summaryrefslogtreecommitdiff
diff options
context:
space:
mode:
-rw-r--r--build/Android.gtest.mk1
-rw-r--r--compiler/Android.bp3
-rw-r--r--compiler/compiler.h3
-rw-r--r--compiler/dex/dex_to_dex_compiler.cc7
-rw-r--r--compiler/dex/dex_to_dex_compiler.h7
-rw-r--r--compiler/driver/compiler_driver-inl.h13
-rw-r--r--compiler/driver/compiler_driver.cc123
-rw-r--r--compiler/driver/compiler_driver.h14
-rw-r--r--compiler/driver/compiler_driver_test.cc1
-rw-r--r--compiler/driver/dex_compilation_unit.cc2
-rw-r--r--compiler/driver/dex_compilation_unit.h8
-rw-r--r--compiler/image_writer.cc11
-rw-r--r--compiler/image_writer.h10
-rw-r--r--compiler/jit/jit_compiler.cc2
-rw-r--r--compiler/jit/jit_logger.cc11
-rw-r--r--compiler/jit/jit_logger.h10
-rw-r--r--compiler/oat_writer.cc16
-rw-r--r--compiler/optimizing/builder.h15
-rw-r--r--compiler/optimizing/code_generator_mips.cc93
-rw-r--r--compiler/optimizing/code_generator_mips.h30
-rw-r--r--compiler/optimizing/code_generator_mips64.cc74
-rw-r--r--compiler/optimizing/code_generator_mips64.h24
-rw-r--r--compiler/optimizing/codegen_test.cc331
-rw-r--r--compiler/optimizing/codegen_test_utils.h355
-rw-r--r--compiler/optimizing/common_arm.h6
-rw-r--r--compiler/optimizing/induction_var_range.cc29
-rw-r--r--compiler/optimizing/inliner.cc45
-rw-r--r--compiler/optimizing/instruction_builder.cc49
-rw-r--r--compiler/optimizing/instruction_builder.h11
-rw-r--r--compiler/optimizing/intrinsics.h3
-rw-r--r--compiler/optimizing/intrinsics_arm_vixl.cc216
-rw-r--r--compiler/optimizing/nodes.cc16
-rw-r--r--compiler/optimizing/nodes.h4
-rw-r--r--compiler/optimizing/optimizing_compiler.cc32
-rw-r--r--compiler/optimizing/optimizing_unit_test.h3
-rw-r--r--compiler/optimizing/reference_type_propagation.cc46
-rw-r--r--compiler/optimizing/reference_type_propagation.h3
-rw-r--r--compiler/optimizing/reference_type_propagation_test.cc1
-rw-r--r--compiler/optimizing/scheduler.cc610
-rw-r--r--compiler/optimizing/scheduler.h487
-rw-r--r--compiler/optimizing/scheduler_arm64.cc196
-rw-r--r--compiler/optimizing/scheduler_arm64.h117
-rw-r--r--compiler/optimizing/scheduler_test.cc238
-rw-r--r--compiler/optimizing/sharpening.cc4
-rw-r--r--compiler/optimizing/ssa_builder.cc6
-rw-r--r--compiler/optimizing/ssa_builder.h3
-rw-r--r--compiler/optimizing/stack_map_stream.cc123
-rw-r--r--compiler/optimizing/stack_map_stream.h12
-rw-r--r--compiler/optimizing/stack_map_test.cc81
-rw-r--r--compiler/utils/assembler_test_base.h1
-rw-r--r--compiler/utils/x86/assembler_x86.cc19
-rw-r--r--compiler/utils/x86/assembler_x86.h3
-rw-r--r--compiler/utils/x86/assembler_x86_test.cc40
-rw-r--r--compiler/utils/x86_64/assembler_x86_64.cc22
-rw-r--r--compiler/utils/x86_64/assembler_x86_64.h3
-rw-r--r--compiler/utils/x86_64/assembler_x86_64_test.cc8
-rw-r--r--dex2oat/dex2oat.cc28
-rw-r--r--dexdump/dexdump_test.cc1
-rw-r--r--dexlayout/dexlayout_test.cc1
-rw-r--r--dexlist/dexlist_test.cc1
-rw-r--r--imgdiag/imgdiag_test.cc1
-rw-r--r--oatdump/oatdump.cc78
-rw-r--r--oatdump/oatdump_test.cc1
-rw-r--r--patchoat/patchoat.cc4
-rw-r--r--profman/profile_assistant_test.cc1
-rw-r--r--runtime/Android.bp2
-rw-r--r--runtime/arch/instruction_set.h8
-rw-r--r--runtime/art_field-inl.h15
-rw-r--r--runtime/art_field.cc4
-rw-r--r--runtime/art_field.h2
-rw-r--r--runtime/art_method-inl.h18
-rw-r--r--runtime/art_method.cc2
-rw-r--r--runtime/art_method.h7
-rw-r--r--runtime/base/arena_allocator.cc4
-rw-r--r--runtime/base/arena_allocator.h1
-rw-r--r--runtime/base/iteration_range.h2
-rw-r--r--runtime/bit_memory_region.h2
-rw-r--r--runtime/check_reference_map_visitor.h6
-rw-r--r--runtime/class_linker-inl.h33
-rw-r--r--runtime/class_linker.cc77
-rw-r--r--runtime/class_linker.h8
-rw-r--r--runtime/class_linker_test.cc8
-rw-r--r--runtime/dex2oat_environment_test.h1
-rw-r--r--runtime/dex_file_test.cc9
-rw-r--r--runtime/entrypoints/entrypoint_utils-inl.h16
-rw-r--r--runtime/exec_utils.cc102
-rw-r--r--runtime/exec_utils.h34
-rw-r--r--runtime/gc/collector/concurrent_copying.cc27
-rw-r--r--runtime/gc/collector/garbage_collector.cc20
-rw-r--r--runtime/gc/collector/garbage_collector.h4
-rw-r--r--runtime/gc/heap.cc14
-rw-r--r--runtime/gc/space/image_space.cc5
-rw-r--r--runtime/image.cc2
-rw-r--r--runtime/interpreter/interpreter_common.cc22
-rw-r--r--runtime/interpreter/mterp/mips64/bincmp.S1
-rw-r--r--runtime/interpreter/mterp/mips64/op_packed_switch.S1
-rw-r--r--runtime/interpreter/mterp/mterp.cc48
-rw-r--r--runtime/interpreter/mterp/out/mterp_mips64.S8
-rw-r--r--runtime/interpreter/unstarted_runtime.cc36
-rw-r--r--runtime/interpreter/unstarted_runtime_list.h2
-rw-r--r--runtime/interpreter/unstarted_runtime_test.cc59
-rw-r--r--runtime/jit/jit.h2
-rw-r--r--runtime/jit/jit_code_cache.cc13
-rw-r--r--runtime/memory_region.cc3
-rw-r--r--runtime/memory_region.h23
-rw-r--r--runtime/mirror/class.cc3
-rw-r--r--runtime/mirror/dex_cache-inl.h110
-rw-r--r--runtime/mirror/dex_cache.cc20
-rw-r--r--runtime/mirror/dex_cache.h77
-rw-r--r--runtime/mirror/dex_cache_test.cc3
-rw-r--r--runtime/native/java_lang_DexCache.cc14
-rw-r--r--runtime/oat.h2
-rw-r--r--runtime/oat_file.cc2
-rw-r--r--runtime/oat_file_assistant.cc145
-rw-r--r--runtime/oat_file_assistant.h10
-rw-r--r--runtime/oat_file_assistant_test.cc139
-rw-r--r--runtime/openjdkjvmti/ti_class_loader.cc37
-rw-r--r--runtime/openjdkjvmti/ti_class_loader.h5
-rw-r--r--runtime/openjdkjvmti/ti_redefine.cc122
-rw-r--r--runtime/openjdkjvmti/ti_redefine.h11
-rw-r--r--runtime/quick_exception_handler.cc6
-rw-r--r--runtime/runtime_common.cc74
-rw-r--r--runtime/stack.cc2
-rw-r--r--runtime/stack_map.cc14
-rw-r--r--runtime/stack_map.h134
-rw-r--r--runtime/thread.cc99
-rw-r--r--runtime/thread.h6
-rw-r--r--runtime/utils.cc68
-rw-r--r--runtime/utils.h7
-rw-r--r--runtime/utils/dex_cache_arrays_layout-inl.h19
-rw-r--r--runtime/utils_test.cc1
-rw-r--r--runtime/vdex_file.cc28
-rw-r--r--runtime/vdex_file.h24
-rw-r--r--runtime/vdex_file_test.cc46
-rw-r--r--runtime/verifier/method_verifier.cc12
-rw-r--r--test/082-inline-execute/src/Main.java11
-rw-r--r--test/623-checker-loop-regressions/src/Main.java121
-rw-r--r--test/626-checker-arm64-scratch-register/src/Main.java4
-rw-r--r--test/626-const-class-linking/clear_dex_cache_types.cc3
-rw-r--r--test/706-checker-scheduler/expected.txt0
-rw-r--r--test/706-checker-scheduler/info.txt1
-rw-r--r--test/706-checker-scheduler/src/Main.java82
-rw-r--r--test/908-gc-start-finish/gc_callbacks.cc25
-rw-r--r--test/934-load-transform/src/Main.java4
-rw-r--r--test/935-non-retransformable/src-ex/TestMain.java21
-rw-r--r--test/935-non-retransformable/src/Main.java5
-rwxr-xr-xtest/938-load-transform-bcp/build17
-rw-r--r--test/938-load-transform-bcp/expected.txt2
-rw-r--r--test/938-load-transform-bcp/info.txt1
-rwxr-xr-xtest/938-load-transform-bcp/run17
-rw-r--r--test/938-load-transform-bcp/src-ex/TestMain.java35
-rw-r--r--test/938-load-transform-bcp/src/Main.java123
-rwxr-xr-xtest/939-hello-transformation-bcp/build17
-rw-r--r--test/939-hello-transformation-bcp/expected.txt3
-rw-r--r--test/939-hello-transformation-bcp/info.txt6
-rwxr-xr-xtest/939-hello-transformation-bcp/run17
-rw-r--r--test/939-hello-transformation-bcp/src/Main.java126
-rwxr-xr-xtest/940-recursive-obsolete/build17
-rw-r--r--test/940-recursive-obsolete/expected.txt21
-rw-r--r--test/940-recursive-obsolete/info.txt1
-rwxr-xr-xtest/940-recursive-obsolete/run17
-rw-r--r--test/940-recursive-obsolete/src/Main.java89
-rw-r--r--test/940-recursive-obsolete/src/Transform.java28
-rwxr-xr-xtest/941-recurive-obsolete-jit/build17
-rw-r--r--test/941-recurive-obsolete-jit/expected.txt22
-rw-r--r--test/941-recurive-obsolete-jit/info.txt1
-rwxr-xr-xtest/941-recurive-obsolete-jit/run17
-rw-r--r--test/941-recurive-obsolete-jit/src/Main.java155
-rw-r--r--test/941-recurive-obsolete-jit/src/Transform.java29
-rwxr-xr-xtest/942-private-recursive/build17
-rw-r--r--test/942-private-recursive/expected.txt21
-rw-r--r--test/942-private-recursive/info.txt1
-rwxr-xr-xtest/942-private-recursive/run17
-rw-r--r--test/942-private-recursive/src/Main.java94
-rw-r--r--test/942-private-recursive/src/Transform.java32
-rwxr-xr-xtest/943-private-recursive-jit/build17
-rw-r--r--test/943-private-recursive-jit/expected.txt22
-rw-r--r--test/943-private-recursive-jit/info.txt1
-rwxr-xr-xtest/943-private-recursive-jit/run17
-rw-r--r--test/943-private-recursive-jit/src/Main.java171
-rw-r--r--test/943-private-recursive-jit/src/Transform.java33
-rwxr-xr-xtest/944-transform-classloaders/build17
-rw-r--r--test/944-transform-classloaders/classloader.cc44
-rw-r--r--test/944-transform-classloaders/expected.txt5
-rw-r--r--test/944-transform-classloaders/info.txt7
-rwxr-xr-xtest/944-transform-classloaders/run17
-rw-r--r--test/944-transform-classloaders/src/CommonClassDefinition.java27
-rw-r--r--test/944-transform-classloaders/src/Main.java265
-rw-r--r--test/944-transform-classloaders/src/Transform.java28
-rw-r--r--test/944-transform-classloaders/src/Transform2.java21
-rw-r--r--test/Android.bp1
-rw-r--r--test/Android.run-test.mk5
-rw-r--r--test/Nested/Nested.java2
-rwxr-xr-xtest/etc/run-test-jar2
-rw-r--r--test/ti-agent/common_helper.cc26
-rw-r--r--test/ti-agent/common_load.cc7
-rwxr-xr-xtools/buildbot-build.sh3
-rw-r--r--tools/cpp-define-generator/constant_jit.def1
198 files changed, 6158 insertions, 1426 deletions
diff --git a/build/Android.gtest.mk b/build/Android.gtest.mk
index bc0838435c..e5258087db 100644
--- a/build/Android.gtest.mk
+++ b/build/Android.gtest.mk
@@ -113,6 +113,7 @@ ART_GTEST_runtime_callbacks_test_DEX_DEPS := XandY
ART_GTEST_stub_test_DEX_DEPS := AllFields
ART_GTEST_transaction_test_DEX_DEPS := Transaction
ART_GTEST_type_lookup_table_test_DEX_DEPS := Lookup
+ART_GTEST_unstarted_runtime_test_DEX_DEPS := Nested
ART_GTEST_verifier_deps_test_DEX_DEPS := VerifierDeps MultiDex
ART_GTEST_dex_to_dex_decompiler_test_DEX_DEPS := VerifierDeps DexToDexDecompiler
diff --git a/compiler/Android.bp b/compiler/Android.bp
index 46f3358af1..f6a4db49fb 100644
--- a/compiler/Android.bp
+++ b/compiler/Android.bp
@@ -80,6 +80,7 @@ art_cc_defaults {
"optimizing/register_allocator_graph_color.cc",
"optimizing/register_allocator_linear_scan.cc",
"optimizing/select_generator.cc",
+ "optimizing/scheduler.cc",
"optimizing/sharpening.cc",
"optimizing/side_effects_analysis.cc",
"optimizing/ssa_builder.cc",
@@ -123,6 +124,7 @@ art_cc_defaults {
"jni/quick/arm64/calling_convention_arm64.cc",
"linker/arm64/relative_patcher_arm64.cc",
"optimizing/code_generator_arm64.cc",
+ "optimizing/scheduler_arm64.cc",
"optimizing/instruction_simplifier_arm64.cc",
"optimizing/intrinsics_arm64.cc",
"optimizing/nodes_arm64.cc",
@@ -362,6 +364,7 @@ art_cc_test {
"jni/jni_cfi_test.cc",
"optimizing/codegen_test.cc",
"optimizing/optimizing_cfi_test.cc",
+ "optimizing/scheduler_test.cc",
],
codegen: {
diff --git a/compiler/compiler.h b/compiler/compiler.h
index 908d3669ed..2ca0b77a73 100644
--- a/compiler/compiler.h
+++ b/compiler/compiler.h
@@ -27,7 +27,6 @@ namespace jit {
class JitCodeCache;
}
namespace mirror {
- class ClassLoader;
class DexCache;
}
@@ -64,7 +63,7 @@ class Compiler {
InvokeType invoke_type,
uint16_t class_def_idx,
uint32_t method_idx,
- Handle<mirror::ClassLoader> class_loader,
+ jobject class_loader,
const DexFile& dex_file,
Handle<mirror::DexCache> dex_cache) const = 0;
diff --git a/compiler/dex/dex_to_dex_compiler.cc b/compiler/dex/dex_to_dex_compiler.cc
index 76aeaa55d7..d4f6545c59 100644
--- a/compiler/dex/dex_to_dex_compiler.cc
+++ b/compiler/dex/dex_to_dex_compiler.cc
@@ -284,13 +284,16 @@ void DexCompiler::CompileInvokeVirtual(Instruction* inst, uint32_t dex_pc,
}
uint32_t method_idx = is_range ? inst->VRegB_3rc() : inst->VRegB_35c();
ScopedObjectAccess soa(Thread::Current());
+ StackHandleScope<1> hs(soa.Self());
+ Handle<mirror::ClassLoader> class_loader(hs.NewHandle(
+ soa.Decode<mirror::ClassLoader>(unit_.GetClassLoader())));
ClassLinker* class_linker = unit_.GetClassLinker();
ArtMethod* resolved_method = class_linker->ResolveMethod<ClassLinker::kForceICCECheck>(
GetDexFile(),
method_idx,
unit_.GetDexCache(),
- unit_.GetClassLoader(),
+ class_loader,
/* referrer */ nullptr,
kVirtual);
@@ -327,7 +330,7 @@ CompiledMethod* ArtCompileDEX(
InvokeType invoke_type ATTRIBUTE_UNUSED,
uint16_t class_def_idx,
uint32_t method_idx,
- Handle<mirror::ClassLoader> class_loader,
+ jobject class_loader,
const DexFile& dex_file,
DexToDexCompilationLevel dex_to_dex_compilation_level) {
DCHECK(driver != nullptr);
diff --git a/compiler/dex/dex_to_dex_compiler.h b/compiler/dex/dex_to_dex_compiler.h
index 00c596d60e..0a00d45297 100644
--- a/compiler/dex/dex_to_dex_compiler.h
+++ b/compiler/dex/dex_to_dex_compiler.h
@@ -18,7 +18,6 @@
#define ART_COMPILER_DEX_DEX_TO_DEX_COMPILER_H_
#include "dex_file.h"
-#include "handle.h"
#include "invoke_type.h"
namespace art {
@@ -26,10 +25,6 @@ namespace art {
class CompiledMethod;
class CompilerDriver;
-namespace mirror {
-class ClassLoader;
-} // namespace mirror
-
namespace optimizer {
enum class DexToDexCompilationLevel {
@@ -45,7 +40,7 @@ CompiledMethod* ArtCompileDEX(CompilerDriver* driver,
InvokeType invoke_type,
uint16_t class_def_idx,
uint32_t method_idx,
- Handle<mirror::ClassLoader> class_loader,
+ jobject class_loader,
const DexFile& dex_file,
DexToDexCompilationLevel dex_to_dex_compilation_level);
diff --git a/compiler/driver/compiler_driver-inl.h b/compiler/driver/compiler_driver-inl.h
index 81d80f4f8f..f056dd3c00 100644
--- a/compiler/driver/compiler_driver-inl.h
+++ b/compiler/driver/compiler_driver-inl.h
@@ -31,12 +31,17 @@
namespace art {
+inline mirror::ClassLoader* CompilerDriver::GetClassLoader(const ScopedObjectAccess& soa,
+ const DexCompilationUnit* mUnit) {
+ return soa.Decode<mirror::ClassLoader>(mUnit->GetClassLoader()).Ptr();
+}
+
inline mirror::Class* CompilerDriver::ResolveClass(
const ScopedObjectAccess& soa, Handle<mirror::DexCache> dex_cache,
Handle<mirror::ClassLoader> class_loader, dex::TypeIndex cls_index,
const DexCompilationUnit* mUnit) {
DCHECK_EQ(dex_cache->GetDexFile(), mUnit->GetDexFile());
- DCHECK_EQ(class_loader.Get(), mUnit->GetClassLoader().Get());
+ DCHECK_EQ(class_loader.Get(), GetClassLoader(soa, mUnit));
mirror::Class* cls = mUnit->GetClassLinker()->ResolveType(
*mUnit->GetDexFile(), cls_index, dex_cache, class_loader);
DCHECK_EQ(cls == nullptr, soa.Self()->IsExceptionPending());
@@ -51,7 +56,7 @@ inline mirror::Class* CompilerDriver::ResolveCompilingMethodsClass(
const ScopedObjectAccess& soa, Handle<mirror::DexCache> dex_cache,
Handle<mirror::ClassLoader> class_loader, const DexCompilationUnit* mUnit) {
DCHECK_EQ(dex_cache->GetDexFile(), mUnit->GetDexFile());
- DCHECK_EQ(class_loader.Get(), mUnit->GetClassLoader().Get());
+ DCHECK_EQ(class_loader.Get(), GetClassLoader(soa, mUnit));
const DexFile::MethodId& referrer_method_id =
mUnit->GetDexFile()->GetMethodId(mUnit->GetDexMethodIndex());
return ResolveClass(soa, dex_cache, class_loader, referrer_method_id.class_idx_, mUnit);
@@ -82,7 +87,7 @@ inline ArtField* CompilerDriver::ResolveField(
const ScopedObjectAccess& soa, Handle<mirror::DexCache> dex_cache,
Handle<mirror::ClassLoader> class_loader, const DexCompilationUnit* mUnit,
uint32_t field_idx, bool is_static) {
- DCHECK_EQ(class_loader.Get(), mUnit->GetClassLoader().Get());
+ DCHECK_EQ(class_loader.Get(), GetClassLoader(soa, mUnit));
return ResolveFieldWithDexFile(soa, dex_cache, class_loader, mUnit->GetDexFile(), field_idx,
is_static);
}
@@ -193,7 +198,7 @@ inline ArtMethod* CompilerDriver::ResolveMethod(
ScopedObjectAccess& soa, Handle<mirror::DexCache> dex_cache,
Handle<mirror::ClassLoader> class_loader, const DexCompilationUnit* mUnit,
uint32_t method_idx, InvokeType invoke_type, bool check_incompatible_class_change) {
- DCHECK_EQ(class_loader.Get(), mUnit->GetClassLoader().Get());
+ DCHECK_EQ(class_loader.Get(), GetClassLoader(soa, mUnit));
ArtMethod* resolved_method =
check_incompatible_class_change
? mUnit->GetClassLinker()->ResolveMethod<ClassLinker::kForceICCECheck>(
diff --git a/compiler/driver/compiler_driver.cc b/compiler/driver/compiler_driver.cc
index 4e19dbe949..1d4eaf8c5a 100644
--- a/compiler/driver/compiler_driver.cc
+++ b/compiler/driver/compiler_driver.cc
@@ -583,7 +583,7 @@ static void CompileMethod(Thread* self,
InvokeType invoke_type,
uint16_t class_def_idx,
uint32_t method_idx,
- Handle<mirror::ClassLoader> class_loader,
+ jobject class_loader,
const DexFile& dex_file,
optimizer::DexToDexCompilationLevel dex_to_dex_compilation_level,
bool compilation_enabled,
@@ -624,6 +624,9 @@ static void CompileMethod(Thread* self,
// Look-up the ArtMethod associated with this code_item (if any)
// -- It is later used to lookup any [optimization] annotations for this method.
