW5pdD4AFUdvb2RieWUg" +
+ "LSBUcmFuc2Zvcm1lZAATSGVsbG8gLSBUcmFuc2Zvcm1lZAAXTGFydC9UZXN0OTQ1JFRyYW5zZm9y" +
+ "bTsADUxhcnQvVGVzdDk0NTsAIkxkYWx2aWsvYW5ub3RhdGlvbi9FbmNsb3NpbmdDbGFzczsAHkxk" +
+ "YWx2aWsvYW5ub3RhdGlvbi9Jbm5lckNsYXNzOwAVTGphdmEvaW8vUHJpbnRTdHJlYW07ABJMamF2" +
+ "YS9sYW5nL09iamVjdDsAFExqYXZhL2xhbmcvUnVubmFibGU7ABJMamF2YS9sYW5nL1N0cmluZzsA" +
+ "EkxqYXZhL2xhbmcvU3lzdGVtOwAMVGVzdDk0NS5qYXZhAAlUcmFuc2Zvcm0AAVYAAlZMAAthY2Nl" +
+ "c3NGbGFncwAJZG9FeGVjdXRlAARuYW1lAANvdXQAB3ByaW50bG4ABXNheUhpAAV2YWx1ZQAAAAAB" +
+ "AAAABgAAAAEAAAAHAAAABQAHDgAFAAcOAAgBAAcOAQgPAQMPAQgPAAAAAAAAAAAAAAAA9AIAAAEA" +
+ "AAAOAAAAAQABAAEAAAD5AgAABAAAAHAQBQAAAA4ABAACAAIAAAD+AgAAFAAAAGIAAAAbAQMAAABu" +
+ "IAQAEABxEAIAAwBiAAAAGwECAAAAbiAEABAADgAAAAMBAIiABJAGAYCABKQGAYoCAAMBvAYCAgEX" +
+ "GAECAwIRBAgTFw4AAgAAAIwDAACSAwAAnAMAAAAAAAAAAAAAAAAAABAAAAAAAAAAAQAAAAAAAAAB" +
+ "AAAAGAAAAHAAAAACAAAACgAAANAAAAADAAAAAwAAAPgAAAAEAAAAAQAAABwBAAAFAAAABgAAACQB" +
+ "AAAGAAAAAQAAAFQBAAACIAAAGAAAAHQBAAABEAAAAgAAAOQCAAADIAAAAwAAAPQCAAABIAAAAwAA" +
+ "ABADAAAAIAAAAQAAAHQDAAAEIAAAAgAAAIwDAAADEAAAAQAAAJwDAAAGIAAAAQAAAKgDAAAAEAAA" +
+ "AQAAALgDAAA=");
+
+ public static void run() {
+ Redefinition.setTestConfiguration(Redefinition.Config.COMMON_REDEFINE);
+ doTest(new Transform());
+ }
+
+ public static void doTest(Transform t) {
+ t.sayHi(() -> { System.out.println("Not doing anything here"); });
+ t.sayHi(() -> {
+ System.out.println("transforming calling function");
+ Redefinition.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+ });
+ t.sayHi(() -> { System.out.println("Not doing anything here"); });
+ }
+}
diff --git a/test/946-obsolete-throw/expected.txt b/test/946-obsolete-throw/expected.txt
index 71d5182100..edf796eb96 100644
--- a/test/946-obsolete-throw/expected.txt
+++ b/test/946-obsolete-throw/expected.txt
@@ -5,10 +5,11 @@ hello
transforming calling function
Received error : java.lang.Error: Throwing exception into an obsolete method!
java.lang.Error: Throwing exception into an obsolete method!
- at Main$DoRedefinitionClass.run(Main.java:65)
- at Transform.sayHi(Transform.java:27)
- at Main.doTest(Main.java:72)
- at Main.main(Main.java:57)
+ at art.Test946$DoRedefinitionClass.run(Test946.java:81)
+ at art.Test946$Transform.sayHi(Test946.java:26)
+ at art.Test946.doTest(Test946.java:88)
+ at art.Test946.run(Test946.java:73)
+ at Main.main(Main.java:19)
Hello - Transformed
Not doing anything here
Goodbye - Transformed
diff --git a/test/946-obsolete-throw/src/Main.java b/test/946-obsolete-throw/src/Main.java
index 077ad72acd..0b1f78dc4a 100644
--- a/test/946-obsolete-throw/src/Main.java
+++ b/test/946-obsolete-throw/src/Main.java
@@ -14,71 +14,8 @@
* limitations under the License.
*/
-import java.util.Base64;
-
public class Main {
- // class Transform {
- // public void sayHi(Runnable r) {
- // System.out.println("Hello - Transformed");
- // r.run();
- // System.out.println("Goodbye - Transformed");
- // }
- // }
- private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
- "yv66vgAAADQAJAoACAARCQASABMIABQKABUAFgsAFwAYCAAZBwAaBwAbAQAGPGluaXQ+AQADKClW" +
- "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
- "KVYBAApTb3VyY2VGaWxlAQAOVHJhbnNmb3JtLmphdmEMAAkACgcAHAwAHQAeAQATSGVsbG8gLSBU" +
- "cmFuc2Zvcm1lZAcAHwwAIAAhBwAiDAAjAAoBABVHb29kYnllIC0gVHJhbnNmb3JtZWQBAAlUcmFu" +
- "c2Zvcm0BABBqYXZhL2xhbmcvT2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZh" +
- "L2lvL1ByaW50U3RyZWFtOwEAE2phdmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZh" +
- "L2xhbmcvU3RyaW5nOylWAQASamF2YS9sYW5nL1J1bm5hYmxlAQADcnVuACAABwAIAAAAAAACAAAA" +
- "CQAKAAEACwAAAB0AAQABAAAABSq3AAGxAAAAAQAMAAAABgABAAAAAQABAA0ADgABAAsAAAA7AAIA" +
- "AgAAABeyAAISA7YABCu5AAUBALIAAhIGtgAEsQAAAAEADAAAABIABAAAAAMACAAEAA4ABQAWAAYA" +
- "AQAPAAAAAgAQ");
- private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
- "ZGV4CjAzNQAYeAMMXgYWxoeSHAS9EWKCCtVRSAGpqZVQAwAAcAAAAHhWNBIAAAAAAAAAALACAAAR" +
- "AAAAcAAAAAcAAAC0AAAAAwAAANAAAAABAAAA9AAAAAUAAAD8AAAAAQAAACQBAAAMAgAARAEAAKIB" +
- "AACqAQAAwQEAANYBAADjAQAA+gEAAA4CAAAkAgAAOAIAAEwCAABcAgAAXwIAAGMCAAB3AgAAfAIA" +
- "AIUCAACKAgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACgAAAAoAAAAGAAAAAAAAAAsAAAAGAAAA" +
- "lAEAAAsAAAAGAAAAnAEAAAUAAQANAAAAAAAAAAAAAAAAAAEAEAAAAAEAAgAOAAAAAgAAAAAAAAAD" +
- "AAAADwAAAAAAAAAAAAAAAgAAAAAAAAAJAAAAAAAAAJ8CAAAAAAAAAQABAAEAAACRAgAABAAAAHAQ" +
- "AwAAAA4ABAACAAIAAACWAgAAFAAAAGIAAAAbAQIAAABuIAIAEAByEAQAAwBiAAAAGwEBAAAAbiAC" +
- "ABAADgABAAAAAwAAAAEAAAAEAAY8aW5pdD4AFUdvb2RieWUgLSBUcmFuc2Zvcm1lZAATSGVsbG8g" +
- "LSBUcmFuc2Zvcm1lZAALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwASTGphdmEv" +
- "bGFuZy9PYmplY3Q7ABRMamF2YS9sYW5nL1J1bm5hYmxlOwASTGphdmEvbGFuZy9TdHJpbmc7ABJM" +
- "amF2YS9sYW5nL1N5c3RlbTsADlRyYW5zZm9ybS5qYXZhAAFWAAJWTAASZW1pdHRlcjogamFjay00" +
- "LjEzAANvdXQAB3ByaW50bG4AA3J1bgAFc2F5SGkAAQAHDgADAQAHDoc8hwAAAAEBAICABMQCAQHc" +
- "AgAAAA0AAAAAAAAAAQAAAAAAAAABAAAAEQAAAHAAAAACAAAABwAAALQAAAADAAAAAwAAANAAAAAE" +
- "AAAAAQAAAPQAAAAFAAAABQAAAPwAAAAGAAAAAQAAACQBAAABIAAAAgAAAEQBAAABEAAAAgAAAJQB" +
- "AAACIAAAEQAAAKIBAAADIAAAAgAAAJECAAAAIAAAAQAAAJ8CAAAAEAAAAQAAALACAAA=");
-
- public static void main(String[] args) {
- art.Main.bindAgentJNIForClass(Main.class);
- doTest(new Transform());
- }
-
- static class DoRedefinitionClass implements Runnable {
- @Override
- public void run() {
- System.out.println("transforming calling function");
- doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
- throw new Error("Throwing exception into an obsolete method!");
- }
+ public static void main(String[] args) throws Exception {
+ art.Test946.run();
}
-
- public static void doTest(Transform t) {
- t.sayHi(() -> { System.out.println("Not doing anything here"); });
- try {
- t.sayHi(new DoRedefinitionClass());
- } catch (Throwable e) {
- System.out.println("Received error : " + e);
- e.printStackTrace(System.out);
- }
- t.sayHi(() -> { System.out.println("Not doing anything here"); });
- }
-
- // Transforms the class
- private static native void doCommonClassRedefinition(Class<?> target,
- byte[] classfile,
- byte[] dexfile);
}
diff --git a/test/946-obsolete-throw/src/Transform.java b/test/946-obsolete-throw/src/Transform.java
deleted file mode 100644
index 4f43086d32..0000000000
--- a/test/946-obsolete-throw/src/Transform.java
+++ /dev/null
@@ -1,30 +0,0 @@
-/*
- * Copyright (C) 2017 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
- public void sayHi(Runnable r) {
- // Use lower 'h' to make sure the string will have a different string id
- // than the transformation (the transformation code is the same except
- // the actual printed String, which was making the test inacurately passing
- // in JIT mode when loading the string from the dex cache, as the string ids
- // of the two different strings were the same).
- // We know the string ids will be different because lexicographically:
- // "Hello" < "LTransform;" < "hello".
- System.out.println("hello");
- r.run();
- System.out.println("goodbye");
- }
-}
diff --git a/test/946-obsolete-throw/src/art/Redefinition.java b/test/946-obsolete-throw/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/946-obsolete-throw/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/946-obsolete-throw/src/art/Test946.java b/test/946-obsolete-throw/src/art/Test946.java
new file mode 100644
index 0000000000..9f0e57c333
--- /dev/null
+++ b/test/946-obsolete-throw/src/art/Test946.java
@@ -0,0 +1,95 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.Base64;
+
+public class Test946 {
+
+ static class Transform {
+ public void sayHi(Runnable r) {
+ System.out.println("hello");
+ r.run();
+ System.out.println("goodbye");
+ }
+ }
+
+ // static class Transform {
+ // public void sayHi(Runnable r) {
+ // System.out.println("Hello - Transformed");
+ // r.run();
+ // System.out.println("Goodbye - Transformed");
+ // }
+ // }
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAKAoACAARCQASABMIABQKABUAFgsAFwAYCAAZBwAbBwAeAQAGPGluaXQ+AQADKClW" +
+ "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
+ "KVYBAApTb3VyY2VGaWxlAQAMVGVzdDk0Ni5qYXZhDAAJAAoHAB8MACAAIQEAE0hlbGxvIC0gVHJh" +
+ "bnNmb3JtZWQHACIMACMAJAcAJQwAJgAKAQAVR29vZGJ5ZSAtIFRyYW5zZm9ybWVkBwAnAQAVYXJ0" +
+ "L1Rlc3Q5NDYkVHJhbnNmb3JtAQAJVHJhbnNmb3JtAQAMSW5uZXJDbGFzc2VzAQAQamF2YS9sYW5n" +
+ "L09iamVjdAEAEGphdmEvbGFuZy9TeXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsB" +
+ "ABNqYXZhL2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgEA" +
+ "EmphdmEvbGFuZy9SdW5uYWJsZQEAA3J1bgEAC2FydC9UZXN0OTQ2ACAABwAIAAAAAAACAAAACQAK" +
+ "AAEACwAAAB0AAQABAAAABSq3AAGxAAAAAQAMAAAABgABAAAABQABAA0ADgABAAsAAAA7AAIAAgAA" +
+ "ABeyAAISA7YABCu5AAUBALIAAhIGtgAEsQAAAAEADAAAABIABAAAAAcACAAIAA4ACQAWAAoAAgAP" +
+ "AAAAAgAQAB0AAAAKAAEABwAaABwACA==");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQB0mzt6AAAAAAAAAAAAAAAAAAAAAAAAAAA8BAAAcAAAAHhWNBIAAAAAAAAAAHgDAAAX" +
+ "AAAAcAAAAAoAAADMAAAAAwAAAPQAAAABAAAAGAEAAAUAAAAgAQAAAQAAAEgBAADUAgAAaAEAAGgB" +
+ "AABwAQAAhwEAAJwBAAC1AQAAxAEAAOgBAAAIAgAAHwIAADMCAABJAgAAXQIAAHECAAB/AgAAigIA" +
+ "AI0CAACRAgAAngIAAKQCAACpAgAAsgIAALcCAAC+AgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAA" +
+ "CQAAAAoAAAALAAAADgAAAA4AAAAJAAAAAAAAAA8AAAAJAAAAyAIAAA8AAAAJAAAA0AIAAAgABAAS" +
+ "AAAAAAAAAAAAAAAAAAEAFQAAAAQAAgATAAAABQAAAAAAAAAGAAAAFAAAAAAAAAAAAAAABQAAAAAA" +
+ "AAAMAAAAaAMAADwDAAAAAAAABjxpbml0PgAVR29vZGJ5ZSAtIFRyYW5zZm9ybWVkABNIZWxsbyAt" +
+ "IFRyYW5zZm9ybWVkABdMYXJ0L1Rlc3Q5NDYkVHJhbnNmb3JtOwANTGFydC9UZXN0OTQ2OwAiTGRh" +
+ "bHZpay9hbm5vdGF0aW9uL0VuY2xvc2luZ0NsYXNzOwAeTGRhbHZpay9hbm5vdGF0aW9uL0lubmVy" +
+ "Q2xhc3M7ABVMamF2YS9pby9QcmludFN0cmVhbTsAEkxqYXZhL2xhbmcvT2JqZWN0OwAUTGphdmEv" +
+ "bGFuZy9SdW5uYWJsZTsAEkxqYXZhL2xhbmcvU3RyaW5nOwASTGphdmEvbGFuZy9TeXN0ZW07AAxU" +
+ "ZXN0OTQ2LmphdmEACVRyYW5zZm9ybQABVgACVkwAC2FjY2Vzc0ZsYWdzAARuYW1lAANvdXQAB3By" +
+ "aW50bG4AA3J1bgAFc2F5SGkABXZhbHVlAAAAAAEAAAAGAAAAAQAAAAcAAAAFAAcOAAcBAAcOAQgP" +
+ "AQMPAQgPAAEAAQABAAAA2AIAAAQAAABwEAMAAAAOAAQAAgACAAAA3QIAABQAAABiAAAAGwECAAAA" +
+ "biACABAAchAEAAMAYgAAABsBAQAAAG4gAgAQAA4AAAABAQCAgATsBQEBhAYAAAICARYYAQIDAhAE" +
+ "CBEXDQACAAAATAMAAFIDAABcAwAAAAAAAAAAAAAAAAAAEAAAAAAAAAABAAAAAAAAAAEAAAAXAAAA" +
+ "cAAAAAIAAAAKAAAAzAAAAAMAAAADAAAA9AAAAAQAAAABAAAAGAEAAAUAAAAFAAAAIAEAAAYAAAAB" +
+ "AAAASAEAAAIgAAAXAAAAaAEAAAEQAAACAAAAyAIAAAMgAAACAAAA2AIAAAEgAAACAAAA7AIAAAAg" +
+ "AAABAAAAPAMAAAQgAAACAAAATAMAAAMQAAABAAAAXAMAAAYgAAABAAAAaAMAAAAQAAABAAAAeAMA" +
+ "AA==");
+
+ public static void run() {
+ doTest(new Transform());
+ }
+
+ static class DoRedefinitionClass implements Runnable {
+ @Override
+ public void run() {
+ System.out.println("transforming calling function");
+ Redefinition.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+ throw new Error("Throwing exception into an obsolete method!");
+ }
+ }
+
+ public static void doTest(Transform t) {
+ t.sayHi(() -> { System.out.println("Not doing anything here"); });
+ try {
+ t.sayHi(new DoRedefinitionClass());
+ } catch (Throwable e) {
+ System.out.println("Received error : " + e);
+ e.printStackTrace(System.out);
+ }
+ t.sayHi(() -> { System.out.println("Not doing anything here"); });
+ }
+}
diff --git a/test/947-reflect-method/src/Main.java b/test/947-reflect-method/src/Main.java
index da746ac4db..bc3f4b2cf4 100644
--- a/test/947-reflect-method/src/Main.java
+++ b/test/947-reflect-method/src/Main.java
@@ -14,60 +14,8 @@
* limitations under the License.
