diff options
| -rw-r--r-- | runtime/openjdkjvmti/OpenjdkJvmTi.cc | 89 | ||||
| -rw-r--r-- | runtime/openjdkjvmti/art_jvmti.h | 28 | ||||
| -rw-r--r-- | runtime/openjdkjvmti/events-inl.h | 86 | ||||
| -rw-r--r-- | runtime/openjdkjvmti/events.h | 9 | ||||
| -rw-r--r-- | runtime/openjdkjvmti/ti_redefine.cc | 98 | ||||
| -rw-r--r-- | runtime/openjdkjvmti/ti_redefine.h | 16 | ||||
| -rw-r--r-- | runtime/openjdkjvmti/transform.cc | 136 | ||||
| -rw-r--r-- | runtime/openjdkjvmti/transform.h | 34 | ||||
| -rw-r--r-- | test/921-hello-failure/expected.txt | 8 | ||||
| -rw-r--r-- | test/921-hello-failure/src/Main.java | 14 | ||||
| -rw-r--r-- | test/921-hello-failure/src/MultiRetrans.java | 108 | ||||
| -rwxr-xr-x | test/930-hello-retransform/build | 17 | ||||
| -rw-r--r-- | test/930-hello-retransform/expected.txt | 2 | ||||
| -rw-r--r-- | test/930-hello-retransform/info.txt | 1 | ||||
| -rwxr-xr-x | test/930-hello-retransform/run | 19 | ||||
| -rw-r--r-- | test/930-hello-retransform/src/Main.java | 70 | ||||
| -rw-r--r-- | test/930-hello-retransform/src/Transform.java | 28 | ||||
| -rw-r--r-- | test/Android.run-test.mk | 1 | ||||
| -rw-r--r-- | test/ti-agent/common_helper.cc | 167 | ||||
| -rw-r--r-- | test/ti-agent/common_helper.h | 4 | ||||
| -rw-r--r-- | test/ti-agent/common_load.cc | 3 |
21 files changed, 785 insertions, 153 deletions
diff --git a/runtime/openjdkjvmti/OpenjdkJvmTi.cc b/runtime/openjdkjvmti/OpenjdkJvmTi.cc index 90467db8f6..32e3948e3e 100644 --- a/runtime/openjdkjvmti/OpenjdkJvmTi.cc +++ b/runtime/openjdkjvmti/OpenjdkJvmTi.cc @@ -631,7 +631,17 @@ class JvmtiFunctions { } static jvmtiError RetransformClasses(jvmtiEnv* env, jint class_count, const jclass* classes) { - return ERR(NOT_IMPLEMENTED); + std::string error_msg; + jvmtiError res = Transformer::RetransformClasses(ArtJvmTiEnv::AsArtJvmTiEnv(env), + art::Runtime::Current(), + art::Thread::Current(), + class_count, + classes, + &error_msg); + if (res != OK) { + LOG(WARNING) << "FAILURE TO RETRANFORM " << error_msg; + } + return res; } static jvmtiError RedefineClasses(jvmtiEnv* env, @@ -1255,78 +1265,6 @@ class JvmtiFunctions { *format_ptr = jvmtiJlocationFormat::JVMTI_JLOCATION_JVMBCI; return ERR(NONE); } - - // TODO Remove this once events are working. - static jvmtiError RetransformClassWithHook(jvmtiEnv* env, - jclass klass, - jvmtiEventClassFileLoadHook hook) { - std::vector<jclass> classes; - classes.push_back(klass); - return RetransformClassesWithHook(reinterpret_cast<ArtJvmTiEnv*>(env), classes, hook); - } - - // TODO This will be called by the event handler for the art::ti Event Load Event - static jvmtiError RetransformClassesWithHook(ArtJvmTiEnv* env, - const std::vector<jclass>& classes, - jvmtiEventClassFileLoadHook hook) { - if (!IsValidEnv(env)) { - return ERR(INVALID_ENVIRONMENT); - } - jvmtiError res = OK; - std::string error; - for (jclass klass : classes) { - JNIEnv* jni_env = nullptr; - jobject loader = nullptr; - std::string name; - jobject protection_domain = nullptr; - jint data_len = 0; - unsigned char* dex_data = nullptr; - jvmtiError ret = OK; - std::string location; - if ((ret = GetTransformationData(env, - klass, - /*out*/&location, - /*out*/&jni_env, - /*out*/&loader, - /*out*/&name, - /*out*/&protection_domain, - /*out*/&data_len, - /*out*/&dex_data)) != OK) { - // TODO Do something more here? Maybe give log statements? - return ret; - } - jint new_data_len = 0; - unsigned char* new_dex_data = nullptr; - hook(env, - jni_env, - klass, - loader, - name.c_str(), - protection_domain, - data_len, - dex_data, - /*out*/&new_data_len, - /*out*/&new_dex_data); - // Check if anything actually changed. - if ((new_data_len != 0 || new_dex_data != nullptr) && new_dex_data != dex_data) { - jvmtiClassDefinition def = { klass, new_data_len, new_dex_data }; - res = Redefiner::RedefineClasses(env, - art::Runtime::Current(), - art::Thread::Current(), - 1, - &def, - &error); - env->Deallocate(new_dex_data); - } - // Deallocate the old dex data. - env->Deallocate(dex_data); - if (res != OK) { - LOG(ERROR) << "FAILURE TO REDEFINE " << error; - return res; - } - } - return OK; - } }; static bool IsJvmtiVersion(jint version) { @@ -1369,10 +1307,7 @@ extern "C" bool ArtPlugin_Initialize() { // The actual struct holding all of the entrypoints into the jvmti interface. const jvmtiInterface_1 gJvmtiInterface = { - // SPECIAL FUNCTION: RetransformClassWithHook Is normally reserved1 - // TODO Remove once we have events working. - reinterpret_cast<void*>(JvmtiFunctions::RetransformClassWithHook), - // nullptr, // reserved1 + nullptr, // reserved1 JvmtiFunctions::SetEventNotificationMode, nullptr, // reserved3 JvmtiFunctions::GetAllThreads, diff --git a/runtime/openjdkjvmti/art_jvmti.h b/runtime/openjdkjvmti/art_jvmti.h index 5eadc5a8e0..1c84d4d0ce 100644 --- a/runtime/openjdkjvmti/art_jvmti.h +++ b/runtime/openjdkjvmti/art_jvmti.h @@ -47,6 +47,7 @@ namespace openjdkjvmti { extern const jvmtiInterface_1 gJvmtiInterface; +extern EventHandler gEventHandler; // A structure that is a jvmtiEnv with additional information for the runtime. struct ArtJvmTiEnv : public jvmtiEnv { @@ -124,6 +125,29 @@ static inline jvmtiError CopyString(jvmtiEnv* env, const char* src, unsigned cha return ret; } +struct ArtClassDefinition { + jclass klass; + jobject loader; + std::string name; + jobject protection_domain; + jint dex_len; + JvmtiUniquePtr dex_data; + bool modified; + + ArtClassDefinition() = default; + ArtClassDefinition(ArtClassDefinition&& o) = default; + + void SetNewDexData(ArtJvmTiEnv* env, jint new_dex_len, unsigned char* new_dex_data) { + if (new_dex_data == nullptr) { + return; + } else if (new_dex_data != dex_data.get() || new_dex_len != dex_len) { + modified = true; + dex_len = new_dex_len; + dex_data = MakeJvmtiUniquePtr(env, new_dex_data); + } + } +}; + const jvmtiCapabilities kPotentialCapabilities = { .can_tag_objects = 1, .can_generate_field_modification_events = 0, @@ -134,7 +158,7 @@ const jvmtiCapabilities kPotentialCapabilities = { .can_get_current_contended_monitor = 0, .can_get_monitor_info = 0, .can_pop_frame = 0, - .can_redefine_classes = 0, + .can_redefine_classes = 1, .can_signal_thread = 0, .can_get_source_file_name = 