ScopedObjectAccess soa(self);
+ StackHandleScope<1> hs(soa.Self());
+ Handle<mirror::ClassLoader> class_loader_handle(hs.NewHandle(
+ soa.Decode<mirror::ClassLoader>(class_loader)));
// TODO: Lookup annotation from DexFile directly without resolving method.
ArtMethod* method =
@@ -631,7 +634,7 @@ static void CompileMethod(Thread* self,
dex_file,
method_idx,
dex_cache,
- class_loader,
+ class_loader_handle,
/* referrer */ nullptr,
invoke_type);
@@ -678,14 +681,9 @@ static void CompileMethod(Thread* self,
if (compile) {
// NOTE: if compiler declines to compile this method, it will return null.
- compiled_method = driver->GetCompiler()->Compile(code_item,
- access_flags,
- invoke_type,
- class_def_idx,
- method_idx,
- class_loader,
- dex_file,
- dex_cache);
+ compiled_method = driver->GetCompiler()->Compile(code_item, access_flags, invoke_type,
+ class_def_idx, method_idx, class_loader,
+ dex_file, dex_cache);
}
if (compiled_method == nullptr &&
dex_to_dex_compilation_level != optimizer::DexToDexCompilationLevel::kDontDexToDexCompile) {
@@ -732,14 +730,12 @@ void CompilerDriver::CompileOne(Thread* self, ArtMethod* method, TimingLogger* t
uint32_t method_idx = method->GetDexMethodIndex();
uint32_t access_flags = method->GetAccessFlags();
InvokeType invoke_type = method->GetInvokeType();
- StackHandleScope<2> hs(self);
+ StackHandleScope<1> hs(self);
Handle<mirror::DexCache> dex_cache(hs.NewHandle(method->GetDexCache()));
- Handle<mirror::ClassLoader> class_loader(
- hs.NewHandle(method->GetDeclaringClass()->GetClassLoader()));
{
ScopedObjectAccessUnchecked soa(self);
ScopedLocalRef<jobject> local_class_loader(
- soa.Env(), soa.AddLocalReference<jobject>(class_loader.Get()));
+ soa.Env(), soa.AddLocalReference<jobject>(method->GetDeclaringClass()->GetClassLoader()));
jclass_loader = soa.Env()->NewGlobalRef(local_class_loader.get());
// Find the dex_file
dex_file = method->GetDexFile();
@@ -773,7 +769,7 @@ void CompilerDriver::CompileOne(Thread* self, ArtMethod* method, TimingLogger* t
invoke_type,
class_def_idx,
method_idx,
- class_loader,
+ jclass_loader,
*dex_file,
dex_to_dex_compilation_level,
true,
@@ -799,7 +795,7 @@ void CompilerDriver::CompileOne(Thread* self, ArtMethod* method, TimingLogger* t
invoke_type,
class_def_idx,
method_idx,
- class_loader,
+ jclass_loader,
*dex_file,
dex_to_dex_compilation_level,
true,
@@ -1074,30 +1070,22 @@ bool CompilerDriver::ShouldCompileBasedOnProfile(const MethodReference& method_r
class ResolveCatchBlockExceptionsClassVisitor : public ClassVisitor {
public:
- ResolveCatchBlockExceptionsClassVisitor() : classes_() {}
+ explicit ResolveCatchBlockExceptionsClassVisitor(
+ std::set<std::pair<dex::TypeIndex, const DexFile*>>& exceptions_to_resolve)
+ : exceptions_to_resolve_(exceptions_to_resolve) {}
virtual bool operator()(ObjPtr<mirror::Class> c) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_) {
- classes_.push_back(c);
- return true;
- }
-
- void FindExceptionTypesToResolve(
- std::set<std::pair<dex::TypeIndex, const DexFile*>>* exceptions_to_resolve)
- REQUIRES_SHARED(Locks::mutator_lock_) {
const auto pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
- for (ObjPtr<mirror::Class> klass : classes_) {
- for (ArtMethod& method : klass->GetMethods(pointer_size)) {
- FindExceptionTypesToResolveForMethod(&method, exceptions_to_resolve);
- }
+ for (auto& m : c->GetMethods(pointer_size)) {
+ ResolveExceptionsForMethod(&m);
}
+ return true;
}
private:
- void FindExceptionTypesToResolveForMethod(
- ArtMethod* method,
- std::set<std::pair<dex::TypeIndex, const DexFile*>>* exceptions_to_resolve)
+ void ResolveExceptionsForMethod(ArtMethod* method_handle)
REQUIRES_SHARED(Locks::mutator_lock_) {
- const DexFile::CodeItem* code_item = method->GetCodeItem();
+ const DexFile::CodeItem* code_item = method_handle->GetCodeItem();
if (code_item == nullptr) {
return; // native or abstract method
}
@@ -1117,9 +1105,9 @@ class ResolveCatchBlockExceptionsClassVisitor : public ClassVisitor {
dex::TypeIndex encoded_catch_handler_handlers_type_idx =
dex::TypeIndex(DecodeUnsignedLeb128(&encoded_catch_handler_list));
// Add to set of types to resolve if not already in the dex cache resolved types
- if (!method->IsResolvedTypeIdx(encoded_catch_handler_handlers_type_idx)) {
- exceptions_to_resolve->emplace(encoded_catch_handler_handlers_type_idx,
- method->GetDexFile());
+ if (!method_handle->IsResolvedTypeIdx(encoded_catch_handler_handlers_type_idx)) {
+ exceptions_to_resolve_.emplace(encoded_catch_handler_handlers_type_idx,
+ method_handle->GetDexFile());
}
// ignore address associated with catch handler
DecodeUnsignedLeb128(&encoded_catch_handler_list);
@@ -1131,7 +1119,7 @@ class ResolveCatchBlockExceptionsClassVisitor : public ClassVisitor {
}
}
- std::vector<ObjPtr<mirror::Class>> classes_;
+ std::set<std::pair<dex::TypeIndex, const DexFile*>>& exceptions_to_resolve_;
};
class RecordImageClassesVisitor : public ClassVisitor {
@@ -1185,14 +1173,8 @@ void CompilerDriver::LoadImageClasses(TimingLogger* timings) {
hs.NewHandle(class_linker->FindSystemClass(self, "Ljava/lang/Throwable;")));
do {
unresolved_exception_types.clear();
- {
- // Thread suspension is not allowed while ResolveCatchBlockExceptionsClassVisitor
- // is using a std::vector<ObjPtr<mirror::Class>>.
- ScopedAssertNoThreadSuspension ants(__FUNCTION__);
- ResolveCatchBlockExceptionsClassVisitor visitor;
- class_linker->VisitClasses(&visitor);
- visitor.FindExceptionTypesToResolve(&unresolved_exception_types);
- }
+ ResolveCatchBlockExceptionsClassVisitor visitor(unresolved_exception_types);
+ class_linker->VisitClasses(&visitor);
for (const auto& exception_type : unresolved_exception_types) {
dex::TypeIndex exception_type_idx = exception_type.first;
const DexFile* dex_file = exception_type.second;
@@ -1441,14 +1423,19 @@ void CompilerDriver::MarkForDexToDexCompilation(Thread* self, const MethodRefere
dex_to_dex_references_.back().GetMethodIndexes().SetBit(method_ref.dex_method_index);
}
-bool CompilerDriver::CanAccessTypeWithoutChecks(ObjPtr<mirror::Class> referrer_class,
- ObjPtr<mirror::Class> resolved_class) {
+bool CompilerDriver::CanAccessTypeWithoutChecks(uint32_t referrer_idx,
+ Handle<mirror::DexCache> dex_cache,
+ dex::TypeIndex type_idx) {
+ // Get type from dex cache assuming it was populated by the verifier
+ mirror::Class* resolved_class = dex_cache->GetResolvedType(type_idx);
if (resolved_class == nullptr) {
stats_->TypeNeedsAccessCheck();
return false; // Unknown class needs access checks.
}
+ const DexFile::MethodId& method_id = dex_cache->GetDexFile()->GetMethodId(referrer_idx);
bool is_accessible = resolved_class->IsPublic(); // Public classes are always accessible.
if (!is_accessible) {
+ mirror::Class* referrer_class = dex_cache->GetResolvedType(method_id.class_idx_);
if (referrer_class == nullptr) {
stats_->TypeNeedsAccessCheck();
return false; // Incomplete referrer knowledge needs access check.
@@ -1465,9 +1452,12 @@ bool CompilerDriver::CanAccessTypeWithoutChecks(ObjPtr<mirror::Class> referrer_c
return is_accessible;
}
-bool CompilerDriver::CanAccessInstantiableTypeWithoutChecks(ObjPtr<mirror::Class> referrer_class,
- ObjPtr<mirror::Class> resolved_class,
+bool CompilerDriver::CanAccessInstantiableTypeWithoutChecks(uint32_t referrer_idx,
+ Handle<mirror::DexCache> dex_cache,
+ dex::TypeIndex type_idx,
bool* finalizable) {
+ // Get type from dex cache assuming it was populated by the verifier.
+ mirror::Class* resolved_class = dex_cache->GetResolvedType(type_idx);
if (resolved_class == nullptr) {
stats_->TypeNeedsAccessCheck();
// Be conservative.
@@ -1475,8 +1465,10 @@ bool CompilerDriver::CanAccessInstantiableTypeWithoutChecks(ObjPtr<mirror::Class
return false; // Unknown class needs access checks.
}
*finalizable = resolved_class->IsFinalizable();
+ const DexFile::MethodId& method_id = dex_cache->GetDexFile()->GetMethodId(referrer_idx);
bool is_accessible = resolved_class->IsPublic(); // Public classes are always accessible.
if (!is_accessible) {
+ mirror::Class* referrer_class = dex_cache->GetResolvedType(method_id.class_idx_);
if (referrer_class == nullptr) {
stats_->TypeNeedsAccessCheck();
return false; // Incomplete referrer knowledge needs access check.
@@ -1520,7 +1512,9 @@ ArtField* CompilerDriver::ComputeInstanceFieldInfo(uint32_t field_idx,
mirror::Class* referrer_class;
Handle<mirror::DexCache> dex_cache(mUnit->GetDexCache());
{
- Handle<mirror::ClassLoader> class_loader_handle = mUnit->GetClassLoader();
+ StackHandleScope<1> hs(soa.Self());
+ Handle<mirror::ClassLoader> class_loader_handle(
+ hs.NewHandle(soa.Decode<mirror::ClassLoader>(mUnit->GetClassLoader())));
resolved_field = ResolveField(soa, dex_cache, class_loader_handle, mUnit, field_idx, false);
referrer_class = resolved_field != nullptr
? ResolveCompilingMethodsClass(soa, dex_cache, class_loader_handle, mUnit) : nullptr;
@@ -2593,18 +2587,10 @@ class CompileClassVisitor : public CompilationVisitor {
continue;
}
previous_direct_method_idx = method_idx;
- CompileMethod(soa.Self(),
- driver,
- it.GetMethodCodeItem(),
- it.GetMethodAccessFlags(),
- it.GetMethodInvokeType(class_def),
- class_def_index,
- method_idx,
- class_loader,
- dex_file,
- dex_to_dex_compilation_level,
- compilation_enabled,
- dex_cache);
+ CompileMethod(soa.Self(), driver, it.GetMethodCodeItem(), it.GetMethodAccessFlags(),
+ it.GetMethodInvokeType(class_def), class_def_index,
+ method_idx, jclass_loader, dex_file, dex_to_dex_compilation_level,
+ compilation_enabled, dex_cache);
it.Next();
}
// Compile virtual methods
@@ -2618,17 +2604,10 @@ class CompileClassVisitor : public CompilationVisitor {
continue;
}
previous_virtual_method_idx = method_idx;
- CompileMethod(soa.Self(),
- driver, it.GetMethodCodeItem(),
- it.GetMethodAccessFlags(),
- it.GetMethodInvokeType(class_def),
- class_def_index,
- method_idx,
- class_loader,
- dex_file,
- dex_to_dex_compilation_level,
- compilation_enabled,
- dex_cache);
+ CompileMethod(soa.Self(), driver, it.GetMethodCodeItem(), it.GetMethodAccessFlags(),
+ it.GetMethodInvokeType(class_def), class_def_index,
+ method_idx, jclass_loader, dex_file, dex_to_dex_compilation_level,
+ compilation_enabled, dex_cache);
it.Next();
}
DCHECK(!it.HasNext());
diff --git a/compiler/driver/compiler_driver.h b/compiler/driver/compiler_driver.h
index d032a26fd5..503fe3adfc 100644
--- a/compiler/driver/compiler_driver.h
+++ b/compiler/driver/compiler_driver.h
@@ -187,14 +187,16 @@ class CompilerDriver {
REQUIRES(!requires_constructor_barrier_lock_);
// Are runtime access checks necessary in the compiled code?
- bool CanAccessTypeWithoutChecks(ObjPtr<mirror::Class> referrer_class,
- ObjPtr<mirror::Class> resolved_class)
+ bool CanAccessTypeWithoutChecks(uint32_t referrer_idx,
+ Handle<mirror::DexCache> dex_cache,
+ dex::TypeIndex type_idx)
REQUIRES_SHARED(Locks::mutator_lock_);
// Are runtime access and instantiable checks necessary in the code?
// out_is_finalizable is set to whether the type is finalizable.
- bool CanAccessInstantiableTypeWithoutChecks(ObjPtr<mirror::Class> referrer_class,
- ObjPtr<mirror::Class> resolved_class,
+ bool CanAccessInstantiableTypeWithoutChecks(uint32_t referrer_idx,
+ Handle<mirror::DexCache> dex_cache,
+ dex::TypeIndex type_idx,
bool* out_is_finalizable)
REQUIRES_SHARED(Locks::mutator_lock_);
@@ -404,6 +406,10 @@ class CompilerDriver {
uint32_t field_idx)
REQUIRES_SHARED(Locks::mutator_lock_);
+ mirror::ClassLoader* GetClassLoader(const ScopedObjectAccess& soa,
+ const DexCompilationUnit* mUnit)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
private:
void PreCompile(jobject class_loader,
const std::vector<const DexFile*>& dex_files,
diff --git a/compiler/driver/compiler_driver_test.cc b/compiler/driver/compiler_driver_test.cc
index e4b66ebc5a..1e4ca16844 100644
--- a/compiler/driver/compiler_driver_test.cc
+++ b/compiler/driver/compiler_driver_test.cc
@@ -101,7 +101,6 @@ class CompilerDriverTest : public CommonCompilerTest {
};
// Disabled due to 10 second runtime on host
-// TODO: Update the test for hash-based dex cache arrays. Bug: 30627598
TEST_F(CompilerDriverTest, DISABLED_LARGE_CompileDexLibCore) {
CompileAll(nullptr);
diff --git a/compiler/driver/dex_compilation_unit.cc b/compiler/driver/dex_compilation_unit.cc
index 7e8e812c4a..47b19297e5 100644
--- a/compiler/driver/dex_compilation_unit.cc
+++ b/compiler/driver/dex_compilation_unit.cc
@@ -21,7 +21,7 @@
namespace art {
-DexCompilationUnit::DexCompilationUnit(Handle<mirror::ClassLoader> class_loader,
+DexCompilationUnit::DexCompilationUnit(jobject class_loader,
ClassLinker* class_linker,
const DexFile& dex_file,
const DexFile::CodeItem* code_item,
diff --git a/compiler/driver/dex_compilation_unit.h b/compiler/driver/dex_compilation_unit.h
index 24a9a5b653..854927d747 100644
--- a/compiler/driver/dex_compilation_unit.h
+++ b/compiler/driver/dex_compilation_unit.h
@@ -34,7 +34,7 @@ class VerifiedMethod;
class DexCompilationUnit : public DeletableArenaObject<kArenaAllocMisc> {
public:
- DexCompilationUnit(Handle<mirror::ClassLoader> class_loader,
+ DexCompilationUnit(jobject class_loader,
ClassLinker* class_linker,
const DexFile& dex_file,
const DexFile::CodeItem* code_item,
@@ -44,7 +44,7 @@ class DexCompilationUnit : public DeletableArenaObject<kArenaAllocMisc> {
const VerifiedMethod* verified_method,
Handle<mirror::DexCache> dex_cache);
- Handle<mirror::ClassLoader> GetClassLoader() const {
+ jobject GetClassLoader() const {
return class_loader_;
}
@@ -113,7 +113,7 @@ class DexCompilationUnit : public DeletableArenaObject<kArenaAllocMisc> {
}
private:
- const Handle<mirror::ClassLoader> class_loader_;
+ const jobject class_loader_;
ClassLinker* const class_linker_;
@@ -125,7 +125,7 @@ class DexCompilationUnit : public DeletableArenaObject<kArenaAllocMisc> {
const uint32_t access_flags_;
const VerifiedMethod* verified_method_;
- const Handle<mirror::DexCache> dex_cache_;
+ Handle<mirror::DexCache> dex_cache_;
std::string symbol_;
};
diff --git a/compiler/image_writer.cc b/compiler/image_writer.cc
index 3e9ae0834c..c72edb18a3 100644
--- a/compiler/image_writer.cc
+++ b/compiler/image_writer.cc
@@ -940,11 +940,9 @@ void ImageWriter::PruneNonImageClasses() {
}
ObjPtr<mirror::DexCache> dex_cache = self->DecodeJObject(data.weak_root)->AsDexCache();
for (size_t i = 0; i < dex_cache->NumResolvedTypes(); i++) {
- mirror::TypeDexCachePair pair =
- dex_cache->GetResolvedTypes()[i].load(std::memory_order_relaxed);
- mirror::Class* klass = pair.object.Read();
+ Class* klass = dex_cache->GetResolvedType(dex::TypeIndex(i));
if (klass != nullptr && !KeepClass(klass)) {
- dex_cache->ClearResolvedType(dex::TypeIndex(pair.index));
+ dex_cache->SetResolvedType(dex::TypeIndex(i), nullptr);
}
}
ArtMethod** resolved_methods = dex_cache->GetResolvedMethods();
@@ -1924,7 +1922,8 @@ void ImageWriter::CopyAndFixupNativeData(size_t oat_index) {
// above comment for intern tables.