*/
-import java.util.Base64;
-import java.lang.reflect.Method;
-
public class Main {
-
- /**
- * base64 encoded class/dex file for
- * class Transform {
- * public void sayHi() {
- * System.out.println("Goodbye");
- * }
- * }
- */
- private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
- "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
- "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
- "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
- "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
- "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" +
- "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
- "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0=");
- private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
- "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
- "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
- "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
- "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
- "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
- "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
- "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
- "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
- "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
- "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
- "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
- "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
- "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
-
- public static void main(String[] args) {
- art.Main.bindAgentJNIForClass(Main.class);
- doTest(new Transform());
+ public static void main(String[] args) throws Exception {
+ art.Test947.run();
}
-
- public static void doTest(Transform t) {
- try {
- Method say_hi_method = t.getClass().getDeclaredMethod("sayHi");
- say_hi_method.invoke(t);
- doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
- say_hi_method.invoke(t);
- } catch (Exception e) {
- e.printStackTrace();
- }
- }
-
- // Transforms the class
- private static native void doCommonClassRedefinition(Class<?> target,
- byte[] class_file,
- byte[] dex_file);
}
diff --git a/test/947-reflect-method/src/Transform.java b/test/947-reflect-method/src/Transform.java
deleted file mode 100644
index b8fe34aef3..0000000000
--- a/test/947-reflect-method/src/Transform.java
+++ /dev/null
@@ -1,28 +0,0 @@
-/*
- * Copyright (C) 2017 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
- public void sayHi() {
- // Use lower 'h' to make sure the string will have a different string id
- // than the transformation (the transformation code is the same except
- // the actual printed String, which was making the test inacurately passing
- // in JIT mode when loading the string from the dex cache, as the string ids
- // of the two different strings were the same).
- // We know the string ids will be different because lexicographically:
- // "Goodbye" < "LTransform;" < "hello".
- System.out.println("hello");
- }
-}
diff --git a/test/947-reflect-method/src/art/Redefinition.java b/test/947-reflect-method/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/947-reflect-method/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/947-reflect-method/src/art/Test947.java b/test/947-reflect-method/src/art/Test947.java
new file mode 100644
index 0000000000..8cb515e492
--- /dev/null
+++ b/test/947-reflect-method/src/art/Test947.java
@@ -0,0 +1,82 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.Base64;
+import java.lang.reflect.Method;
+
+public class Test947 {
+
+ static class Transform {
+ public void sayHi() {
+ System.out.println("hello");
+ }
+ }
+
+
+ /**
+ * base64 encoded class/dex file for
+ * static class Transform {
+ * public void sayHi() {
+ * System.out.println("Goodbye");
+ * }
+ * }
+ */
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAIAoABgAOCQAPABAIABEKABIAEwcAFQcAGAEABjxpbml0PgEAAygpVgEABENvZGUB" +
+ "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAAxUZXN0OTQ3LmphdmEMAAcA" +
+ "CAcAGQwAGgAbAQAHR29vZGJ5ZQcAHAwAHQAeBwAfAQAVYXJ0L1Rlc3Q5NDckVHJhbnNmb3JtAQAJ" +
+ "VHJhbnNmb3JtAQAMSW5uZXJDbGFzc2VzAQAQamF2YS9sYW5nL09iamVjdAEAEGphdmEvbGFuZy9T" +
+ "eXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsBABNqYXZhL2lvL1ByaW50U3RyZWFt" +
+ "AQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgEAC2FydC9UZXN0OTQ3ACAABQAGAAAA" +
+ "AAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAABQABAAsACAABAAkA" +
+ "AAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAAHAAgACAACAAwAAAACAA0AFwAAAAoA" +
+ "AQAFABQAFgAI");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQCEgoKcAAAAAAAAAAAAAAAAAAAAAAAAAAC4AwAAcAAAAHhWNBIAAAAAAAAAAPQCAAAU" +
+ "AAAAcAAAAAkAAADAAAAAAgAAAOQAAAABAAAA/AAAAAQAAAAEAQAAAQAAACQBAAB0AgAARAEAAEQB" +
+ "AABMAQAAVQEAAG4BAAB9AQAAoQEAAMEBAADYAQAA7AEAAAACAAAUAgAAIgIAAC0CAAAwAgAANAIA" +
+ "AEECAABHAgAATAIAAFUCAABcAgAAAgAAAAMAAAAEAAAABQAAAAYAAAAHAAAACAAAAAkAAAAMAAAA" +
+ "DAAAAAgAAAAAAAAADQAAAAgAAABkAgAABwAEABAAAAAAAAAAAAAAAAAAAAASAAAABAABABEAAAAF" +
+ "AAAAAAAAAAAAAAAAAAAABQAAAAAAAAAKAAAA5AIAALgCAAAAAAAABjxpbml0PgAHR29vZGJ5ZQAX" +
+ "TGFydC9UZXN0OTQ3JFRyYW5zZm9ybTsADUxhcnQvVGVzdDk0NzsAIkxkYWx2aWsvYW5ub3RhdGlv" +
+ "bi9FbmNsb3NpbmdDbGFzczsAHkxkYWx2aWsvYW5ub3RhdGlvbi9Jbm5lckNsYXNzOwAVTGphdmEv" +
+ "aW8vUHJpbnRTdHJlYW07ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwAS" +
+ "TGphdmEvbGFuZy9TeXN0ZW07AAxUZXN0OTQ3LmphdmEACVRyYW5zZm9ybQABVgACVkwAC2FjY2Vz" +
+ "c0ZsYWdzAARuYW1lAANvdXQAB3ByaW50bG4ABXNheUhpAAV2YWx1ZQAAAQAAAAYAAAAFAAcOAAcA" +
+ "Bw4BCA8AAAAAAQABAAEAAABsAgAABAAAAHAQAwAAAA4AAwABAAIAAABxAgAACQAAAGIAAAAbAQEA" +
+ "AABuIAIAEAAOAAAAAAABAQCAgAT8BAEBlAUAAAICARMYAQIDAg4ECA8XCwACAAAAyAIAAM4CAADY" +
+ "AgAAAAAAAAAAAAAAAAAAEAAAAAAAAAABAAAAAAAAAAEAAAAUAAAAcAAAAAIAAAAJAAAAwAAAAAMA" +
+ "AAACAAAA5AAAAAQAAAABAAAA/AAAAAUAAAAEAAAABAEAAAYAAAABAAAAJAEAAAIgAAAUAAAARAEA" +
+ "AAEQAAABAAAAZAIAAAMgAAACAAAAbAIAAAEgAAACAAAAfAIAAAAgAAABAAAAuAIAAAQgAAACAAAA" +
+ "yAIAAAMQAAABAAAA2AIAAAYgAAABAAAA5AIAAAAQAAABAAAA9AIAAA==");
+
+ public static void run() {
+ doTest(new Transform());
+ }
+
+ public static void doTest(Transform t) {
+ try {
+ Method say_hi_method = t.getClass().getDeclaredMethod("sayHi");
+ say_hi_method.invoke(t);
+ Redefinition.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+ say_hi_method.invoke(t);
+ } catch (Exception e) {
+ e.printStackTrace();
+ }
+ }
+}
diff --git a/test/948-change-annotations/src/Main.java b/test/948-change-annotations/src/Main.java
index a290396ebf..5d3406dacc 100644
--- a/test/948-change-annotations/src/Main.java
+++ b/test/948-change-annotations/src/Main.java
@@ -14,6 +14,7 @@
* limitations under the License.
*/
+import art.Redefinition;
import java.util.Arrays;
import java.util.Base64;
import java.util.Comparator;
@@ -85,7 +86,9 @@ public class Main {
}
// Transforms the class
- public static native void doCommonClassRedefinition(Class<?> target,
- byte[] class_file,
- byte[] dex_file);
+ public static void doCommonClassRedefinition(Class<?> target,
+ byte[] class_file,
+ byte[] dex_file) {
+ Redefinition.doCommonClassRedefinition(target, class_file, dex_file);
+ }
}
diff --git a/test/948-change-annotations/src/art/Redefinition.java b/test/948-change-annotations/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/948-change-annotations/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/949-in-memory-transform/src/Main.java b/test/949-in-memory-transform/src/Main.java
index 1a6b224a37..b49a93f67b 100644
--- a/test/949-in-memory-transform/src/Main.java
+++ b/test/949-in-memory-transform/src/Main.java
@@ -14,112 +14,8 @@
* limitations under the License.
*/
-import java.util.Base64;
-import java.lang.reflect.*;
-import java.nio.ByteBuffer;
-
public class Main {
- /**
- * base64 encoded class/dex file for
- * public class Transform {
- * public void sayHi() {
- * System.out.println("hello");
- * }
- * }
- */
- private static final byte[] INITIAL_CLASS_BYTES = Base64.getDecoder().decode(
- "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
- "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
- "BwAIBwAWDAAXABgBAAVoZWxsbwcAGQwAGgAbAQAJVHJhbnNmb3JtAQAQamF2YS9sYW5nL09iamVj" +
- "dAEAEGphdmEvbGFuZy9TeXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsBABNqYXZh" +
- "L2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgAhAAUABgAA" +
- "AAAAAgABAAcACAABAAkAAAAdAAEAAQAAAAUqtwABsQAAAAEACgAAAAYAAQAAABEAAQALAAgAAQAJ" +
- "AAAAJQACAAEAAAAJsgACEgO2AASxAAAAAQAKAAAACgACAAAAGgAIABsAAQAMAAAAAgAN");
- private static final byte[] INITIAL_DEX_BYTES = Base64.getDecoder().decode(
- "ZGV4CjAzNQAJX3mZphwHJCT1qdTz/GS+jXOR+O/9e3fMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
- "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
- "AABqAQAAdwEAAI4BAACiAQAAtgEAAMoBAADaAQAA3QEAAOEBAAD1AQAA/AEAAAECAAAKAgAAAQAA" +
- "AAIAAAADAAAABAAAAAUAAAAHAAAABwAAAAUAAAAAAAAACAAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
- "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAABAAAAAgAAAAAAAAAGAAAAAAAAABwCAAAA" +
- "AAAAAQABAAEAAAARAgAABAAAAHAQAwAAAA4AAwABAAIAAAAWAgAACQAAAGIAAAAbAQoAAABuIAIA" +
- "EAAOAAAAAQAAAAMABjxpbml0PgALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwAS" +
- "TGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xhbmcvU3lzdGVt" +
- "OwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTQuMjUABWhlbGxvAANvdXQA" +
- "B3ByaW50bG4ABXNheUhpABEABw4AGgAHDocAAAABAQCBgASgAgEBuAIAAA0AAAAAAAAAAQAAAAAA" +
- "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
- "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
- "AgAAABECAAAAIAAAAQAAABwCAAAAEAAAAQAAACwCAAA=");
-
-
- /**
- * base64 encoded class/dex file for
- * public class Transform {
- * public void sayHi() {
- * System.out.println("Goodbye");
- * }
- * }
- */
- private static final byte[] TRANSFORMED_CLASS_BYTES = Base64.getDecoder().decode(
- "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
- "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
- "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
- "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
- "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACEABQAG" +
- "AAAAAAACAAEABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
- "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAAaAAgAGwABAAwAAAACAA0=");
- private static final byte[] TRANSFORMED_DEX_BYTES = Base64.getDecoder().decode(
- "ZGV4CjAzNQAPXh6T3l1FObhHsKf1U2vi+0GmAvElxBLMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
- "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
- "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
- "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
- "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAABAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
- "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
- "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
- "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
- "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTQuMjUAA291" +
- "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgAaAAcOhwAAAAEBAIGABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
- "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
- "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
- "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
-
public static void main(String[] args) throws Exception {
- art.Main.bindAgentJNIForClass(Main.class);
- ClassLoader loader;
- try {
- // Art uses this classloader to do in-memory dex files. There is no support for defineClass
- loader = (ClassLoader)Class.forName("dalvik.system.InMemoryDexClassLoader")
- .getConstructor(ByteBuffer.class, ClassLoader.class)
- .newInstance(ByteBuffer.wrap(INITIAL_DEX_BYTES),
- ClassLoader.getSystemClassLoader());
- } catch (ClassNotFoundException e) {
- // Seem to be on RI. Just make a new ClassLoader that calls defineClass.
- loader = new ClassLoader() {
- public Class<?> findClass(String name) throws ClassNotFoundException {
- if (name.equals("Transform")) {
- return defineClass(name, INITIAL_CLASS_BYTES, 0, INITIAL_CLASS_BYTES.length);
- } else {
- throw new ClassNotFoundException("Couldn't find class: " + name);
- }
- }
- };
- }
- doTest(loader);
+ art.Test949.run();
}
-
- public static void doTest(ClassLoader loader) throws Exception {
- // Get the class
- Class<?> transform_class = loader.loadClass("Transform");
- Method say_hi_method = transform_class.getMethod("sayHi");
- Object t = transform_class.newInstance();
-
- // Run the actual test.
- say_hi_method.invoke(t);
- doCommonClassRedefinition(transform_class, TRANSFORMED_CLASS_BYTES, TRANSFORMED_DEX_BYTES);
- say_hi_method.invoke(t);
- }
-
- // Transforms the class
- private static native void doCommonClassRedefinition(Class<?> target,
- byte[] class_file,
- byte[] dex_file);
}
diff --git a/test/949-in-memory-transform/src/art/Redefinition.java b/test/949-in-memory-transform/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/949-in-memory-transform/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/949-in-memory-transform/src/art/Test949.java b/test/949-in-memory-transform/src/art/Test949.java
new file mode 100644
index 0000000000..cd733b9f2d
--- /dev/null
+++ b/test/949-in-memory-transform/src/art/Test949.java
@@ -0,0 +1,123 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import static art.Redefinition.doCommonClassRedefinition;
+
+import java.util.Base64;
+import java.lang.reflect.*;
+import java.nio.ByteBuffer;
+
+public class Test949 {
+ /**
+ * base64 encoded class/dex file for
+ * public class Transform {
+ * public void sayHi() {
+ * System.out.println("hello");
+ * }
+ * }
+ */
+ private static final byte[] INITIAL_CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+ "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
+ "BwAIBwAWDAAXABgBAAVoZWxsbwcAGQwAGgAbAQAJVHJhbnNmb3JtAQAQamF2YS9sYW5nL09iamVj" +
+ "dAEAEGphdmEvbGFuZy9TeXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsBABNqYXZh" +
+ "L2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgAhAAUABgAA" +
+ "AAAAAgABAAcACAABAAkAAAAdAAEAAQAAAAUqtwABsQAAAAEACgAAAAYAAQAAABEAAQALAAgAAQAJ" +
+ "AAAAJQACAAEAAAAJsgACEgO2AASxAAAAAQAKAAAACgACAAAAGgAIABsAAQAMAAAAAgAN");
+ private static final byte[] INITIAL_DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQAJX3mZphwHJCT1qdTz/GS+jXOR+O/9e3fMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+ "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+ "AABqAQAAdwEAAI4BAACiAQAAtgEAAMoBAADaAQAA3QEAAOEBAAD1AQAA/AEAAAECAAAKAgAAAQAA" +
+ "AAIAAAADAAAABAAAAAUAAAAHAAAABwAAAAUAAAAAAAAACAAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+ "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAABAAAAAgAAAAAAAAAGAAAAAAAAABwCAAAA" +
+ "AAAAAQABAAEAAAARAgAABAAAAHAQAwAAAA4AAwABAAIAAAAWAgAACQAAAGIAAAAbAQoAAABuIAIA" +
+ "EAAOAAAAAQAAAAMABjxpbml0PgALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwAS" +
+ "TGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xhbmcvU3lzdGVt" +
+ "OwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTQuMjUABWhlbGxvAANvdXQA" +
+ "B3ByaW50bG4ABXNheUhpABEABw4AGgAHDocAAAABAQCBgASgAgEBuAIAAA0AAAAAAAAAAQAAAAAA" +
+ "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+ "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+ "AgAAABECAAAAIAAAAQAAABwCAAAAEAAAAQAAACwCAAA=");
+
+
+ /**
+ * base64 encoded class/dex file for
+ * public class Transform {
+ * public void sayHi() {
+ * System.out.println("Goodbye");
+ * }
+ * }
+ */
+ private static final byte[] TRANSFORMED_CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+ "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
+ "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
+ "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
+ "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACEABQAG" +
+ "AAAAAAACAAEABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
+ "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAAaAAgAGwABAAwAAAACAA0=");
+ private static final byte[] TRANSFORMED_DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQAPXh6T3l1FObhHsKf1U2vi+0GmAvElxBLMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+ "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+ "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
+ "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+ "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAABAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
+ "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
+ "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
+ "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
+ "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTQuMjUAA291" +
+ "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgAaAAcOhwAAAAEBAIGABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
+ "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+ "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+ "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
+
+ public static void run() throws Exception {
+ ClassLoader loader;
+ try {
+ // Art uses this classloader to do in-memory dex files. There is no support for defineClass
+ loader = (ClassLoader)Class.forName("dalvik.system.InMemoryDexClassLoader")
+ .getConstructor(ByteBuffer.class, ClassLoader.class)
+ .newInstance(ByteBuffer.wrap(INITIAL_DEX_BYTES),
+ ClassLoader.getSystemClassLoader());
+ } catch (ClassNotFoundException e) {
+ // Seem to be on RI. Just make a new ClassLoader that calls defineClass.