0, .can_get_line_numbers = 0, @@ -162,7 +186,7 @@ const jvmtiCapabilities kPotentialCapabilities = { .can_get_owned_monitor_stack_depth_info = 0, .can_get_constant_pool = 0, .can_set_native_method_prefix = 0, - .can_retransform_classes = 0, + .can_retransform_classes = 1, .can_retransform_any_class = 0, .can_generate_resource_exhaustion_heap_events = 0, .can_generate_resource_exhaustion_threads_events = 0, diff --git a/runtime/openjdkjvmti/events-inl.h b/runtime/openjdkjvmti/events-inl.h index 1e07bc6b7b..21ec731ba5 100644 --- a/runtime/openjdkjvmti/events-inl.h +++ b/runtime/openjdkjvmti/events-inl.h @@ -115,9 +115,95 @@ ALWAYS_INLINE static inline FnType* GetCallback(ArtJvmTiEnv* env, ArtJvmtiEvent } template <typename ...Args> +inline void EventHandler::DispatchClassFileLoadHookEvent(art::Thread*, + ArtJvmtiEvent event, + Args... args ATTRIBUTE_UNUSED) const { + CHECK(event == ArtJvmtiEvent::kClassFileLoadHookRetransformable || + event == ArtJvmtiEvent::kClassFileLoadHookNonRetransformable); + LOG(FATAL) << "Incorrect arguments to ClassFileLoadHook!"; +} + +// TODO Locking of some type! +template <> +inline void EventHandler::DispatchClassFileLoadHookEvent(art::Thread* thread, + ArtJvmtiEvent event, + JNIEnv* jnienv, + jclass class_being_redefined, + jobject loader, + const char* name, + jobject protection_domain, + jint class_data_len, + const unsigned char* class_data, + jint* new_class_data_len, + unsigned char** new_class_data) const { + CHECK(event == ArtJvmtiEvent::kClassFileLoadHookRetransformable || + event == ArtJvmtiEvent::kClassFileLoadHookNonRetransformable); + using FnType = void(jvmtiEnv* /* jvmti_env */, + JNIEnv* /* jnienv */, + jclass /* class_being_redefined */, + jobject /* loader */, + const char* /* name */, + jobject /* protection_domain */, + jint /* class_data_len */, + const unsigned char* /* class_data */, + jint* /* new_class_data_len */, + unsigned char** /* new_class_data */); + jint current_len = class_data_len; + unsigned char* current_class_data = const_cast<unsigned char*>(class_data); + ArtJvmTiEnv* last_env = nullptr; + for (ArtJvmTiEnv* env : envs) { + if (ShouldDispatch(event, env, thread)) { + jint new_len; + unsigned char* new_data; + FnType* callback = GetCallback<FnType>(env, event); + callback(env, + jnienv, + class_being_redefined, + loader, + name, + protection_domain, + current_len, + current_class_data, + &new_len, + &new_data); + if (new_data != nullptr && new_data != current_class_data) { + // Destroy the data the last transformer made. We skip this if the previous state was the + // initial one since we don't know here which jvmtiEnv allocated it. + // NB Currently this doesn't matter since all allocations just go to malloc but in the + // future we might have jvmtiEnv's keep track of their allocations for leak-checking. + if (last_env != nullptr) { + last_env->Deallocate(current_class_data); + } + last_env = env; + current_class_data = new_data; + current_len = new_len; + } + } + } + if (last_env != nullptr) { + *new_class_data_len = current_len; + *new_class_data = current_class_data; + } +} + +template <typename ...Args> inline void EventHandler::DispatchEvent(art::Thread* thread, ArtJvmtiEvent event, Args... args) const { + switch (event) { + case ArtJvmtiEvent::kClassFileLoadHookRetransformable: + case ArtJvmtiEvent::kClassFileLoadHookNonRetransformable: + return DispatchClassFileLoadHookEvent(thread, event, args...); + default: + return GenericDispatchEvent(thread, event, args...); + } +} + +// TODO Locking of some type! +template <typename ...Args> +inline void EventHandler::GenericDispatchEvent(art::Thread* thread, + ArtJvmtiEvent event, + Args... args) const { using FnType = void(jvmtiEnv*, Args...); for (ArtJvmTiEnv* env : envs) { if (ShouldDispatch(event, env, thread)) { diff --git a/runtime/openjdkjvmti/events.h b/runtime/openjdkjvmti/events.h index 7990141562..08a87659c7 100644 --- a/runtime/openjdkjvmti/events.h +++ b/runtime/openjdkjvmti/events.h @@ -178,6 +178,15 @@ class EventHandler { ALWAYS_INLINE inline void RecalculateGlobalEventMask(ArtJvmtiEvent event); + template <typename ...Args> + ALWAYS_INLINE inline void GenericDispatchEvent(art::Thread* thread, + ArtJvmtiEvent event, + Args... args) const; + template <typename ...Args> + ALWAYS_INLINE inline void DispatchClassFileLoadHookEvent(art::Thread* thread, + ArtJvmtiEvent event, + Args... args) const; + void HandleEventType(ArtJvmtiEvent event, bool enable); // List of all JvmTiEnv objects that have been created, in their creation order. diff --git a/runtime/openjdkjvmti/ti_redefine.cc b/runtime/openjdkjvmti/ti_redefine.cc index 6af51c4c6c..2db8a40ad4 100644 --- a/runtime/openjdkjvmti/ti_redefine.cc +++ b/runtime/openjdkjvmti/ti_redefine.cc @@ -242,14 +242,12 @@ Redefiner::ClassRedefinition::~ClassRedefinition() { } } -// TODO This should handle doing multiple classes at once so we need to do less cleanup when things -// go wrong. jvmtiError Redefiner::RedefineClasses(ArtJvmTiEnv* env, art::Runtime* runtime, art::Thread* self, jint class_count, const jvmtiClassDefinition* definitions, - std::string* error_msg) { + /*out*/std::string* error_msg) { if (env == nullptr) { *error_msg = "env was null!"; return ERR(INVALID_ENVIRONMENT); @@ -263,46 +261,95 @@ jvmtiError Redefiner::RedefineClasses(ArtJvmTiEnv* env, *error_msg = "null definitions!"; return ERR(NULL_POINTER); } + std::vector<ArtClassDefinition> def_vector; + def_vector.reserve(class_count); + for (jint i = 0; i < class_count; i++) { + // We make a copy of the class_bytes to pass into the retransformation. + // This makes cleanup easier (since we unambiguously own the bytes) and also is useful since we + // will need to keep the original bytes around unaltered for subsequent RetransformClasses calls + // to get the passed in bytes. + // TODO Implement saving the original bytes. + unsigned char* class_bytes_copy = nullptr; + jvmtiError res = env->Allocate(definitions[i].class_byte_count, &class_bytes_copy); + if (res != OK) { + return res; + } + memcpy(class_bytes_copy, definitions[i].class_bytes, definitions[i].class_byte_count); + + ArtClassDefinition def; + def.dex_len = definitions[i].class_byte_count; + def.dex_data = MakeJvmtiUniquePtr(env, class_bytes_copy); + // We are definitely modified. + def.modified = true; + res = Transformer::FillInTransformationData(env, definitions[i].klass, &def); + if (res != OK) { + return res; + } + def_vector.push_back(std::move(def)); + } + // Call all the transformation events. + jvmtiError res = Transformer::RetransformClassesDirect(env, + self, + &def_vector); + if (res != OK) { + // Something went wrong with transformation! + return res; + } + return RedefineClassesDirect(env, runtime, self, def_vector, error_msg); +} + +jvmtiError Redefiner::RedefineClassesDirect(ArtJvmTiEnv* env, + art::Runtime* runtime, + art::Thread* self, + const std::vector<ArtClassDefinition>& definitions, + std::string* error_msg) { + DCHECK(env != nullptr); + if (definitions.size() == 0) { + // We don't actually need to do anything. Just return OK. + return OK; + } // Stop JIT for the duration of this redefine since the JIT might concurrently compile a method we // are going to redefine. art::jit::ScopedJitSuspend suspend_jit; // Get shared mutator lock so we can lock all the classes. art::ScopedObjectAccess soa(self); std::vector<Redefiner::ClassRedefinition> redefinitions; - redefinitions.reserve(class_count); + redefinitions.reserve(definitions.size()); Redefiner r(runtime, self, error_msg); - for (jint i = 0; i < class_count; i++) { - jvmtiError res = r.AddRedefinition(env, definitions[i]); - if (res != OK) { - return res; + for (const ArtClassDefinition& def : definitions) { + // Only try to transform classes that have been modified. + if (def.modified) { + jvmtiError res = r.AddRedefinition(env, def); + if (res != OK) { + return res; + } } } return r.Run(); } -jvmtiError Redefiner::AddRedefinition(ArtJvmTiEnv* env, const jvmtiClassDefinition& def) { +jvmtiError Redefiner::AddRedefinition(ArtJvmTiEnv* env, const ArtClassDefinition& def) { std::string original_dex_location; jvmtiError ret = OK; if ((ret = GetClassLocation(env, def.klass, &original_dex_location))) { *error_msg_ = "Unable to get original dex file location!"; return ret; } - std::unique_ptr<art::MemMap> map(MoveDataToMemMap(original_dex_location, - def.class_byte_count, - def.class_bytes, - error_msg_)); - std::ostringstream os; char* generic_ptr_unused = nullptr; char* signature_ptr = nullptr; - if (env->GetClassSignature(def.klass, &signature_ptr, &generic_ptr_unused) != OK) { - *error_msg_ = "A jclass passed in does not seem to be valid"; - return ERR(INVALID_CLASS); + if ((ret = env->GetClassSignature(def.klass, &signature_ptr, &generic_ptr_unused)) != OK) { + *error_msg_ = "Unable to get class signature!"; + return ret; } - // These will make sure we deallocate the signature. - JvmtiUniquePtr sig_unique_ptr(MakeJvmtiUniquePtr(env, signature_ptr)); JvmtiUniquePtr generic_unique_ptr(MakeJvmtiUniquePtr(env, generic_ptr_unused)); + JvmtiUniquePtr signature_unique_ptr(MakeJvmtiUniquePtr(env, signature_ptr)); + std::unique_ptr<art::MemMap> map(MoveDataToMemMap(original_dex_location, + def.dex_len, + def.dex_data.get(), + error_msg_)); + std::ostringstream os; if (map.get() == nullptr) { - os << "Failed to create anonymous mmap for modified dex file of class " << signature_ptr + os << "Failed to create anonymous mmap for modified dex file of class " << def.name << "in dex file " << original_dex_location << " because: " << *error_msg_; *error_msg_ = os.str(); return ERR(OUT_OF_MEMORY); @@ -319,7 +366,7 @@ jvmtiError Redefiner::AddRedefinition(ArtJvmTiEnv* env, const jvmtiClassDefiniti /*verify_checksum*/true, error_msg_)); if (dex_file.get() == nullptr) { - os << "Unable to load modified dex file for " << signature_ptr << ": " << *error_msg_; + os << "Unable to load modified dex file for " << def.name << ": " << *error_msg_; *error_msg_ = os.str(); return ERR(INVALID_CLASS_FORMAT); } @@ -989,17 +1036,16 @@ void Redefiner::ClassRedefinition::UpdateFields(art::ObjPtr<art::mirror::Class> // Performs updates to class that will allow us to verify it. void Redefiner::ClassRedefinition::UpdateClass(art::ObjPtr<art::mirror::Class> mclass, art::ObjPtr<art::mirror::DexCache> new_dex_cache) { - const art::DexFile::ClassDef* class_def = art::OatFile::OatDexFile::FindClassDef( - *dex_file_, class_sig_.c_str(), art::ComputeModifiedUtf8Hash(class_sig_.c_str())); - DCHECK(class_def != nullptr); - UpdateMethods(mclass, new_dex_cache, *class_def); + DCHECK_EQ(dex_file_->NumClassDefs(), 1u); + const art::DexFile::ClassDef& class_def = dex_file_->GetClassDef(0); + UpdateMethods(mclass, new_dex_cache, class_def); UpdateFields(mclass); // Update the class fields. // Need to update class last since the ArtMethod gets its DexFile from the class (which is needed // to call GetReturnTypeDescriptor and GetParameterTypeList above). mclass->SetDexCache(new_dex_cache.Ptr()); - mclass->SetDexClassDefIndex(dex_file_->GetIndexForClassDef(*class_def)); + mclass->SetDexClassDefIndex(dex_file_->GetIndexForClassDef(class_def)); mclass->SetDexTypeIndex(dex_file_->GetIndexForTypeId(*dex_file_->FindTypeId(class_sig_.c_str()))); } diff --git a/runtime/openjdkjvmti/ti_redefine.h b/runtime/openjdkjvmti/ti_redefine.h index 8626bc54d5..f8d51ad124 100644 --- a/runtime/openjdkjvmti/ti_redefine.h +++ b/runtime/openjdkjvmti/ti_redefine.h @@ -72,13 +72,25 @@ class Redefiner { public: // Redefine the given classes with the given dex data. Note this function does not take ownership // of the dex_data pointers. It is not used after this call however and may be freed if desired. + // The caller is responsible for freeing it. The runtime makes its own copy of the data. This + // function does not call the transformation events. + // TODO Check modified flag of the definitions. + static jvmtiError RedefineClassesDirect(ArtJvmTiEnv* env, + art::Runtime* runtime, + art::Thread* self, + const std::vector<ArtClassDefinition>& definitions, + /*out*/std::string* error_msg); + + // Redefine the given classes with the given dex data. Note this function does not take ownership + // of the dex_data pointers. It is not used after this call however and may be freed if desired. // The caller is responsible for freeing it. The runtime makes its own copy of the data. + // TODO This function should call the