ClassTable temp_class_table;
temp_class_table.ReadFromMemory(class_table_memory_ptr);
- ObjPtr<mirror::ClassLoader> class_loader = GetClassLoader();
+ CHECK_EQ(class_loaders_.size(), compile_app_image_ ? 1u : 0u);
+ mirror::ClassLoader* class_loader = compile_app_image_ ? *class_loaders_.begin() : nullptr;
CHECK_EQ(temp_class_table.NumZygoteClasses(class_loader),
table->NumNonZygoteClasses(class_loader) + table->NumZygoteClasses(class_loader));
UnbufferedRootVisitor visitor(&root_visitor, RootInfo(kRootUnknown));
@@ -2214,7 +2213,7 @@ void ImageWriter::FixupDexCache(mirror::DexCache* orig_dex_cache,
orig_dex_cache->FixupStrings(NativeCopyLocation(orig_strings, orig_dex_cache),
ImageAddressVisitor(this));
}
- mirror::TypeDexCacheType* orig_types = orig_dex_cache->GetResolvedTypes();
+ GcRoot<mirror::Class>* orig_types = orig_dex_cache->GetResolvedTypes();
if (orig_types != nullptr) {
copy_dex_cache->SetFieldPtrWithSize<false>(mirror::DexCache::ResolvedTypesOffset(),
NativeLocationInImage(orig_types),
diff --git a/compiler/image_writer.h b/compiler/image_writer.h
index bdc7146632..cc7df1ce21 100644
--- a/compiler/image_writer.h
+++ b/compiler/image_writer.h
@@ -51,13 +51,8 @@ class ImageSpace;
} // namespace space
} // namespace gc
-namespace mirror {
-class ClassLoader;
-} // namespace mirror
-
class ClassLoaderVisitor;
class ClassTable;
-class ImtConflictTable;
static constexpr int kInvalidFd = -1;
@@ -84,11 +79,6 @@ class ImageWriter FINAL {
return true;
}
- ObjPtr<mirror::ClassLoader> GetClassLoader() {
- CHECK_EQ(class_loaders_.size(), compile_app_image_ ? 1u : 0u);
- return compile_app_image_ ? *class_loaders_.begin() : nullptr;
- }
-
template <typename T>
T* GetImageAddress(T* object) const REQUIRES_SHARED(Locks::mutator_lock_) {
if (object == nullptr || IsInBootImage(object)) {
diff --git a/compiler/jit/jit_compiler.cc b/compiler/jit/jit_compiler.cc
index eaac0b40f5..cbd831a60f 100644
--- a/compiler/jit/jit_compiler.cc
+++ b/compiler/jit/jit_compiler.cc
@@ -211,7 +211,7 @@ bool JitCompiler::CompileMethod(Thread* self, ArtMethod* method, bool osr) {
JitCodeCache* const code_cache = runtime->GetJit()->GetCodeCache();
success = compiler_driver_->GetCompiler()->JitCompile(self, code_cache, method, osr);
if (success && (jit_logger_ != nullptr)) {
- jit_logger_->WriteLog(code_cache, method);
+ jit_logger_->WriteLog(code_cache, method, osr);
}
}
diff --git a/compiler/jit/jit_logger.cc b/compiler/jit/jit_logger.cc
index 9ce3b0cfe8..aa4f66773a 100644
--- a/compiler/jit/jit_logger.cc
+++ b/compiler/jit/jit_logger.cc
@@ -23,6 +23,7 @@
#include "driver/compiler_driver.h"
#include "jit/jit.h"
#include "jit/jit_code_cache.h"
+#include "oat_file-inl.h"
namespace art {
namespace jit {
@@ -49,9 +50,10 @@ void JitLogger::OpenPerfMapLog() {
}
}
-void JitLogger::WritePerfMapLog(JitCodeCache* code_cache, ArtMethod* method) {
+void JitLogger::WritePerfMapLog(JitCodeCache* code_cache, ArtMethod* method, bool osr) {
if (perf_file_ != nullptr) {
- const void* ptr = method->GetEntryPointFromQuickCompiledCode();
+ const void* ptr = osr ? code_cache->LookupOsrMethodHeader(method)->GetCode()
+ : method->GetEntryPointFromQuickCompiledCode();
size_t code_size = code_cache->GetMemorySizeOfCodePointer(ptr);
std::string method_name = method->PrettyMethod();
@@ -268,9 +270,10 @@ void JitLogger::OpenJitDumpLog() {
WriteJitDumpHeader();
}
-void JitLogger::WriteJitDumpLog(JitCodeCache* code_cache, ArtMethod* method) {
+void JitLogger::WriteJitDumpLog(JitCodeCache* code_cache, ArtMethod* method, bool osr) {
if (jit_dump_file_ != nullptr) {
- const void* code = method->GetEntryPointFromQuickCompiledCode();
+ const void* code = osr ? code_cache->LookupOsrMethodHeader(method)->GetCode()
+ : method->GetEntryPointFromQuickCompiledCode();
size_t code_size = code_cache->GetMemorySizeOfCodePointer(code);
std::string method_name = method->PrettyMethod();
diff --git a/compiler/jit/jit_logger.h b/compiler/jit/jit_logger.h
index 0f8cfe4e2f..460864e8a9 100644
--- a/compiler/jit/jit_logger.h
+++ b/compiler/jit/jit_logger.h
@@ -94,10 +94,10 @@ class JitLogger {
OpenJitDumpLog();
}
- void WriteLog(JitCodeCache* code_cache, ArtMethod* method)
+ void WriteLog(JitCodeCache* code_cache, ArtMethod* method, bool osr)
REQUIRES_SHARED(Locks::mutator_lock_) {
- WritePerfMapLog(code_cache, method);
- WriteJitDumpLog(code_cache, method);
+ WritePerfMapLog(code_cache, method, osr);
+ WriteJitDumpLog(code_cache, method, osr);
}
void CloseLog() {
@@ -108,13 +108,13 @@ class JitLogger {
private:
// For perf-map profiling
void OpenPerfMapLog();
- void WritePerfMapLog(JitCodeCache* code_cache, ArtMethod* method)
+ void WritePerfMapLog(JitCodeCache* code_cache, ArtMethod* method, bool osr)
REQUIRES_SHARED(Locks::mutator_lock_);
void ClosePerfMapLog();
// For perf-inject profiling
void OpenJitDumpLog();
- void WriteJitDumpLog(JitCodeCache* code_cache, ArtMethod* method)
+ void WriteJitDumpLog(JitCodeCache* code_cache, ArtMethod* method, bool osr)
REQUIRES_SHARED(Locks::mutator_lock_);
void CloseJitDumpLog();
diff --git a/compiler/oat_writer.cc b/compiler/oat_writer.cc
index 227fdc4874..bd2c5e3bfc 100644
--- a/compiler/oat_writer.cc
+++ b/compiler/oat_writer.cc
@@ -1060,7 +1060,6 @@ class OatWriter::WriteCodeMethodVisitor : public OatDexMethodVisitor {
WriteCodeMethodVisitor(OatWriter* writer, OutputStream* out, const size_t file_offset,
size_t relative_offset) SHARED_LOCK_FUNCTION(Locks::mutator_lock_)
: OatDexMethodVisitor(writer, relative_offset),
- class_loader_(writer->HasImage() ? writer->image_writer_->GetClassLoader() : nullptr),
out_(out),
file_offset_(file_offset),
soa_(Thread::Current()),
@@ -1246,13 +1245,12 @@ class OatWriter::WriteCodeMethodVisitor : public OatDexMethodVisitor {
}
private:
- ObjPtr<mirror::ClassLoader> class_loader_;
OutputStream* const out_;
const size_t file_offset_;
const ScopedObjectAccess soa_;
const ScopedAssertNoThreadSuspension no_thread_suspension_;
ClassLinker* const class_linker_;
- ObjPtr<mirror::DexCache> dex_cache_;
+ mirror::DexCache* dex_cache_;
std::vector<uint8_t> patched_code_;
void ReportWriteFailure(const char* what, const ClassDataItemIterator& it) {
@@ -1263,7 +1261,7 @@ class OatWriter::WriteCodeMethodVisitor : public OatDexMethodVisitor {
ArtMethod* GetTargetMethod(const LinkerPatch& patch)
REQUIRES_SHARED(Locks::mutator_lock_) {
MethodReference ref = patch.TargetMethod();
- ObjPtr<mirror::DexCache> dex_cache =
+ mirror::DexCache* dex_cache =
(dex_file_ == ref.dex_file) ? dex_cache_ : class_linker_->FindDexCache(
Thread::Current(), *ref.dex_file);
ArtMethod* method = dex_cache->GetResolvedMethod(
@@ -1297,7 +1295,7 @@ class OatWriter::WriteCodeMethodVisitor : public OatDexMethodVisitor {
return target_offset;
}
- ObjPtr<mirror::DexCache> GetDexCache(const DexFile* target_dex_file)
+ mirror::DexCache* GetDexCache(const DexFile* target_dex_file)
REQUIRES_SHARED(Locks::mutator_lock_) {
return (target_dex_file == dex_file_)
? dex_cache_
@@ -1305,12 +1303,10 @@ class OatWriter::WriteCodeMethodVisitor : public OatDexMethodVisitor {
}
mirror::Class* GetTargetType(const LinkerPatch& patch) REQUIRES_SHARED(Locks::mutator_lock_) {
- DCHECK(writer_->HasImage());
- ObjPtr<mirror::DexCache> dex_cache = GetDexCache(patch.TargetTypeDexFile());
- ObjPtr<mirror::Class> type =
- ClassLinker::LookupResolvedType(patch.TargetTypeIndex(), dex_cache, class_loader_);
+ mirror::DexCache* dex_cache = GetDexCache(patch.TargetTypeDexFile());
+ mirror::Class* type = dex_cache->GetResolvedType(patch.TargetTypeIndex());
CHECK(type != nullptr);
- return type.Ptr();
+ return type;
}
mirror::String* GetTargetString(const LinkerPatch& patch) REQUIRES_SHARED(Locks::mutator_lock_) {
diff --git a/compiler/optimizing/builder.h b/compiler/optimizing/builder.h
index 223439b0c7..8cf4089eba 100644
--- a/compiler/optimizing/builder.h
+++ b/compiler/optimizing/builder.h
@@ -51,10 +51,7 @@ class HGraphBuilder : public ValueObject {
compiler_driver_(driver),
compilation_stats_(compiler_stats),
block_builder_(graph, dex_file, code_item),
- ssa_builder_(graph,
- dex_compilation_unit->GetClassLoader(),
- dex_compilation_unit->GetDexCache(),
- handles),
+ ssa_builder_(graph, dex_compilation_unit->GetDexCache(), handles),
instruction_builder_(graph,
&block_builder_,
&ssa_builder_,
@@ -79,12 +76,10 @@ class HGraphBuilder : public ValueObject {
code_item_(code_item),
dex_compilation_unit_(nullptr),
compiler_driver_(nullptr),
+ null_dex_cache_(),
compilation_stats_(nullptr),
block_builder_(graph, nullptr, code_item),
- ssa_builder_(graph,
- handles->NewHandle<mirror::ClassLoader>(nullptr),
- handles->NewHandle<mirror::DexCache>(nullptr),
- handles),
+ ssa_builder_(graph, null_dex_cache_, handles),
instruction_builder_(graph,
&block_builder_,
&ssa_builder_,
@@ -96,7 +91,7 @@ class HGraphBuilder : public ValueObject {
/* compiler_driver */ nullptr,
/* interpreter_metadata */ nullptr,
/* compiler_stats */ nullptr,
- handles->NewHandle<mirror::DexCache>(nullptr),
+ null_dex_cache_,
handles) {}
GraphAnalysisResult BuildGraph();
@@ -117,6 +112,8 @@ class HGraphBuilder : public ValueObject {
CompilerDriver* const compiler_driver_;
+ ScopedNullHandle<mirror::DexCache> null_dex_cache_;
+
OptimizingCompilerStats* compilation_stats_;
HBasicBlockBuilder block_builder_;
diff --git a/compiler/optimizing/code_generator_mips.cc b/compiler/optimizing/code_generator_mips.cc
index a095970a1e..00969443c1 100644
--- a/compiler/optimizing/code_generator_mips.cc
+++ b/compiler/optimizing/code_generator_mips.cc
@@ -484,6 +484,8 @@ CodeGeneratorMIPS::CodeGeneratorMIPS(HGraph* graph,
type_bss_entry_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
boot_image_address_patches_(std::less<uint32_t>(),
graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ jit_string_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ jit_class_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
clobbered_ra_(false) {
// Save RA (containing the return address) to mimic Quick.
AddAllocatedRegister(Location::RegisterLocation(RA));
@@ -704,9 +706,6 @@ bool CodeGeneratorMIPS::HasAllocatedCalleeSaveRegisters() const {
// (this can happen in leaf methods), force CodeGenerator::InitializeCodeGeneration()
// into the path that creates a stack frame so that RA can be explicitly saved and restored.
// RA can't otherwise be saved/restored when it's the only spilled register.
- // TODO: Can this be improved? It causes creation of a stack frame (while RA might be
- // saved in an unused temporary register) and saving of RA and the current method pointer
- // in the frame.
return CodeGenerator::HasAllocatedCalleeSaveRegisters() || clobbered_ra_;
}
@@ -1160,6 +1159,67 @@ void CodeGeneratorMIPS::EmitPcRelativeAddressPlaceholderHigh(PcRelativePatchInfo
// offset to `out` (e.g. lw, jialc, addiu).
}
+CodeGeneratorMIPS::JitPatchInfo* CodeGeneratorMIPS::NewJitRootStringPatch(
+ const DexFile& dex_file,
+ dex::StringIndex dex_index,
+ Handle<mirror::String> handle) {
+ jit_string_roots_.Overwrite(StringReference(&dex_file, dex_index),
+ reinterpret_cast64<uint64_t>(handle.GetReference()));
+ jit_string_patches_.emplace_back(dex_file, dex_index.index_);
+ return &jit_string_patches_.back();
+}
+
+CodeGeneratorMIPS::JitPatchInfo* CodeGeneratorMIPS::NewJitRootClassPatch(
+ const DexFile& dex_file,
+ dex::TypeIndex dex_index,
+ Handle<mirror::Class> handle) {
+ jit_class_roots_.Overwrite(TypeReference(&dex_file, dex_index),
+ reinterpret_cast64<uint64_t>(handle.GetReference()));
+ jit_class_patches_.emplace_back(dex_file, dex_index.index_);
+ return &jit_class_patches_.back();
+}
+
+void CodeGeneratorMIPS::PatchJitRootUse(uint8_t* code,
+ const uint8_t* roots_data,
+ const CodeGeneratorMIPS::JitPatchInfo& info,
+ uint64_t index_in_table) const {
+ uint32_t literal_offset = GetAssembler().GetLabelLocation(&info.high_label);
+ uintptr_t address =
+ reinterpret_cast<uintptr_t>(roots_data) + index_in_table * sizeof(GcRoot<mirror::Object>);
+ uint32_t addr32 = dchecked_integral_cast<uint32_t>(address);
+ // lui reg, addr32_high
+ DCHECK_EQ(code[literal_offset + 0], 0x34);
+ DCHECK_EQ(code[literal_offset + 1], 0x12);
+ DCHECK_EQ((code[literal_offset + 2] & 0xE0), 0x00);
+ DCHECK_EQ(code[literal_offset + 3], 0x3C);
+ // lw reg, reg, addr32_low
+ DCHECK_EQ(code[literal_offset + 4], 0x78);
+ DCHECK_EQ(code[literal_offset + 5], 0x56);
+ DCHECK_EQ((code[literal_offset + 7] & 0xFC), 0x8C);
+ addr32 += (addr32 & 0x8000) << 1; // Account for sign extension in "lw reg, reg, addr32_low".
+ // lui reg, addr32_high
+ code[literal_offset + 0] = static_cast<uint8_t>(addr32 >> 16);
+ code[literal_offset + 1] = static_cast<uint8_t>(addr32 >> 24);
+ // lw reg, reg, addr32_low
+ code[literal_offset + 4] = static_cast<uint8_t>(addr32 >> 0);
+ code[literal_offset + 5] = static_cast<uint8_t>(addr32 >> 8);
+}
+
+void CodeGeneratorMIPS::EmitJitRootPatches(uint8_t* code, const uint8_t* roots_data) {
+ for (const JitPatchInfo& info : jit_string_patches_) {
+ const auto& it = jit_string_roots_.find(StringReference(&info.target_dex_file,
+ dex::StringIndex(info.index)));
+ DCHECK(it != jit_string_roots_.end());
+ PatchJitRootUse(code, roots_data, info, it->second);
+ }
+ for (const JitPatchInfo& info : jit_class_patches_) {
+ const auto& it = jit_class_roots_.find(TypeReference(&info.target_dex_file,
+ dex::TypeIndex(info.index)));
+ DCHECK(it != jit_class_roots_.end());
+ PatchJitRootUse(code, roots_data, info, it->second);
+ }
+}
+
void CodeGeneratorMIPS::MarkGCCard(Register object,
Register value,
bool value_can_be_null) {
@@ -5225,8 +5285,7 @@ HLoadString::LoadKind CodeGeneratorMIPS::GetSupportedLoadStringKind(
break;
case HLoadString::LoadKind::kJitTableAddress:
DCHECK(Runtime::Current()->UseJitCompilation());
- // TODO: implement.
- fallback_load = true;
+ fallback_load = false;
break;
case HLoadString::LoadKind::kDexCacheViaMethod:
fallback_load = false;
@@ -5265,8 +5324,7 @@ HLoadClass::LoadKind CodeGeneratorMIPS::GetSupportedLoadClassKind(
break;
case HLoadClass::LoadKind::kJitTableAddress:
DCHECK(Runtime::Current()->UseJitCompilation());
- // TODO: implement.
- fallback_load = true;
+ fallback_load = false;
break;
case HLoadClass::LoadKind::kDexCacheViaMethod:
fallback_load = false;
@@ -5591,7 +5649,14 @@ void InstructionCodeGeneratorMIPS::VisitLoadClass(HLoadClass* cls) NO_THREAD_SAF
break;
}
case HLoadClass::LoadKind::kJitTableAddress: {
- LOG(FATAL) << "Unimplemented";
+ CodeGeneratorMIPS::JitPatchInfo* info = codegen_->NewJitRootClassPatch(cls->GetDexFile(),
+ cls->GetTypeIndex(),
+ cls->GetClass());
+ bool reordering = __ SetReorder(false);
+ __ Bind(&info->high_label);
+ __ Lui(out, /* placeholder */ 0x1234);
+ GenerateGcRootFieldLoad(cls, out_loc, out, /* placeholder */ 0x5678);
+ __ SetReorder(reordering);
break;
}
case HLoadClass::LoadKind::kDexCacheViaMethod:
@@ -5730,6 +5795,18 @@ void InstructionCodeGeneratorMIPS::VisitLoadString(HLoadString* load) NO_THREAD_
__ Bind(slow_path->GetExitLabel());
return;
}
+ case HLoadString::LoadKind::kJitTableAddress: {
+ CodeGeneratorMIPS::JitPatchInfo* info =
+ codegen_->NewJitRootStringPatch(load->GetDexFile(),
+ load->GetStringIndex(),
+ load->GetString());
+ bool reordering = __ SetReorder(false);
+ __ Bind(&info->high_label);
+ __ Lui(out, /* placeholder */ 0x1234);
+ GenerateGcRootFieldLoad(load, out_loc, out, /* placeholder */ 0x5678);
+ __ SetReorder(reordering);
+ return;
+ }
default:
break;
}
diff --git a/compiler/optimizing/code_generator_mips.h b/compiler/optimizing/code_generator_mips.h
index e92eeef88f..47eba50248 100644
--- a/compiler/optimizing/code_generator_mips.h
+++ b/compiler/optimizing/code_generator_mips.h
@@ -352,6 +352,7 @@ class CodeGeneratorMIPS : public CodeGenerator {
// Emit linker patches.
void EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_patches) OVERRIDE;
+ void EmitJitRootPatches(uint8_t* code, const uint8_t* roots_data) OVERRIDE;
void MarkGCCard(Register object, Register value, bool value_can_be_null);
@@ -465,6 +466,31 @@ class CodeGeneratorMIPS : public CodeGenerator {
void EmitPcRelativeAddressPlaceholderHigh(PcRelativePatchInfo* info, Register out, Register base);
+ // The JitPatchInfo is used for JIT string and class loads.
+ struct JitPatchInfo {
+ JitPatchInfo(const DexFile& dex_file, uint64_t idx)
+ : target_dex_file(dex_file), index(idx) { }
+ JitPatchInfo(JitPatchInfo&& other) = default;
+
+ const DexFile& target_dex_file;
+ // String/type index.
+ uint64_t index;
+ // Label for the instruction loading the most significant half of the address.
+ // The least significant half is loaded with the instruction that follows immediately.
+ MipsLabel high_label;
+ };
+
+ void PatchJitRootUse(uint8_t* code,
+ const uint8_t* roots_data,
+ const JitPatchInfo& info,
+ uint64_t index_in_table) const;
+ JitPatchInfo* NewJitRootStringPatch(const DexFile& dex_file,
+ dex::StringIndex dex_index,
+ Handle<mirror::String> handle);
+ JitPatchInfo* NewJitRootClassPatch(const DexFile& dex_file,
+ dex::TypeIndex dex_index,
+ Handle<mirror::Class> handle);
+
private:
Register GetInvokeStaticOrDirectExtraParameter(HInvokeStaticOrDirect* invoke, Register temp);
@@ -512,6 +538,10 @@ class CodeGeneratorMIPS : public CodeGenerator {
ArenaDeque<PcRelativePatchInfo> type_bss_entry_patches_;
// Deduplication map for patchable boot image addresses.
Uint32ToLiteralMap boot_image_address_patches_;
+ // Patches for string root accesses in JIT compiled code.
+ ArenaDeque<JitPatchInfo> jit_string_patches_;
+ // Patches for class root accesses in JIT compiled code.
+ ArenaDeque<JitPatchInfo> jit_class_patches_;
// PC-relative loads on R2 clobber RA, which may need to be preserved explicitly in leaf methods.
// This is a flag set by pc_relative_fixups_mips and dex_cache_array_fixups_mips optimizations.
diff --git a/compiler/optimizing/code_generator_mips64.cc b/compiler/optimizing/code_generator_mips64.cc
index e96e3d75e1..55904a3679 100644
--- a/compiler/optimizing/code_generator_mips64.cc
+++ b/compiler/optimizing/code_generator_mips64.cc
@@ -91,9 +91,6 @@ Location InvokeDexCallingConventionVisitorMIPS64::GetNextLocation(Primitive::Typ
// Space on the stack is reserved for all arguments.
stack_index_ += Primitive::Is64BitType(type) ? 2 : 1;
- // TODO: shouldn't we use a whole machine word per argument on the stack?
- // Implicit 4-byte method pointer (and such) will cause misalignment.
-
return next_location;
}
@@ -434,7 +431,11 @@ CodeGeneratorMIPS64::CodeGeneratorMIPS64(HGraph* graph,
pc_relative_type_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
type_bss_entry_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
boot_image_address_patches_(std::less<uint32_t>(),
- graph->GetArena()->Adapter(kArenaAllocCodeGenerator)) {
+ graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ jit_string_patches_(StringReferenceValueComparator(),
+ graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ jit_class_patches_(TypeReferenceValueComparator(),
+ graph->GetArena()->Adapter(kArenaAllocCodeGenerator)) {
// Save RA (containing the return address) to mimic Quick.
AddAllocatedRegister(Location::RegisterLocation(RA));
}
@@ -1055,6 +1056,49 @@ void CodeGeneratorMIPS64::EmitPcRelativeAddressPlaceholderHigh(PcRelativePatchIn
// offset to `out` (e.g. ld, jialc, daddiu).