+ loader = new ClassLoader() {
+ public Class<?> findClass(String name) throws ClassNotFoundException {
+ if (name.equals("Transform")) {
+ return defineClass(name, INITIAL_CLASS_BYTES, 0, INITIAL_CLASS_BYTES.length);
+ } else {
+ throw new ClassNotFoundException("Couldn't find class: " + name);
+ }
+ }
+ };
+ }
+ doTest(loader);
+ }
+
+ public static void doTest(ClassLoader loader) throws Exception {
+ // Get the class
+ Class<?> transform_class = loader.loadClass("Transform");
+ Method say_hi_method = transform_class.getMethod("sayHi");
+ Object t = transform_class.newInstance();
+
+ // Run the actual test.
+ say_hi_method.invoke(t);
+ doCommonClassRedefinition(transform_class, TRANSFORMED_CLASS_BYTES, TRANSFORMED_DEX_BYTES);
+ say_hi_method.invoke(t);
+ }
+}
diff --git a/test/950-redefine-intrinsic/src/Main.java b/test/950-redefine-intrinsic/src/Main.java
index 2578d6e278..369a8f417e 100644
--- a/test/950-redefine-intrinsic/src/Main.java
+++ b/test/950-redefine-intrinsic/src/Main.java
@@ -14,6 +14,7 @@
* limitations under the License.
*/
+import static art.Redefinition.doCommonClassRedefinition;
import java.util.Base64;
import java.util.Random;
import java.util.function.*;
@@ -464,9 +465,4 @@ public class Main {
}
System.out.println("Finished!");
}
-
- // Transforms the class
- private static native void doCommonClassRedefinition(Class<?> target,
- byte[] class_file,
- byte[] dex_file);
}
diff --git a/test/950-redefine-intrinsic/src/art/Redefinition.java b/test/950-redefine-intrinsic/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/950-redefine-intrinsic/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/951-threaded-obsolete/src/Main.java b/test/951-threaded-obsolete/src/Main.java
index a82090e736..d245aa9ec8 100644
--- a/test/951-threaded-obsolete/src/Main.java
+++ b/test/951-threaded-obsolete/src/Main.java
@@ -1,5 +1,5 @@
/*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
@@ -14,84 +14,8 @@
* limitations under the License.
*/
-import java.util.Base64;
-import java.util.concurrent.Semaphore;
-
public class Main {
- // class Transform {
- // public void sayHi(Runnable r) {
- // System.out.println("Hello - Transformed");
- // r.run();
- // System.out.println("Goodbye - Transformed");
- // }
- // }
- private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
- "yv66vgAAADQAJAoACAARCQASABMIABQKABUAFgsAFwAYCAAZBwAaBwAbAQAGPGluaXQ+AQADKClW" +
- "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
- "KVYBAApTb3VyY2VGaWxlAQAOVHJhbnNmb3JtLmphdmEMAAkACgcAHAwAHQAeAQATSGVsbG8gLSBU" +
- "cmFuc2Zvcm1lZAcAHwwAIAAhBwAiDAAjAAoBABVHb29kYnllIC0gVHJhbnNmb3JtZWQBAAlUcmFu" +
- "c2Zvcm0BABBqYXZhL2xhbmcvT2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZh" +
- "L2lvL1ByaW50U3RyZWFtOwEAE2phdmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZh" +
- "L2xhbmcvU3RyaW5nOylWAQASamF2YS9sYW5nL1J1bm5hYmxlAQADcnVuACAABwAIAAAAAAACAAAA" +
- "CQAKAAEACwAAAB0AAQABAAAABSq3AAGxAAAAAQAMAAAABgABAAAAAQABAA0ADgABAAsAAAA7AAIA" +
- "AgAAABeyAAISA7YABCu5AAUBALIAAhIGtgAEsQAAAAEADAAAABIABAAAAAMACAAEAA4ABQAWAAYA" +
- "AQAPAAAAAgAQ");
- private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
- "ZGV4CjAzNQAYeAMMXgYWxoeSHAS9EWKCCtVRSAGpqZVQAwAAcAAAAHhWNBIAAAAAAAAAALACAAAR" +
- "AAAAcAAAAAcAAAC0AAAAAwAAANAAAAABAAAA9AAAAAUAAAD8AAAAAQAAACQBAAAMAgAARAEAAKIB" +
- "AACqAQAAwQEAANYBAADjAQAA+gEAAA4CAAAkAgAAOAIAAEwCAABcAgAAXwIAAGMCAAB3AgAAfAIA" +
- "AIUCAACKAgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACgAAAAoAAAAGAAAAAAAAAAsAAAAGAAAA" +
- "lAEAAAsAAAAGAAAAnAEAAAUAAQANAAAAAAAAAAAAAAAAAAEAEAAAAAEAAgAOAAAAAgAAAAAAAAAD" +
- "AAAADwAAAAAAAAAAAAAAAgAAAAAAAAAJAAAAAAAAAJ8CAAAAAAAAAQABAAEAAACRAgAABAAAAHAQ" +
- "AwAAAA4ABAACAAIAAACWAgAAFAAAAGIAAAAbAQIAAABuIAIAEAByEAQAAwBiAAAAGwEBAAAAbiAC" +
- "ABAADgABAAAAAwAAAAEAAAAEAAY8aW5pdD4AFUdvb2RieWUgLSBUcmFuc2Zvcm1lZAATSGVsbG8g" +
- "LSBUcmFuc2Zvcm1lZAALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwASTGphdmEv" +
- "bGFuZy9PYmplY3Q7ABRMamF2YS9sYW5nL1J1bm5hYmxlOwASTGphdmEvbGFuZy9TdHJpbmc7ABJM" +
- "amF2YS9sYW5nL1N5c3RlbTsADlRyYW5zZm9ybS5qYXZhAAFWAAJWTAASZW1pdHRlcjogamFjay00" +
- "LjEzAANvdXQAB3ByaW50bG4AA3J1bgAFc2F5SGkAAQAHDgADAQAHDoc8hwAAAAEBAICABMQCAQHc" +
- "AgAAAA0AAAAAAAAAAQAAAAAAAAABAAAAEQAAAHAAAAACAAAABwAAALQAAAADAAAAAwAAANAAAAAE" +
- "AAAAAQAAAPQAAAAFAAAABQAAAPwAAAAGAAAAAQAAACQBAAABIAAAAgAAAEQBAAABEAAAAgAAAJQB" +
- "AAACIAAAEQAAAKIBAAADIAAAAgAAAJECAAAAIAAAAQAAAJ8CAAAAEAAAAQAAALACAAA=");
-
- public static void main(String[] args) {
- art.Main.bindAgentJNIForClass(Main.class);
- // Semaphores to let each thread know where the other is. We could use barriers but semaphores
- // mean we don't need to have the worker thread be waiting around.
- final Semaphore sem_redefine_start = new Semaphore(0);
- final Semaphore sem_redefine_end = new Semaphore(0);
- // Create a thread to do the actual redefinition. We will just communicate through an
- // atomic-integer.
- new Thread(() -> {
- try {
- // Wait for the other thread to ask for redefinition.
- sem_redefine_start.acquire();
- // Do the redefinition.
- doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
- // Allow the other thread to wake up if it is waiting.
- sem_redefine_end.release();
- } catch (InterruptedException e) {
- throw new Error("unable to do redefinition", e);
- }
- }).start();
-
- Transform t = new Transform();
- t.sayHi(() -> { System.out.println("Not doing anything here"); });
- t.sayHi(() -> {
- try {
- System.out.println("transforming calling function");
- // Wake up the waiting thread.
- sem_redefine_start.release();
- // Wait for the other thread to finish with redefinition.
- sem_redefine_end.acquire();
- } catch (InterruptedException e) {
- throw new Error("unable to do redefinition", e);
- }
- });
- t.sayHi(() -> { System.out.println("Not doing anything here"); });
+ public static void main(String[] args) throws Exception {
+ art.Test951.run();
}
-
- // Transforms the class
- private static native void doCommonClassRedefinition(Class<?> target,
- byte[] classfile,
- byte[] dexfile);
}
diff --git a/test/951-threaded-obsolete/src/Transform.java b/test/951-threaded-obsolete/src/Transform.java
deleted file mode 100644
index 8cda6cdf53..0000000000
--- a/test/951-threaded-obsolete/src/Transform.java
+++ /dev/null
@@ -1,30 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
- public void sayHi(Runnable r) {
- // Use lower 'h' to make sure the string will have a different string id
- // than the transformation (the transformation code is the same except
- // the actual printed String, which was making the test inacurately passing
- // in JIT mode when loading the string from the dex cache, as the string ids
- // of the two different strings were the same).
- // We know the string ids will be different because lexicographically:
- // "Hello" < "LTransform;" < "hello".
- System.out.println("hello");
- r.run();
- System.out.println("goodbye");
- }
-}
diff --git a/test/951-threaded-obsolete/src/art/Redefinition.java b/test/951-threaded-obsolete/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/951-threaded-obsolete/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/951-threaded-obsolete/src/art/Test951.java b/test/951-threaded-obsolete/src/art/Test951.java
new file mode 100644
index 0000000000..3628f4f9db
--- /dev/null
+++ b/test/951-threaded-obsolete/src/art/Test951.java
@@ -0,0 +1,108 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.Base64;
+import java.util.concurrent.Semaphore;
+
+public class Test951 {
+
+ static class Transform {
+ public void sayHi(Runnable r) {
+ System.out.println("hello");
+ r.run();
+ System.out.println("goodbye");
+ }
+ }
+
+ // static class Transform {
+ // public void sayHi(Runnable r) {
+ // System.out.println("Hello - Transformed");
+ // r.run();
+ // System.out.println("Goodbye - Transformed");
+ // }
+ // }
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAKAoACAARCQASABMIABQKABUAFgsAFwAYCAAZBwAbBwAeAQAGPGluaXQ+AQADKClW" +
+ "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
+ "KVYBAApTb3VyY2VGaWxlAQAMVGVzdDk1MS5qYXZhDAAJAAoHAB8MACAAIQEAE0hlbGxvIC0gVHJh" +
+ "bnNmb3JtZWQHACIMACMAJAcAJQwAJgAKAQAVR29vZGJ5ZSAtIFRyYW5zZm9ybWVkBwAnAQAVYXJ0" +
+ "L1Rlc3Q5NTEkVHJhbnNmb3JtAQAJVHJhbnNmb3JtAQAMSW5uZXJDbGFzc2VzAQAQamF2YS9sYW5n" +
+ "L09iamVjdAEAEGphdmEvbGFuZy9TeXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsB" +
+ "ABNqYXZhL2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgEA" +
+ "EmphdmEvbGFuZy9SdW5uYWJsZQEAA3J1bgEAC2FydC9UZXN0OTUxACAABwAIAAAAAAACAAAACQAK" +
+ "AAEACwAAAB0AAQABAAAABSq3AAGxAAAAAQAMAAAABgABAAAABQABAA0ADgABAAsAAAA7AAIAAgAA" +
+ "ABeyAAISA7YABCu5AAUBALIAAhIGtgAEsQAAAAEADAAAABIABAAAAAcACAAIAA4ACQAWAAoAAgAP" +
+ "AAAAAgAQAB0AAAAKAAEABwAaABwACA==");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQBom/JeAAAAAAAAAAAAAAAAAAAAAAAAAAA8BAAAcAAAAHhWNBIAAAAAAAAAAHgDAAAX" +
+ "AAAAcAAAAAoAAADMAAAAAwAAAPQAAAABAAAAGAEAAAUAAAAgAQAAAQAAAEgBAADUAgAAaAEAAGgB" +
+ "AABwAQAAhwEAAJwBAAC1AQAAxAEAAOgBAAAIAgAAHwIAADMCAABJAgAAXQIAAHECAAB/AgAAigIA" +
+ "AI0CAACRAgAAngIAAKQCAACpAgAAsgIAALcCAAC+AgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAA" +
+ "CQAAAAoAAAALAAAADgAAAA4AAAAJAAAAAAAAAA8AAAAJAAAAyAIAAA8AAAAJAAAA0AIAAAgABAAS" +
+ "AAAAAAAAAAAAAAAAAAEAFQAAAAQAAgATAAAABQAAAAAAAAAGAAAAFAAAAAAAAAAAAAAABQAAAAAA" +
+ "AAAMAAAAaAMAADwDAAAAAAAABjxpbml0PgAVR29vZGJ5ZSAtIFRyYW5zZm9ybWVkABNIZWxsbyAt" +
+ "IFRyYW5zZm9ybWVkABdMYXJ0L1Rlc3Q5NTEkVHJhbnNmb3JtOwANTGFydC9UZXN0OTUxOwAiTGRh" +
+ "bHZpay9hbm5vdGF0aW9uL0VuY2xvc2luZ0NsYXNzOwAeTGRhbHZpay9hbm5vdGF0aW9uL0lubmVy" +
+ "Q2xhc3M7ABVMamF2YS9pby9QcmludFN0cmVhbTsAEkxqYXZhL2xhbmcvT2JqZWN0OwAUTGphdmEv" +
+ "bGFuZy9SdW5uYWJsZTsAEkxqYXZhL2xhbmcvU3RyaW5nOwASTGphdmEvbGFuZy9TeXN0ZW07AAxU" +
+ "ZXN0OTUxLmphdmEACVRyYW5zZm9ybQABVgACVkwAC2FjY2Vzc0ZsYWdzAARuYW1lAANvdXQAB3By" +
+ "aW50bG4AA3J1bgAFc2F5SGkABXZhbHVlAAAAAAEAAAAGAAAAAQAAAAcAAAAFAAcOAAcBAAcOAQgP" +
+ "AQMPAQgPAAEAAQABAAAA2AIAAAQAAABwEAMAAAAOAAQAAgACAAAA3QIAABQAAABiAAAAGwECAAAA" +
+ "biACABAAchAEAAMAYgAAABsBAQAAAG4gAgAQAA4AAAABAQCAgATsBQEBhAYAAAICARYYAQIDAhAE" +
+ "CBEXDQACAAAATAMAAFIDAABcAwAAAAAAAAAAAAAAAAAAEAAAAAAAAAABAAAAAAAAAAEAAAAXAAAA" +
+ "cAAAAAIAAAAKAAAAzAAAAAMAAAADAAAA9AAAAAQAAAABAAAAGAEAAAUAAAAFAAAAIAEAAAYAAAAB" +
+ "AAAASAEAAAIgAAAXAAAAaAEAAAEQAAACAAAAyAIAAAMgAAACAAAA2AIAAAEgAAACAAAA7AIAAAAg" +
+ "AAABAAAAPAMAAAQgAAACAAAATAMAAAMQAAABAAAAXAMAAAYgAAABAAAAaAMAAAAQAAABAAAAeAMA" +
+ "AA==");
+
+ public static void run() {
+ // Semaphores to let each thread know where the other is. We could use barriers but semaphores
+ // mean we don't need to have the worker thread be waiting around.
+ final Semaphore sem_redefine_start = new Semaphore(0);
+ final Semaphore sem_redefine_end = new Semaphore(0);
+ // Create a thread to do the actual redefinition. We will just communicate through an
+ // atomic-integer.
+ new Thread(() -> {
+ try {
+ // Wait for the other thread to ask for redefinition.
+ sem_redefine_start.acquire();
+ // Do the redefinition.
+ Redefinition.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+ // Allow the other thread to wake up if it is waiting.