transformation events. static jvmtiError RedefineClasses(ArtJvmTiEnv* env, art::Runtime* runtime, art::Thread* self, jint class_count, const jvmtiClassDefinition* definitions, - std::string* error_msg); + /*out*/std::string* error_msg); static jvmtiError IsModifiableClass(jvmtiEnv* env, jclass klass, jboolean* is_redefinable); @@ -209,7 +221,7 @@ class Redefiner { redefinitions_(), error_msg_(error_msg) { } - jvmtiError AddRedefinition(ArtJvmTiEnv* env, const jvmtiClassDefinition& def) + jvmtiError AddRedefinition(ArtJvmTiEnv* env, const ArtClassDefinition& def) REQUIRES_SHARED(art::Locks::mutator_lock_); static jvmtiError GetClassRedefinitionError(art::Handle<art::mirror::Class> klass, diff --git a/runtime/openjdkjvmti/transform.cc b/runtime/openjdkjvmti/transform.cc index f5451254c0..2809cb6926 100644 --- a/runtime/openjdkjvmti/transform.cc +++ b/runtime/openjdkjvmti/transform.cc @@ -38,6 +38,7 @@ #include "class_linker.h" #include "dex_file.h" #include "dex_file_types.h" +#include "events-inl.h" #include "gc_root-inl.h" #include "globals.h" #include "jni_env_ext-inl.h" @@ -52,12 +53,76 @@ #include "scoped_thread_state_change-inl.h" #include "stack.h" #include "thread_list.h" +#include "ti_redefine.h" #include "transform.h" #include "utf.h" #include "utils/dex_cache_arrays_layout-inl.h" namespace openjdkjvmti { +jvmtiError Transformer::RetransformClassesDirect( + ArtJvmTiEnv* env, + art::Thread* self, + /*in-out*/std::vector<ArtClassDefinition>* definitions) { + for (ArtClassDefinition& def : *definitions) { + jint new_len = -1; + unsigned char* new_data = nullptr; + // Static casts are so that we get the right template initialization for the special event + // handling code required by the ClassFileLoadHooks. + gEventHandler.DispatchEvent(self, + ArtJvmtiEvent::kClassFileLoadHookRetransformable, + GetJniEnv(env), + static_cast<jclass>(def.klass), + static_cast<jobject>(def.loader), + static_cast<const char*>(def.name.c_str()), + static_cast<jobject>(def.protection_domain), + static_cast<jint>(def.dex_len), + static_cast<const unsigned char*>(def.dex_data.get()), + static_cast<jint*>(&new_len), + static_cast<unsigned char**>(&new_data)); + def.SetNewDexData(env, new_len, new_data); + } + return OK; +} + +jvmtiError Transformer::RetransformClasses(ArtJvmTiEnv* env, + art::Runtime* runtime, + art::Thread* self, + jint class_count, + const jclass* classes, + /*out*/std::string* error_msg) { + if (env == nullptr) { + *error_msg = "env was null!"; + return ERR(INVALID_ENVIRONMENT); + } else if (class_count < 0) { + *error_msg = "class_count was less then 0"; + return ERR(ILLEGAL_ARGUMENT); + } else if (class_count == 0) { + // We don't actually need to do anything. Just return OK. + return OK; + } else if (classes == nullptr) { + *error_msg = "null classes!"; + return ERR(NULL_POINTER); + } + // A holder that will Deallocate all the class bytes buffers on destruction. + std::vector<ArtClassDefinition> definitions; + jvmtiError res = OK; + for (jint i = 0; i < class_count; i++) { + ArtClassDefinition def; + res = FillInTransformationData(env, classes[i], &def); + if (res != OK) { + return res; + } + definitions.push_back(std::move(def)); + } + res = RetransformClassesDirect(env, self, &definitions); + if (res != OK) { + return res; + } + return Redefiner::RedefineClassesDirect(env, runtime, self, definitions, error_msg); +} + +// TODO Move this somewhere else, ti_class? jvmtiError GetClassLocation(ArtJvmTiEnv* env, jclass klass, /*out*/std::string* location) { JNIEnv* jni_env = nullptr; jint ret = env->art_vm->GetEnv(reinterpret_cast<void**>(&jni_env), JNI_VERSION_1_1); @@ -73,42 +138,61 @@ jvmtiError GetClassLocation(ArtJvmTiEnv* env, jclass klass, /*out*/std::string* return OK; } +// TODO Implement this for real once transformed dex data is actually saved. +jvmtiError Transformer::GetDexDataForRetransformation(ArtJvmTiEnv* env, + art::Handle<art::mirror::Class> klass, + /*out*/jint* dex_data_len, + /*out*/unsigned char** dex_data) { + // TODO De-quicken the dex file before passing it to the agents. + LOG(WARNING) << "Dex file is not de-quickened yet! Quickened dex instructions might be present"; + LOG(WARNING) << "Caching of initial dex data is not yet performed! Dex data might have been " + << "transformed by agent already"; + const art::DexFile& dex = klass->GetDexFile(); + *dex_data_len = static_cast<jint>(dex.Size()); + unsigned char* new_dex_data = nullptr; + jvmtiError alloc_error = env->Allocate(*dex_data_len, &new_dex_data); + if (alloc_error != OK) { + return alloc_error; + } + // Copy the data into a temporary buffer. + memcpy(reinterpret_cast<void*>(new_dex_data), + reinterpret_cast<const void*>(dex.Begin()), + *dex_data_len); + *dex_data = new_dex_data; + return OK; +} + // TODO Move this function somewhere more appropriate. // Gets the data surrounding the given class. -jvmtiError GetTransformationData(ArtJvmTiEnv* env, - jclass klass, - /*out*/std::string* location, - /*out*/JNIEnv** jni_env_ptr, - /*out*/jobject* loader, - /*out*/std::string* name, - /*out*/jobject* protection_domain, - /*out*/jint* data_len, - /*out*/unsigned char** dex_data) { - jint ret = env->art_vm->GetEnv(reinterpret_cast<void**>(jni_env_ptr), JNI_VERSION_1_1); - if (ret != JNI_OK) { +// TODO Make this less magical. +jvmtiError Transformer::FillInTransformationData(ArtJvmTiEnv* env, + jclass klass, + ArtClassDefinition* def) { + JNIEnv* jni_env = GetJniEnv(env); + if (jni_env == nullptr) { // TODO Different error might be better? return ERR(INTERNAL); } - JNIEnv* jni_env = *jni_env_ptr; art::ScopedObjectAccess soa(jni_env); art::StackHandleScope<3> hs(art::Thread::Current()); art::Handle<art::mirror::Class> hs_klass(hs.NewHandle(soa.Decode<art::mirror::Class>(klass))); - *loader = soa.AddLocalReference<jobject>(hs_klass->GetClassLoader()); - *name = art::mirror::Class::ComputeName(hs_klass)->ToModifiedUtf8(); + if (hs_klass.IsNull()) { + return ERR(INVALID_CLASS); + } + def->klass = klass; + def->loader = soa.AddLocalReference<jobject>(hs_klass->GetClassLoader()); + def->name = art::mirror::Class::ComputeName(hs_klass)->ToModifiedUtf8(); // TODO is this always null? - *protection_domain = nullptr; - const art::DexFile& dex = hs_klass->GetDexFile(); - *location = dex.GetLocation(); - *data_len = static_cast<jint>(dex.Size()); - // TODO We should maybe change env->Allocate to allow us to mprotect this memory and stop writes. - jvmtiError alloc_error = env->Allocate(*data_len, dex_data); - if (alloc_error != OK) { - return alloc_error; + def->protection_domain = nullptr; + if (def->dex_data.get() == nullptr) { + unsigned char* new_data; + jvmtiError res = GetDexDataForRetransformation(env, hs_klass, &def->dex_len, &new_data); + if (res == OK) { + def->dex_data = MakeJvmtiUniquePtr(env, new_data); + } else { + return res; + } } - // Copy the data into a temporary buffer. - memcpy(reinterpret_cast<void*>(*dex_data), - reinterpret_cast<const void*>(dex.Begin()), - *data_len); return OK; } diff --git a/runtime/openjdkjvmti/transform.h b/runtime/openjdkjvmti/transform.h index 0ad5099daf..0ff2bd1d40 100644 --- a/runtime/openjdkjvmti/transform.h +++ b/runtime/openjdkjvmti/transform.h @@ -43,16 +43,30 @@ namespace openjdkjvmti { jvmtiError GetClassLocation(ArtJvmTiEnv* env, jclass klass, /*out*/std::string* location); -// Gets the data surrounding the given class. -jvmtiError GetTransformationData(ArtJvmTiEnv* env, - jclass klass, - /*out*/std::string* location, - /*out*/JNIEnv** jni_env_ptr, - /*out*/jobject* loader, - /*out*/std::string* name, - /*out*/jobject* protection_domain, - /*out*/jint* data_len, - /*out*/unsigned char** dex_data); +class Transformer { + public: + static jvmtiError RetransformClassesDirect( + ArtJvmTiEnv* env, art::Thread* self, /*in-out*/std::vector<ArtClassDefinition>* definitions); + + static jvmtiError RetransformClasses(ArtJvmTiEnv* env, + art::Runtime* runtime, + art::Thread* self, + jint class_count, + const jclass* classes, + /*out*/std::string* error_msg); + + // Gets the data surrounding the given class. + static jvmtiError FillInTransformationData(ArtJvmTiEnv* env, + jclass klass, + ArtClassDefinition* def); + + private: + static jvmtiError GetDexDataForRetransformation(ArtJvmTiEnv* env, + art::Handle<art::mirror::Class> klass, + /*out*/jint* dex_data_length, + /*out*/unsigned char** dex_data) + REQUIRES_SHARED(art::Locks::mutator_lock_); +}; } // namespace openjdkjvmti diff --git a/test/921-hello-failure/expected.txt b/test/921-hello-failure/expected.txt index 1c1d4d9b80..9615e6b33d 100644 --- a/test/921-hello-failure/expected.txt +++ b/test/921-hello-failure/expected.txt @@ -21,3 +21,11 @@ hello2 - MultiRedef Transformation error : java.lang.Exception(Failed to redefine classes <LTransform;, LTransform2;> due to JVMTI_ERROR_NAMES_DONT_MATCH) hello - MultiRedef hello2 - MultiRedef +hello - MultiRetrans +hello2 - MultiRetrans +Transformation error : java.lang.Exception(Failed to retransform classes <LTransform2;, LTransform;> due to JVMTI_ERROR_NAMES_DONT_MATCH) +hello - MultiRetrans +hello2 - MultiRetrans +Transformation error : java.lang.Exception(Failed to retransform classes <LTransform;, LTransform2;> due to JVMTI_ERROR_NAMES_DONT_MATCH) +hello - MultiRetrans +hello2 - MultiRetrans diff --git a/test/921-hello-failure/src/Main.java b/test/921-hello-failure/src/Main.java index 1fe259961d..43d6e9ed07 100644 --- a/test/921-hello-failure/src/Main.java +++ b/test/921-hello-failure/src/Main.java @@ -25,6 +25,7 @@ public class Main { MissingInterface.doTest(new Transform2()); ReorderInterface.doTest(new Transform2()); MultiRedef.doTest(new Transform(), new Transform2()); + MultiRetrans.doTest(new Transform(), new Transform2()); } // Transforms the class. This throws an exception if something goes wrong. @@ -47,7 +48,20 @@ public class Main { dex_files.toArray(new byte[0][])); } + public static void addMultiTransformationResults(CommonClassDefinition... defs) throws Exception { + for (CommonClassDefinition d : defs) { + addCommonTransformationResult(d.target.getCanonicalName(), + d.class_file_bytes, + d.dex_file_bytes); + } + } + public static native void doCommonMultiClassRedefinition(Class<?>[] targets, byte[][] classfiles, byte[][] dexfiles) throws Exception; + public static native void doCommonClassRetransformation(Class<?>... target) throws Exception; + public static native void enableCommonRetransformation(boolean enable); + public static native void addCommonTransformationResult(String target_name, + byte[] class_bytes, + byte[] dex_bytes); } diff --git a/test/921-hello-failure/src/MultiRetrans.java b/test/921-hello-failure/src/MultiRetrans.java new file mode 100644 index 0000000000..95aaf074e9 --- /dev/null +++ b/test/921-hello-failure/src/MultiRetrans.java @@ -0,0 +1,108 @@ +/* + * Copyright (C) 2017 The Android Open Source Project + * + * Licensed under the Apache License, Version 2.0 (the "License"); + * you may not use this file except in compliance with the License. + * You may obtain a copy of the License at + * + * http://www.apache.org/licenses/LICENSE-2.0 + * + * Unless required by applicable law or agreed to in writing, software + * distributed under the License is distributed on an "AS IS" BASIS, + * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. + * See the License for the specific language governing permissions and + * limitations under the License. + */ + +import java.util.Base64; + +class MultiRetrans { + + // class NotTransform { + // public void sayHi(String name) { + // throw new Error("Should not be called!"); + // } + // } + private static CommonClassDefinition INVALID_DEFINITION_T1 = new