}
+Literal* CodeGeneratorMIPS64::DeduplicateJitStringLiteral(const DexFile& dex_file,
+ dex::StringIndex string_index,
+ Handle<mirror::String> handle) {
+ jit_string_roots_.Overwrite(StringReference(&dex_file, string_index),
+ reinterpret_cast64<uint64_t>(handle.GetReference()));
+ return jit_string_patches_.GetOrCreate(
+ StringReference(&dex_file, string_index),
+ [this]() { return __ NewLiteral<uint32_t>(/* placeholder */ 0u); });
+}
+
+Literal* CodeGeneratorMIPS64::DeduplicateJitClassLiteral(const DexFile& dex_file,
+ dex::TypeIndex type_index,
+ Handle<mirror::Class> handle) {
+ jit_class_roots_.Overwrite(TypeReference(&dex_file, type_index),
+ reinterpret_cast64<uint64_t>(handle.GetReference()));
+ return jit_class_patches_.GetOrCreate(
+ TypeReference(&dex_file, type_index),
+ [this]() { return __ NewLiteral<uint32_t>(/* placeholder */ 0u); });
+}
+
+void CodeGeneratorMIPS64::PatchJitRootUse(uint8_t* code,
+ const uint8_t* roots_data,
+ const Literal* literal,
+ uint64_t index_in_table) const {
+ uint32_t literal_offset = GetAssembler().GetLabelLocation(literal->GetLabel());
+ uintptr_t address =
+ reinterpret_cast<uintptr_t>(roots_data) + index_in_table * sizeof(GcRoot<mirror::Object>);
+ reinterpret_cast<uint32_t*>(code + literal_offset)[0] = dchecked_integral_cast<uint32_t>(address);
+}
+
+void CodeGeneratorMIPS64::EmitJitRootPatches(uint8_t* code, const uint8_t* roots_data) {
+ for (const auto& entry : jit_string_patches_) {
+ const auto& it = jit_string_roots_.find(entry.first);
+ DCHECK(it != jit_string_roots_.end());
+ PatchJitRootUse(code, roots_data, entry.second, it->second);
+ }
+ for (const auto& entry : jit_class_patches_) {
+ const auto& it = jit_class_roots_.find(entry.first);
+ DCHECK(it != jit_class_roots_.end());
+ PatchJitRootUse(code, roots_data, entry.second, it->second);
+ }
+}
+
void CodeGeneratorMIPS64::SetupBlockedRegisters() const {
// ZERO, K0, K1, GP, SP, RA are always reserved and can't be allocated.
blocked_core_registers_[ZERO] = true;
@@ -3309,8 +3353,6 @@ HLoadString::LoadKind CodeGeneratorMIPS64::GetSupportedLoadStringKind(
break;
case HLoadString::LoadKind::kJitTableAddress:
DCHECK(Runtime::Current()->UseJitCompilation());
- // TODO: implement.
- fallback_load = true;
break;
}
if (fallback_load) {
@@ -3341,8 +3383,6 @@ HLoadClass::LoadKind CodeGeneratorMIPS64::GetSupportedLoadClassKind(
break;
case HLoadClass::LoadKind::kJitTableAddress:
DCHECK(Runtime::Current()->UseJitCompilation());
- // TODO: implement.
- fallback_load = true;
break;
case HLoadClass::LoadKind::kDexCacheViaMethod:
break;
@@ -3580,10 +3620,14 @@ void InstructionCodeGeneratorMIPS64::VisitLoadClass(HLoadClass* cls) NO_THREAD_S
generate_null_check = true;
break;
}
- case HLoadClass::LoadKind::kJitTableAddress: {
- LOG(FATAL) << "Unimplemented";
+ case HLoadClass::LoadKind::kJitTableAddress:
+ __ LoadLiteral(out,
+ kLoadUnsignedWord,
+ codegen_->DeduplicateJitClassLiteral(cls->GetDexFile(),
+ cls->GetTypeIndex(),
+ cls->GetClass()));
+ GenerateGcRootFieldLoad(cls, out_loc, out, 0);
break;
- }
case HLoadClass::LoadKind::kDexCacheViaMethod:
LOG(FATAL) << "UNREACHABLE";
UNREACHABLE();
@@ -3685,6 +3729,14 @@ void InstructionCodeGeneratorMIPS64::VisitLoadString(HLoadString* load) NO_THREA
__ Bind(slow_path->GetExitLabel());
return;
}
+ case HLoadString::LoadKind::kJitTableAddress:
+ __ LoadLiteral(out,
+ kLoadUnsignedWord,
+ codegen_->DeduplicateJitStringLiteral(load->GetDexFile(),
+ load->GetStringIndex(),
+ load->GetString()));
+ GenerateGcRootFieldLoad(load, out_loc, out, 0);
+ return;
default:
break;
}
diff --git a/compiler/optimizing/code_generator_mips64.h b/compiler/optimizing/code_generator_mips64.h
index 5ba8912134..26cc7dc788 100644
--- a/compiler/optimizing/code_generator_mips64.h
+++ b/compiler/optimizing/code_generator_mips64.h
@@ -52,7 +52,7 @@ static constexpr size_t kRuntimeParameterFpuRegistersLength =
static constexpr GpuRegister kCoreCalleeSaves[] =
- { S0, S1, S2, S3, S4, S5, S6, S7, GP, S8, RA }; // TODO: review
+ { S0, S1, S2, S3, S4, S5, S6, S7, GP, S8, RA };
static constexpr FpuRegister kFpuCalleeSaves[] =
{ F24, F25, F26, F27, F28, F29, F30, F31 };
@@ -312,6 +312,7 @@ class CodeGeneratorMIPS64 : public CodeGenerator {
// Emit linker patches.
void EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_patches) OVERRIDE;
+ void EmitJitRootPatches(uint8_t* code, const uint8_t* roots_data) OVERRIDE;
void MarkGCCard(GpuRegister object, GpuRegister value, bool value_can_be_null);
@@ -425,10 +426,27 @@ class CodeGeneratorMIPS64 : public CodeGenerator {
void EmitPcRelativeAddressPlaceholderHigh(PcRelativePatchInfo* info, GpuRegister out);
+ void PatchJitRootUse(uint8_t* code,
+ const uint8_t* roots_data,
+ const Literal* literal,
+ uint64_t index_in_table) const;
+ Literal* DeduplicateJitStringLiteral(const DexFile& dex_file,
+ dex::StringIndex string_index,
+ Handle<mirror::String> handle);
+ Literal* DeduplicateJitClassLiteral(const DexFile& dex_file,
+ dex::TypeIndex type_index,
+ Handle<mirror::Class> handle);
+
private:
using Uint32ToLiteralMap = ArenaSafeMap<uint32_t, Literal*>;
using Uint64ToLiteralMap = ArenaSafeMap<uint64_t, Literal*>;
using MethodToLiteralMap = ArenaSafeMap<MethodReference, Literal*, MethodReferenceComparator>;
+ using StringToLiteralMap = ArenaSafeMap<StringReference,
+ Literal*,
+ StringReferenceValueComparator>;
+ using TypeToLiteralMap = ArenaSafeMap<TypeReference,
+ Literal*,
+ TypeReferenceValueComparator>;
using BootStringToLiteralMap = ArenaSafeMap<StringReference,
Literal*,
StringReferenceValueComparator>;
@@ -476,6 +494,10 @@ class CodeGeneratorMIPS64 : public CodeGenerator {
ArenaDeque<PcRelativePatchInfo> type_bss_entry_patches_;
// Deduplication map for patchable boot image addresses.
Uint32ToLiteralMap boot_image_address_patches_;
+ // Patches for string root accesses in JIT compiled code.
+ StringToLiteralMap jit_string_patches_;
+ // Patches for class root accesses in JIT compiled code.
+ TypeToLiteralMap jit_class_patches_;
DISALLOW_COPY_AND_ASSIGN(CodeGeneratorMIPS64);
};
diff --git a/compiler/optimizing/codegen_test.cc b/compiler/optimizing/codegen_test.cc
index 763d6da6f5..f8bbf68c1c 100644
--- a/compiler/optimizing/codegen_test.cc
+++ b/compiler/optimizing/codegen_test.cc
@@ -17,30 +17,15 @@
#include <functional>
#include <memory>
-#include "arch/instruction_set.h"
-#include "arch/arm/instruction_set_features_arm.h"
-#include "arch/arm/registers_arm.h"
-#include "arch/arm64/instruction_set_features_arm64.h"
-#include "arch/mips/instruction_set_features_mips.h"
-#include "arch/mips/registers_mips.h"
-#include "arch/mips64/instruction_set_features_mips64.h"
-#include "arch/mips64/registers_mips64.h"
-#include "arch/x86/instruction_set_features_x86.h"
-#include "arch/x86/registers_x86.h"
-#include "arch/x86_64/instruction_set_features_x86_64.h"
#include "base/macros.h"
#include "builder.h"
-#include "code_simulator_container.h"
-#include "common_compiler_test.h"
+#include "codegen_test_utils.h"
#include "dex_file.h"
#include "dex_instruction.h"
#include "driver/compiler_options.h"
-#include "graph_checker.h"
#include "nodes.h"
#include "optimizing_unit_test.h"
-#include "prepare_for_register_allocation.h"
#include "register_allocator_linear_scan.h"
-#include "ssa_liveness_analysis.h"
#include "utils.h"
#include "utils/arm/assembler_arm_vixl.h"
#include "utils/arm/managed_register_arm.h"
@@ -48,324 +33,10 @@
#include "utils/mips64/managed_register_mips64.h"
#include "utils/x86/managed_register_x86.h"
-#ifdef ART_ENABLE_CODEGEN_arm
-#include "code_generator_arm.h"
-#include "code_generator_arm_vixl.h"
-#endif
-
-#ifdef ART_ENABLE_CODEGEN_arm64
-#include "code_generator_arm64.h"
-#endif
-
-#ifdef ART_ENABLE_CODEGEN_x86
-#include "code_generator_x86.h"
-#endif
-
-#ifdef ART_ENABLE_CODEGEN_x86_64
-#include "code_generator_x86_64.h"
-#endif
-
-#ifdef ART_ENABLE_CODEGEN_mips
-#include "code_generator_mips.h"
-#endif
-
-#ifdef ART_ENABLE_CODEGEN_mips64
-#include "code_generator_mips64.h"
-#endif
-
#include "gtest/gtest.h"
namespace art {
-typedef CodeGenerator* (*CreateCodegenFn)(HGraph*, const CompilerOptions&);
-
-class CodegenTargetConfig {
- public:
- CodegenTargetConfig(InstructionSet isa, CreateCodegenFn create_codegen)
- : isa_(isa), create_codegen_(create_codegen) {
- }
- InstructionSet GetInstructionSet() const { return isa_; }
- CodeGenerator* CreateCodeGenerator(HGraph* graph, const CompilerOptions& compiler_options) {
- return create_codegen_(graph, compiler_options);
- }
-
- private:
- CodegenTargetConfig() {}
- InstructionSet isa_;
- CreateCodegenFn create_codegen_;
-};
-
-#ifdef ART_ENABLE_CODEGEN_arm
-// Provide our own codegen, that ensures the C calling conventions
-// are preserved. Currently, ART and C do not match as R4 is caller-save
-// in ART, and callee-save in C. Alternatively, we could use or write
-// the stub that saves and restores all registers, but it is easier
-// to just overwrite the code generator.
-class TestCodeGeneratorARM : public arm::CodeGeneratorARM {
- public:
- TestCodeGeneratorARM(HGraph* graph,
- const ArmInstructionSetFeatures& isa_features,
- const CompilerOptions& compiler_options)
- : arm::CodeGeneratorARM(graph, isa_features, compiler_options) {
- AddAllocatedRegister(Location::RegisterLocation(arm::R6));
- AddAllocatedRegister(Location::RegisterLocation(arm::R7));
- }
-
- void SetupBlockedRegisters() const OVERRIDE {
- arm::CodeGeneratorARM::SetupBlockedRegisters();
- blocked_core_registers_[arm::R4] = true;
- blocked_core_registers_[arm::R6] = false;
- blocked_core_registers_[arm::R7] = false;
- }
-};
-
-// A way to test the VIXL32-based code generator on ARM. This will replace
-// TestCodeGeneratorARM when the VIXL32-based backend replaces the existing one.
-class TestCodeGeneratorARMVIXL : public arm::CodeGeneratorARMVIXL {
- public:
- TestCodeGeneratorARMVIXL(HGraph* graph,
- const ArmInstructionSetFeatures& isa_features,
- const CompilerOptions& compiler_options)
- : arm::CodeGeneratorARMVIXL(graph, isa_features, compiler_options) {
- AddAllocatedRegister(Location::RegisterLocation(arm::R6));
- AddAllocatedRegister(Location::RegisterLocation(arm::R7));
- }
-
- void SetupBlockedRegisters() const OVERRIDE {
- arm::CodeGeneratorARMVIXL::SetupBlockedRegisters();
- blocked_core_registers_[arm::R4] = true;
- blocked_core_registers_[arm::R6] = false;
- blocked_core_registers_[arm::R7] = false;
- }
-};
-#endif
-
-#ifdef ART_ENABLE_CODEGEN_x86
-class TestCodeGeneratorX86 : public x86::CodeGeneratorX86 {
- public:
- TestCodeGeneratorX86(HGraph* graph,
- const X86InstructionSetFeatures& isa_features,
- const CompilerOptions& compiler_options)
- : x86::CodeGeneratorX86(graph, isa_features, compiler_options) {
- // Save edi, we need it for getting enough registers for long multiplication.
- AddAllocatedRegister(Location::RegisterLocation(x86::EDI));
- }
-
- void SetupBlockedRegisters() const OVERRIDE {
- x86::CodeGeneratorX86::SetupBlockedRegisters();
- // ebx is a callee-save register in C, but caller-save for ART.
- blocked_core_registers_[x86::EBX] = true;
-
- // Make edi available.
- blocked_core_registers_[x86::EDI] = false;
- }
-};
-#endif
-
-class InternalCodeAllocator : public CodeAllocator {
- public:
- InternalCodeAllocator() : size_(0) { }
-
- virtual uint8_t* Allocate(size_t size) {
- size_ = size;
- memory_.reset(new uint8_t[size]);
- return memory_.get();
- }
-
- size_t GetSize() const { return size_; }
- uint8_t* GetMemory() const { return memory_.get(); }
-
- private:
- size_t size_;
- std::unique_ptr<uint8_t[]> memory_;
-
- DISALLOW_COPY_AND_ASSIGN(InternalCodeAllocator);
-};
-
-static bool CanExecuteOnHardware(InstructionSet target_isa) {
- return (target_isa == kRuntimeISA)
- // Handle the special case of ARM, with two instructions sets (ARM32 and Thumb-2).
- || (kRuntimeISA == kArm && target_isa == kThumb2);
-}
-
-static bool CanExecute(InstructionSet target_isa) {
- CodeSimulatorContainer simulator(target_isa);
- return CanExecuteOnHardware(target_isa) || simulator.CanSimulate();
-}
-
-template <typename Expected>
-static Expected SimulatorExecute(CodeSimulator* simulator, Expected (*f)());
-
-template <>
-bool SimulatorExecute<bool>(CodeSimulator* simulator, bool (*f)()) {
- simulator->RunFrom(reinterpret_cast<intptr_t>(f));
- return simulator->GetCReturnBool();
-}
-
-template <>
-int32_t SimulatorExecute<int32_t>(CodeSimulator* simulator, int32_t (*f)()) {
- simulator->RunFrom(reinterpret_cast<intptr_t>(f));
- return simulator->GetCReturnInt32();
-}
-
-template <>
-int64_t SimulatorExecute<int64_t>(CodeSimulator* simulator, int64_t (*f)()) {
- simulator->RunFrom(reinterpret_cast<intptr_t>(f));
- return simulator->GetCReturnInt64();
-}
-
-template <typename Expected>
-static void VerifyGeneratedCode(InstructionSet target_isa,
- Expected (*f)(),
- bool has_result,
- Expected expected) {
- ASSERT_TRUE(CanExecute(target_isa)) << "Target isa is not executable.";
-
- // Verify on simulator.
- CodeSimulatorContainer simulator(target_isa);
- if (simulator.CanSimulate()) {
- Expected result = SimulatorExecute<Expected>(simulator.Get(), f);
- if (has_result) {
- ASSERT_EQ(expected, result);
- }
- }
-
- // Verify on hardware.
- if (CanExecuteOnHardware(target_isa)) {
- Expected result = f();
- if (has_result) {
- ASSERT_EQ(expected, result);
- }
- }
-}
-
-template <typename Expected>
-static void Run(const InternalCodeAllocator& allocator,
- const CodeGenerator& codegen,
- bool has_result,
- Expected expected) {
- InstructionSet target_isa = codegen.GetInstructionSet();
-
- typedef Expected (*fptr)();
- CommonCompilerTest::MakeExecutable(allocator.GetMemory(), allocator.GetSize());
- fptr f = reinterpret_cast<fptr>(allocator.GetMemory());
- if (target_isa == kThumb2) {
- // For thumb we need the bottom bit set.
- f = reinterpret_cast<fptr>(reinterpret_cast<uintptr_t>(f) + 1);
- }
- VerifyGeneratedCode(target_isa, f, has_result, expected);
-}
-
-static void ValidateGraph(HGraph* graph) {
- GraphChecker graph_checker(graph);
- graph_checker.Run();
- if (!graph_checker.IsValid()) {
- for (const auto& error : graph_checker.GetErrors()) {
- std::cout << error << std::endl;
- }
- }
- ASSERT_TRUE(graph_checker.IsValid());
-}
-
-template <typename Expected>
-static void RunCodeNoCheck(CodeGenerator* codegen,
- HGraph* graph,
- const std::function<void(HGraph*)>& hook_before_codegen,
- bool has_result,
- Expected expected) {
- SsaLivenessAnalysis liveness(graph, codegen);
- PrepareForRegisterAllocation(graph).Run();
- liveness.Analyze();
- RegisterAllocator::Create(graph->GetArena(), codegen, liveness)->AllocateRegisters();
- hook_before_codegen(graph);
- InternalCodeAllocator allocator;
- codegen->Compile(&allocator);
- Run(allocator, *codegen, has_result, expected);
-}
-
-template <typename Expected>
-static void RunCode(CodeGenerator* codegen,
- HGraph* graph,
- std::function<void(HGraph*)> hook_before_codegen,
- bool has_result,
- Expected expected) {
- ValidateGraph(graph);
- RunCodeNoCheck(codegen, graph, hook_before_codegen, has_result, expected);
-}
-
-template <typename Expected>
-static void RunCode(CodegenTargetConfig target_config,
- HGraph* graph,
- std::function<void(HGraph*)> hook_before_codegen,
- bool has_result,
- Expected expected) {
- CompilerOptions compiler_options;
- std::unique_ptr<CodeGenerator> codegen(target_config.CreateCodeGenerator(graph, compiler_options));
- RunCode(codegen.get(), graph, hook_before_codegen, has_result, expected);
-}
-
-#ifdef ART_ENABLE_CODEGEN_arm
-CodeGenerator* create_codegen_arm(HGraph* graph, const CompilerOptions& compiler_options) {
- std::unique_ptr<const ArmInstructionSetFeatures> features_arm(
- ArmInstructionSetFeatures::FromCppDefines());
- return new (graph->GetArena()) TestCodeGeneratorARM(graph,
- *features_arm.get(),
- compiler_options);
-}
-
-CodeGenerator* create_codegen_arm_vixl32(HGraph* graph, const CompilerOptions& compiler_options) {
- std::unique_ptr<const ArmInstructionSetFeatures> features_arm(
- ArmInstructionSetFeatures::FromCppDefines());
- return new (graph->GetArena())
- TestCodeGeneratorARMVIXL(graph, *features_arm.get(), compiler_options);
-}
-#endif
-
-#ifdef ART_ENABLE_CODEGEN_arm64
-CodeGenerator* create_codegen_arm64(HGraph* graph, const CompilerOptions& compiler_options) {
- std::unique_ptr<const Arm64InstructionSetFeatures> features_arm64(
- Arm64InstructionSetFeatures::FromCppDefines());
- return new (graph->GetArena()) arm64::CodeGeneratorARM64(graph,
- *features_arm64.get(),
- compiler_options);
-}
-#endif
-
-#ifdef ART_ENABLE_CODEGEN_x86
-CodeGenerator* create_codegen_x86(HGraph* graph, const CompilerOptions& compiler_options) {
- std::unique_ptr<const X86InstructionSetFeatures> features_x86(
- X86InstructionSetFeatures::FromCppDefines());
- return new (graph->GetArena()) TestCodeGeneratorX86(graph, *features_x86.get(), compiler_options);
-}
-#endif
-
-#ifdef ART_ENABLE_CODEGEN_x86_64
-CodeGenerator* create_codegen_x86_64(HGraph* graph, const CompilerOptions& compiler_options) {
- std::unique_ptr<const X86_64InstructionSetFeatures> features_x86_64(
- X86_64InstructionSetFeatures::FromCppDefines());
- return new (graph->GetArena())
- x86_64::CodeGeneratorX86_64(graph, *features_x86_64.get(), compiler_options);
-}
-#endif
-
-#ifdef ART_ENABLE_CODEGEN_mips
-CodeGenerator* create_codegen_mips(HGraph* graph, const CompilerOptions& compiler_options) {
- std::unique_ptr<const MipsInstructionSetFeatures> features_mips(
- MipsInstructionSetFeatures::FromCppDefines());
- return new (graph->GetArena())
- mips::CodeGeneratorMIPS(graph, *features_mips.get(), compiler_options);
-}
-#endif
-
-#ifdef ART_ENABLE_CODEGEN_mips64
-CodeGenerator* create_codegen_mips64(HGraph* graph, const CompilerOptions& compiler_options) {
- std::unique_ptr<const Mips64InstructionSetFeatures> features_mips64(
- Mips64InstructionSetFeatures::FromCppDefines());
- return new (graph->GetArena())
- mips64::CodeGeneratorMIPS64(graph, *features_mips64.get(), compiler_options);
-}
-#endif
-
// Return all combinations of ISA and code generator that are executable on
// hardware, or on simulator, and that we'd like to test.
static ::std::vector<CodegenTargetConfig> GetTargetConfigs() {
diff --git a/compiler/optimizing/codegen_test_utils.h b/compiler/optimizing/codegen_test_utils.h
new file mode 100644
index 0000000000..cd954043f5
--- /dev/null
+++ b/compiler/optimizing/codegen_test_utils.h
@@ -0,0 +1,355 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#ifndef ART_COMPILER_OPTIMIZING_CODEGEN_TEST_UTILS_H_
+#define ART_COMPILER_OPTIMIZING_CODEGEN_TEST_UTILS_H_
+
+#include "arch/arm/instruction_set_features_arm.h"
+#include "arch/arm/registers_arm.h"
+#include "arch/arm64/instruction_set_features_arm64.h"
+#include "arch/instruction_set.h"
+#include "arch/mips/instruction_set_features_mips.h"
+#include "arch/mips/registers_mips.h"
+#include "arch/mips64/instruction_set_features_mips64.h"
+#include "arch/mips64/registers_mips64.h"
+#include "arch/x86/instruction_set_features_x86.h"
+#include "arch/x86/registers_x86.h"
+#include "arch/x86_64/instruction_set_features_x86_64.h"
+#include "code_simulator_container.h"
+#include "common_compiler_test.h"
+#include "graph_checker.h"
+#include "prepare_for_register_allocation.h"
+#include "ssa_liveness_analysis.h"
+
+#ifdef ART_ENABLE_CODEGEN_arm
+#include "code_generator_arm.h"
+#include "code_generator_arm_vixl.h"
+#endif
+
+#ifdef ART_ENABLE_CODEGEN_arm64
+#include "code_generator_arm64.h"
+#endif
+
+#ifdef ART_ENABLE_CODEGEN_x86
+#include "code_generator_x86.h"
+#endif
+
+#ifdef ART_ENABLE_CODEGEN_x86_64
+#include "code_generator_x86_64.h"
+#endif
+
+#ifdef ART_ENABLE_CODEGEN_mips
+#include "code_generator_mips.h"
+#endif
+
+#ifdef ART_ENABLE_CODEGEN_mips64
+#include "code_generator_mips64.h"
+#endif
+
+namespace art {
+
+typedef CodeGenerator* (*CreateCodegenFn)(HGraph*, const CompilerOptions&);
+
+class CodegenTargetConfig {
+ public:
+ CodegenTargetConfig(InstructionSet isa, CreateCodegenFn create_codegen)
+ : isa_(isa), create_codegen_(create_codegen) {
+ }
+ InstructionSet GetInstructionSet() const { return isa_; }
+ CodeGenerator* CreateCodeGenerator(HGraph* graph, const CompilerOptions& compiler_options) {
+ return create_codegen_(graph, compiler_options);
+ }
+
+ private:
+ CodegenTargetConfig() {}
+ InstructionSet isa_;
+ CreateCodegenFn create_codegen_;
+};
+
+#ifdef ART_ENABLE_CODEGEN_arm
+// Provide our own codegen, that ensures the C calling conventions
+// are preserved. Currently, ART and C do not match as R4 is caller-save
+// in ART, and callee-save in C. Alternatively, we could use or write
+// the stub that saves and restores all registers, but it is easier
+// to just overwrite the code generator.