+ sem_redefine_end.release();
+ } catch (InterruptedException e) {
+ throw new Error("unable to do redefinition", e);
+ }
+ }).start();
+
+ Transform t = new Transform();
+ t.sayHi(() -> { System.out.println("Not doing anything here"); });
+ t.sayHi(() -> {
+ try {
+ System.out.println("transforming calling function");
+ // Wake up the waiting thread.
+ sem_redefine_start.release();
+ // Wait for the other thread to finish with redefinition.
+ sem_redefine_end.acquire();
+ } catch (InterruptedException e) {
+ throw new Error("unable to do redefinition", e);
+ }
+ });
+ t.sayHi(() -> { System.out.println("Not doing anything here"); });
+ }
+}
diff --git a/test/980-redefine-object/check b/test/980-redefine-object/check
index 987066fe15..07b21b3176 100755
--- a/test/980-redefine-object/check
+++ b/test/980-redefine-object/check
@@ -17,4 +17,4 @@
# The number of paused background threads (and therefore InterruptedExceptions)
# can change so we will just delete their lines from the log.
-sed "/Object allocated of type 'Ljava\/lang\/InterruptedException;'/d" "$2" | diff --strip-trailing-cr -q "$1" - >/dev/null
+sed "/Object allocated of type 'java\.lang\.InterruptedException'/d" "$2" | diff --strip-trailing-cr -q "$1" - >/dev/null
diff --git a/test/980-redefine-object/expected.txt b/test/980-redefine-object/expected.txt
index 6e9bce027a..4c294bc870 100644
--- a/test/980-redefine-object/expected.txt
+++ b/test/980-redefine-object/expected.txt
@@ -2,51 +2,31 @@
Allocating an j.l.Object before redefining Object class
Allocating a Transform before redefining Object class
Redefining the Object class to add a hook into the <init> method
-Object allocated of type 'Ljava/lang/StringBuilder;'
-Object allocated of type 'Ljava/nio/HeapCharBuffer;'
Allocating an j.l.Object after redefining Object class
-Object allocated of type 'Ljava/lang/Object;'
-Object allocated of type 'Ljava/lang/StringBuilder;'
-Object allocated of type 'Ljava/nio/HeapCharBuffer;'
+Object allocated of type 'java.lang.Object'
Allocating a Transform after redefining Object class
-Object allocated of type 'LTransform;'
-Object allocated of type 'Ljava/lang/StringBuilder;'
-Object allocated of type 'Ljava/nio/HeapCharBuffer;'
+Object allocated of type 'Transform'
Allocating an int[] after redefining Object class
-Object allocated of type 'Ljava/lang/StringBuilder;'
-Object allocated of type 'Ljava/nio/HeapCharBuffer;'
Allocating an array list
-Object allocated of type 'Ljava/util/ArrayList;'
-Object allocated of type 'Ljava/lang/StringBuilder;'
-Object allocated of type 'Ljava/nio/HeapCharBuffer;'
+Object allocated of type 'java.util.ArrayList'
Adding a bunch of stuff to the array list
-Object allocated of type 'Ljava/lang/Object;'
-Object allocated of type 'Ljava/lang/Object;'
-Object allocated of type 'LTransform;'
-Object allocated of type 'Ljava/lang/StringBuilder;'
-Object allocated of type 'Ljava/nio/HeapCharBuffer;'
+Object allocated of type 'java.lang.Object'
+Object allocated of type 'java.lang.Object'
+Object allocated of type 'Transform'
Allocating a linked list
-Object allocated of type 'Ljava/util/LinkedList;'
-Object allocated of type 'Ljava/lang/StringBuilder;'
-Object allocated of type 'Ljava/nio/HeapCharBuffer;'
+Object allocated of type 'java.util.LinkedList'
Adding a bunch of stuff to the linked list
-Object allocated of type 'Ljava/lang/Object;'
-Object allocated of type 'Ljava/util/LinkedList$Node;'
-Object allocated of type 'Ljava/lang/Object;'
-Object allocated of type 'Ljava/util/LinkedList$Node;'
-Object allocated of type 'Ljava/util/LinkedList$Node;'
-Object allocated of type 'Ljava/util/LinkedList$Node;'
-Object allocated of type 'Ljava/util/LinkedList$Node;'
-Object allocated of type 'Ljava/util/LinkedList$Node;'
-Object allocated of type 'LTransform;'
-Object allocated of type 'Ljava/util/LinkedList$Node;'
-Object allocated of type 'Ljava/lang/StringBuilder;'
-Object allocated of type 'Ljava/nio/HeapCharBuffer;'
+Object allocated of type 'java.lang.Object'
+Object allocated of type 'java.util.LinkedList$Node'
+Object allocated of type 'java.lang.Object'
+Object allocated of type 'java.util.LinkedList$Node'
+Object allocated of type 'java.util.LinkedList$Node'
+Object allocated of type 'java.util.LinkedList$Node'
+Object allocated of type 'java.util.LinkedList$Node'
+Object allocated of type 'java.util.LinkedList$Node'
+Object allocated of type 'Transform'
+Object allocated of type 'java.util.LinkedList$Node'
Throwing from down 4 stack frames
-Object allocated of type 'Ljava/lang/Exception;'
-Object allocated of type 'Ljava/lang/StringBuilder;'
-Object allocated of type 'Ljava/nio/HeapCharBuffer;'
+Object allocated of type 'java.lang.Exception'
Exception caught.
-Object allocated of type 'Ljava/lang/StringBuilder;'
-Object allocated of type 'Ljava/nio/HeapCharBuffer;'
Finishing test!
diff --git a/test/980-redefine-object/redefine_object.cc b/test/980-redefine-object/redefine_object.cc
deleted file mode 100644
index 1faf1a16a7..0000000000
--- a/test/980-redefine-object/redefine_object.cc
+++ /dev/null
@@ -1,58 +0,0 @@
-/*
- * Copyright (C) 2017 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-#include <inttypes.h>
-#include <iostream>
-
-#include "android-base/stringprintf.h"
-#include "base/logging.h"
-#include "base/macros.h"
-#include "jni.h"
-#include "jvmti.h"
-#include "scoped_utf_chars.h"
-
-// Test infrastructure
-#include "jni_binder.h"
-#include "jvmti_helper.h"
-#include "test_env.h"
-
-namespace art {
-namespace Test980RedefineObjects {
-
-extern "C" JNIEXPORT void JNICALL Java_Main_bindFunctionsForClass(
- JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED, jclass target) {
- BindFunctionsOnClass(jvmti_env, env, target);
-}
-
-extern "C" JNIEXPORT void JNICALL Java_art_test_TestWatcher_NotifyConstructed(
- JNIEnv* env, jclass TestWatcherClass ATTRIBUTE_UNUSED, jobject constructed) {
- char* sig = nullptr;
- char* generic_sig = nullptr;
- if (JvmtiErrorToException(env,
- jvmti_env,
- jvmti_env->GetClassSignature(env->GetObjectClass(constructed),
- &sig,
- &generic_sig))) {
- // Exception.
- return;
- }
- std::cout << "Object allocated of type '" << sig << "'" << std::endl;
- jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(sig));
- jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(generic_sig));
-}
-
-} // namespace Test980RedefineObjects
-} // namespace art
diff --git a/test/980-redefine-object/src-ex/TestWatcher.java b/test/980-redefine-object/src-ex/TestWatcher.java
index d15e68871c..c38e07bfe9 100644
--- a/test/980-redefine-object/src-ex/TestWatcher.java
+++ b/test/980-redefine-object/src-ex/TestWatcher.java
@@ -16,10 +16,60 @@
package art.test;
+import java.util.concurrent.locks.ReentrantLock;
+
public class TestWatcher {
- // NB This function is native since it is called in the Object.<init> method and so cannot cause
- // any java allocations at all. The normal System.out.print* functions will cause allocations to
- // occur so we cannot use them. This means the easiest way to report the object as being created
- // is to go into native code and do it there.
- public static native void NotifyConstructed(Object o);
+ // Lock to synchronize access to the static state of this class.
+ private static final ReentrantLock lock = new ReentrantLock();
+ private static volatile boolean criticalFailure = false;
+ private static boolean reportingEnabled = true;
+ private static boolean doingReport = false;
+
+ private static void MonitorEnter() {
+ lock.lock();
+ }
+
+ private static void MonitorExit() {
+ // Need to do this manually since we need to notify critical failure but would deadlock if
+ // waited for the unlock.
+ if (!lock.isHeldByCurrentThread()) {
+ NotifyCriticalFailure();
+ throw new IllegalMonitorStateException("Locking error!");
+ } else {
+ lock.unlock();
+ }
+ }
+
+ // Stops reporting. Must be paired with an EnableReporting call.
+ public static void DisableReporting() {
+ MonitorEnter();
+ reportingEnabled = false;
+ }
+
+ // Stops reporting. Must be paired with a DisableReporting call.
+ public static void EnableReporting() {
+ reportingEnabled = true;
+ MonitorExit();
+ }
+
+ public static void NotifyCriticalFailure() {
+ criticalFailure = true;
+ }
+
+ public static void NotifyConstructed(Object o) {
+ if (criticalFailure) {
+ // Something went very wrong. We are probably trying to report it so don't get in the way.
+ return;
+ }
+ MonitorEnter();
+ // We could enter an infinite loop if println allocates (which it does) so we disable
+ // reporting while we are doing a report. Since we are synchronized we won't miss any
+ // allocations.
+ if (reportingEnabled && !doingReport) {
+ doingReport = true;
+ System.out.println("Object allocated of type '" + o.getClass().getName() + "'");
+ doingReport = false;
+ }
+ MonitorExit();
+ }
}
diff --git a/test/980-redefine-object/src/Main.java b/test/980-redefine-object/src/Main.java
index a50215e1ad..63c0cab95e 100644
--- a/test/980-redefine-object/src/Main.java
+++ b/test/980-redefine-object/src/Main.java
@@ -14,6 +14,9 @@
* limitations under the License.
*/
+import static art.Redefinition.doCommonClassRedefinition;
+
+import java.lang.reflect.Method;
import java.util.ArrayList;
import java.util.Base64;
import java.util.LinkedList;
@@ -287,6 +290,31 @@ public class Main {
private static final String LISTENER_LOCATION =
System.getenv("DEX_LOCATION") + "/980-redefine-object-ex.jar";
+ private static Method doEnableReporting;
+ private static Method doDisableReporting;
+
+ private static void DisableReporting() {
+ if (doDisableReporting == null) {
+ return;
+ }
+ try {
+ doDisableReporting.invoke(null);
+ } catch (Exception e) {
+ throw new Error("Unable to disable reporting!");
+ }
+ }
+
+ private static void EnableReporting() {
+ if (doEnableReporting == null) {
+ return;
+ }
+ try {
+ doEnableReporting.invoke(null);
+ } catch (Exception e) {
+ throw new Error("Unable to enable reporting!");
+ }
+ }
+
public static void main(String[] args) {
art.Main.bindAgentJNIForClass(Main.class);
doTest();
@@ -298,8 +326,8 @@ public class Main {
addToBootClassLoader(LISTENER_LOCATION);
// Load TestWatcher from the bootclassloader and make sure it is initialized.
Class<?> testwatcher_class = Class.forName("art.test.TestWatcher", true, null);
- // Bind the native functions of testwatcher_class.
- bindFunctionsForClass(testwatcher_class);
+ doEnableReporting = testwatcher_class.getDeclaredMethod("EnableReporting");
+ doDisableReporting = testwatcher_class.getDeclaredMethod("DisableReporting");
} catch (Exception e) {
throw new Error("Exception while making testwatcher", e);
}
@@ -308,9 +336,9 @@ public class Main {
// NB This function will cause 2 objects of type "Ljava/nio/HeapCharBuffer;" and
// "Ljava/nio/HeapCharBuffer;" to be allocated each time it is called.
private static void safePrintln(Object o) {
- System.out.flush();
- System.out.print("\t" + o + "\n");
- System.out.flush();
+ DisableReporting();
+ System.out.println("\t" + o);
+ EnableReporting();
}
private static void throwFrom(int depth) throws Exception {
@@ -381,11 +409,4 @@ public class Main {
}
private static native void addToBootClassLoader(String s);
-
- private static native void bindFunctionsForClass(Class<?> target);
-
- // Transforms the class
- private static native void doCommonClassRedefinition(Class<?> target,
- byte[] class_file,
- byte[] dex_file);
}
diff --git a/test/980-redefine-object/src/art/Redefinition.java b/test/980-redefine-object/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/980-redefine-object/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/981-dedup-original-dex/src/Main.java b/test/981-dedup-original-dex/src/Main.java
index 288f7ce4e0..f90c15ce8a 100644
--- a/test/981-dedup-original-dex/src/Main.java
+++ b/test/981-dedup-original-dex/src/Main.java
@@ -1,5 +1,5 @@
/*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
@@ -14,190 +14,8 @@
* limitations under the License.