CommonClassDefinition( + Transform.class, + Base64.getDecoder().decode( + "yv66vgAAADQAFQoABgAPBwAQCAARCgACABIHABMHABQBAAY8aW5pdD4BAAMoKVYBAARDb2RlAQAP" + + "TGluZU51bWJlclRhYmxlAQAFc2F5SGkBABUoTGphdmEvbGFuZy9TdHJpbmc7KVYBAApTb3VyY2VG" + + "aWxlAQARTm90VHJhbnNmb3JtLmphdmEMAAcACAEAD2phdmEvbGFuZy9FcnJvcgEAFVNob3VsZCBu" + + "b3QgYmUgY2FsbGVkIQwABwAMAQAMTm90VHJhbnNmb3JtAQAQamF2YS9sYW5nL09iamVjdAAgAAUA" + + "BgAAAAAAAgAAAAcACAABAAkAAAAdAAEAAQAAAAUqtwABsQAAAAEACgAAAAYAAQAAAAEAAQALAAwA" + + "AQAJAAAAIgADAAIAAAAKuwACWRIDtwAEvwAAAAEACgAAAAYAAQAAAAMAAQANAAAAAgAO"), + Base64.getDecoder().decode( + "ZGV4CjAzNQDLV95i5xnv6iUi6uIeDoY5jP5Xe9NP1AiYAgAAcAAAAHhWNBIAAAAAAAAAAAQCAAAL" + + "AAAAcAAAAAUAAACcAAAAAgAAALAAAAAAAAAAAAAAAAQAAADIAAAAAQAAAOgAAACQAQAACAEAAEoB" + + "AABSAQAAYgEAAHUBAACJAQAAnQEAALABAADHAQAAygEAAM4BAADiAQAAAQAAAAIAAAADAAAABAAA" + + "AAcAAAAHAAAABAAAAAAAAAAIAAAABAAAAEQBAAAAAAAAAAAAAAAAAQAKAAAAAQABAAAAAAACAAAA" + + "AAAAAAAAAAAAAAAAAgAAAAAAAAAFAAAAAAAAAPQBAAAAAAAAAQABAAEAAADpAQAABAAAAHAQAwAA" + + "AA4ABAACAAIAAADuAQAACQAAACIAAQAbAQYAAABwIAIAEAAnAAAAAQAAAAMABjxpbml0PgAOTE5v" + + "dFRyYW5zZm9ybTsAEUxqYXZhL2xhbmcvRXJyb3I7ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZh" + + "L2xhbmcvU3RyaW5nOwARTm90VHJhbnNmb3JtLmphdmEAFVNob3VsZCBub3QgYmUgY2FsbGVkIQAB" + + "VgACVkwAEmVtaXR0ZXI6IGphY2stNC4yMAAFc2F5SGkAAQAHDgADAQAHDgAAAAEBAICABIgCAQGg" + + "AgAADAAAAAAAAAABAAAAAAAAAAEAAAALAAAAcAAAAAIAAAAFAAAAnAAAAAMAAAACAAAAsAAAAAUA" + + "AAAEAAAAyAAAAAYAAAABAAAA6AAAAAEgAAACAAAACAEAAAEQAAABAAAARAEAAAIgAAALAAAASgEA" + + "AAMgAAACAAAA6QEAAAAgAAABAAAA9AEAAAAQAAABAAAABAIAAA==")); + + // Valid redefinition of Transform2 + // class Transform2 implements Iface1, Iface2 { + // public void sayHi(String name) { + // throw new Error("Should not be called!"); + // } + // } + private static CommonClassDefinition VALID_DEFINITION_T2 = new CommonClassDefinition( + Transform2.class, + Base64.getDecoder().decode( + "yv66vgAAADQAGQoABgARBwASCAATCgACABQHABUHABYHABcHABgBAAY8aW5pdD4BAAMoKVYBAARD" + + "b2RlAQAPTGluZU51bWJlclRhYmxlAQAFc2F5SGkBABUoTGphdmEvbGFuZy9TdHJpbmc7KVYBAApT" + + "b3VyY2VGaWxlAQAPVHJhbnNmb3JtMi5qYXZhDAAJAAoBAA9qYXZhL2xhbmcvRXJyb3IBABVTaG91" + + "bGQgbm90IGJlIGNhbGxlZCEMAAkADgEAClRyYW5zZm9ybTIBABBqYXZhL2xhbmcvT2JqZWN0AQAG" + + "SWZhY2UxAQAGSWZhY2UyACAABQAGAAIABwAIAAAAAgAAAAkACgABAAsAAAAdAAEAAQAAAAUqtwAB" + + "sQAAAAEADAAAAAYAAQAAAAEAAQANAA4AAQALAAAAIgADAAIAAAAKuwACWRIDtwAEvwAAAAEADAAA" + + "AAYAAQAAAAMAAQAPAAAAAgAQ"), + Base64.getDecoder().decode( + "ZGV4CjAzNQDSWls05CPkX+gbTGMVRvx9dc9vozzVbu7AAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAN" + + "AAAAcAAAAAcAAACkAAAAAgAAAMAAAAAAAAAAAAAAAAQAAADYAAAAAQAAAPgAAACoAQAAGAEAAGIB" + + "AABqAQAAdAEAAH4BAACMAQAAnwEAALMBAADHAQAA3gEAAO8BAADyAQAA9gEAAAoCAAABAAAAAgAA" + + "AAMAAAAEAAAABQAAAAYAAAAJAAAACQAAAAYAAAAAAAAACgAAAAYAAABcAQAAAgAAAAAAAAACAAEA" + + "DAAAAAMAAQAAAAAABAAAAAAAAAACAAAAAAAAAAQAAABUAQAACAAAAAAAAAAcAgAAAAAAAAEAAQAB" + + "AAAAEQIAAAQAAABwEAMAAAAOAAQAAgACAAAAFgIAAAkAAAAiAAMAGwEHAAAAcCACABAAJwAAAAIA" + + "AAAAAAEAAQAAAAUABjxpbml0PgAITElmYWNlMTsACExJZmFjZTI7AAxMVHJhbnNmb3JtMjsAEUxq" + + "YXZhL2xhbmcvRXJyb3I7ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwAV" + + "U2hvdWxkIG5vdCBiZSBjYWxsZWQhAA9UcmFuc2Zvcm0yLmphdmEAAVYAAlZMABJlbWl0dGVyOiBq" + + "YWNrLTQuMjAABXNheUhpAAEABw4AAwEABw4AAAABAQCAgASYAgEBsAIAAAwAAAAAAAAAAQAAAAAA" + + "AAABAAAADQAAAHAAAAACAAAABwAAAKQAAAADAAAAAgAAAMAAAAAFAAAABAAAANgAAAAGAAAAAQAA" + + "APgAAAABIAAAAgAAABgBAAABEAAAAgAAAFQBAAACIAAADQAAAGIBAAADIAAAAgAAABECAAAAIAAA" + + "AQAAABwCAAAAEAAAAQAAACwCAAA=")); + + public static void doTest(Transform t1, Transform2 t2) { + t1.sayHi("MultiRetrans"); + t2.sayHi("MultiRetrans"); + try { + Main.addMultiTransformationResults(VALID_DEFINITION_T2, INVALID_DEFINITION_T1); + Main.enableCommonRetransformation(true); + Main.doCommonClassRetransformation(Transform2.class, Transform.class); + } catch (Exception e) { + System.out.println( + "Transformation error : " + e.getClass().getName() + "(" + e.getMessage() + ")"); + } finally { + Main.enableCommonRetransformation(false); + } + t1.sayHi("MultiRetrans"); + t2.sayHi("MultiRetrans"); + try { + Main.addMultiTransformationResults(VALID_DEFINITION_T2, INVALID_DEFINITION_T1); + Main.enableCommonRetransformation(true); + Main.doCommonClassRetransformation(Transform.class, Transform2.class); + } catch (Exception e) { + System.out.println( + "Transformation error : " + e.getClass().getName() + "(" + e.getMessage() + ")"); + } finally { + Main.enableCommonRetransformation(false); + } + t1.sayHi("MultiRetrans"); + t2.sayHi("MultiRetrans"); + } +} diff --git a/test/930-hello-retransform/build b/test/930-hello-retransform/build new file mode 100755 index 0000000000..898e2e54a2 --- /dev/null +++ b/test/930-hello-retransform/build @@ -0,0 +1,17 @@ +#!/bin/bash +# +# Copyright 2016 The Android Open Source Project +# +# Licensed under the Apache License, Version 2.0 (the "License"); +# you may not use this file except in compliance with the License. +# You may obtain a copy of the License at +# +# http://www.apache.org/licenses/LICENSE-2.0 +# +# Unless required by applicable law or agreed to in writing, software +# distributed under the License is distributed on an "AS IS" BASIS, +# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. +# See the License for the specific language governing permissions and +# limitations under the License. + +./default-build "$@" --experimental agents diff --git a/test/930-hello-retransform/expected.txt b/test/930-hello-retransform/expected.txt new file mode 100644 index 0000000000..4774b81b49 --- /dev/null +++ b/test/930-hello-retransform/expected.txt @@ -0,0 +1,2 @@ +hello +Goodbye diff --git a/test/930-hello-retransform/info.txt b/test/930-hello-retransform/info.txt new file mode 100644 index 0000000000..875a5f6ec1 --- /dev/null +++ b/test/930-hello-retransform/info.txt @@ -0,0 +1 @@ +Tests basic functions in the jvmti plugin. diff --git a/test/930-hello-retransform/run b/test/930-hello-retransform/run new file mode 100755 index 0000000000..4379349cb2 --- /dev/null +++ b/test/930-hello-retransform/run @@ -0,0 +1,19 @@ +#!