+class TestCodeGeneratorARM : public arm::CodeGeneratorARM {
+ public:
+ TestCodeGeneratorARM(HGraph* graph,
+ const ArmInstructionSetFeatures& isa_features,
+ const CompilerOptions& compiler_options)
+ : arm::CodeGeneratorARM(graph, isa_features, compiler_options) {
+ AddAllocatedRegister(Location::RegisterLocation(arm::R6));
+ AddAllocatedRegister(Location::RegisterLocation(arm::R7));
+ }
+
+ void SetupBlockedRegisters() const OVERRIDE {
+ arm::CodeGeneratorARM::SetupBlockedRegisters();
+ blocked_core_registers_[arm::R4] = true;
+ blocked_core_registers_[arm::R6] = false;
+ blocked_core_registers_[arm::R7] = false;
+ }
+};
+
+// A way to test the VIXL32-based code generator on ARM. This will replace
+// TestCodeGeneratorARM when the VIXL32-based backend replaces the existing one.
+class TestCodeGeneratorARMVIXL : public arm::CodeGeneratorARMVIXL {
+ public:
+ TestCodeGeneratorARMVIXL(HGraph* graph,
+ const ArmInstructionSetFeatures& isa_features,
+ const CompilerOptions& compiler_options)
+ : arm::CodeGeneratorARMVIXL(graph, isa_features, compiler_options) {
+ AddAllocatedRegister(Location::RegisterLocation(arm::R6));
+ AddAllocatedRegister(Location::RegisterLocation(arm::R7));
+ }
+
+ void SetupBlockedRegisters() const OVERRIDE {
+ arm::CodeGeneratorARMVIXL::SetupBlockedRegisters();
+ blocked_core_registers_[arm::R4] = true;
+ blocked_core_registers_[arm::R6] = false;
+ blocked_core_registers_[arm::R7] = false;
+ }
+};
+#endif
+
+#ifdef ART_ENABLE_CODEGEN_x86
+class TestCodeGeneratorX86 : public x86::CodeGeneratorX86 {
+ public:
+ TestCodeGeneratorX86(HGraph* graph,
+ const X86InstructionSetFeatures& isa_features,
+ const CompilerOptions& compiler_options)
+ : x86::CodeGeneratorX86(graph, isa_features, compiler_options) {
+ // Save edi, we need it for getting enough registers for long multiplication.
+ AddAllocatedRegister(Location::RegisterLocation(x86::EDI));
+ }
+
+ void SetupBlockedRegisters() const OVERRIDE {
+ x86::CodeGeneratorX86::SetupBlockedRegisters();
+ // ebx is a callee-save register in C, but caller-save for ART.
+ blocked_core_registers_[x86::EBX] = true;
+
+ // Make edi available.
+ blocked_core_registers_[x86::EDI] = false;
+ }
+};
+#endif
+
+class InternalCodeAllocator : public CodeAllocator {
+ public:
+ InternalCodeAllocator() : size_(0) { }
+
+ virtual uint8_t* Allocate(size_t size) {
+ size_ = size;
+ memory_.reset(new uint8_t[size]);
+ return memory_.get();
+ }
+
+ size_t GetSize() const { return size_; }
+ uint8_t* GetMemory() const { return memory_.get(); }
+
+ private:
+ size_t size_;
+ std::unique_ptr<uint8_t[]> memory_;
+
+ DISALLOW_COPY_AND_ASSIGN(InternalCodeAllocator);
+};
+
+static bool CanExecuteOnHardware(InstructionSet target_isa) {
+ return (target_isa == kRuntimeISA)
+ // Handle the special case of ARM, with two instructions sets (ARM32 and Thumb-2).
+ || (kRuntimeISA == kArm && target_isa == kThumb2);
+}
+
+static bool CanExecute(InstructionSet target_isa) {
+ CodeSimulatorContainer simulator(target_isa);
+ return CanExecuteOnHardware(target_isa) || simulator.CanSimulate();
+}
+
+template <typename Expected>
+inline static Expected SimulatorExecute(CodeSimulator* simulator, Expected (*f)());
+
+template <>
+inline bool SimulatorExecute<bool>(CodeSimulator* simulator, bool (*f)()) {
+ simulator->RunFrom(reinterpret_cast<intptr_t>(f));
+ return simulator->GetCReturnBool();
+}
+
+template <>
+inline int32_t SimulatorExecute<int32_t>(CodeSimulator* simulator, int32_t (*f)()) {
+ simulator->RunFrom(reinterpret_cast<intptr_t>(f));
+ return simulator->GetCReturnInt32();
+}
+
+template <>
+inline int64_t SimulatorExecute<int64_t>(CodeSimulator* simulator, int64_t (*f)()) {
+ simulator->RunFrom(reinterpret_cast<intptr_t>(f));
+ return simulator->GetCReturnInt64();
+}
+
+template <typename Expected>
+static void VerifyGeneratedCode(InstructionSet target_isa,
+ Expected (*f)(),
+ bool has_result,
+ Expected expected) {
+ ASSERT_TRUE(CanExecute(target_isa)) << "Target isa is not executable.";
+
+ // Verify on simulator.
+ CodeSimulatorContainer simulator(target_isa);
+ if (simulator.CanSimulate()) {
+ Expected result = SimulatorExecute<Expected>(simulator.Get(), f);
+ if (has_result) {
+ ASSERT_EQ(expected, result);
+ }
+ }
+
+ // Verify on hardware.
+ if (CanExecuteOnHardware(target_isa)) {
+ Expected result = f();
+ if (has_result) {
+ ASSERT_EQ(expected, result);
+ }
+ }
+}
+
+template <typename Expected>
+static void Run(const InternalCodeAllocator& allocator,
+ const CodeGenerator& codegen,
+ bool has_result,
+ Expected expected) {
+ InstructionSet target_isa = codegen.GetInstructionSet();
+
+ typedef Expected (*fptr)();
+ CommonCompilerTest::MakeExecutable(allocator.GetMemory(), allocator.GetSize());
+ fptr f = reinterpret_cast<fptr>(allocator.GetMemory());
+ if (target_isa == kThumb2) {
+ // For thumb we need the bottom bit set.
+ f = reinterpret_cast<fptr>(reinterpret_cast<uintptr_t>(f) + 1);
+ }
+ VerifyGeneratedCode(target_isa, f, has_result, expected);
+}
+
+static void ValidateGraph(HGraph* graph) {
+ GraphChecker graph_checker(graph);
+ graph_checker.Run();
+ if (!graph_checker.IsValid()) {
+ for (const auto& error : graph_checker.GetErrors()) {
+ std::cout << error << std::endl;
+ }
+ }
+ ASSERT_TRUE(graph_checker.IsValid());
+}
+
+template <typename Expected>
+static void RunCodeNoCheck(CodeGenerator* codegen,
+ HGraph* graph,
+ const std::function<void(HGraph*)>& hook_before_codegen,
+ bool has_result,
+ Expected expected) {
+ SsaLivenessAnalysis liveness(graph, codegen);
+ PrepareForRegisterAllocation(graph).Run();
+ liveness.Analyze();
+ RegisterAllocator::Create(graph->GetArena(), codegen, liveness)->AllocateRegisters();
+ hook_before_codegen(graph);
+ InternalCodeAllocator allocator;
+ codegen->Compile(&allocator);
+ Run(allocator, *codegen, has_result, expected);
+}
+
+template <typename Expected>
+static void RunCode(CodeGenerator* codegen,
+ HGraph* graph,
+ std::function<void(HGraph*)> hook_before_codegen,
+ bool has_result,
+ Expected expected) {
+ ValidateGraph(graph);
+ RunCodeNoCheck(codegen, graph, hook_before_codegen, has_result, expected);
+}
+
+template <typename Expected>
+static void RunCode(CodegenTargetConfig target_config,
+ HGraph* graph,
+ std::function<void(HGraph*)> hook_before_codegen,
+ bool has_result,
+ Expected expected) {
+ CompilerOptions compiler_options;
+ std::unique_ptr<CodeGenerator> codegen(target_config.CreateCodeGenerator(graph, compiler_options));
+ RunCode(codegen.get(), graph, hook_before_codegen, has_result, expected);
+}
+
+#ifdef ART_ENABLE_CODEGEN_arm
+CodeGenerator* create_codegen_arm(HGraph* graph, const CompilerOptions& compiler_options) {
+ std::unique_ptr<const ArmInstructionSetFeatures> features_arm(
+ ArmInstructionSetFeatures::FromCppDefines());
+ return new (graph->GetArena()) TestCodeGeneratorARM(graph,
+ *features_arm.get(),
+ compiler_options);
+}
+
+CodeGenerator* create_codegen_arm_vixl32(HGraph* graph, const CompilerOptions& compiler_options) {
+ std::unique_ptr<const ArmInstructionSetFeatures> features_arm(
+ ArmInstructionSetFeatures::FromCppDefines());
+ return new (graph->GetArena())
+ TestCodeGeneratorARMVIXL(graph, *features_arm.get(), compiler_options);
+}
+#endif
+
+#ifdef ART_ENABLE_CODEGEN_arm64
+CodeGenerator* create_codegen_arm64(HGraph* graph, const CompilerOptions& compiler_options) {
+ std::unique_ptr<const Arm64InstructionSetFeatures> features_arm64(
+ Arm64InstructionSetFeatures::FromCppDefines());
+ return new (graph->GetArena()) arm64::CodeGeneratorARM64(graph,
+ *features_arm64.get(),
+ compiler_options);
+}
+#endif
+
+#ifdef ART_ENABLE_CODEGEN_x86
+CodeGenerator* create_codegen_x86(HGraph* graph, const CompilerOptions& compiler_options) {
+ std::unique_ptr<const X86InstructionSetFeatures> features_x86(
+ X86InstructionSetFeatures::FromCppDefines());
+ return new (graph->GetArena()) TestCodeGeneratorX86(graph, *features_x86.get(), compiler_options);
+}
+#endif
+
+#ifdef ART_ENABLE_CODEGEN_x86_64
+CodeGenerator* create_codegen_x86_64(HGraph* graph, const CompilerOptions& compiler_options) {
+ std::unique_ptr<const X86_64InstructionSetFeatures> features_x86_64(
+ X86_64InstructionSetFeatures::FromCppDefines());
+ return new (graph->GetArena())
+ x86_64::CodeGeneratorX86_64(graph, *features_x86_64.get(), compiler_options);
+}
+#endif
+
+#ifdef ART_ENABLE_CODEGEN_mips
+CodeGenerator* create_codegen_mips(HGraph* graph, const CompilerOptions& compiler_options) {
+ std::unique_ptr<const MipsInstructionSetFeatures> features_mips(
+ MipsInstructionSetFeatures::FromCppDefines());
+ return new (graph->GetArena())
+ mips::CodeGeneratorMIPS(graph, *features_mips.get(), compiler_options);
+}
+#endif
+
+#ifdef ART_ENABLE_CODEGEN_mips64
+CodeGenerator* create_codegen_mips64(HGraph* graph, const CompilerOptions& compiler_options) {
+ std::unique_ptr<const Mips64InstructionSetFeatures> features_mips64(
+ Mips64InstructionSetFeatures::FromCppDefines());
+ return new (graph->GetArena())
+ mips64::CodeGeneratorMIPS64(graph, *features_mips64.get(), compiler_options);
+}
+#endif
+
+} // namespace art
+
+#endif // ART_COMPILER_OPTIMIZING_CODEGEN_TEST_UTILS_H_
diff --git a/compiler/optimizing/common_arm.h b/compiler/optimizing/common_arm.h
index 21c3ae628a..ecb86875d6 100644
--- a/compiler/optimizing/common_arm.h
+++ b/compiler/optimizing/common_arm.h
@@ -146,6 +146,12 @@ inline vixl::aarch32::Register InputRegister(HInstruction* instr) {
return InputRegisterAt(instr, 0);
}
+inline vixl::aarch32::DRegister DRegisterFromS(vixl::aarch32::SRegister s) {
+ vixl::aarch32::DRegister d = vixl::aarch32::DRegister(s.GetCode() / 2);
+ DCHECK(s.Is(d.GetLane(0)) || s.Is(d.GetLane(1)));
+ return d;
+}
+
inline int32_t Int32ConstantFrom(HInstruction* instr) {
if (instr->IsIntConstant()) {
return instr->AsIntConstant()->GetValue();
diff --git a/compiler/optimizing/induction_var_range.cc b/compiler/optimizing/induction_var_range.cc
index 3973985338..5539413aad 100644
--- a/compiler/optimizing/induction_var_range.cc
+++ b/compiler/optimizing/induction_var_range.cc
@@ -57,14 +57,18 @@ static bool IsIntAndGet(HInstruction* instruction, int64_t* value) {
return false;
}
-/** Returns b^e for b,e >= 1. */
-static int64_t IntPow(int64_t b, int64_t e) {
+/** Returns b^e for b,e >= 1. Sets overflow if arithmetic wrap-around occurred. */
+static int64_t IntPow(int64_t b, int64_t e, /*out*/ bool* overflow) {
DCHECK_GE(b, 1);
DCHECK_GE(e, 1);
int64_t pow = 1;
while (e) {
if (e & 1) {
+ int64_t oldpow = pow;
pow *= b;
+ if (pow < oldpow) {
+ *overflow = true;
+ }
}
e >>= 1;
b *= b;
@@ -1020,20 +1024,27 @@ bool InductionVarRange::GenerateLastValueGeometric(HInductionVarAnalysis::Induct
HInstruction* opb = nullptr;
if (GenerateCode(info->op_a, nullptr, graph, block, &opa, false, false) &&
GenerateCode(info->op_b, nullptr, graph, block, &opb, false, false)) {
- // Compute f ^ m for known maximum index value m.
- int64_t fpow = IntPow(f, m);
if (graph != nullptr) {
- DCHECK(info->operation == HInductionVarAnalysis::kMul ||
- info->operation == HInductionVarAnalysis::kDiv);
Primitive::Type type = info->type;
+ // Compute f ^ m for known maximum index value m.
+ bool overflow = false;
+ int64_t fpow = IntPow(f, m, &overflow);
+ if (info->operation == HInductionVarAnalysis::kDiv) {
+ // For division, any overflow truncates to zero.
+ if (overflow || (type != Primitive::kPrimLong && !CanLongValueFitIntoInt(fpow))) {
+ fpow = 0;
+ }
+ } else if (type != Primitive::kPrimLong) {
+ // For multiplication, okay to truncate to required precision.
+ DCHECK(info->operation == HInductionVarAnalysis::kMul);
+ fpow = static_cast<int32_t>(fpow);
+ }
+ // Generate code.
if (fpow == 0) {
// Special case: repeated mul/div always yields zero.
*result = graph->GetConstant(type, 0);
} else {
// Last value: a * f ^ m + b or a * f ^ -m + b.
- if (type != Primitive::kPrimLong) {
- fpow = static_cast<int32_t>(fpow); // okay to truncate
- }
HInstruction* e = nullptr;
if (info->operation == HInductionVarAnalysis::kMul) {
e = new (graph->GetArena()) HMul(type, opa, graph->GetConstant(type, fpow));
diff --git a/compiler/optimizing/inliner.cc b/compiler/optimizing/inliner.cc
index 22f0646fd0..7772e8f973 100644
--- a/compiler/optimizing/inliner.cc
+++ b/compiler/optimizing/inliner.cc
@@ -198,9 +198,9 @@ static uint32_t FindMethodIndexIn(ArtMethod* method,
}
static dex::TypeIndex FindClassIndexIn(mirror::Class* cls,
- const DexCompilationUnit& compilation_unit)
+ const DexFile& dex_file,
+ Handle<mirror::DexCache> dex_cache)
REQUIRES_SHARED(Locks::mutator_lock_) {
- const DexFile& dex_file = *compilation_unit.GetDexFile();
dex::TypeIndex index;
if (cls->GetDexCache() == nullptr) {
DCHECK(cls->IsArrayClass()) << cls->PrettyClass();
@@ -209,19 +209,22 @@ static dex::TypeIndex FindClassIndexIn(mirror::Class* cls,
DCHECK(cls->IsProxyClass()) << cls->PrettyClass();
// TODO: deal with proxy classes.
} else if (IsSameDexFile(cls->GetDexFile(), dex_file)) {
- DCHECK_EQ(cls->GetDexCache(), compilation_unit.GetDexCache().Get());
+ DCHECK_EQ(cls->GetDexCache(), dex_cache.Get());
index = cls->GetDexTypeIndex();
+ // Update the dex cache to ensure the class is in. The generated code will
+ // consider it is. We make it safe by updating the dex cache, as other
+ // dex files might also load the class, and there is no guarantee the dex
+ // cache of the dex file of the class will be updated.
+ if (dex_cache->GetResolvedType(index) == nullptr) {
+ dex_cache->SetResolvedType(index, cls);
+ }
} else {
index = cls->FindTypeIndexInOtherDexFile(dex_file);
- // We cannot guarantee the entry will resolve to the same class,
+ // We cannot guarantee the entry in the dex cache will resolve to the same class,
// as there may be different class loaders. So only return the index if it's
- // the right class already resolved with the class loader.
- if (index.IsValid()) {
- ObjPtr<mirror::Class> resolved = ClassLinker::LookupResolvedType(
- index, compilation_unit.GetDexCache().Get(), compilation_unit.GetClassLoader().Get());
- if (resolved != cls) {
- index = dex::TypeIndex::Invalid();
- }
+ // the right class in the dex cache already.
+ if (index.IsValid() && dex_cache->GetResolvedType(index) != cls) {
+ index = dex::TypeIndex::Invalid();
}
}
@@ -448,8 +451,9 @@ bool HInliner::TryInlineMonomorphicCall(HInvoke* invoke_instruction,
DCHECK(invoke_instruction->IsInvokeVirtual() || invoke_instruction->IsInvokeInterface())
<< invoke_instruction->DebugName();
+ const DexFile& caller_dex_file = *caller_compilation_unit_.GetDexFile();
dex::TypeIndex class_index = FindClassIndexIn(
- GetMonomorphicType(classes), caller_compilation_unit_);
+ GetMonomorphicType(classes), caller_dex_file, caller_compilation_unit_.GetDexCache());
if (!class_index.IsValid()) {
VLOG(compiler) << "Call to " << ArtMethod::PrettyMethod(resolved_method)
<< " from inline cache is not inlined because its class is not"
@@ -492,7 +496,6 @@ bool HInliner::TryInlineMonomorphicCall(HInvoke* invoke_instruction,
// Run type propagation to get the guard typed, and eventually propagate the
// type of the receiver.