*/
-import java.lang.reflect.Field;
-import java.util.Base64;
-import java.nio.ByteBuffer;
-
-import dalvik.system.ClassExt;
-import dalvik.system.InMemoryDexClassLoader;
-
public class Main {
-
- /**
- * base64 encoded class/dex file for
- * class Transform {
- * public void sayHi() {
- * System.out.println("Goodbye");
- * }
- * }
- */
- private static final byte[] DEX_BYTES_1 = Base64.getDecoder().decode(
- "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
- "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
- "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
- "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
- "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
- "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
- "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
- "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
- "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
- "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
- "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
- "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
- "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
-
- /**
- * base64 encoded class/dex file for
- * class Transform2 {
- * public void sayHi() {
- * System.out.println("Goodbye2");
- * }
- * }
- */
- private static final byte[] DEX_BYTES_2 = Base64.getDecoder().decode(
- "ZGV4CjAzNQAjXDED2iflQ3NXbPtBRVjQVMqoDU9nDz/QAgAAcAAAAHhWNBIAAAAAAAAAADACAAAO" +
- "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACwAQAAIAEAAGIB" +
- "AABqAQAAdAEAAIIBAACZAQAArQEAAMEBAADVAQAA5gEAAOkBAADtAQAAAQIAAAYCAAAPAgAAAgAA" +
- "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
- "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAACECAAAA" +
- "AAAAAQABAAEAAAAWAgAABAAAAHAQAwAAAA4AAwABAAIAAAAbAgAACQAAAGIAAAAbAQEAAABuIAIA" +
- "EAAOAAAAAQAAAAMABjxpbml0PgAIR29vZGJ5ZTIADExUcmFuc2Zvcm0yOwAVTGphdmEvaW8vUHJp" +
- "bnRTdHJlYW07ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwASTGphdmEv" +
- "bGFuZy9TeXN0ZW07AA9UcmFuc2Zvcm0yLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTQuMzAA" +
- "A291dAAHcHJpbnRsbgAFc2F5SGkAAQAHDgADAAcOhwAAAAEBAICABKACAQG4AgANAAAAAAAAAAEA" +
- "AAAAAAAAAQAAAA4AAABwAAAAAgAAAAYAAACoAAAAAwAAAAIAAADAAAAABAAAAAEAAADYAAAABQAA" +
- "AAQAAADgAAAABgAAAAEAAAAAAQAAASAAAAIAAAAgAQAAARAAAAEAAABcAQAAAiAAAA4AAABiAQAA" +
- "AyAAAAIAAAAWAgAAACAAAAEAAAAhAgAAABAAAAEAAAAwAgAA");
-
-
- /**
- * base64 encoded class/dex file for
- * class Transform3 {
- * public void sayHi() {
- * System.out.println("hello3");
- * }
- * }
- */
- private static final byte[] DEX_BYTES_3_INITIAL = Base64.getDecoder().decode(
- "ZGV4CjAzNQC2W2fBsAeLNAwWYlG8FVigzfsV7nBWITzQAgAAcAAAAHhWNBIAAAAAAAAAADACAAAO" +
- "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACwAQAAIAEAAGIB" +
- "AABqAQAAeAEAAI8BAACjAQAAtwEAAMsBAADcAQAA3wEAAOMBAAD3AQAA/wEAAAQCAAANAgAAAQAA" +
- "AAIAAAADAAAABAAAAAUAAAAHAAAABwAAAAUAAAAAAAAACAAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
- "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAGAAAAAAAAAB8CAAAA" +
- "AAAAAQABAAEAAAAUAgAABAAAAHAQAwAAAA4AAwABAAIAAAAZAgAACQAAAGIAAAAbAQoAAABuIAIA" +
- "EAAOAAAAAQAAAAMABjxpbml0PgAMTFRyYW5zZm9ybTM7ABVMamF2YS9pby9QcmludFN0cmVhbTsA" +
- "EkxqYXZhL2xhbmcvT2JqZWN0OwASTGphdmEvbGFuZy9TdHJpbmc7ABJMamF2YS9sYW5nL1N5c3Rl" +
- "bTsAD1RyYW5zZm9ybTMuamF2YQABVgACVkwAEmVtaXR0ZXI6IGphY2stNC4zMAAGaGVsbG8zAANv" +
- "dXQAB3ByaW50bG4ABXNheUhpAAIABw4ABAAHDocAAAABAQCAgASgAgEBuAIAAAANAAAAAAAAAAEA" +
- "AAAAAAAAAQAAAA4AAABwAAAAAgAAAAYAAACoAAAAAwAAAAIAAADAAAAABAAAAAEAAADYAAAABQAA" +
- "AAQAAADgAAAABgAAAAEAAAAAAQAAASAAAAIAAAAgAQAAARAAAAEAAABcAQAAAiAAAA4AAABiAQAA" +
- "AyAAAAIAAAAUAgAAACAAAAEAAAAfAgAAABAAAAEAAAAwAgAA");
-
- /**
- * base64 encoded class/dex file for
- * class Transform3 {
- * public void sayHi() {
- * System.out.println("Goodbye3");
- * }
- * }
- */
- private static final byte[] DEX_BYTES_3_FINAL = Base64.getDecoder().decode(
- "ZGV4CjAzNQBAXE5GthgMydaFBuinf+ZBfXcBYIw2UlXQAgAAcAAAAHhWNBIAAAAAAAAAADACAAAO" +
- "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACwAQAAIAEAAGIB" +
- "AABqAQAAdAEAAIIBAACZAQAArQEAAMEBAADVAQAA5gEAAOkBAADtAQAAAQIAAAYCAAAPAgAAAgAA" +
- "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
- "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAACECAAAA" +
- "AAAAAQABAAEAAAAWAgAABAAAAHAQAwAAAA4AAwABAAIAAAAbAgAACQAAAGIAAAAbAQEAAABuIAIA" +
- "EAAOAAAAAQAAAAMABjxpbml0PgAIR29vZGJ5ZTMADExUcmFuc2Zvcm0zOwAVTGphdmEvaW8vUHJp" +
- "bnRTdHJlYW07ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwASTGphdmEv" +
- "bGFuZy9TeXN0ZW07AA9UcmFuc2Zvcm0zLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTQuMzAA" +
- "A291dAAHcHJpbnRsbgAFc2F5SGkAAgAHDgAEAAcOhwAAAAEBAICABKACAQG4AgANAAAAAAAAAAEA" +
- "AAAAAAAAAQAAAA4AAABwAAAAAgAAAAYAAACoAAAAAwAAAAIAAADAAAAABAAAAAEAAADYAAAABQAA" +
- "AAQAAADgAAAABgAAAAEAAAAAAQAAASAAAAIAAAAgAQAAARAAAAEAAABcAQAAAiAAAA4AAABiAQAA" +
- "AyAAAAIAAAAWAgAAACAAAAEAAAAhAgAAABAAAAEAAAAwAgAA");
-
- public static void main(String[] args) {
- art.Main.bindAgentJNIForClass(Main.class);
- try {
- doTest();
- } catch (Exception e) {
- e.printStackTrace();
- }
- }
-
- private static void assertSame(Object a, Object b) throws Exception {
- if (a != b) {
- throw new AssertionError("'" + (a != null ? a.toString() : "null") + "' is not the same as " +
- "'" + (b != null ? b.toString() : "null") + "'");
- }
- }
-
- private static Object getObjectField(Object o, String name) throws Exception {
- return getObjectField(o, o.getClass(), name);
- }
-
- private static Object getObjectField(Object o, Class<?> type, String name) throws Exception {
- Field f = type.getDeclaredField(name);
- f.setAccessible(true);
- return f.get(o);
- }
-
- private static Object getOriginalDexFile(Class<?> k) throws Exception {
- ClassExt ext_data_object = (ClassExt) getObjectField(k, "extData");
- if (ext_data_object == null) {
- return null;
- }
-
- return getObjectField(ext_data_object, "originalDexFile");
+ public static void main(String[] args) throws Exception {
+ art.Test981.run();
}
-
- public static void doTest() throws Exception {
- // Make sure both of these are loaded prior to transformations being added so they have the same
- // original dex files.
- Transform t1 = new Transform();
- Transform2 t2 = new Transform2();
-
- assertSame(null, getOriginalDexFile(t1.getClass()));
- assertSame(null, getOriginalDexFile(t2.getClass()));
- assertSame(null, getOriginalDexFile(Main.class));
-
- addCommonTransformationResult("Transform", new byte[0], DEX_BYTES_1);
- addCommonTransformationResult("Transform2", new byte[0], DEX_BYTES_2);
- enableCommonRetransformation(true);
- doCommonClassRetransformation(Transform.class, Transform2.class);
-
- assertSame(getOriginalDexFile(t1.getClass()), getOriginalDexFile(t2.getClass()));
- assertSame(null, getOriginalDexFile(Main.class));
- // Make sure that the original dex file is a DexCache object.
- assertSame(getOriginalDexFile(t1.getClass()).getClass(), Class.forName("java.lang.DexCache"));
-
- // Check that we end up with a byte[] if we do a direct RedefineClasses
- enableCommonRetransformation(false);
- doCommonClassRedefinition(Transform.class, new byte[0], DEX_BYTES_1);
- assertSame((new byte[0]).getClass(), getOriginalDexFile(t1.getClass()).getClass());
-
- // Check we don't have anything if we don't have any originalDexFile if the onload
- // transformation doesn't do anything.
- enableCommonRetransformation(true);
- Class<?> transform3Class = new InMemoryDexClassLoader(
- ByteBuffer.wrap(DEX_BYTES_3_INITIAL), Main.class.getClassLoader()).loadClass("Transform3");
- assertSame(null, getOriginalDexFile(transform3Class));
-
- // Check that we end up with a java.lang.Long pointer if we do an 'on-load' redefinition.
- addCommonTransformationResult("Transform3", new byte[0], DEX_BYTES_3_FINAL);
- enableCommonRetransformation(true);
- Class<?> transform3ClassTransformed = new InMemoryDexClassLoader(
- ByteBuffer.wrap(DEX_BYTES_3_INITIAL), Main.class.getClassLoader()).loadClass("Transform3");
- assertSame(Long.class, getOriginalDexFile(transform3ClassTransformed).getClass());
- }
-
- // Transforms the class
- private static native void doCommonClassRetransformation(Class<?>... target);
- private static native void doCommonClassRedefinition(Class<?> target,
- byte[] class_file,
- byte[] dex_file);
- private static native void enableCommonRetransformation(boolean enable);
- private static native void addCommonTransformationResult(String target_name,
- byte[] class_bytes,
- byte[] dex_bytes);
}
diff --git a/test/981-dedup-original-dex/src/Transform.java b/test/981-dedup-original-dex/src/Transform.java
deleted file mode 100644
index 3c97907ddc..0000000000
--- a/test/981-dedup-original-dex/src/Transform.java
+++ /dev/null
@@ -1,21 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
- public void sayHi() {
- System.out.println("hello");
- }
-}
diff --git a/test/981-dedup-original-dex/src/Transform2.java b/test/981-dedup-original-dex/src/Transform2.java
deleted file mode 100644
index eb22842184..0000000000
--- a/test/981-dedup-original-dex/src/Transform2.java
+++ /dev/null
@@ -1,21 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform2 {
- public void sayHi() {
- System.out.println("hello2");
- }
-}
diff --git a/test/981-dedup-original-dex/src/art/Redefinition.java b/test/981-dedup-original-dex/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/981-dedup-original-dex/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/981-dedup-original-dex/src/art/Test981.java b/test/981-dedup-original-dex/src/art/Test981.java
new file mode 100644
index 0000000000..3a97268ef9
--- /dev/null
+++ b/test/981-dedup-original-dex/src/art/Test981.java
@@ -0,0 +1,210 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.lang.reflect.Field;
+import java.util.Base64;
+import java.nio.ByteBuffer;
+
+import dalvik.system.ClassExt;
+import dalvik.system.InMemoryDexClassLoader;
+
+public class Test981 {
+
+ static class Transform {
+ public void sayHi() {
+ System.out.println("hello");
+ }
+ }
+
+ static class Transform2 {
+ public void sayHi() {
+ System.out.println("hello2");
+ }
+ }
+
+ /**
+ * base64 encoded class/dex file for
+ * static class Transform {
+ * public void sayHi() {
+ * System.out.println("Goodbye");
+ * }
+ * }
+ */
+ private static final byte[] DEX_BYTES_1 = Base64.getDecoder().decode(
+ "ZGV4CjAzNQB+giqQAAAAAAAAAAAAAAAAAAAAAAAAAAC4AwAAcAAAAHhWNBIAAAAAAAAAAPQCAAAU" +
+ "AAAAcAAAAAkAAADAAAAAAgAAAOQAAAABAAAA/AAAAAQAAAAEAQAAAQAAACQBAAB0AgAARAEAAEQB" +
+ "AABMAQAAVQEAAG4BAAB9AQAAoQEAAMEBAADYAQAA7AEAAAACAAAUAgAAIgIAAC0CAAAwAgAANAIA" +
+ "AEECAABHAgAATAIAAFUCAABcAgAAAgAAAAMAAAAEAAAABQAAAAYAAAAHAAAACAAAAAkAAAAMAAAA" +
+ "DAAAAAgAAAAAAAAADQAAAAgAAABkAgAABwAEABAAAAAAAAAAAAAAAAAAAAASAAAABAABABEAAAAF" +
+ "AAAAAAAAAAAAAAAAAAAABQAAAAAAAAAKAAAA5AIAALgCAAAAAAAABjxpbml0PgAHR29vZGJ5ZQAX" +
+ "TGFydC9UZXN0OTgxJFRyYW5zZm9ybTsADUxhcnQvVGVzdDk4MTsAIkxkYWx2aWsvYW5ub3RhdGlv" +
+ "bi9FbmNsb3NpbmdDbGFzczsAHkxkYWx2aWsvYW5ub3RhdGlvbi9Jbm5lckNsYXNzOwAVTGphdmEv" +
+ "aW8vUHJpbnRTdHJlYW07ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwAS" +
+ "TGphdmEvbGFuZy9TeXN0ZW07AAxUZXN0OTgxLmphdmEACVRyYW5zZm9ybQABVgACVkwAC2FjY2Vz" +
+ "c0ZsYWdzAARuYW1lAANvdXQAB3ByaW50bG4ABXNheUhpAAV2YWx1ZQAAAQAAAAYAAAAFAAcOAAcA" +
+ "Bw4BCA8AAAAAAQABAAEAAABsAgAABAAAAHAQAwAAAA4AAwABAAIAAABxAgAACQAAAGIAAAAbAQEA" +
+ "AABuIAIAEAAOAAAAAAABAQCAgAT8BAEBlAUAAAICARMYAQIDAg4ECA8XCwACAAAAyAIAAM4CAADY" +
+ "AgAAAAAAAAAAAAAAAAAAEAAAAAAAAAABAAAAAAAAAAEAAAAUAAAAcAAAAAIAAAAJAAAAwAAAAAMA" +
+ "AAACAAAA5AAAAAQAAAABAAAA/AAAAAUAAAAEAAAABAEAAAYAAAABAAAAJAEAAAIgAAAUAAAARAEA" +
+ "AAEQAAABAAAAZAIAAAMgAAACAAAAbAIAAAEgAAACAAAAfAIAAAAgAAABAAAAuAIAAAQgAAACAAAA" +
+ "yAIAAAMQAAABAAAA2AIAAAYgAAABAAAA5AIAAAAQAAABAAAA9AIAAA==");
+
+ /**
+ * base64 encoded class/dex file for
+ * static class Transform2 {
+ * public void sayHi() {
+ * System.out.println("Goodbye2");
+ * }
+ * }
+ */
+ private static final byte[] DEX_BYTES_2 = Base64.getDecoder().decode(
+ "ZGV4CjAzNQAhg+RVAAAAAAAAAAAAAAAAAAAAAAAAAAC8AwAAcAAAAHhWNBIAAAAAAAAAAPgCAAAU" +
+ "AAAAcAAAAAkAAADAAAAAAgAAAOQAAAABAAAA/AAAAAQAAAAEAQAAAQAAACQBAAB4AgAARAEAAEQB" +
+ "AABMAQAAVgEAAHABAAB/AQAAowEAAMMBAADaAQAA7gEAAAICAAAWAgAAJAIAADACAAAzAgAANwIA" +
+ "AEQCAABKAgAATwIAAFgCAABfAgAAAgAAAAMAAAAEAAAABQAAAAYAAAAHAAAACAAAAAkAAAAMAAAA" +
+ "DAAAAAgAAAAAAAAADQAAAAgAAABoAgAABwAEABAAAAAAAAAAAAAAAAAAAAASAAAABAABABEAAAAF" +
+ "AAAAAAAAAAAAAAAAAAAABQAAAAAAAAAKAAAA6AIAALwCAAAAAAAABjxpbml0PgAIR29vZGJ5ZTIA" +
+ "GExhcnQvVGVzdDk4MSRUcmFuc2Zvcm0yOwANTGFydC9UZXN0OTgxOwAiTGRhbHZpay9hbm5vdGF0" +
+ "aW9uL0VuY2xvc2luZ0NsYXNzOwAeTGRhbHZpay9hbm5vdGF0aW9uL0lubmVyQ2xhc3M7ABVMamF2" +
+ "YS9pby9QcmludFN0cmVhbTsAEkxqYXZhL2xhbmcvT2JqZWN0OwASTGphdmEvbGFuZy9TdHJpbmc7" +
+ "ABJMamF2YS9sYW5nL1N5c3RlbTsADFRlc3Q5ODEuamF2YQAKVHJhbnNmb3JtMgABVgACVkwAC2Fj" +
+ "Y2Vzc0ZsYWdzAARuYW1lAANvdXQAB3ByaW50bG4ABXNheUhpAAV2YWx1ZQAAAAEAAAAGAAAACgAH" +
+ "DgAMAAcOAQgPAAAAAAEAAQABAAAAcAIAAAQAAABwEAMAAAAOAAMAAQACAAAAdQIAAAkAAABiAAAA" +
+ "GwEBAAAAbiACABAADgAAAAAAAQEAgIAEgAUBAZgFAAACAgETGAECAwIOBAgPFwsAAgAAAMwCAADS" +
+ "AgAA3AIAAAAAAAAAAAAAAAAAABAAAAAAAAAAAQAAAAAAAAABAAAAFAAAAHAAAAACAAAACQAAAMAA" +
+ "AAADAAAAAgAAAOQAAAAEAAAAAQAAAPwAAAAFAAAABAAAAAQBAAAGAAAAAQAAACQBAAACIAAAFAAA" +
+ "AEQBAAABEAAAAQAAAGgCAAADIAAAAgAAAHACAAABIAAAAgAAAIACAAAAIAAAAQAAALwCAAAEIAAA" +
+ "AgAAAMwCAAADEAAAAQAAANwCAAAGIAAAAQAAAOgCAAAAEAAAAQAAAPgCAAA=");
+
+ /**
+ * base64 encoded class/dex file for
+ * class Transform3 {
+ * public void sayHi() {
+ * System.out.println("hello3");
+ * }
+ * }
+ */
+ private static final byte[] DEX_BYTES_3_INITIAL = Base64.getDecoder().decode(
+ "ZGV4CjAzNQC2W2fBsAeLNAwWYlG8FVigzfsV7nBWITzQAgAAcAAAAHhWNBIAAAAAAAAAADACAAAO" +
+ "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACwAQAAIAEAAGIB" +
+ "AABqAQAAeAEAAI8BAACjAQAAtwEAAMsBAADcAQAA3wEAAOMBAAD3AQAA/wEAAAQCAAANAgAAAQAA" +
+ "AAIAAAADAAAABAAAAAUAAAAHAAAABwAAAAUAAAAAAAAACAAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+ "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAGAAAAAAAAAB8CAAAA" +
+ "AAAAAQABAAEAAAAUAgAABAAAAHAQAwAAAA4AAwABAAIAAAAZAgAACQAAAGIAAAAbAQoAAABuIAIA" +
+ "EAAOAAAAAQAAAAMABjxpbml0PgAMTFRyYW5zZm9ybTM7ABVMamF2YS9pby9QcmludFN0cmVhbTsA" +
+ "EkxqYXZhL2xhbmcvT2JqZWN0OwASTGphdmEvbGFuZy9TdHJpbmc7ABJMamF2YS9sYW5nL1N5c3Rl" +
+ "bTsAD1RyYW5zZm9ybTMuamF2YQABVgACVkwAEmVtaXR0ZXI6IGphY2stNC4zMAAGaGVsbG8zAANv" +
+ "dXQAB3ByaW50bG4ABXNheUhpAAIABw4ABAAHDocAAAABAQCAgASgAgEBuAIAAAANAAAAAAAAAAEA" +
+ "AAAAAAAAAQAAAA4AAABwAAAAAgAAAAYAAACoAAAAAwAAAAIAAADAAAAABAAAAAEAAADYAAAABQAA" +
+ "AAQAAADgAAAABgAAAAEAAAAAAQAAASAAAAIAAAAgAQAAARAAAAEAAABcAQAAAiAAAA4AAABiAQAA" +
+ "AyAAAAIAAAAUAgAAACAAAAEAAAAfAgAAABAAAAEAAAAwAgAA");
+
+ /**
+ * base64 encoded class/dex file for
+ * class Transform3 {
+ * public void sayHi() {
+ * System.out.println("Goodbye3");
+ * }
+ * }
+ */
+ private static final byte[] DEX_BYTES_3_FINAL = Base64.getDecoder().decode(
+ "ZGV4CjAzNQBAXE5GthgMydaFBuinf+ZBfXcBYIw2UlXQAgAAcAAAAHhWNBIAAAAAAAAAADACAAAO" +
+ "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACwAQAAIAEAAGIB" +
+ "AABqAQAAdAEAAIIBAACZAQAArQEAAMEBAADVAQAA5gEAAOkBAADtAQAAAQIAAAYCAAAPAgAAAgAA" +
+ "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+ "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAACECAAAA" +
+ "AAAAAQABAAEAAAAWAgAABAAAAHAQAwAAAA4AAwABAAIAAAAbAgAACQAAAGIAAAAbAQEAAABuIAIA" +
+ "EAAOAAAAAQAAAAMABjxpbml0PgAIR29vZGJ5ZTMADExUcmFuc2Zvcm0zOwAVTGphdmEvaW8vUHJp" +
+ "bnRTdHJlYW07ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwASTGphdmEv" +
+ "bGFuZy9TeXN0ZW07AA9UcmFuc2Zvcm0zLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTQuMzAA" +
+ "A291dAAHcHJpbnRsbgAFc2F5SGkAAgAHDgAEAAcOhwAAAAEBAICABKACAQG4AgANAAAAAAAAAAEA" +
+ "AAAAAAAAAQAAAA4AAABwAAAAAgAAAAYAAACoAAAAAwAAAAIAAADAAAAABAAAAAEAAADYAAAABQAA" +
+ "AAQAAADgAAAABgAAAAEAAAAAAQAAASAAAAIAAAAgAQAAARAAAAEAAABcAQAAAiAAAA4AAABiAQAA" +
+ "AyAAAAIAAAAWAgAAACAAAAEAAAAhAgAAABAAAAEAAAAwAgAA");
+
+ public static void run() throws Exception {
+ Redefinition.setTestConfiguration(Redefinition.Config.COMMON_RETRANSFORM);
+ doTest();
+ }
+
+ private static void assertSame(Object a, Object b) throws Exception {
+ if (a != b) {
+ throw new AssertionError("'" + (a != null ? a.toString() : "null") + "' is not the same as " +
+ "'" + (b != null ? b.toString() : "null") + "'");
+ }
+ }
+
+ private static Object getObjectField(Object o, String name) throws Exception {
+ return getObjectField(o, o.getClass(), name);
+ }
+
+ private static Object getObjectField(Object o, Class<?> type, String name) throws Exception {
+ Field f = type.getDeclaredField(name);
+ f.setAccessible(true);
+ return f.get(o);
+ }
+
+ private static Object getOriginalDexFile(Class<?> k) throws Exception {
+ ClassExt ext_data_object = (ClassExt) getObjectField(k, "extData");
+ if (ext_data_object == null) {
+ return null;
+ }
+
+ return getObjectField(ext_data_object, "originalDexFile");
+ }
+
+ public static void doTest() throws Exception {
+ // Make sure both of these are loaded prior to transformations being added so they have the same
+ // original dex files.