/bin/bash +# +# Copyright 2016 The Android Open Source Project +# +# Licensed under the Apache License, Version 2.0 (the "License"); +# you may not use this file except in compliance with the License. +# You may obtain a copy of the License at +# +# http://www.apache.org/licenses/LICENSE-2.0 +# +# Unless required by applicable law or agreed to in writing, software +# distributed under the License is distributed on an "AS IS" BASIS, +# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. +# See the License for the specific language governing permissions and +# limitations under the License. + +./default-run "$@" --experimental agents \ + --experimental runtime-plugins \ + --jvmti diff --git a/test/930-hello-retransform/src/Main.java b/test/930-hello-retransform/src/Main.java new file mode 100644 index 0000000000..12194c3235 --- /dev/null +++ b/test/930-hello-retransform/src/Main.java @@ -0,0 +1,70 @@ +/* + * Copyright (C) 2016 The Android Open Source Project + * + * Licensed under the Apache License, Version 2.0 (the "License"); + * you may not use this file except in compliance with the License. + * You may obtain a copy of the License at + * + * http://www.apache.org/licenses/LICENSE-2.0 + * + * Unless required by applicable law or agreed to in writing, software + * distributed under the License is distributed on an "AS IS" BASIS, + * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. + * See the License for the specific language governing permissions and + * limitations under the License. + */ + +import java.util.Base64; +public class Main { + + /** + * base64 encoded class/dex file for + * class Transform { + * public void sayHi() { + * System.out.println("Goodbye"); + * } + * } + */ + private static final byte[] CLASS_BYTES = Base64.getDecoder().decode( + "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" + + "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" + + "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" + + "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" + + "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" + + "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" + + "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0="); + private static final byte[] DEX_BYTES = Base64.getDecoder().decode( + "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" + + "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" + + "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" + + "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" + + "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" + + "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" + + "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" + + "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" + + "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" + + "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" + + "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" + + "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" + + "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA="); + + public static void main(String[] args) { + System.loadLibrary(args[1]); + doTest(new Transform()); + } + + public static void doTest(Transform t) { + t.sayHi(); + addCommonTransformationResult("Transform", CLASS_BYTES, DEX_BYTES); + enableCommonRetransformation(true); + doCommonClassRetransformation(Transform.class); + t.sayHi(); + } + + // Transforms the class + private static native void doCommonClassRetransformation(Class<?>... target); + private static native void enableCommonRetransformation(boolean enable); + private static native void addCommonTransformationResult(String target_name, + byte[] class_bytes, + byte[] dex_bytes); +} diff --git a/test/930-hello-retransform/src/Transform.java b/test/930-hello-retransform/src/Transform.java new file mode 100644 index 0000000000..8e8af355da --- /dev/null +++ b/test/930-hello-retransform/src/Transform.java @@ -0,0 +1,28 @@ +/* + * Copyright (C) 2016 The Android Open Source Project + * + * Licensed under the Apache License, Version 2.0 (the "License"); + * you may not use this file except in compliance with the License. + * You may obtain a copy of the License at + * + * http://www.apache.org/licenses/LICENSE-2.0 + * + * Unless required by applicable law or agreed to in writing, software + * distributed under the License is distributed on an "AS IS" BASIS, + * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. + * See the License for the specific language governing permissions and + * limitations under the License. + */ + +class Transform { + public void sayHi() { + // Use lower 'h' to make sure the string will have a different string id + // than the transformation (the transformation code is the same except + // the actual printed String, which was making the test inacurately passing + // in JIT mode when loading the string from the dex cache, as the string ids + // of the two different strings were the same). + // We know the string ids will be different because lexicographically: + // "Goodbye" < "LTransform;" < "hello". + System.out.println("hello"); + } +} diff --git a/test/Android.run-test.mk b/test/Android.run-test.mk index e604c93c72..38b88e44a6 100644 --- a/test/Android.run-test.mk +++ b/test/Android.run-test.mk @@ -309,6 +309,7 @@ TEST_ART_BROKEN_TARGET_TESTS += \ 927-timers \ 928-jni-table \ 929-search \ + 930-hello-retransform \ ifneq (,$(filter target,$(TARGET_TYPES))) ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,target,$(RUN_TYPES),$(PREBUILD_TYPES), \ diff --git a/test/ti-agent/common_helper.cc b/test/ti-agent/common_helper.cc index 2c6d3eda00..8799c9188b 100644 --- a/test/ti-agent/common_helper.cc +++ b/test/ti-agent/common_helper.cc @@ -18,6 +18,7 @@ #include <stdio.h> #include <sstream> +#include <deque> #include "art_method.h" #include "jni.h" @@ -60,17 +61,17 @@ bool JvmtiErrorToException(JNIEnv* env, jvmtiError error) { return true; } -namespace common_redefine { -static void throwRedefinitionError(jvmtiEnv* jvmti, - JNIEnv* env, - jint num_targets, - jclass* target, - jvmtiError res) { +template <bool is_redefine> +static void throwCommonRedefinitionError(jvmtiEnv* jvmti, + JNIEnv* env, + jint num_targets, + jclass* target, + jvmtiError res) { std::stringstream err; char* error = nullptr; jvmti->GetErrorName(res, &error); - err << "Failed to redefine class"; + err << "Failed to " << (is_redefine ? "redefine" : "retransform") << " class"; if (num_targets > 1) { err << "es"; } @@ -92,6 +93,16 @@ static void throwRedefinitionError(jvmtiEnv* jvmti, env->ThrowNew(env->FindClass("java/lang/Exception"), message.c_str()); } +namespace common_redefine { + +static void throwRedefinitionError(jvmtiEnv* jvmti, + JNIEnv* env, + jint num_targets, + jclass* target, + jvmtiError res) { + return throwCommonRedefinitionError<true>(jvmti, env, num_targets, target, res); +} + static void DoMultiClassRedefine(jvmtiEnv* jvmti_env, JNIEnv* env, jint num_redefines, @@ -161,7 +172,7 @@ extern "C" JNIEXPORT void JNICALL Java_Main_doCommonMultiClassRedefinition( dex_files.data()); } -// Don't do anything +// Get all capabilities except those related to retransformation. jint OnLoad(JavaVM* vm, char* options ATTRIBUTE_UNUSED, void* reserved ATTRIBUTE_UNUSED) { @@ -169,10 +180,148 @@ jint OnLoad(JavaVM* vm, printf("Unable to get jvmti env!