ReferenceTypePropagation rtp_fixup(graph_,
- outer_compilation_unit_.GetClassLoader(),
outer_compilation_unit_.GetDexCache(),
handles_,
/* is_first_run */ false);
@@ -583,6 +586,7 @@ bool HInliner::TryInlinePolymorphicCall(HInvoke* invoke_instruction,
ClassLinker* class_linker = caller_compilation_unit_.GetClassLinker();
PointerSize pointer_size = class_linker->GetImagePointerSize();
+ const DexFile& caller_dex_file = *caller_compilation_unit_.GetDexFile();
bool all_targets_inlined = true;
bool one_target_inlined = false;
@@ -604,7 +608,8 @@ bool HInliner::TryInlinePolymorphicCall(HInvoke* invoke_instruction,
HInstruction* cursor = invoke_instruction->GetPrevious();
HBasicBlock* bb_cursor = invoke_instruction->GetBlock();
- dex::TypeIndex class_index = FindClassIndexIn(handle.Get(), caller_compilation_unit_);
+ dex::TypeIndex class_index = FindClassIndexIn(
+ handle.Get(), caller_dex_file, caller_compilation_unit_.GetDexCache());
HInstruction* return_replacement = nullptr;
if (!class_index.IsValid() ||
!TryBuildAndInline(invoke_instruction,
@@ -660,7 +665,6 @@ bool HInliner::TryInlinePolymorphicCall(HInvoke* invoke_instruction,
// Run type propagation to get the guards typed.
ReferenceTypePropagation rtp_fixup(graph_,
- outer_compilation_unit_.GetClassLoader(),
outer_compilation_unit_.GetDexCache(),
handles_,
/* is_first_run */ false);
@@ -855,7 +859,6 @@ bool HInliner::TryInlinePolymorphicCallToSameTarget(
// Run type propagation to get the guard typed.
ReferenceTypePropagation rtp_fixup(graph_,
- outer_compilation_unit_.GetClassLoader(),
outer_compilation_unit_.GetDexCache(),
handles_,
/* is_first_run */ false);
@@ -924,7 +927,6 @@ bool HInliner::TryInlineAndReplace(HInvoke* invoke_instruction,
// Actual return value has a more specific type than the method's declared
// return type. Run RTP again on the outer graph to propagate it.
ReferenceTypePropagation(graph_,
- outer_compilation_unit_.GetClassLoader(),
outer_compilation_unit_.GetDexCache(),
handles_,
/* is_first_run */ false).Run();
@@ -1177,11 +1179,7 @@ HInstanceFieldGet* HInliner::CreateInstanceFieldGet(Handle<mirror::DexCache> dex
/* dex_pc */ 0);
if (iget->GetType() == Primitive::kPrimNot) {
// Use the same dex_cache that we used for field lookup as the hint_dex_cache.
- ReferenceTypePropagation rtp(graph_,
- outer_compilation_unit_.GetClassLoader(),
- dex_cache,
- handles_,
- /* is_first_run */ false);
+ ReferenceTypePropagation rtp(graph_, dex_cache, handles_, /* is_first_run */ false);
rtp.Visit(iget);
}
return iget;
@@ -1227,7 +1225,7 @@ bool HInliner::TryBuildAndInlineHelper(HInvoke* invoke_instruction,
resolved_method->GetDeclaringClass()->GetClassLoader()));
DexCompilationUnit dex_compilation_unit(
- class_loader,
+ class_loader.ToJObject(),
class_linker,
callee_dex_file,
code_item,
@@ -1343,7 +1341,6 @@ bool HInliner::TryBuildAndInlineHelper(HInvoke* invoke_instruction,
// are more specific than the declared ones, run RTP again on the inner graph.
if (run_rtp || ArgumentTypesMoreSpecific(invoke_instruction, resolved_method)) {
ReferenceTypePropagation(callee_graph,
- outer_compilation_unit_.GetClassLoader(),
dex_compilation_unit.GetDexCache(),
handles_,
/* is_first_run */ false).Run();
diff --git a/compiler/optimizing/instruction_builder.cc b/compiler/optimizing/instruction_builder.cc
index 3d911d77ba..cac385ce3c 100644
--- a/compiler/optimizing/instruction_builder.cc
+++ b/compiler/optimizing/instruction_builder.cc
@@ -668,10 +668,11 @@ static InvokeType GetInvokeTypeFromOpCode(Instruction::Code opcode) {
ArtMethod* HInstructionBuilder::ResolveMethod(uint16_t method_idx, InvokeType invoke_type) {
ScopedObjectAccess soa(Thread::Current());
- StackHandleScope<2> hs(soa.Self());
+ StackHandleScope<3> hs(soa.Self());
ClassLinker* class_linker = dex_compilation_unit_->GetClassLinker();
- Handle<mirror::ClassLoader> class_loader = dex_compilation_unit_->GetClassLoader();
+ Handle<mirror::ClassLoader> class_loader(hs.NewHandle(
+ soa.Decode<mirror::ClassLoader>(dex_compilation_unit_->GetClassLoader())));
Handle<mirror::Class> compiling_class(hs.NewHandle(GetCompilingClass()));
// We fetch the referenced class eagerly (that is, the class pointed by in the MethodId
// at method_idx), as `CanAccessResolvedMethod` expects it be be in the dex cache.
@@ -1283,7 +1284,9 @@ bool HInstructionBuilder::BuildInstanceFieldAccess(const Instruction& instructio
static mirror::Class* GetClassFrom(CompilerDriver* driver,
const DexCompilationUnit& compilation_unit) {
ScopedObjectAccess soa(Thread::Current());
- Handle<mirror::ClassLoader> class_loader = compilation_unit.GetClassLoader();
+ StackHandleScope<1> hs(soa.Self());
+ Handle<mirror::ClassLoader> class_loader(hs.NewHandle(
+ soa.Decode<mirror::ClassLoader>(compilation_unit.GetClassLoader())));
Handle<mirror::DexCache> dex_cache = compilation_unit.GetDexCache();
return driver->ResolveCompilingMethodsClass(soa, dex_cache, class_loader, &compilation_unit);
@@ -1299,9 +1302,10 @@ mirror::Class* HInstructionBuilder::GetCompilingClass() const {
bool HInstructionBuilder::IsOutermostCompilingClass(dex::TypeIndex type_index) const {
ScopedObjectAccess soa(Thread::Current());
- StackHandleScope<2> hs(soa.Self());
+ StackHandleScope<3> hs(soa.Self());
Handle<mirror::DexCache> dex_cache = dex_compilation_unit_->GetDexCache();
- Handle<mirror::ClassLoader> class_loader = dex_compilation_unit_->GetClassLoader();
+ Handle<mirror::ClassLoader> class_loader(hs.NewHandle(
+ soa.Decode<mirror::ClassLoader>(dex_compilation_unit_->GetClassLoader())));
Handle<mirror::Class> cls(hs.NewHandle(compiler_driver_->ResolveClass(
soa, dex_cache, class_loader, type_index, dex_compilation_unit_)));
Handle<mirror::Class> outer_class(hs.NewHandle(GetOutermostCompilingClass()));
@@ -1339,8 +1343,10 @@ bool HInstructionBuilder::BuildStaticFieldAccess(const Instruction& instruction,
uint16_t field_index = instruction.VRegB_21c();
ScopedObjectAccess soa(Thread::Current());
+ StackHandleScope<3> hs(soa.Self());
Handle<mirror::DexCache> dex_cache = dex_compilation_unit_->GetDexCache();
- Handle<mirror::ClassLoader> class_loader = dex_compilation_unit_->GetClassLoader();
+ Handle<mirror::ClassLoader> class_loader(hs.NewHandle(
+ soa.Decode<mirror::ClassLoader>(dex_compilation_unit_->GetClassLoader())));
ArtField* resolved_field = compiler_driver_->ResolveField(
soa, dex_cache, class_loader, dex_compilation_unit_, field_index, true);
@@ -1351,7 +1357,6 @@ bool HInstructionBuilder::BuildStaticFieldAccess(const Instruction& instruction,
return true;
}
- StackHandleScope<2> hs(soa.Self());
Primitive::Type field_type = resolved_field->GetTypeAsPrimitiveType();
Handle<mirror::DexCache> outer_dex_cache = outer_compilation_unit_->GetDexCache();
Handle<mirror::Class> outer_class(hs.NewHandle(GetOutermostCompilingClass()));
@@ -1630,7 +1635,9 @@ HLoadClass* HInstructionBuilder::BuildLoadClass(dex::TypeIndex type_index,
const DexCompilationUnit* compilation_unit =
outer ? outer_compilation_unit_ : dex_compilation_unit_;
const DexFile& dex_file = *compilation_unit->GetDexFile();
- Handle<mirror::ClassLoader> class_loader = dex_compilation_unit_->GetClassLoader();
+ StackHandleScope<1> hs(soa.Self());
+ Handle<mirror::ClassLoader> class_loader(hs.NewHandle(
+ soa.Decode<mirror::ClassLoader>(dex_compilation_unit_->GetClassLoader())));
Handle<mirror::Class> klass = handles_->NewHandle(compiler_driver_->ResolveClass(
soa, compilation_unit->GetDexCache(), class_loader, type_index, compilation_unit));
@@ -1685,9 +1692,17 @@ void HInstructionBuilder::BuildTypeCheck(const Instruction& instruction,
}
}
-bool HInstructionBuilder::NeedsAccessCheck(dex::TypeIndex type_index, bool* finalizable) const {
+bool HInstructionBuilder::NeedsAccessCheck(dex::TypeIndex type_index,
+ Handle<mirror::DexCache> dex_cache,
+ bool* finalizable) const {
return !compiler_driver_->CanAccessInstantiableTypeWithoutChecks(
- LookupReferrerClass(), LookupResolvedType(type_index, *dex_compilation_unit_), finalizable);
+ dex_compilation_unit_->GetDexMethodIndex(), dex_cache, type_index, finalizable);
+}
+
+bool HInstructionBuilder::NeedsAccessCheck(dex::TypeIndex type_index, bool* finalizable) const {
+ ScopedObjectAccess soa(Thread::Current());
+ Handle<mirror::DexCache> dex_cache = dex_compilation_unit_->GetDexCache();
+ return NeedsAccessCheck(type_index, dex_cache, finalizable);
}
bool HInstructionBuilder::CanDecodeQuickenedInfo() const {
@@ -2727,18 +2742,4 @@ bool HInstructionBuilder::ProcessDexInstruction(const Instruction& instruction,
return true;
} // NOLINT(readability/fn_size)
-ObjPtr<mirror::Class> HInstructionBuilder::LookupResolvedType(
- dex::TypeIndex type_index,
- const DexCompilationUnit& compilation_unit) const {
- return ClassLinker::LookupResolvedType(
- type_index, compilation_unit.GetDexCache().Get(), compilation_unit.GetClassLoader().Get());
-}
-
-ObjPtr<mirror::Class> HInstructionBuilder::LookupReferrerClass() const {
- // TODO: Cache the result in a Handle<mirror::Class>.
- const DexFile::MethodId& method_id =
- dex_compilation_unit_->GetDexFile()->GetMethodId(dex_compilation_unit_->GetDexMethodIndex());
- return LookupResolvedType(method_id.class_idx_, *dex_compilation_unit_);
-}
-
} // namespace art
diff --git a/compiler/optimizing/instruction_builder.h b/compiler/optimizing/instruction_builder.h
index 6e3b078dbb..5efe95094c 100644
--- a/compiler/optimizing/instruction_builder.h
+++ b/compiler/optimizing/instruction_builder.h
@@ -103,8 +103,11 @@ class HInstructionBuilder : public ValueObject {
// Returns whether the current method needs access check for the type.
// Output parameter finalizable is set to whether the type is finalizable.
- bool NeedsAccessCheck(dex::TypeIndex type_index, /*out*/bool* finalizable) const
+ bool NeedsAccessCheck(dex::TypeIndex type_index,
+ Handle<mirror::DexCache> dex_cache,
+ /*out*/bool* finalizable) const
REQUIRES_SHARED(Locks::mutator_lock_);
+ bool NeedsAccessCheck(dex::TypeIndex type_index, /*out*/bool* finalizable) const;
template<typename T>
void Unop_12x(const Instruction& instruction, Primitive::Type type, uint32_t dex_pc);
@@ -287,12 +290,6 @@ class HInstructionBuilder : public ValueObject {
// not be resolved.
ArtMethod* ResolveMethod(uint16_t method_idx, InvokeType invoke_type);
- ObjPtr<mirror::Class> LookupResolvedType(dex::TypeIndex type_index,
- const DexCompilationUnit& compilation_unit) const
- REQUIRES_SHARED(Locks::mutator_lock_);
-
- ObjPtr<mirror::Class> LookupReferrerClass() const REQUIRES_SHARED(Locks::mutator_lock_);
-
ArenaAllocator* const arena_;
HGraph* const graph_;
VariableSizedHandleScope* handles_;
diff --git a/compiler/optimizing/intrinsics.h b/compiler/optimizing/intrinsics.h
index 1e73cf67df..6425e1313f 100644
--- a/compiler/optimizing/intrinsics.h
+++ b/compiler/optimizing/intrinsics.h
@@ -31,6 +31,9 @@ class DexFile;
static constexpr uint32_t kPositiveInfinityFloat = 0x7f800000U;
static constexpr uint64_t kPositiveInfinityDouble = UINT64_C(0x7ff0000000000000);
+static constexpr uint32_t kNanFloat = 0x7fc00000U;
+static constexpr uint64_t kNanDouble = 0x7ff8000000000000;
+
// Recognize intrinsics from HInvoke nodes.
class IntrinsicsRecognizer : public HOptimization {
public:
diff --git a/compiler/optimizing/intrinsics_arm_vixl.cc b/compiler/optimizing/intrinsics_arm_vixl.cc
index 1a10173ed7..70a3d38c13 100644
--- a/compiler/optimizing/intrinsics_arm_vixl.cc
+++ b/compiler/optimizing/intrinsics_arm_vixl.cc
@@ -40,10 +40,12 @@ using helpers::LocationFrom;
using helpers::LowRegisterFrom;
using helpers::LowSRegisterFrom;
using helpers::OutputDRegister;
+using helpers::OutputSRegister;
using helpers::OutputRegister;
using helpers::OutputVRegister;
using helpers::RegisterFrom;
using helpers::SRegisterFrom;
+using helpers::DRegisterFromS;
using namespace vixl::aarch32; // NOLINT(build/namespaces)
@@ -462,6 +464,214 @@ void IntrinsicCodeGeneratorARMVIXL::VisitMathAbsLong(HInvoke* invoke) {
GenAbsInteger(invoke->GetLocations(), /* is64bit */ true, GetAssembler());
}
+static void GenMinMaxFloat(HInvoke* invoke, bool is_min, ArmVIXLAssembler* assembler) {
+ Location op1_loc = invoke->GetLocations()->InAt(0);
+ Location op2_loc = invoke->GetLocations()->InAt(1);
+ Location out_loc = invoke->GetLocations()->Out();
+
+ // Optimization: don't generate any code if inputs are the same.
+ if (op1_loc.Equals(op2_loc)) {
+ DCHECK(out_loc.Equals(op1_loc)); // out_loc is set as SameAsFirstInput() in location builder.
+ return;
+ }
+
+ vixl32::SRegister op1 = SRegisterFrom(op1_loc);
+ vixl32::SRegister op2 = SRegisterFrom(op2_loc);
+ vixl32::SRegister out = OutputSRegister(invoke);
+ UseScratchRegisterScope temps(assembler->GetVIXLAssembler());
+ const vixl32::Register temp1 = temps.Acquire();
+ vixl32::Register temp2 = RegisterFrom(invoke->GetLocations()->GetTemp(0));
+ vixl32::Label nan, done;
+
+ DCHECK(op1.Is(out));
+
+ __ Vcmp(op1, op2);
+ __ Vmrs(RegisterOrAPSR_nzcv(kPcCode), FPSCR);
+ __ B(vs, &nan, /* far_target */ false); // if un-ordered, go to NaN handling.
+
+ // op1 <> op2
+ vixl32::ConditionType cond = is_min ? gt : lt;
+ {
+ ExactAssemblyScope it_scope(assembler->GetVIXLAssembler(),
+ 2 * kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
+ __ it(cond);
+ __ vmov(cond, F32, out, op2);
+ }
+ __ B(ne, &done, /* far_target */ false); // for <>(not equal), we've done min/max calculation.
+
+ // handle op1 == op2, max(+0.0,-0.0), min(+0.0,-0.0).
+ __ Vmov(temp1, op1);
+ __ Vmov(temp2, op2);
+ if (is_min) {
+ __ Orr(temp1, temp1, temp2);
+ } else {
+ __ And(temp1, temp1, temp2);
+ }
+ __ Vmov(out, temp1);
+ __ B(&done);
+
+ // handle NaN input.
+ __ Bind(&nan);
+ __ Movt(temp1, High16Bits(kNanFloat)); // 0x7FC0xxxx is a NaN.
+ __ Vmov(out, temp1);
+
+ __ Bind(&done);
+}
+
+static void CreateFPFPToFPLocations(ArenaAllocator* arena, HInvoke* invoke) {
+ LocationSummary* locations = new (arena) LocationSummary(invoke,
+ LocationSummary::kNoCall,
+ kIntrinsified);
+ locations->SetInAt(0, Location::RequiresFpuRegister());
+ locations->SetInAt(1, Location::RequiresFpuRegister());
+ locations->SetOut(Location::SameAsFirstInput());
+}
+
+void IntrinsicLocationsBuilderARMVIXL::VisitMathMinFloatFloat(HInvoke* invoke) {
+ CreateFPFPToFPLocations(arena_, invoke);
+ invoke->GetLocations()->AddTemp(Location::RequiresRegister());
+}
+
+void IntrinsicCodeGeneratorARMVIXL::VisitMathMinFloatFloat(HInvoke* invoke) {
+ GenMinMaxFloat(invoke, /* is_min */ true, GetAssembler());
+}
+
+void IntrinsicLocationsBuilderARMVIXL::VisitMathMaxFloatFloat(HInvoke* invoke) {
+ CreateFPFPToFPLocations(arena_, invoke);
+ invoke->GetLocations()->AddTemp(Location::RequiresRegister());
+}
+
+void IntrinsicCodeGeneratorARMVIXL::VisitMathMaxFloatFloat(HInvoke* invoke) {
+ GenMinMaxFloat(invoke, /* is_min */ false, GetAssembler());
+}
+
+static void GenMinMaxDouble(HInvoke* invoke, bool is_min, ArmVIXLAssembler* assembler) {
+ Location op1_loc = invoke->GetLocations()->InAt(0);
+ Location op2_loc = invoke->GetLocations()->InAt(1);
+ Location out_loc = invoke->GetLocations()->Out();
+
+ // Optimization: don't generate any code if inputs are the same.
+ if (op1_loc.Equals(op2_loc)) {
+ DCHECK(out_loc.Equals(op1_loc)); // out_loc is set as SameAsFirstInput() in.
+ return;
+ }
+
+ vixl32::DRegister op1 = DRegisterFrom(op1_loc);
+ vixl32::DRegister op2 = DRegisterFrom(op2_loc);
+ vixl32::DRegister out = OutputDRegister(invoke);
+ vixl32::Label handle_nan_eq, done;
+
+ DCHECK(op1.Is(out));
+
+ __ Vcmp(op1, op2);
+ __ Vmrs(RegisterOrAPSR_nzcv(kPcCode), FPSCR);
+ __ B(vs, &handle_nan_eq, /* far_target */ false); // if un-ordered, go to NaN handling.
+
+ // op1 <> op2
+ vixl32::ConditionType cond = is_min ? gt : lt;
+ {
+ ExactAssemblyScope it_scope(assembler->GetVIXLAssembler(),
+ 2 * kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
+ __ it(cond);
+ __ vmov(cond, F64, out, op2);
+ }
+ __ B(ne, &done, /* far_target */ false); // for <>(not equal), we've done min/max calculation.
+
+ // handle op1 == op2, max(+0.0,-0.0).
+ if (!is_min) {
+ __ Vand(F64, out, op1, op2);
+ __ B(&done);
+ }
+
+ // handle op1 == op2, min(+0.0,-0.0), NaN input.
+ __ Bind(&handle_nan_eq);
+ __ Vorr(F64, out, op1, op2); // assemble op1/-0.0/NaN.
+
+ __ Bind(&done);
+}
+
+void IntrinsicLocationsBuilderARMVIXL::VisitMathMinDoubleDouble(HInvoke* invoke) {
+ CreateFPFPToFPLocations(arena_, invoke);
+}
+
+void IntrinsicCodeGeneratorARMVIXL::VisitMathMinDoubleDouble(HInvoke* invoke) {
+ GenMinMaxDouble(invoke, /* is_min */ true , GetAssembler());
+}
+
+void IntrinsicLocationsBuilderARMVIXL::VisitMathMaxDoubleDouble(HInvoke* invoke) {
+ CreateFPFPToFPLocations(arena_, invoke);
+}
+
+void IntrinsicCodeGeneratorARMVIXL::VisitMathMaxDoubleDouble(HInvoke* invoke) {
+ GenMinMaxDouble(invoke, /* is_min */ false, GetAssembler());
+}
+
+static void GenMinMaxLong(HInvoke* invoke, bool is_min, ArmVIXLAssembler* assembler) {
+ Location op1_loc = invoke->GetLocations()->InAt(0);
+ Location op2_loc = invoke->GetLocations()->InAt(1);
+ Location out_loc = invoke->GetLocations()->Out();
+
+ // Optimization: don't generate any code if inputs are the same.
+ if (op1_loc.Equals(op2_loc)) {
+ DCHECK(out_loc.Equals(op1_loc)); // out_loc is set as SameAsFirstInput() in location builder.
+ return;
+ }
+
+ vixl32::Register op1_lo = LowRegisterFrom(op1_loc);
+ vixl32::Register op1_hi = HighRegisterFrom(op1_loc);
+ vixl32::Register op2_lo = LowRegisterFrom(op2_loc);
+ vixl32::Register op2_hi = HighRegisterFrom(op2_loc);
+ vixl32::Register out_lo = LowRegisterFrom(out_loc);
+ vixl32::Register out_hi = HighRegisterFrom(out_loc);
+ UseScratchRegisterScope temps(assembler->GetVIXLAssembler());
+ const vixl32::Register temp = temps.Acquire();
+
+ DCHECK(op1_lo.Is(out_lo));
+ DCHECK(op1_hi.Is(out_hi));
+
+ // Compare op1 >= op2, or op1 < op2.