+ Transform t1 = new Transform();
+ Transform2 t2 = new Transform2();
+
+ assertSame(null, getOriginalDexFile(t1.getClass()));
+ assertSame(null, getOriginalDexFile(t2.getClass()));
+ assertSame(null, getOriginalDexFile(Test981.class));
+
+ Redefinition.addCommonTransformationResult("art/Test981$Transform", new byte[0], DEX_BYTES_1);
+ Redefinition.addCommonTransformationResult("art/Test981$Transform2", new byte[0], DEX_BYTES_2);
+ Redefinition.enableCommonRetransformation(true);
+ Redefinition.doCommonClassRetransformation(Transform.class, Transform2.class);
+
+ assertSame(getOriginalDexFile(t1.getClass()), getOriginalDexFile(t2.getClass()));
+ assertSame(null, getOriginalDexFile(Test981.class));
+ // Make sure that the original dex file is a DexCache object.
+ assertSame(getOriginalDexFile(t1.getClass()).getClass(), Class.forName("java.lang.DexCache"));
+
+ // Check that we end up with a byte[] if we do a direct RedefineClasses
+ Redefinition.enableCommonRetransformation(false);
+ Redefinition.doCommonClassRedefinition(Transform.class, new byte[0], DEX_BYTES_1);
+ assertSame((new byte[0]).getClass(), getOriginalDexFile(t1.getClass()).getClass());
+
+ // Check we don't have anything if we don't have any originalDexFile if the onload
+ // transformation doesn't do anything.
+ Redefinition.enableCommonRetransformation(true);
+ Class<?> transform3Class = new InMemoryDexClassLoader(
+ ByteBuffer.wrap(DEX_BYTES_3_INITIAL), Test981.class.getClassLoader()).loadClass("Transform3");
+ assertSame(null, getOriginalDexFile(transform3Class));
+
+ // Check that we end up with a java.lang.Long pointer if we do an 'on-load' redefinition.
+ Redefinition.addCommonTransformationResult("Transform3", new byte[0], DEX_BYTES_3_FINAL);
+ Redefinition.enableCommonRetransformation(true);
+ Class<?> transform3ClassTransformed = new InMemoryDexClassLoader(
+ ByteBuffer.wrap(DEX_BYTES_3_INITIAL), Test981.class.getClassLoader()).loadClass("Transform3");
+ assertSame(Long.class, getOriginalDexFile(transform3ClassTransformed).getClass());
+ }
+}
diff --git a/test/982-ok-no-retransform/src/Main.java b/test/982-ok-no-retransform/src/Main.java
index 33e50d77ba..bd73e81da6 100644
--- a/test/982-ok-no-retransform/src/Main.java
+++ b/test/982-ok-no-retransform/src/Main.java
@@ -1,5 +1,5 @@
/*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
@@ -14,22 +14,8 @@
* limitations under the License.
*/
-import java.util.Base64;
public class Main {
-
- public static void main(String[] args) {
- art.Main.bindAgentJNIForClass(Main.class);
- doTest(new Transform());
- }
-
- public static void doTest(Transform t) {
- t.sayHi();
- enableCommonRetransformation(true);
- doCommonClassRetransformation(Transform.class);
- t.sayHi();
+ public static void main(String[] args) throws Exception {
+ art.Test982.run();
}
-
- // Transforms the class
- private static native void doCommonClassRetransformation(Class<?>... target);
- private static native void enableCommonRetransformation(boolean enable);
}
diff --git a/test/982-ok-no-retransform/src/Transform.java b/test/982-ok-no-retransform/src/Transform.java
deleted file mode 100644
index 8e8af355da..0000000000
--- a/test/982-ok-no-retransform/src/Transform.java
+++ /dev/null
@@ -1,28 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
- public void sayHi() {
- // Use lower 'h' to make sure the string will have a different string id
- // than the transformation (the transformation code is the same except
- // the actual printed String, which was making the test inacurately passing
- // in JIT mode when loading the string from the dex cache, as the string ids
- // of the two different strings were the same).
- // We know the string ids will be different because lexicographically:
- // "Goodbye" < "LTransform;" < "hello".
- System.out.println("hello");
- }
-}
diff --git a/test/982-ok-no-retransform/src/art/Redefinition.java b/test/982-ok-no-retransform/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/982-ok-no-retransform/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/942-private-recursive/src/Transform.java b/test/982-ok-no-retransform/src/art/Test982.java
index 7714326066..080d47facc 100644
--- a/test/942-private-recursive/src/Transform.java
+++ b/test/982-ok-no-retransform/src/art/Test982.java
@@ -14,19 +14,26 @@
* limitations under the License.
*/
-class Transform {
- private void privateSayHi(int recur, Runnable r) {
- System.out.println("hello" + recur);
- if (recur == 1) {
- r.run();
- privateSayHi(recur - 1, r);
- } else if (recur != 0) {
- privateSayHi(recur - 1, r);
+package art;
+
+import java.util.Base64;
+public class Test982 {
+
+ static class Transform {
+ public void sayHi() {
+ System.out.println("hello");
}
- System.out.println("goodbye" + recur);
}
- public void sayHi(int recur, Runnable r) {
- privateSayHi(recur, r);
+ public static void run() {
+ Redefinition.setTestConfiguration(Redefinition.Config.COMMON_RETRANSFORM);
+ doTest(new Transform());
+ }
+
+ public static void doTest(Transform t) {
+ t.sayHi();
+ Redefinition.enableCommonRetransformation(true);
+ Redefinition.doCommonClassRetransformation(Transform.class);
+ t.sayHi();
}
}
diff --git a/test/983-source-transform-verify/expected.txt b/test/983-source-transform-verify/expected.txt
index 0a94212ad2..abcdf3a868 100644
--- a/test/983-source-transform-verify/expected.txt
+++ b/test/983-source-transform-verify/expected.txt
@@ -1,2 +1,2 @@
-Dex file hook for Transform
+Dex file hook for art/Test983$Transform
Dex file hook for java/lang/Object
diff --git a/test/983-source-transform-verify/src/Main.java b/test/983-source-transform-verify/src/Main.java
index ad081a2006..e1d20f6678 100644
--- a/test/983-source-transform-verify/src/Main.java
+++ b/test/983-source-transform-verify/src/Main.java
@@ -1,5 +1,5 @@
/*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
@@ -14,23 +14,8 @@
* limitations under the License.
*/
-import java.util.Base64;
public class Main {
-
- public static void main(String[] args) {
- art.Main.bindAgentJNIForClass(Main.class);
- doTest();
- }
-
- public static void doTest() {
- Transform abc = new Transform();
- enableCommonRetransformation(true);
- doCommonClassRetransformation(Transform.class);
- doCommonClassRetransformation(Object.class);
- enableCommonRetransformation(false);
+ public static void main(String[] args) throws Exception {
+ art.Test983.run();
}
-
- // Transforms the class
- private static native void doCommonClassRetransformation(Class<?>... target);
- private static native void enableCommonRetransformation(boolean enable);
}
diff --git a/test/983-source-transform-verify/src/Transform.java b/test/983-source-transform-verify/src/Transform.java
deleted file mode 100644
index 8e8af355da..0000000000
--- a/test/983-source-transform-verify/src/Transform.java
+++ /dev/null
@@ -1,28 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
- public void sayHi() {
- // Use lower 'h' to make sure the string will have a different string id
- // than the transformation (the transformation code is the same except
- // the actual printed String, which was making the test inacurately passing
- // in JIT mode when loading the string from the dex cache, as the string ids
- // of the two different strings were the same).
- // We know the string ids will be different because lexicographically:
- // "Goodbye" < "LTransform;" < "hello".
- System.out.println("hello");
- }
-}
diff --git a/test/983-source-transform-verify/src/art/Redefinition.java b/test/983-source-transform-verify/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/983-source-transform-verify/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/915-obsolete-2/src/Transform.java b/test/983-source-transform-verify/src/art/Test983.java
index e914e29479..b81e7f4df3 100644
--- a/test/915-obsolete-2/src/Transform.java
+++ b/test/983-source-transform-verify/src/art/Test983.java
@@ -14,22 +14,25 @@
* limitations under the License.
*/
-class Transform {
- private void Start() {
- System.out.println("hello - private");
+package art;
+
+import java.util.Base64;
+public class Test983 {
+ static class Transform {
+ public void sayHi() {
+ System.out.println("hello");
+ }
}
- private void Finish() {
- System.out.println("goodbye - private");
+ public static void run() {
+ doTest();
}
- public void sayHi(Runnable r) {
- System.out.println("Pre Start private method call");
- Start();
- System.out.println("Post Start private method call");
- r.run();
- System.out.println("Pre Finish private method call");
- Finish();
- System.out.println("Post Finish private method call");
+ public static void doTest() {
+ Transform abc = new Transform();
+ Redefinition.enableCommonRetransformation(true);
+ Redefinition.doCommonClassRetransformation(Transform.class);
+ Redefinition.doCommonClassRetransformation(Object.class);
+ Redefinition.enableCommonRetransformation(false);
}
}
diff --git a/test/984-obsolete-invoke/obsolete_invoke.cc b/test/984-obsolete-invoke/obsolete_invoke.cc
index 27e36ba509..ab2499aa62 100644
--- a/test/984-obsolete-invoke/obsolete_invoke.cc
+++ b/test/984-obsolete-invoke/obsolete_invoke.cc
@@ -17,20 +17,20 @@
#include "android-base/macros.h"
#include "jni.h"
#include "jvmti.h"
-#include "mirror/class-inl.h"
-#include "scoped_local_ref.h"
// Test infrastructure
#include "test_env.h"
#include "jvmti_helper.h"
+#include "scoped_local_ref.h"
namespace art {
namespace Test984ObsoleteInvoke {
static constexpr size_t kNumFrames = 30;
-extern "C" JNIEXPORT jobject JNICALL Java_Main_getFirstObsoleteMethod984(JNIEnv* env, jclass) {
+extern "C" JNIEXPORT jobject JNICALL Java_art_Test984_getFirstObsoleteMethod984(JNIEnv* env,
+ jclass) {
jthread cur;
jint frame_count;
jvmtiFrameInfo frames[kNumFrames];
diff --git a/test/984-obsolete-invoke/src/Main.java b/test/984-obsolete-invoke/src/Main.java
index 418d64d906..04a368dcd4 100644
--- a/test/984-obsolete-invoke/src/Main.java
+++ b/test/984-obsolete-invoke/src/Main.java
@@ -1,5 +1,5 @@
/*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
@@ -14,96 +14,8 @@
* limitations under the License.
*/
-import java.lang.reflect.Method;
-import java.util.Base64;
-
public class Main {
- // class Transform {
- // public static void sayHi(Runnable r) {
- // System.out.println("Hello - Transformed");
- // r.run();
- // System.out.println("Goodbye - Transformed");
- // }
- // }
- private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
- "yv66vgAAADQAJAoACAARCQASABMIABQKABUAFgsAFwAYCAAZBwAaBwAbAQAGPGluaXQ+AQADKClW" +
- "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
- "KVYBAApTb3VyY2VGaWxlAQAOVHJhbnNmb3JtLmphdmEMAAkACgcAHAwAHQAeAQATSGVsbG8gLSBU" +
- "cmFuc2Zvcm1lZAcAHwwAIAAhBwAiDAAjAAoBABVHb29kYnllIC0gVHJhbnNmb3JtZWQBAAlUcmFu" +
- "c2Zvcm0BABBqYXZhL2xhbmcvT2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZh" +
- "L2lvL1ByaW50U3RyZWFtOwEAE2phdmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZh" +
- "L2xhbmcvU3RyaW5nOylWAQASamF2YS9sYW5nL1J1bm5hYmxlAQADcnVuACAABwAIAAAAAAACAAAA" +
- "CQAKAAEACwAAAB0AAQABAAAABSq3AAGxAAAAAQAMAAAABgABAAAAAQAJAA0ADgABAAsAAAA7AAIA" +
- "AQAAABeyAAISA7YABCq5AAUBALIAAhIGtgAEsQAAAAEADAAAABIABAAAAAMACAAEAA4ABQAWAAYA" +
- "AQAPAAAAAgAQ");
- private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
- "ZGV4CjAzNQCMekj2NPwzrEp/v+2yzzSg8xZvBtU1bC1QAwAAcAAAAHhWNBIAAAAAAAAAALACAAAR" +
- "AAAAcAAAAAcAAAC0AAAAAwAAANAAAAABAAAA9AAAAAUAAAD8AAAAAQAAACQBAAAMAgAARAEAAKIB" +
- "AACqAQAAwQEAANYBAADjAQAA+gEAAA4CAAAkAgAAOAIAAEwCAABcAgAAXwIAAGMCAAB3AgAAfAIA" +
- "AIUCAACKAgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACgAAAAoAAAAGAAAAAAAAAAsAAAAGAAAA" +
- "lAEAAAsAAAAGAAAAnAEAAAUAAQANAAAAAAAAAAAAAAAAAAEAEAAAAAEAAgAOAAAAAgAAAAAAAAAD" +
- "AAAADwAAAAAAAAAAAAAAAgAAAAAAAAAJAAAAAAAAAJ8CAAAAAAAAAQABAAEAAACRAgAABAAAAHAQ" +
- "AwAAAA4AAwABAAIAAACWAgAAFAAAAGIAAAAbAQIAAABuIAIAEAByEAQAAgBiAAAAGwEBAAAAbiAC" +
- "ABAADgABAAAAAwAAAAEAAAAEAAY8aW5pdD4AFUdvb2RieWUgLSBUcmFuc2Zvcm1lZAATSGVsbG8g" +
- "LSBUcmFuc2Zvcm1lZAALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwASTGphdmEv" +
- "bGFuZy9PYmplY3Q7ABRMamF2YS9sYW5nL1J1bm5hYmxlOwASTGphdmEvbGFuZy9TdHJpbmc7ABJM" +
- "amF2YS9sYW5nL1N5c3RlbTsADlRyYW5zZm9ybS5qYXZhAAFWAAJWTAASZW1pdHRlcjogamFjay00" +
- "LjMxAANvdXQAB3ByaW50bG4AA3J1bgAFc2F5SGkAAQAHDgADAQAHDoc8hwAAAAIAAICABMQCAQnc" +
- "AgAAAA0AAAAAAAAAAQAAAAAAAAABAAAAEQAAAHAAAAACAAAABwAAALQAAAADAAAAAwAAANAAAAAE" +
- "AAAAAQAAAPQAAAAFAAAABQAAAPwAAAAGAAAAAQAAACQBAAABIAAAAgAAAEQBAAABEAAAAgAAAJQB" +
- "AAACIAAAEQAAAKIBAAADIAAAAgAAAJECAAAAIAAAAQAAAJ8CAAAAEAAAAQAAALACAAA=");
-
- public static void main(String[] args) {
- art.Main.bindAgentJNIForClass(Main.class);
- doTest();
+ public static void main(String[] args) throws Exception {
+ art.Test984.run();
}
-
- // The Method that holds an obsolete method pointer. We will fill it in by getting a jmethodID
- // from a stack with an obsolete method in it. There should be no other ways to obtain an obsolete
- // jmethodID in ART without unsafe casts.