\n"); return 1; } - SetAllCapabilities(jvmti_env); + jvmtiCapabilities caps; + jvmti_env->GetPotentialCapabilities(&caps); + caps.can_retransform_classes = 0; + caps.can_retransform_any_class = 0; + jvmti_env->AddCapabilities(&caps); return 0; } } // namespace common_redefine +namespace common_retransform { + +struct CommonTransformationResult { + std::vector<unsigned char> class_bytes; + std::vector<unsigned char> dex_bytes; + + CommonTransformationResult(size_t class_size, size_t dex_size) + : class_bytes(class_size), dex_bytes(dex_size) {} + + CommonTransformationResult() = default; + CommonTransformationResult(CommonTransformationResult&&) = default; + CommonTransformationResult(CommonTransformationResult&) = default; +}; + +// Map from class name to transformation result. +std::map<std::string, std::deque<CommonTransformationResult>> gTransformations; + +extern "C" JNIEXPORT void JNICALL Java_Main_addCommonTransformationResult(JNIEnv* env, + jclass, + jstring class_name, + jbyteArray class_array, + jbyteArray dex_array) { + const char* name_chrs = env->GetStringUTFChars(class_name, nullptr); + std::string name_str(name_chrs); + env->ReleaseStringUTFChars(class_name, name_chrs); + CommonTransformationResult trans(env->GetArrayLength(class_array), + env->GetArrayLength(dex_array)); + if (env->ExceptionOccurred()) { + return; + } + env->GetByteArrayRegion(class_array, + 0, + env->GetArrayLength(class_array), + reinterpret_cast<jbyte*>(trans.class_bytes.data())); + if (env->ExceptionOccurred()) { + return; + } + env->GetByteArrayRegion(dex_array, + 0, + env->GetArrayLength(dex_array), + reinterpret_cast<jbyte*>(trans.dex_bytes.data())); + if (env->ExceptionOccurred()) { + return; + } + if (gTransformations.find(name_str) == gTransformations.end()) { + std::deque<CommonTransformationResult> list; + gTransformations[name_str] = std::move(list); + } + gTransformations[name_str].push_back(std::move(trans)); +} + +// The hook we are using. +void JNICALL CommonClassFileLoadHookRetransformable(jvmtiEnv* jvmti_env, + JNIEnv* jni_env ATTRIBUTE_UNUSED, + jclass class_being_redefined ATTRIBUTE_UNUSED, + jobject loader ATTRIBUTE_UNUSED, + const char* name, + jobject protection_domain ATTRIBUTE_UNUSED, + jint class_data_len ATTRIBUTE_UNUSED, + const unsigned char* class_dat ATTRIBUTE_UNUSED, + jint* new_class_data_len, + unsigned char** new_class_data) { + std::string name_str(name); + if (gTransformations.find(name_str) != gTransformations.end()) { + CommonTransformationResult& res = gTransformations[name_str][0]; + const std::vector<unsigned char>& desired_array = IsJVM() ? res.class_bytes : res.dex_bytes; + unsigned char* new_data; + jvmti_env->Allocate(desired_array.size(), &new_data); + memcpy(new_data, desired_array.data(), desired_array.size()); + *new_class_data = new_data; + *new_class_data_len = desired_array.size(); + gTransformations[name_str].pop_front(); + } +} + +extern "C" JNIEXPORT void Java_Main_enableCommonRetransformation(JNIEnv* env, + jclass, + jboolean enable) { + jvmtiError res = jvmti_env->SetEventNotificationMode(enable ? JVMTI_ENABLE : JVMTI_DISABLE, + JVMTI_EVENT_CLASS_FILE_LOAD_HOOK, + nullptr); + if (res != JVMTI_ERROR_NONE) { + JvmtiErrorToException(env, res); + } +} + +static void throwRetransformationError(jvmtiEnv* jvmti, + JNIEnv* env, + jint num_targets, + jclass* targets, + jvmtiError res) { + return throwCommonRedefinitionError<false>(jvmti, env, num_targets, targets, res); +} + +static void DoClassRetransformation(jvmtiEnv* jvmti_env, JNIEnv* env, jobjectArray targets) { + std::vector<jclass> classes; + jint len = env->GetArrayLength(targets); + for (jint i = 0; i < len; i++) { + classes.push_back(static_cast<jclass>(env->GetObjectArrayElement(targets, i))); + } + jvmtiError res = jvmti_env->RetransformClasses(len, classes.data()); + if (res != JVMTI_ERROR_NONE) { + throwRetransformationError(jvmti_env, env, len, classes.data(), res); + } +} + +// TODO Write something useful. +extern "C" JNIEXPORT void JNICALL Java_Main_doCommonClassRetransformation(JNIEnv* env, + jclass, + jobjectArray targets) { + DoClassRetransformation(jvmti_env, env, targets); +} + +// Get all capabilities except those related to retransformation. +jint OnLoad(JavaVM* vm, + char* options ATTRIBUTE_UNUSED, + void* reserved ATTRIBUTE_UNUSED) { + if (vm->GetEnv(reinterpret_cast<void**>(&jvmti_env), JVMTI_VERSION_1_0)) { + printf("Unable to get jvmti env!\n"); + return 1; + } + SetAllCapabilities(jvmti_env); + jvmtiEventCallbacks cb; + memset(&cb, 0, sizeof(cb)); + cb.ClassFileLoadHook = CommonClassFileLoadHookRetransformable; + if (jvmti_env->SetEventCallbacks(&cb, sizeof(cb)) != JVMTI_ERROR_NONE) { + printf("Unable to set class file load hook cb!\n"); + return 1; + } + return 0; +} + +} // namespace common_retransform + } // namespace art diff --git a/test/ti-agent/common_helper.h b/test/ti-agent/common_helper.h index 642ca03274..8599fc4d6c 100644 --- a/test/ti-agent/common_helper.h +++ b/test/ti-agent/common_helper.h @@ -27,6 +27,10 @@ namespace common_redefine { jint OnLoad(JavaVM* vm, char* options, void* reserved); } // namespace common_redefine +namespace common_retransform { +jint OnLoad(JavaVM* vm, char* options, void* reserved); +} // namespace common_retransform + extern bool RuntimeIsJVM; diff --git a/test/ti-agent/common_load.cc b/test/ti-agent/common_load.cc index 521e672330..1b11442092 100644 --- a/test/ti-agent/common_load.cc +++ b/test/ti-agent/common_load.cc @@ -64,8 +64,9 @@ AgentLib agents[] = { { "916-obsolete-jit", common_redefine::OnLoad, nullptr }, { "917-fields-transformation", common_redefine::OnLoad, nullptr }, { "919-obsolete-fields", common_redefine::OnLoad, nullptr }, - { "921-hello-failure", common_redefine::OnLoad, nullptr }, + { "921-hello-failure", common_retransform::OnLoad, nullptr }, { "926-multi-obsolescence", common_redefine::OnLoad, nullptr }, + { "930-hello-retransform", common_retransform::OnLoad, nullptr }, }; static AgentLib* FindAgent(char* name) { |