+ __ Cmp(out_lo, op2_lo);
+ __ Sbcs(temp, out_hi, op2_hi);
+
+ // Now GE/LT condition code is correct for the long comparison.
+ {
+ vixl32::ConditionType cond = is_min ? ge : lt;
+ ExactAssemblyScope it_scope(assembler->GetVIXLAssembler(),
+ 3 * kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
+ __ itt(cond);
+ __ mov(cond, out_lo, op2_lo);
+ __ mov(cond, out_hi, op2_hi);
+ }
+}
+
+static void CreateLongLongToLongLocations(ArenaAllocator* arena, HInvoke* invoke) {
+ LocationSummary* locations = new (arena) LocationSummary(invoke,
+ LocationSummary::kNoCall,
+ kIntrinsified);
+ locations->SetInAt(0, Location::RequiresRegister());
+ locations->SetInAt(1, Location::RequiresRegister());
+ locations->SetOut(Location::SameAsFirstInput());
+}
+
+void IntrinsicLocationsBuilderARMVIXL::VisitMathMinLongLong(HInvoke* invoke) {
+ CreateLongLongToLongLocations(arena_, invoke);
+}
+
+void IntrinsicCodeGeneratorARMVIXL::VisitMathMinLongLong(HInvoke* invoke) {
+ GenMinMaxLong(invoke, /* is_min */ true, GetAssembler());
+}
+
+void IntrinsicLocationsBuilderARMVIXL::VisitMathMaxLongLong(HInvoke* invoke) {
+ CreateLongLongToLongLocations(arena_, invoke);
+}
+
+void IntrinsicCodeGeneratorARMVIXL::VisitMathMaxLongLong(HInvoke* invoke) {
+ GenMinMaxLong(invoke, /* is_min */ false, GetAssembler());
+}
+
static void GenMinMax(HInvoke* invoke, bool is_min, ArmVIXLAssembler* assembler) {
vixl32::Register op1 = InputRegisterAt(invoke, 0);
vixl32::Register op2 = InputRegisterAt(invoke, 1);
@@ -2778,12 +2988,6 @@ void IntrinsicCodeGeneratorARMVIXL::VisitMathFloor(HInvoke* invoke) {
__ Vrintm(F64, F64, OutputDRegister(invoke), InputDRegisterAt(invoke, 0));
}
-UNIMPLEMENTED_INTRINSIC(ARMVIXL, MathMinDoubleDouble)
-UNIMPLEMENTED_INTRINSIC(ARMVIXL, MathMinFloatFloat)
-UNIMPLEMENTED_INTRINSIC(ARMVIXL, MathMaxDoubleDouble)
-UNIMPLEMENTED_INTRINSIC(ARMVIXL, MathMaxFloatFloat)
-UNIMPLEMENTED_INTRINSIC(ARMVIXL, MathMinLongLong)
-UNIMPLEMENTED_INTRINSIC(ARMVIXL, MathMaxLongLong)
UNIMPLEMENTED_INTRINSIC(ARMVIXL, MathRoundDouble) // Could be done by changing rounding mode, maybe?
UNIMPLEMENTED_INTRINSIC(ARMVIXL, MathRoundFloat) // Could be done by changing rounding mode, maybe?
UNIMPLEMENTED_INTRINSIC(ARMVIXL, UnsafeCASLong) // High register pressure.
diff --git a/compiler/optimizing/nodes.cc b/compiler/optimizing/nodes.cc
index d15145e673..76900f23a9 100644
--- a/compiler/optimizing/nodes.cc
+++ b/compiler/optimizing/nodes.cc
@@ -1354,13 +1354,15 @@ std::ostream& operator<<(std::ostream& os, const HInstruction::InstructionKind&
return os;
}
-void HInstruction::MoveBefore(HInstruction* cursor) {
- DCHECK(!IsPhi());
- DCHECK(!IsControlFlow());
- DCHECK(CanBeMoved() ||
- // HShouldDeoptimizeFlag can only be moved by CHAGuardOptimization.
- IsShouldDeoptimizeFlag());
- DCHECK(!cursor->IsPhi());
+void HInstruction::MoveBefore(HInstruction* cursor, bool do_checks) {
+ if (do_checks) {
+ DCHECK(!IsPhi());
+ DCHECK(!IsControlFlow());
+ DCHECK(CanBeMoved() ||
+ // HShouldDeoptimizeFlag can only be moved by CHAGuardOptimization.
+ IsShouldDeoptimizeFlag());
+ DCHECK(!cursor->IsPhi());
+ }
next_->previous_ = previous_;
if (previous_ != nullptr) {
diff --git a/compiler/optimizing/nodes.h b/compiler/optimizing/nodes.h
index f0ea9e20e6..acf14aa726 100644
--- a/compiler/optimizing/nodes.h
+++ b/compiler/optimizing/nodes.h
@@ -2065,8 +2065,8 @@ class HInstruction : public ArenaObject<kArenaAllocInstruction> {
other->ReplaceInput(this, use_index);
}
- // Move `this` instruction before `cursor`.
- void MoveBefore(HInstruction* cursor);
+ // Move `this` instruction before `cursor`
+ void MoveBefore(HInstruction* cursor, bool do_checks = true);
// Move `this` before its first user and out of any loops. If there is no
// out-of-loop user that dominates all other users, move the instruction
diff --git a/compiler/optimizing/optimizing_compiler.cc b/compiler/optimizing/optimizing_compiler.cc
index dad87e3d9e..1ab671022b 100644
--- a/compiler/optimizing/optimizing_compiler.cc
+++ b/compiler/optimizing/optimizing_compiler.cc
@@ -90,6 +90,7 @@
#include "reference_type_propagation.h"
#include "register_allocator_linear_scan.h"
#include "select_generator.h"
+#include "scheduler.h"
#include "sharpening.h"
#include "side_effects_analysis.h"
#include "ssa_builder.h"
@@ -305,7 +306,7 @@ class OptimizingCompiler FINAL : public Compiler {
InvokeType invoke_type,
uint16_t class_def_idx,
uint32_t method_idx,
- Handle<mirror::ClassLoader> class_loader,
+ jobject class_loader,
const DexFile& dex_file,
Handle<mirror::DexCache> dex_cache) const OVERRIDE;
@@ -374,7 +375,7 @@ class OptimizingCompiler FINAL : public Compiler {
InvokeType invoke_type,
uint16_t class_def_idx,
uint32_t method_idx,
- Handle<mirror::ClassLoader> class_loader,
+ jobject class_loader,
const DexFile& dex_file,
Handle<mirror::DexCache> dex_cache,
ArtMethod* method,
@@ -658,10 +659,13 @@ void OptimizingCompiler::RunArchOptimizations(InstructionSet instruction_set,
new (arena) arm64::InstructionSimplifierArm64(graph, stats);
SideEffectsAnalysis* side_effects = new (arena) SideEffectsAnalysis(graph);
GVNOptimization* gvn = new (arena) GVNOptimization(graph, *side_effects, "GVN$after_arch");
+ HInstructionScheduling* scheduling =
+ new (arena) HInstructionScheduling(graph, instruction_set);
HOptimization* arm64_optimizations[] = {
simplifier,
side_effects,
- gvn
+ gvn,
+ scheduling,
};
RunOptimizations(arm64_optimizations, arraysize(arm64_optimizations), pass_observer);
break;
@@ -871,7 +875,7 @@ CodeGenerator* OptimizingCompiler::TryCompile(ArenaAllocator* arena,
InvokeType invoke_type,
uint16_t class_def_idx,
uint32_t method_idx,
- Handle<mirror::ClassLoader> class_loader,
+ jobject class_loader,
const DexFile& dex_file,
Handle<mirror::DexCache> dex_cache,
ArtMethod* method,
@@ -942,8 +946,11 @@ CodeGenerator* OptimizingCompiler::TryCompile(ArenaAllocator* arena,
const uint8_t* interpreter_metadata = nullptr;
if (method == nullptr) {
ScopedObjectAccess soa(Thread::Current());
+ StackHandleScope<1> hs(soa.Self());
+ Handle<mirror::ClassLoader> loader(hs.NewHandle(
+ soa.Decode<mirror::ClassLoader>(class_loader)));
method = compiler_driver->ResolveMethod(
- soa, dex_cache, class_loader, &dex_compilation_unit, method_idx, invoke_type);
+ soa, dex_cache, loader, &dex_compilation_unit, method_idx, invoke_type);
}
// For AOT compilation, we may not get a method, for example if its class is erroneous.
// JIT should always have a method.
@@ -952,6 +959,16 @@ CodeGenerator* OptimizingCompiler::TryCompile(ArenaAllocator* arena,
graph->SetArtMethod(method);
ScopedObjectAccess soa(Thread::Current());
interpreter_metadata = method->GetQuickenedInfo(class_linker->GetImagePointerSize());
+ dex::TypeIndex type_index = method->GetDeclaringClass()->GetDexTypeIndex();
+
+ // Update the dex cache if the type is not in it yet. Note that under AOT,
+ // the verifier must have set it, but under JIT, there's no guarantee, as we
+ // don't necessarily run the verifier.
+ // The compiler and the compiler driver assume the compiling class is
+ // in the dex cache.
+ if (dex_cache->GetResolvedType(type_index) == nullptr) {
+ dex_cache->SetResolvedType(type_index, method->GetDeclaringClass());
+ }
}
std::unique_ptr<CodeGenerator> codegen(
@@ -1031,7 +1048,7 @@ CompiledMethod* OptimizingCompiler::Compile(const DexFile::CodeItem* code_item,
InvokeType invoke_type,
uint16_t class_def_idx,
uint32_t method_idx,
- Handle<mirror::ClassLoader> jclass_loader,
+ jobject jclass_loader,
const DexFile& dex_file,
Handle<mirror::DexCache> dex_cache) const {
CompilerDriver* compiler_driver = GetCompilerDriver();
@@ -1126,6 +1143,7 @@ bool OptimizingCompiler::JitCompile(Thread* self,
Handle<mirror::DexCache> dex_cache(hs.NewHandle(method->GetDexCache()));
DCHECK(method->IsCompilable());
+ jobject jclass_loader = class_loader.ToJObject();
const DexFile* dex_file = method->GetDexFile();
const uint16_t class_def_idx = method->GetClassDefIndex();
const DexFile::CodeItem* code_item = dex_file->GetCodeItem(method->GetCodeItemOffset());
@@ -1149,7 +1167,7 @@ bool OptimizingCompiler::JitCompile(Thread* self,
invoke_type,
class_def_idx,
method_idx,
- class_loader,
+ jclass_loader,
*dex_file,
dex_cache,
method,
diff --git a/compiler/optimizing/optimizing_unit_test.h b/compiler/optimizing/optimizing_unit_test.h
index 58d90176cd..bf963b8996 100644
--- a/compiler/optimizing/optimizing_unit_test.h
+++ b/compiler/optimizing/optimizing_unit_test.h
@@ -64,6 +64,9 @@ LiveInterval* BuildInterval(const size_t ranges[][2],
void RemoveSuspendChecks(HGraph* graph) {
for (HBasicBlock* block : graph->GetBlocks()) {
if (block != nullptr) {
+ if (block->GetLoopInformation() != nullptr) {
+ block->GetLoopInformation()->SetSuspendCheck(nullptr);
+ }
for (HInstructionIterator it(block->GetInstructions()); !it.Done(); it.Advance()) {
HInstruction* current = it.Current();
if (current->IsSuspendCheck()) {
diff --git a/compiler/optimizing/reference_type_propagation.cc b/compiler/optimizing/reference_type_propagation.cc
index be4857a49a..b02f2509ab 100644
--- a/compiler/optimizing/reference_type_propagation.cc
+++ b/compiler/optimizing/reference_type_propagation.cc
@@ -66,13 +66,11 @@ ReferenceTypeInfo::TypeHandle ReferenceTypePropagation::HandleCache::GetThrowabl
class ReferenceTypePropagation::RTPVisitor : public HGraphDelegateVisitor {
public:
RTPVisitor(HGraph* graph,
- Handle<mirror::ClassLoader> class_loader,
Handle<mirror::DexCache> hint_dex_cache,
HandleCache* handle_cache,
ArenaVector<HInstruction*>* worklist,
bool is_first_run)
: HGraphDelegateVisitor(graph),
- class_loader_(class_loader),
hint_dex_cache_(hint_dex_cache),
handle_cache_(handle_cache),
worklist_(worklist),
@@ -104,7 +102,6 @@ class ReferenceTypePropagation::RTPVisitor : public HGraphDelegateVisitor {
bool is_exact);
private:
- Handle<mirror::ClassLoader> class_loader_;
Handle<mirror::DexCache> hint_dex_cache_;
HandleCache* handle_cache_;
ArenaVector<HInstruction*>* worklist_;
@@ -112,13 +109,11 @@ class ReferenceTypePropagation::RTPVisitor : public HGraphDelegateVisitor {
};
ReferenceTypePropagation::ReferenceTypePropagation(HGraph* graph,
- Handle<mirror::ClassLoader> class_loader,
Handle<mirror::DexCache> hint_dex_cache,
VariableSizedHandleScope* handles,
bool is_first_run,
const char* name)
: HOptimization(graph, name),
- class_loader_(class_loader),
hint_dex_cache_(hint_dex_cache),
handle_cache_(handles),
worklist_(graph->GetArena()->Adapter(kArenaAllocReferenceTypePropagation)),
@@ -153,12 +148,7 @@ void ReferenceTypePropagation::ValidateTypes() {
}
void ReferenceTypePropagation::Visit(HInstruction* instruction) {
- RTPVisitor visitor(graph_,
- class_loader_,
- hint_dex_cache_,
- &handle_cache_,
- &worklist_,
- is_first_run_);
+ RTPVisitor visitor(graph_, hint_dex_cache_, &handle_cache_, &worklist_, is_first_run_);
instruction->Accept(&visitor);
}
@@ -332,12 +322,7 @@ void ReferenceTypePropagation::Run() {
}
void ReferenceTypePropagation::VisitBasicBlock(HBasicBlock* block) {
- RTPVisitor visitor(graph_,
- class_loader_,
- hint_dex_cache_,
- &handle_cache_,
- &worklist_,
- is_first_run_);
+ RTPVisitor visitor(graph_, hint_dex_cache_, &handle_cache_, &worklist_, is_first_run_);
// Handle Phis first as there might be instructions in the same block who depend on them.
for (HInstructionIterator it(block->GetPhis()); !it.Done(); it.Advance()) {
VisitPhi(it.Current()->AsPhi());
@@ -557,10 +542,9 @@ void ReferenceTypePropagation::RTPVisitor::UpdateReferenceTypeInfo(HInstruction*
DCHECK_EQ(instr->GetType(), Primitive::kPrimNot);
ScopedObjectAccess soa(Thread::Current());
- ObjPtr<mirror::DexCache> dex_cache = FindDexCacheWithHint(soa.Self(), dex_file, hint_dex_cache_);
- ObjPtr<mirror::Class> klass =
- ClassLinker::LookupResolvedType(type_idx, dex_cache, class_loader_.Get());
- SetClassAsTypeInfo(instr, klass, is_exact);
+ mirror::DexCache* dex_cache = FindDexCacheWithHint(soa.Self(), dex_file, hint_dex_cache_);
+ // Get type from dex cache assuming it was populated by the verifier.
+ SetClassAsTypeInfo(instr, dex_cache->GetResolvedType(type_idx), is_exact);
}
void ReferenceTypePropagation::RTPVisitor::VisitNewInstance(HNewInstance* instr) {
@@ -573,13 +557,25 @@ void ReferenceTypePropagation::RTPVisitor::VisitNewArray(HNewArray* instr) {
SetClassAsTypeInfo(instr, instr->GetLoadClass()->GetClass().Get(), /* is_exact */ true);
}
+static mirror::Class* GetClassFromDexCache(Thread* self,
+ const DexFile& dex_file,
+ dex::TypeIndex type_idx,
+ Handle<mirror::DexCache> hint_dex_cache)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ mirror::DexCache* dex_cache = FindDexCacheWithHint(self, dex_file, hint_dex_cache);
+ // Get type from dex cache assuming it was populated by the verifier.
+ return dex_cache->GetResolvedType(type_idx);
+}
+
void ReferenceTypePropagation::RTPVisitor::VisitParameterValue(HParameterValue* instr) {
// We check if the existing type is valid: the inliner may have set it.
if (instr->GetType() == Primitive::kPrimNot && !instr->GetReferenceTypeInfo().IsValid()) {
- UpdateReferenceTypeInfo(instr,
- instr->GetTypeIndex(),
- instr->GetDexFile(),
- /* is_exact */ false);
+ ScopedObjectAccess soa(Thread::Current());
+ mirror::Class* resolved_class = GetClassFromDexCache(soa.Self(),
+ instr->GetDexFile(),
+ instr->GetTypeIndex(),
+ hint_dex_cache_);
+ SetClassAsTypeInfo(instr, resolved_class, /* is_exact */ false);
}
}
diff --git a/compiler/optimizing/reference_type_propagation.h b/compiler/optimizing/reference_type_propagation.h
index 215e96786b..4663471729 100644
--- a/compiler/optimizing/reference_type_propagation.h
+++ b/compiler/optimizing/reference_type_propagation.h
@@ -33,7 +33,6 @@ namespace art {
class ReferenceTypePropagation : public HOptimization {
public:
ReferenceTypePropagation(HGraph* graph,
- Handle<mirror::ClassLoader> class_loader,
Handle<mirror::DexCache> hint_dex_cache,
VariableSizedHandleScope* handles,
bool is_first_run,
@@ -106,8 +105,6 @@ class ReferenceTypePropagation : public HOptimization {
void ValidateTypes();
- Handle<mirror::ClassLoader> class_loader_;
-
// Note: hint_dex_cache_ is usually, but not necessarily, the dex cache associated with
// graph_->GetDexFile(). Since we may look up also in other dex files, it's used only
// as a hint, to reduce the number of calls to the costly ClassLinker::FindDexCache().
diff --git a/compiler/optimizing/reference_type_propagation_test.cc b/compiler/optimizing/reference_type_propagation_test.cc
index 84a4bab1a9..b061c871b0 100644
--- a/compiler/optimizing/reference_type_propagation_test.cc
+++ b/compiler/optimizing/reference_type_propagation_test.cc
@@ -38,7 +38,6 @@ class ReferenceTypePropagationTest : public CommonCompilerTest {
void SetupPropagation(VariableSizedHandleScope* handles) {
graph_->InitializeInexactObjectRTI(handles);
propagation_ = new (&allocator_) ReferenceTypePropagation(graph_,
- Handle<mirror::ClassLoader>(),
Handle<mirror::DexCache>(),
handles,
true,
diff --git a/compiler/optimizing/scheduler.cc b/compiler/optimizing/scheduler.cc
new file mode 100644
index 0000000000..d65d20cf43
--- /dev/null
+++ b/compiler/optimizing/scheduler.cc
@@ -0,0 +1,610 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include <string>
+
+#include "prepare_for_register_allocation.h"
+#include "scheduler.h"
+
+#ifdef ART_ENABLE_CODEGEN_arm64
+#include "scheduler_arm64.h"
+#endif
+
+namespace art {
+
+void SchedulingGraph::AddDependency(SchedulingNode* node,
+ SchedulingNode* dependency,
+ bool is_data_dependency) {
+ if (node == nullptr || dependency == nullptr) {
+ // A `nullptr` node indicates an instruction out of scheduling range (eg. in
+ // an other block), so we do not need to add a dependency edge to the graph.
+ return;
+ }
+
+ if (is_data_dependency) {
+ if (!HasImmediateDataDependency(node, dependency)) {
+ node->AddDataPredecessor(dependency);
+ }
+ } else if (!HasImmediateOtherDependency(node, dependency)) {
+ node->AddOtherPredecessor(dependency);
+ }
+}
+
+static bool MayHaveReorderingDependency(SideEffects node, SideEffects other) {
+ // Read after write.
+ if (node.MayDependOn(other)) {
+ return true;
+ }
+
+ // Write after read.
+ if (other.MayDependOn(node)) {
+ return true;
+ }
+
+ // Memory write after write.
+ if (node.DoesAnyWrite() && other.DoesAnyWrite()) {
+ return true;
+ }
+
+ return false;
+}
+
+
+// Check whether `node` depends on `other`, taking into account `SideEffect`
+// information and `CanThrow` information.
+static bool HasSideEffectDependency(const HInstruction* node, const HInstruction* other) {
+ if (MayHaveReorderingDependency(node->GetSideEffects(), other->GetSideEffects())) {
+ return true;
+ }
+
+ if (other->CanThrow() && node->GetSideEffects().DoesAnyWrite()) {
+ return true;
+ }
+
+ if (other->GetSideEffects().DoesAnyWrite() && node->CanThrow()) {
+ return true;
+ }
+
+ if (other->CanThrow() && node->CanThrow()) {
+ return true;
+ }
+
+ // Check side-effect dependency between ArrayGet and BoundsCheck.
+ if (node->IsArrayGet() && other->IsBoundsCheck() && node->InputAt(1) == other) {
+ return true;
+ }
+
+ return false;
+}
+
+void SchedulingGraph::AddDependencies(HInstruction* instruction, bool is_scheduling_barrier) {
+ SchedulingNode* instruction_node = GetNode(instruction);
+
+ // Define-use dependencies.
+ for (const HUseListNode<HInstruction*>& use : instruction->GetUses()) {
+ AddDataDependency(GetNode(use.GetUser()), instruction_node);
+ }
+
+ // Scheduling barrier dependencies.
+ DCHECK(!is_scheduling_barrier || contains_scheduling_barrier_);
+ if (contains_scheduling_barrier_) {
+ // A barrier depends on instructions after it. And instructions before the
+ // barrier depend on it.