- public static Method obsolete_method = null;
-
- public static void doTest() {
- // Capture the obsolete method.
- //
- // NB The obsolete method must be direct so that we will not look in the receiver type to get
- // the actual method.
- Transform.sayHi(() -> {
- System.out.println("transforming calling function");
- doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
- System.out.println("Retrieving obsolete method from current stack");
- // This should get the obsolete sayHi method (as the only obsolete method on the current
- // threads stack).
- Main.obsolete_method = getFirstObsoleteMethod984();
- });
-
- // Prove we did actually redefine something.
- System.out.println("Invoking redefined version of method.");
- Transform.sayHi(() -> { System.out.println("Not doing anything here"); });
-
- System.out.println("invoking obsolete method");
- try {
- obsolete_method.invoke(null, (Runnable)() -> {
- throw new Error("Unexpected code running from invoke of obsolete method!");
- });
- throw new Error("Running obsolete method did not throw exception");
- } catch (Throwable e) {
- if (e instanceof InternalError || e.getCause() instanceof InternalError) {
- System.out.println("Caught expected error from attempting to invoke an obsolete method.");
- } else {
- System.out.println("Unexpected error type for calling obsolete method! Expected either "
- + "an InternalError or something that is caused by an InternalError.");
- throw new Error("Unexpected error caught: ", e);
- }
- }
- }
-
- // Transforms the class
- private static native void doCommonClassRedefinition(Class<?> target,
- byte[] classfile,
- byte[] dexfile);
-
- // Gets the first obsolete method on the current threads stack (NB only looks through the first 30
- // stack frames).
- private static native Method getFirstObsoleteMethod984();
}
diff --git a/test/984-obsolete-invoke/src/Transform.java b/test/984-obsolete-invoke/src/Transform.java
deleted file mode 100644
index 536de84c46..0000000000
--- a/test/984-obsolete-invoke/src/Transform.java
+++ /dev/null
@@ -1,25 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
- // This method must be 'static' so that when we try to invoke it through a j.l.r.Method we will
- // simply use the jmethodID directly and not do any lookup in any receiver object.
- public static void sayHi(Runnable r) {
- System.out.println("hello");
- r.run();
- System.out.println("goodbye");
- }
-}
diff --git a/test/984-obsolete-invoke/src/art/Redefinition.java b/test/984-obsolete-invoke/src/art/Redefinition.java
new file mode 100644
index 0000000000..0350ab42ad
--- /dev/null
+++ b/test/984-obsolete-invoke/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+ // Bind native functions.
+ static {
+ Main.bindAgentJNIForClass(Redefinition.class);
+ }
+
+ public static final class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+ }
+
+ // A set of possible test configurations. Test should set this if they need to.
+ // This must be kept in sync with the defines in ti-agent/common_helper.cc
+ public static enum Config {
+ COMMON_REDEFINE(0),
+ COMMON_RETRANSFORM(1),
+ COMMON_TRANSFORM(2);
+
+ private final int val;
+ private Config(int val) {
+ this.val = val;
+ }
+ }
+
+ public static void setTestConfiguration(Config type) {
+ nativeSetTestConfiguration(type.val);
+ }
+
+ private static native void nativeSetTestConfiguration(int type);
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+ public static native void doCommonClassRetransformation(Class<?>... target);
+ public static native void setPopRetransformations(boolean pop);
+ public static native void popTransformationFor(String name);
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/984-obsolete-invoke/src/art/Test984.java b/test/984-obsolete-invoke/src/art/Test984.java
new file mode 100644
index 0000000000..3fe66f68bf
--- /dev/null
+++ b/test/984-obsolete-invoke/src/art/Test984.java
@@ -0,0 +1,122 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.lang.reflect.Method;
+import java.util.Base64;
+
+public class Test984 {
+
+ static class Transform {
+ // This method must be 'static' so that when we try to invoke it through a j.l.r.Method we will
+ // simply use the jmethodID directly and not do any lookup in any receiver object.
+ public static void sayHi(Runnable r) {
+ System.out.println("hello");
+ r.run();
+ System.out.println("goodbye");
+ }
+ }
+ // static class Transform {
+ // public static void sayHi(Runnable r) {
+ // System.out.println("Hello - Transformed");
+ // r.run();
+ // System.out.println("Goodbye - Transformed");
+ // }
+ // }
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAKAoACAARCQASABMIABQKABUAFgsAFwAYCAAZBwAbBwAeAQAGPGluaXQ+AQADKClW" +
+ "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
+ "KVYBAApTb3VyY2VGaWxlAQAMVGVzdDk4NC5qYXZhDAAJAAoHAB8MACAAIQEAE0hlbGxvIC0gVHJh" +
+ "bnNmb3JtZWQHACIMACMAJAcAJQwAJgAKAQAVR29vZGJ5ZSAtIFRyYW5zZm9ybWVkBwAnAQAVYXJ0" +
+ "L1Rlc3Q5ODQkVHJhbnNmb3JtAQAJVHJhbnNmb3JtAQAMSW5uZXJDbGFzc2VzAQAQamF2YS9sYW5n" +
+ "L09iamVjdAEAEGphdmEvbGFuZy9TeXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsB" +
+ "ABNqYXZhL2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgEA" +
+ "EmphdmEvbGFuZy9SdW5uYWJsZQEAA3J1bgEAC2FydC9UZXN0OTg0ACAABwAIAAAAAAACAAAACQAK" +
+ "AAEACwAAAB0AAQABAAAABSq3AAGxAAAAAQAMAAAABgABAAAABQAJAA0ADgABAAsAAAA7AAIAAQAA" +
+ "ABeyAAISA7YABCq5AAUBALIAAhIGtgAEsQAAAAEADAAAABIABAAAAAcACAAIAA4ACQAWAAoAAgAP" +
+ "AAAAAgAQAB0AAAAKAAEABwAaABwACA==");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQB/mxSMAAAAAAAAAAAAAAAAAAAAAAAAAAA8BAAAcAAAAHhWNBIAAAAAAAAAAHgDAAAX" +
+ "AAAAcAAAAAoAAADMAAAAAwAAAPQAAAABAAAAGAEAAAUAAAAgAQAAAQAAAEgBAADUAgAAaAEAAGgB" +
+ "AABwAQAAhwEAAJwBAAC1AQAAxAEAAOgBAAAIAgAAHwIAADMCAABJAgAAXQIAAHECAAB/AgAAigIA" +
+ "AI0CAACRAgAAngIAAKQCAACpAgAAsgIAALcCAAC+AgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAA" +
+ "CQAAAAoAAAALAAAADgAAAA4AAAAJAAAAAAAAAA8AAAAJAAAAyAIAAA8AAAAJAAAA0AIAAAgABAAS" +
+ "AAAAAAAAAAAAAAAAAAEAFQAAAAQAAgATAAAABQAAAAAAAAAGAAAAFAAAAAAAAAAAAAAABQAAAAAA" +
+ "AAAMAAAAaAMAADwDAAAAAAAABjxpbml0PgAVR29vZGJ5ZSAtIFRyYW5zZm9ybWVkABNIZWxsbyAt" +
+ "IFRyYW5zZm9ybWVkABdMYXJ0L1Rlc3Q5ODQkVHJhbnNmb3JtOwANTGFydC9UZXN0OTg0OwAiTGRh" +
+ "bHZpay9hbm5vdGF0aW9uL0VuY2xvc2luZ0NsYXNzOwAeTGRhbHZpay9hbm5vdGF0aW9uL0lubmVy" +
+ "Q2xhc3M7ABVMamF2YS9pby9QcmludFN0cmVhbTsAEkxqYXZhL2xhbmcvT2JqZWN0OwAUTGphdmEv" +
+ "bGFuZy9SdW5uYWJsZTsAEkxqYXZhL2xhbmcvU3RyaW5nOwASTGphdmEvbGFuZy9TeXN0ZW07AAxU" +
+ "ZXN0OTg0LmphdmEACVRyYW5zZm9ybQABVgACVkwAC2FjY2Vzc0ZsYWdzAARuYW1lAANvdXQAB3By" +
+ "aW50bG4AA3J1bgAFc2F5SGkABXZhbHVlAAAAAAEAAAAGAAAAAQAAAAcAAAAFAAcOAAcBAAcOAQgP" +
+ "AQMPAQgPAAEAAQABAAAA2AIAAAQAAABwEAMAAAAOAAMAAQACAAAA3QIAABQAAABiAAAAGwECAAAA" +
+ "biACABAAchAEAAIAYgAAABsBAQAAAG4gAgAQAA4AAAACAACAgATsBQEJhAYAAAICARYYAQIDAhAE" +
+ "CBEXDQACAAAATAMAAFIDAABcAwAAAAAAAAAAAAAAAAAAEAAAAAAAAAABAAAAAAAAAAEAAAAXAAAA" +
+ "cAAAAAIAAAAKAAAAzAAAAAMAAAADAAAA9AAAAAQAAAABAAAAGAEAAAUAAAAFAAAAIAEAAAYAAAAB" +
+ "AAAASAEAAAIgAAAXAAAAaAEAAAEQAAACAAAAyAIAAAMgAAACAAAA2AIAAAEgAAACAAAA7AIAAAAg" +
+ "AAABAAAAPAMAAAQgAAACAAAATAMAAAMQAAABAAAAXAMAAAYgAAABAAAAaAMAAAAQAAABAAAAeAMA" +
+ "AA==");
+
+ public static void run() {
+ art.Main.bindAgentJNIForClass(Test984.class);
+ doTest();
+ }
+
+ // The Method that holds an obsolete method pointer. We will fill it in by getting a jmethodID
+ // from a stack with an obsolete method in it. There should be no other ways to obtain an obsolete
+ // jmethodID in ART without unsafe casts.
+ public static Method obsolete_method = null;
+
+ public static void doTest() {
+ // Capture the obsolete method.
+ //
+ // NB The obsolete method must be direct so that we will not look in the receiver type to get
+ // the actual method.
+ Transform.sayHi(() -> {
+ System.out.println("transforming calling function");
+ Redefinition.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+ System.out.println("Retrieving obsolete method from current stack");
+ // This should get the obsolete sayHi method (as the only obsolete method on the current
+ // threads stack).
+ Test984.obsolete_method = getFirstObsoleteMethod984();
+ });
+
+ // Prove we did actually redefine something.
+ System.out.println("Invoking redefined version of method.");
+ Transform.sayHi(() -> { System.out.println("Not doing anything here"); });
+
+ System.out.println("invoking obsolete method");
+ try {
+ obsolete_method.invoke(null, (Runnable)() -> {
+ throw new Error("Unexpected code running from invoke of obsolete method!");
+ });
+ throw new Error("Running obsolete method did not throw exception");
+ } catch (Throwable e) {
+ if (e instanceof InternalError || e.getCause() instanceof InternalError) {
+ System.out.println("Caught expected error from attempting to invoke an obsolete method.");
+ } else {
+ System.out.println("Unexpected error type for calling obsolete method! Expected either "
+ + "an InternalError or something that is caused by an InternalError.");
+ throw new Error("Unexpected error caught: ", e);
+ }
+ }
+ }
+
+ // Gets the first obsolete method on the current threads stack (NB only looks through the first 30
+ // stack frames).
+ private static native Method getFirstObsoleteMethod984();
+}
diff --git a/test/Android.bp b/test/Android.bp
index 8059a2f204..c5d96da20c 100644
--- a/test/Android.bp
+++ b/test/Android.bp
@@ -250,6 +250,7 @@ art_cc_defaults {
"ti-agent/jni_binder.cc",
"ti-agent/jvmti_helper.cc",
"ti-agent/test_env.cc",
+ "ti-agent/common_helper.cc",
// This is the list of non-special OnLoad things and excludes BCI and anything that depends
// on ART internals.
"903-hello-tagging/tagging.cc",
@@ -260,6 +261,7 @@ art_cc_defaults {
"908-gc-start-finish/gc_callbacks.cc",
"910-methods/methods.cc",
"911-get-stack-trace/stack_trace.cc",
+ "913-heaps/heaps.cc",
"918-fields/fields.cc",
"920-objects/objects.cc",
"922-properties/properties.cc",
@@ -271,6 +273,8 @@ art_cc_defaults {
"929-search/search.cc",
"931-agent-thread/agent_thread.cc",
"933-misc-events/misc_events.cc",
+ "945-obsolete-native/obsolete_native.cc",
+ "984-obsolete-invoke/obsolete_invoke.cc",
],
shared_libs: [
"libbase",
@@ -286,20 +290,14 @@ art_cc_defaults {
// This is to get the IsInterpreted native method.
"common/stack_inspect.cc",
"common/runtime_state.cc",
+ "ti-agent/common_load.cc",
// This includes the remaining test functions. We should try to refactor things to
// make this list smaller.
- "ti-agent/common_helper.cc",
- "ti-agent/common_load.cc",
"901-hello-ti-agent/basics.cc",
"909-attach-agent/attach.cc",
"912-classes/classes.cc",
- "913-heaps/heaps.cc",
"936-search-onload/search_onload.cc",
- "944-transform-classloaders/classloader.cc",
- "945-obsolete-native/obsolete_native.cc",
- "980-redefine-object/redefine_object.cc",
"983-source-transform-verify/source_transform.cc",
- "984-obsolete-invoke/obsolete_invoke.cc",
],
}
diff --git a/test/Android.run-test-jvmti-java-library.mk b/test/Android.run-test-jvmti-java-library.mk
index b6da92b942..dcb238cd9f 100644
--- a/test/Android.run-test-jvmti-java-library.mk
+++ b/test/Android.run-test-jvmti-java-library.mk
@@ -18,13 +18,17 @@ LOCAL_PATH := $(call my-dir)
include $(CLEAR_VARS)
-# Main shim classes. We use one that exposes the tagging common functionality.
-LOCAL_MAIN_SHIM := 903-hello-tagging/src/art/Main.java
-LOCAL_SRC_FILES := $(LOCAL_MAIN_SHIM)
+# shim classes. We use one that exposes the common functionality.
+LOCAL_SHIM_CLASSES := \
+ 902-hello-transformation/src/art/Redefinition.java \
+ 903-hello-tagging/src/art/Main.java \
+
+LOCAL_SRC_FILES := $(LOCAL_SHIM_CLASSES)
# Actual test classes.
LOCAL_SRC_FILES += \
901-hello-ti-agent/src/art/Test901.java \
+ 902-hello-transformation/src/art/Test902.java \
903-hello-tagging/src/art/Test903.java \
904-object-allocation/src/art/Test904.java \
905-object-free/src/art/Test905.java \
@@ -42,19 +46,36 @@ LOCAL_SRC_FILES += \
911-get-stack-trace/src/art/SameThread.java \
911-get-stack-trace/src/art/ThreadListTraces.java \
913-heaps/src/art/Test913.java \
+ 914-hello-obsolescence/src/art/Test914.java \
+ 915-obsolete-2/src/art/Test915.java \
+ 917-fields-transformation/src/art/Test917.java \
918-fields/src/art/Test918.java \
+ 919-obsolete-fields/src/art/Test919.java \
920-objects/src/art/Test920.java \
922-properties/src/art/Test922.java \
923-monitors/src/art/Test923.java \
924-threads/src/art/Test924.java \
925-threadgroups/src/art/Test925.java \
+ 926-multi-obsolescence/src/art/Test926.java \
927-timers/src/art/Test927.java \
928-jni-table/src/art/Test928.java \
+ 930-hello-retransform/src/art/Test930.java \
931-agent-thread/src/art/Test931.java \
+ 932-transform-saves/src/art/Test932.java \
933-misc-events/src/art/Test933.java \
+ 940-recursive-obsolete/src/art/Test940.java \
+ 942-private-recursive/src/art/Test942.java \
+ 944-transform-classloaders/src/art/Test944.java \
+ 945-obsolete-native/src/art/Test945.java \
+ 947-reflect-method/src/art/Test947.java \
+ 951-threaded-obsolete/src/art/Test951.java \
+ 981-dedup-original-dex/src/art/Test981.java \
+ 982-ok-no-retransform/src/art/Test982.java \
+ 984-obsolete-invoke/src/art/Test984.java \
JVMTI_RUN_TEST_GENERATED_NUMBERS := \
901 \
+ 902 \
903 \
904 \
905 \
@@ -64,16 +85,32 @@ JVMTI_RUN_TEST_GENERATED_NUMBERS := \
910 \
911 \
913 \
+ 914 \
+ 915 \
+ 917 \
918 \
+ 919 \
920 \
922 \
923 \
924 \
925 \
+ 926 \
927 \
928 \
+ 930 \
931 \
+ 932 \
933 \
+ 940 \
+ 942 \
+ 944 \
+ 945 \
+ 947 \
+ 951 \
+ 981 \
+ 982 \
+ 984 \
# Try to enforce that the directories correspond to the Java files we pull in.
JVMTI_RUN_TEST_DIR_CHECK := $(sort $(foreach DIR,$(JVMTI_RUN_TEST_GENERATED_NUMBERS), \
diff --git a/test/etc/default-build b/test/etc/default-build
index d74b24d985..744c38bb6d 100755
--- a/test/etc/default-build
+++ b/test/etc/default-build
@@ -91,7 +91,7 @@ JAVAC_EXPERIMENTAL_ARGS["default-methods"]="-source 1.8 -target 1.8"
JAVAC_EXPERIMENTAL_ARGS["lambdas"]="-source 1.8 -target 1.8"
JAVAC_EXPERIMENTAL_ARGS["method-handles"]="-source 1.8 -target 1.8"
# We need to leave javac at default 1.7 so that dx will continue to work
-JAVAC_EXPERIMENTAL_ARGS[${DEFAULT_EXPERIMENT}]="-source 1.7 -target 1.7"
+JAVAC_EXPERIMENTAL_ARGS[${DEFAULT_EXPERIMENT}]="-source 1.8 -target 1.8"
JAVAC_EXPERIMENTAL_ARGS["agents"]="-source 1.8 -target 1.8"
while true; do
diff --git a/test/knownfailures.json b/test/knownfailures.json
index 54786bb772..29c1e8bfd0 100644
--- a/test/knownfailures.json
+++ b/test/knownfailures.json
@@ -601,20 +601,20 @@
},
{
"tests": [
- "008-exceptions",
"031-class-attributes",
- "034-call-null",
- "038-inner-null",
- "054-uncaught",
- "122-npe",
- "439-npe",
- "911-get-stack-trace",
- "946-obsolete-throw"
+ "911-get-stack-trace"
],
"description": [
"Tests that use annotations and debug data that is not kept around by dexter."
],
- "bug": "b/37240685 & b/37239009",
+ "bug": "b/37239009",
"variant": "jvmti-stress"
+ },
+ {
+ "tests": "160-read-barrier-stress",
+ "description": ["Disable 160-read-barrier-stress temporarily until we find ",
+ "a fix to avoid the OOME with Jack. Note that it cannot be compiled ",
+ "by javac either ('error: code too large')"],
+ "bug": "http://b/37335480"
}
]
diff --git a/test/ti-agent/common_helper.cc b/test/ti-agent/common_helper.cc
index ab5dbcc0db..bfd4d254f4 100644
--- a/test/ti-agent/common_helper.cc
+++ b/test/ti-agent/common_helper.cc
@@ -17,18 +17,15 @@
#include "common_helper.h"
#include <dlfcn.h>
+#include <map>
#include <stdio.h>
#include <sstream>
#include <deque>
+#include <vector>
#include "android-base/stringprintf.h"
-#include "art_method.h"
#include "jni.h"
-#include "jni_internal.h"
#include "jvmti.h"
-#include "scoped_thread_state_change-inl.h"
-#include "stack.h"
-#include "utils.h"
#include "jni_binder.h"
#include "jvmti_helper.h"
@@ -37,6 +34,10 @@
namespace art {
+static void SetupCommonRetransform();
+static void SetupCommonRedefine();
+static void SetupCommonTransform();
+
template <bool is_redefine>
static void throwCommonRedefinitionError(jvmtiEnv* jvmti,
JNIEnv* env,
@@ -108,18 +109,15 @@ static void DoClassRedefine(jvmtiEnv* jvmti_env,
// Magic JNI export that classes can use for redefining classes.
// To use classes should declare this as a native function with signature (Ljava/lang/Class;[B[B)V
-extern "C" JNIEXPORT void JNICALL Java_Main_doCommonClassRedefinition(JNIEnv* env,
- jclass,
- jclass target,
- jbyteArray class_file_bytes,
- jbyteArray dex_file_bytes) {
+extern "C" JNIEXPORT void JNICALL Java_art_Redefinition_doCommonClassRedefinition(
+ JNIEnv* env, jclass, jclass target, jbyteArray class_file_bytes, jbyteArray dex_file_bytes) {
DoClassRedefine(jvmti_env, env, target, class_file_bytes, dex_file_bytes);
}
// Magic JNI export that classes can use for redefining classes.
// To use classes should declare this as a native function with signature
// ([Ljava/lang/Class;[[B[[B)V
-extern "C" JNIEXPORT void JNICALL Java_Main_doCommonMultiClassRedefinition(
+extern "C" JNIEXPORT void JNICALL Java_art_Redefinition_doCommonMultiClassRedefinition(
JNIEnv* env,
jclass,
jobjectArray targets,
@@ -155,11 +153,7 @@ jint OnLoad(JavaVM* vm,
printf("Unable to get jvmti env!\n");
return 1;
}
- jvmtiCapabilities caps;
- jvmti_env->GetPotentialCapabilities(&caps);
- caps.can_retransform_classes = 0;
- caps.can_retransform_any_class = 0;
- jvmti_env->AddCapabilities(&caps);
+ SetupCommonRedefine();
return 0;
}
@@ -183,11 +177,8 @@ struct CommonTransformationResult {
std::map<std::string, std::deque<CommonTransformationResult>> gTransformations;
bool gPopTransformations = true;
-extern "C" JNIEXPORT void JNICALL Java_Main_addCommonTransformationResult(JNIEnv* env,
- jclass,
- jstring class_name,
- jbyteArray class_array,
- jbyteArray dex_array) {
+extern "C" JNIEXPORT void JNICALL Java_art_Redefinition_addCommonTransformationResult(
+ JNIEnv* env, jclass, jstring class_name, jbyteArray class_array, jbyteArray dex_array) {
const char* name_chrs = env->GetStringUTFChars(class_name, nullptr);
std::string name_str(name_chrs);
env->ReleaseStringUTFChars(class_name, name_chrs);
@@ -244,15 +235,15 @@ void JNICALL CommonClassFileLoadHookRetransformable(jvmtiEnv* jvmti_env,
}
}
-extern "C" JNIEXPORT void Java_Main_setPopRetransformations(JNIEnv*,
- jclass,
- jboolean enable) {
+extern "C" JNIEXPORT void Java_art_Redefinition_setPopRetransformations(JNIEnv*,
+ jclass,
+ jboolean enable) {
gPopTransformations = enable;
}
-extern "C" JNIEXPORT void Java_Main_popTransformationFor(JNIEnv* env,
- jclass,
- jstring class_name) {
+extern "C" JNIEXPORT void Java_art_Redefinition_popTransformationFor(JNIEnv* env,
+ jclass,
+ jstring class_name) {
const char* name_chrs = env->GetStringUTFChars(class_name, nullptr);
std::string name_str(name_chrs);
env->ReleaseStringUTFChars(class_name, name_chrs);
@@ -267,9 +258,9 @@ extern "C" JNIEXPORT void Java_Main_popTransformationFor(JNIEnv* env,
}
}
-extern "C" JNIEXPORT void Java_Main_enableCommonRetransformation(JNIEnv* env,
- jclass,
- jboolean enable) {
+extern "C" JNIEXPORT void Java_art_Redefinition_enableCommonRetransformation(JNIEnv* env,
+ jclass,
+ jboolean enable) {
jvmtiError res = jvmti_env->SetEventNotificationMode(enable ? JVMTI_ENABLE : JVMTI_DISABLE,
JVMTI_EVENT_CLASS_FILE_LOAD_HOOK,
nullptr);
@@ -298,9 +289,8 @@ static void DoClassRetransformation(jvmtiEnv* jvmti_env, JNIEnv* env, jobjectArr
}
}
-extern "C" JNIEXPORT void JNICALL Java_Main_doCommonClassRetransformation(JNIEnv* env,
- jclass,
- jobjectArray targets) {
+extern "C" JNIEXPORT void JNICALL Java_art_Redefinition_doCommonClassRetransformation(
+ JNIEnv* env, jclass, jobjectArray targets) {
jvmtiCapabilities caps;
jvmtiError caps_err = jvmti_env->GetCapabilities(&caps);
if (caps_err != JVMTI_ERROR_NONE) {
@@ -338,14 +328,7 @@ jint OnLoad(JavaVM* vm,
printf("Unable to get jvmti env!\n");
return 1;
}
- SetAllCapabilities(jvmti_env);
- jvmtiEventCallbacks cb;
- memset(&cb, 0, sizeof(cb));
- cb.ClassFileLoadHook = CommonClassFileLoadHookRetransformable;
- if (jvmti_env->SetEventCallbacks(&cb, sizeof(cb)) != JVMTI_ERROR_NONE) {
- printf("Unable to set class file load hook cb!\n");
- return 1;
- }
+ SetupCommonRetransform();
return 0;
}
@@ -353,8 +336,6 @@ jint OnLoad(JavaVM* vm,
namespace common_transform {
-using art::common_retransform::CommonClassFileLoadHookRetransformable;
-
// Get all capabilities except those related to retransformation.
jint OnLoad(JavaVM* vm,
char* options ATTRIBUTE_UNUSED,
@@ -363,6 +344,35 @@ jint OnLoad(JavaVM* vm,
printf("Unable to get jvmti env!\n");
return 1;
}
+ SetupCommonTransform();
+ return 0;
+}
+
+} // namespace common_transform
+
+#define CONFIGURATION_COMMON_REDEFINE 0
+#define CONFIGURATION_COMMON_RETRANSFORM 1
+#define CONFIGURATION_COMMON_TRANSFORM 2
+
+static void SetupCommonRedefine() {
+ jvmtiCapabilities caps;
+ jvmti_env->GetPotentialCapabilities(&caps);
+ caps.can_retransform_classes = 0;
+ caps.can_retransform_any_class = 0;
+ jvmti_env->AddCapabilities(&caps);
+}
+
+static void SetupCommonRetransform() {
+ SetAllCapabilities(jvmti_env);
+ jvmtiEventCallbacks cb;
+ memset(&cb, 0, sizeof(cb));
+ cb.ClassFileLoadHook = common_retransform::CommonClassFileLoadHookRetransformable;
+ jvmtiError res = jvmti_env->SetEventCallbacks(&cb, sizeof(cb));
+ CHECK_EQ(res, JVMTI_ERROR_NONE);
+ common_retransform::gTransformations.clear();
+}
+
+static void SetupCommonTransform() {
// Don't set the retransform caps
jvmtiCapabilities caps;
jvmti_env->GetPotentialCapabilities(&caps);
@@ -373,14 +383,31 @@ jint OnLoad(JavaVM* vm,
// Use the same callback as the retransform test.
jvmtiEventCallbacks cb;
memset(&cb, 0, sizeof(cb));
- cb.ClassFileLoadHook = CommonClassFileLoadHookRetransformable;
- if (jvmti_env->SetEventCallbacks(&cb, sizeof(cb)) != JVMTI_ERROR_NONE) {
- printf("Unable to set class file load hook cb!\n");
- return 1;
- }
- return 0;
+ cb.ClassFileLoadHook = common_retransform::CommonClassFileLoadHookRetransformable;
+ jvmtiError res = jvmti_env->SetEventCallbacks(&cb, sizeof(cb));
+ CHECK_EQ(res, JVMTI_ERROR_NONE);
+ common_retransform::gTransformations.clear();
}
-} // namespace common_transform
-
+extern "C" JNIEXPORT void JNICALL Java_art_Redefinition_nativeSetTestConfiguration(JNIEnv*,
+ jclass,
+ jint type) {
+ switch (type) {
+ case CONFIGURATION_COMMON_REDEFINE: {
+ SetupCommonRedefine();
+ return;
+ }
+ case CONFIGURATION_COMMON_RETRANSFORM: {
+ SetupCommonRetransform();
+ return;
+ }
+ case CONFIGURATION_COMMON_TRANSFORM: {
+ SetupCommonTransform();
+ return;
+ }
+ default: {
+ LOG(FATAL) << "Unknown test configuration: " << type;
+ }
+ }
+}
} // namespace art
diff --git a/test/ti-agent/common_load.cc b/test/ti-agent/common_load.cc
index 9e7b75daf2..3455409b2d 100644
--- a/test/ti-agent/common_load.cc
+++ b/test/ti-agent/common_load.cc
@@ -60,31 +60,17 @@ static jint MinimalOnLoad(JavaVM* vm,
// MinimalOnLoad.
static AgentLib agents[] = {
{ "901-hello-ti-agent", Test901HelloTi::OnLoad, nullptr },
- { "902-hello-transformation", common_redefine::OnLoad, nullptr },
{ "909-attach-agent", nullptr, Test909AttachAgent::OnAttach },
- { "914-hello-obsolescence", common_redefine::OnLoad, nullptr },
- { "915-obsolete-2", common_redefine::OnLoad, nullptr },
{ "916-obsolete-jit", common_redefine::OnLoad, nullptr },
- { "917-fields-transformation", common_redefine::OnLoad, nullptr },
- { "919-obsolete-fields", common_redefine::OnLoad, nullptr },
{ "921-hello-failure", common_retransform::OnLoad, nullptr },
- { "926-multi-obsolescence", common_redefine::OnLoad, nullptr },
- { "930-hello-retransform", common_retransform::OnLoad, nullptr },
- { "932-transform-saves", common_retransform::OnLoad, nullptr },
{ "934-load-transform", common_retransform::OnLoad, nullptr },
{ "935-non-retransformable", common_transform::OnLoad, nullptr },
{ "936-search-onload", Test936SearchOnload::OnLoad, nullptr },
{ "937-hello-retransform-package", common_retransform::OnLoad, nullptr },
{ "938-load-transform-bcp", common_retransform::OnLoad, nullptr },
{ "939-hello-transformation-bcp", common_redefine::OnLoad, nullptr },
- { "940-recursive-obsolete", common_redefine::OnLoad, nullptr },
{ "941-recursive-obsolete-jit", common_redefine::OnLoad, nullptr },
- { "942-private-recursive", common_redefine::OnLoad, nullptr },
{ "943-private-recursive-jit", common_redefine::OnLoad, nullptr },
- { "944-transform-classloaders", common_redefine::OnLoad, nullptr },
- { "945-obsolete-native", common_redefine::OnLoad, nullptr },
- { "981-dedup-original-dex", common_retransform::OnLoad, nullptr },
- { "982-ok-no-retransform", common_retransform::OnLoad, nullptr },
{ "983-source-transform-verify", Test983SourceTransformVerify::OnLoad, nullptr },
};