+ for (HInstruction* other = instruction->GetNext(); other != nullptr; other = other->GetNext()) {
+ SchedulingNode* other_node = GetNode(other);
+ bool other_is_barrier = other_node->IsSchedulingBarrier();
+ if (is_scheduling_barrier || other_is_barrier) {
+ AddOtherDependency(other_node, instruction_node);
+ }
+ if (other_is_barrier) {
+ // This other scheduling barrier guarantees ordering of instructions after
+ // it, so avoid creating additional useless dependencies in the graph.
+ // For example if we have
+ // instr_1
+ // barrier_2
+ // instr_3
+ // barrier_4
+ // instr_5
+ // we only create the following non-data dependencies
+ // 1 -> 2
+ // 2 -> 3
+ // 2 -> 4
+ // 3 -> 4
+ // 4 -> 5
+ // and do not create
+ // 1 -> 4
+ // 2 -> 5
+ // Note that in this example we could also avoid creating the dependency
+ // `2 -> 4`. But if we remove `instr_3` that dependency is required to
+ // order the barriers. So we generate it to avoid a special case.
+ break;
+ }
+ }
+ }
+
+ // Side effect dependencies.
+ if (!instruction->GetSideEffects().DoesNothing() || instruction->CanThrow()) {
+ for (HInstruction* other = instruction->GetNext(); other != nullptr; other = other->GetNext()) {
+ SchedulingNode* other_node = GetNode(other);
+ if (other_node->IsSchedulingBarrier()) {
+ // We have reached a scheduling barrier so we can stop further
+ // processing.
+ DCHECK(HasImmediateOtherDependency(other_node, instruction_node));
+ break;
+ }
+ if (HasSideEffectDependency(other, instruction)) {
+ AddOtherDependency(other_node, instruction_node);
+ }
+ }
+ }
+
+ // Environment dependencies.
+ // We do not need to process those if the instruction is a scheduling barrier,
+ // since the barrier already has non-data dependencies on all following
+ // instructions.
+ if (!is_scheduling_barrier) {
+ for (const HUseListNode<HEnvironment*>& use : instruction->GetEnvUses()) {
+ // Note that here we could stop processing if the environment holder is
+ // across a scheduling barrier. But checking this would likely require
+ // more work than simply iterating through environment uses.
+ AddOtherDependency(GetNode(use.GetUser()->GetHolder()), instruction_node);
+ }
+ }
+}
+
+bool SchedulingGraph::HasImmediateDataDependency(const SchedulingNode* node,
+ const SchedulingNode* other) const {
+ return ContainsElement(node->GetDataPredecessors(), other);
+}
+
+bool SchedulingGraph::HasImmediateDataDependency(const HInstruction* instruction,
+ const HInstruction* other_instruction) const {
+ const SchedulingNode* node = GetNode(instruction);
+ const SchedulingNode* other = GetNode(other_instruction);
+ if (node == nullptr || other == nullptr) {
+ // Both instructions must be in current basic block, i.e. the SchedulingGraph can see their
+ // corresponding SchedulingNode in the graph, and tell whether there is a dependency.
+ // Otherwise there is no dependency from SchedulingGraph's perspective, for example,
+ // instruction and other_instruction are in different basic blocks.
+ return false;
+ }
+ return HasImmediateDataDependency(node, other);
+}
+
+bool SchedulingGraph::HasImmediateOtherDependency(const SchedulingNode* node,
+ const SchedulingNode* other) const {
+ return ContainsElement(node->GetOtherPredecessors(), other);
+}
+
+bool SchedulingGraph::HasImmediateOtherDependency(const HInstruction* instruction,
+ const HInstruction* other_instruction) const {
+ const SchedulingNode* node = GetNode(instruction);
+ const SchedulingNode* other = GetNode(other_instruction);
+ if (node == nullptr || other == nullptr) {
+ // Both instructions must be in current basic block, i.e. the SchedulingGraph can see their
+ // corresponding SchedulingNode in the graph, and tell whether there is a dependency.
+ // Otherwise there is no dependency from SchedulingGraph's perspective, for example,
+ // instruction and other_instruction are in different basic blocks.
+ return false;
+ }
+ return HasImmediateOtherDependency(node, other);
+}
+
+static const std::string InstructionTypeId(const HInstruction* instruction) {
+ std::string id;
+ Primitive::Type type = instruction->GetType();
+ if (type == Primitive::kPrimNot) {
+ id.append("l");
+ } else {
+ id.append(Primitive::Descriptor(instruction->GetType()));
+ }
+ // Use lower-case to be closer to the `HGraphVisualizer` output.
+ id[0] = std::tolower(id[0]);
+ id.append(std::to_string(instruction->GetId()));
+ return id;
+}
+
+// Ideally we would reuse the graph visualizer code, but it is not available
+// from here and it is not worth moving all that code only for our use.
+static void DumpAsDotNode(std::ostream& output, const SchedulingNode* node) {
+ const HInstruction* instruction = node->GetInstruction();
+ // Use the instruction typed id as the node identifier.
+ std::string instruction_id = InstructionTypeId(instruction);
+ output << instruction_id << "[shape=record, label=\""
+ << instruction_id << ' ' << instruction->DebugName() << " [";
+ // List the instruction's inputs in its description. When visualizing the
+ // graph this helps differentiating data inputs from other dependencies.
+ const char* seperator = "";
+ for (const HInstruction* input : instruction->GetInputs()) {
+ output << seperator << InstructionTypeId(input);
+ seperator = ",";
+ }
+ output << "]";
+ // Other properties of the node.
+ output << "\\ninternal_latency: " << node->GetInternalLatency();
+ output << "\\ncritical_path: " << node->GetCriticalPath();
+ if (node->IsSchedulingBarrier()) {
+ output << "\\n(barrier)";
+ }
+ output << "\"];\n";
+ // We want program order to go from top to bottom in the graph output, so we
+ // reverse the edges and specify `dir=back`.
+ for (const SchedulingNode* predecessor : node->GetDataPredecessors()) {
+ const HInstruction* predecessor_instruction = predecessor->GetInstruction();
+ output << InstructionTypeId(predecessor_instruction) << ":s -> " << instruction_id << ":n "
+ << "[label=\"" << predecessor->GetLatency() << "\",dir=back]\n";
+ }
+ for (const SchedulingNode* predecessor : node->GetOtherPredecessors()) {
+ const HInstruction* predecessor_instruction = predecessor->GetInstruction();
+ output << InstructionTypeId(predecessor_instruction) << ":s -> " << instruction_id << ":n "
+ << "[dir=back,color=blue]\n";
+ }
+}
+
+void SchedulingGraph::DumpAsDotGraph(const std::string& description,
+ const ArenaVector<SchedulingNode*>& initial_candidates) {
+ // TODO(xueliang): ideally we should move scheduling information into HInstruction, after that
+ // we should move this dotty graph dump feature to visualizer, and have a compiler option for it.
+ std::ofstream output("scheduling_graphs.dot", std::ofstream::out | std::ofstream::app);
+ // Description of this graph, as a comment.
+ output << "// " << description << "\n";
+ // Start the dot graph. Use an increasing index for easier differentiation.
+ output << "digraph G {\n";
+ for (const auto& entry : nodes_map_) {
+ DumpAsDotNode(output, entry.second);
+ }
+ // Create a fake 'end_of_scheduling' node to help visualization of critical_paths.
+ for (auto node : initial_candidates) {
+ const HInstruction* instruction = node->GetInstruction();
+ output << InstructionTypeId(instruction) << ":s -> end_of_scheduling:n "
+ << "[label=\"" << node->GetLatency() << "\",dir=back]\n";
+ }
+ // End of the dot graph.
+ output << "}\n";
+ output.close();
+}
+
+SchedulingNode* CriticalPathSchedulingNodeSelector::SelectMaterializedCondition(
+ ArenaVector<SchedulingNode*>* nodes, const SchedulingGraph& graph) const {
+ // Schedule condition inputs that can be materialized immediately before their use.
+ // In following example, after we've scheduled HSelect, we want LessThan to be scheduled
+ // immediately, because it is a materialized condition, and will be emitted right before HSelect
+ // in codegen phase.
+ //
+ // i20 HLessThan [...] HLessThan HAdd HAdd
+ // i21 HAdd [...] ===> | | |
+ // i22 HAdd [...] +----------+---------+
+ // i23 HSelect [i21, i22, i20] HSelect
+
+ if (prev_select_ == nullptr) {
+ return nullptr;
+ }
+
+ const HInstruction* instruction = prev_select_->GetInstruction();
+ const HCondition* condition = nullptr;
+ DCHECK(instruction != nullptr);
+
+ if (instruction->IsIf()) {
+ condition = instruction->AsIf()->InputAt(0)->AsCondition();
+ } else if (instruction->IsSelect()) {
+ condition = instruction->AsSelect()->GetCondition()->AsCondition();
+ }
+
+ SchedulingNode* condition_node = (condition != nullptr) ? graph.GetNode(condition) : nullptr;
+
+ if ((condition_node != nullptr) &&
+ condition->HasOnlyOneNonEnvironmentUse() &&
+ ContainsElement(*nodes, condition_node)) {
+ DCHECK(!condition_node->HasUnscheduledSuccessors());
+ // Remove the condition from the list of candidates and schedule it.
+ RemoveElement(*nodes, condition_node);
+ return condition_node;
+ }
+
+ return nullptr;
+}
+
+SchedulingNode* CriticalPathSchedulingNodeSelector::PopHighestPriorityNode(
+ ArenaVector<SchedulingNode*>* nodes, const SchedulingGraph& graph) {
+ DCHECK(!nodes->empty());
+ SchedulingNode* select_node = nullptr;
+
+ // Optimize for materialized condition and its emit before use scenario.
+ select_node = SelectMaterializedCondition(nodes, graph);
+
+ if (select_node == nullptr) {
+ // Get highest priority node based on critical path information.
+ select_node = (*nodes)[0];
+ size_t select = 0;
+ for (size_t i = 1, e = nodes->size(); i < e; i++) {
+ SchedulingNode* check = (*nodes)[i];
+ SchedulingNode* candidate = (*nodes)[select];
+ select_node = GetHigherPrioritySchedulingNode(candidate, check);
+ if (select_node == check) {
+ select = i;
+ }
+ }
+ DeleteNodeAtIndex(nodes, select);
+ }
+
+ prev_select_ = select_node;
+ return select_node;
+}
+
+SchedulingNode* CriticalPathSchedulingNodeSelector::GetHigherPrioritySchedulingNode(
+ SchedulingNode* candidate, SchedulingNode* check) const {
+ uint32_t candidate_path = candidate->GetCriticalPath();
+ uint32_t check_path = check->GetCriticalPath();
+ // First look at the critical_path.
+ if (check_path != candidate_path) {
+ return check_path < candidate_path ? check : candidate;
+ }
+ // If both critical paths are equal, schedule instructions with a higher latency
+ // first in program order.
+ return check->GetLatency() < candidate->GetLatency() ? check : candidate;
+}
+
+void HScheduler::Schedule(HGraph* graph) {
+ for (HBasicBlock* block : graph->GetReversePostOrder()) {
+ if (IsSchedulable(block)) {
+ Schedule(block);
+ }
+ }
+}
+
+void HScheduler::Schedule(HBasicBlock* block) {
+ ArenaVector<SchedulingNode*> scheduling_nodes(arena_->Adapter(kArenaAllocScheduler));
+
+ // Build the scheduling graph.
+ scheduling_graph_.Clear();
+ for (HBackwardInstructionIterator it(block->GetInstructions()); !it.Done(); it.Advance()) {
+ HInstruction* instruction = it.Current();
+ SchedulingNode* node = scheduling_graph_.AddNode(instruction, IsSchedulingBarrier(instruction));
+ CalculateLatency(node);
+ scheduling_nodes.push_back(node);
+ }
+
+ if (scheduling_graph_.Size() <= 1) {
+ scheduling_graph_.Clear();
+ return;
+ }
+
+ cursor_ = block->GetLastInstruction();
+
+ // Find the initial candidates for scheduling.
+ candidates_.clear();
+ for (SchedulingNode* node : scheduling_nodes) {
+ if (!node->HasUnscheduledSuccessors()) {
+ node->MaybeUpdateCriticalPath(node->GetLatency());
+ candidates_.push_back(node);
+ }
+ }
+
+ ArenaVector<SchedulingNode*> initial_candidates(arena_->Adapter(kArenaAllocScheduler));
+ if (kDumpDotSchedulingGraphs) {
+ // Remember the list of initial candidates for debug output purposes.
+ initial_candidates.assign(candidates_.begin(), candidates_.end());
+ }
+
+ // Schedule all nodes.
+ while (!candidates_.empty()) {
+ Schedule(selector_->PopHighestPriorityNode(&candidates_, scheduling_graph_));
+ }
+
+ if (kDumpDotSchedulingGraphs) {
+ // Dump the graph in `dot` format.
+ HGraph* graph = block->GetGraph();
+ std::stringstream description;
+ description << graph->GetDexFile().PrettyMethod(graph->GetMethodIdx())
+ << " B" << block->GetBlockId();
+ scheduling_graph_.DumpAsDotGraph(description.str(), initial_candidates);
+ }
+}
+
+void HScheduler::Schedule(SchedulingNode* scheduling_node) {
+ // Check whether any of the node's predecessors will be valid candidates after
+ // this node is scheduled.
+ uint32_t path_to_node = scheduling_node->GetCriticalPath();
+ for (SchedulingNode* predecessor : scheduling_node->GetDataPredecessors()) {
+ predecessor->MaybeUpdateCriticalPath(
+ path_to_node + predecessor->GetInternalLatency() + predecessor->GetLatency());
+ predecessor->DecrementNumberOfUnscheduledSuccessors();
+ if (!predecessor->HasUnscheduledSuccessors()) {
+ candidates_.push_back(predecessor);
+ }
+ }
+ for (SchedulingNode* predecessor : scheduling_node->GetOtherPredecessors()) {
+ // Do not update the critical path.
+ // The 'other' (so 'non-data') dependencies (usually) do not represent a
+ // 'material' dependency of nodes on others. They exist for program
+ // correctness. So we do not use them to compute the critical path.
+ predecessor->DecrementNumberOfUnscheduledSuccessors();
+ if (!predecessor->HasUnscheduledSuccessors()) {
+ candidates_.push_back(predecessor);
+ }
+ }
+
+ Schedule(scheduling_node->GetInstruction());
+}
+
+// Move an instruction after cursor instruction inside one basic block.
+static void MoveAfterInBlock(HInstruction* instruction, HInstruction* cursor) {
+ DCHECK_EQ(instruction->GetBlock(), cursor->GetBlock());
+ DCHECK_NE(cursor, cursor->GetBlock()->GetLastInstruction());
+ DCHECK(!instruction->IsControlFlow());
+ DCHECK(!cursor->IsControlFlow());
+ instruction->MoveBefore(cursor->GetNext(), /* do_checks */ false);
+}
+
+void HScheduler::Schedule(HInstruction* instruction) {
+ if (instruction == cursor_) {
+ cursor_ = cursor_->GetPrevious();
+ } else {
+ MoveAfterInBlock(instruction, cursor_);
+ }
+}
+
+bool HScheduler::IsSchedulable(const HInstruction* instruction) const {
+ // We want to avoid exhaustively listing all instructions, so we first check
+ // for instruction categories that we know are safe.
+ if (instruction->IsControlFlow() ||
+ instruction->IsConstant()) {
+ return true;
+ }
+ // Currently all unary and binary operations are safe to schedule, so avoid
+ // checking for each of them individually.
+ // Since nothing prevents a new scheduling-unsafe HInstruction to subclass
+ // HUnaryOperation (or HBinaryOperation), check in debug mode that we have
+ // the exhaustive lists here.
+ if (instruction->IsUnaryOperation()) {
+ DCHECK(instruction->IsBooleanNot() ||
+ instruction->IsNot() ||
+ instruction->IsNeg()) << "unexpected instruction " << instruction->DebugName();
+ return true;
+ }
+ if (instruction->IsBinaryOperation()) {
+ DCHECK(instruction->IsAdd() ||
+ instruction->IsAnd() ||
+ instruction->IsCompare() ||
+ instruction->IsCondition() ||
+ instruction->IsDiv() ||
+ instruction->IsMul() ||
+ instruction->IsOr() ||
+ instruction->IsRem() ||
+ instruction->IsRor() ||
+ instruction->IsShl() ||
+ instruction->IsShr() ||
+ instruction->IsSub() ||
+ instruction->IsUShr() ||
+ instruction->IsXor()) << "unexpected instruction " << instruction->DebugName();
+ return true;
+ }
+ // The scheduler should not see any of these.
+ DCHECK(!instruction->IsParallelMove()) << "unexpected instruction " << instruction->DebugName();
+ // List of instructions explicitly excluded:
+ // HClearException
+ // HClinitCheck
+ // HDeoptimize
+ // HLoadClass
+ // HLoadException
+ // HMemoryBarrier
+ // HMonitorOperation
+ // HNativeDebugInfo
+ // HThrow
+ // HTryBoundary
+ // TODO: Some of the instructions above may be safe to schedule (maybe as
+ // scheduling barriers).
+ return instruction->IsArrayGet() ||
+ instruction->IsArraySet() ||
+ instruction->IsArrayLength() ||
+ instruction->IsBoundType() ||
+ instruction->IsBoundsCheck() ||
+ instruction->IsCheckCast() ||
+ instruction->IsClassTableGet() ||
+ instruction->IsCurrentMethod() ||
+ instruction->IsDivZeroCheck() ||
+ instruction->IsInstanceFieldGet() ||
+ instruction->IsInstanceFieldSet() ||
+ instruction->IsInstanceOf() ||
+ instruction->IsInvokeInterface() ||
+ instruction->IsInvokeStaticOrDirect() ||
+ instruction->IsInvokeUnresolved() ||
+ instruction->IsInvokeVirtual() ||
+ instruction->IsLoadString() ||
+ instruction->IsNewArray() ||
+ instruction->IsNewInstance() ||
+ instruction->IsNullCheck() ||
+ instruction->IsPackedSwitch() ||
+ instruction->IsParameterValue() ||
+ instruction->IsPhi() ||
+ instruction->IsReturn() ||
+ instruction->IsReturnVoid() ||
+ instruction->IsSelect() ||
+ instruction->IsStaticFieldGet() ||
+ instruction->IsStaticFieldSet() ||
+ instruction->IsSuspendCheck() ||
+ instruction->IsTypeConversion() ||
+ instruction->IsUnresolvedInstanceFieldGet() ||
+ instruction->IsUnresolvedInstanceFieldSet() ||
+ instruction->IsUnresolvedStaticFieldGet() ||
+ instruction->IsUnresolvedStaticFieldSet();
+}
+
+bool HScheduler::IsSchedulable(const HBasicBlock* block) const {
+ // We may be only interested in loop blocks.
+ if (only_optimize_loop_blocks_ && !block->IsInLoop()) {
+ return false;
+ }
+ if (block->GetTryCatchInformation() != nullptr) {
+ // Do not schedule blocks that are part of try-catch.
+ // Because scheduler cannot see if catch block has assumptions on the instruction order in
+ // the try block. In following example, if we enable scheduler for the try block,
+ // MulitiplyAccumulate may be scheduled before DivZeroCheck,
+ // which can result in an incorrect value in the catch block.
+ // try {
+ // a = a/b; // DivZeroCheck
+ // // Div
+ // c = c*d+e; // MulitiplyAccumulate
+ // } catch {System.out.print(c); }
+ return false;
+ }
+ // Check whether all instructions in this block are schedulable.
+ for (HInstructionIterator it(block->GetInstructions()); !it.Done(); it.Advance()) {
+ if (!IsSchedulable(it.Current())) {
+ return false;
+ }
+ }
+ return true;
+}
+
+bool HScheduler::IsSchedulingBarrier(const HInstruction* instr) const {
+ return instr->IsControlFlow() ||
+ // Don't break calling convention.
+ instr->IsParameterValue() ||
+ // Code generation of goto relies on SuspendCheck's position.
+ instr->IsSuspendCheck();
+}
+
+void HInstructionScheduling::Run(bool only_optimize_loop_blocks,
+ bool schedule_randomly) {
+ // Avoid compilation error when compiling for unsupported instruction set.
+ UNUSED(only_optimize_loop_blocks);
+ UNUSED(schedule_randomly);
+ switch (instruction_set_) {
+#ifdef ART_ENABLE_CODEGEN_arm64
+ case kArm64: {
+ // Phase-local allocator that allocates scheduler internal data structures like
+ // scheduling nodes, internel nodes map, dependencies, etc.
+ ArenaAllocator arena_allocator(graph_->GetArena()->GetArenaPool());
+
+ CriticalPathSchedulingNodeSelector critical_path_selector;
+ RandomSchedulingNodeSelector random_selector;
+ SchedulingNodeSelector* selector = schedule_randomly
+ ? static_cast<SchedulingNodeSelector*>(&random_selector)
+ : static_cast<SchedulingNodeSelector*>(&critical_path_selector);
+
+ arm64::HSchedulerARM64 scheduler(&arena_allocator, selector);
+ scheduler.SetOnlyOptimizeLoopBlocks(only_optimize_loop_blocks);
+ scheduler.Schedule(graph_);
+ break;
+ }
+#endif
+ default:
+ break;
+ }
+}
+
+} // namespace art
diff --git a/compiler/optimizing/scheduler.h b/compiler/optimizing/scheduler.h
new file mode 100644
index 0000000000..ab0dad4300
--- /dev/null
+++ b/compiler/optimizing/scheduler.h
@@ -0,0 +1,487 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#ifndef ART_COMPILER_OPTIMIZING_SCHEDULER_H_
+#define ART_COMPILER_OPTIMIZING_SCHEDULER_H_
+
+#include <fstream>
+
+#include "base/time_utils.h"
+#include "driver/compiler_driver.h"
+#include "nodes.h"
+#include "optimization.h"
+
+namespace art {
+
+// General description of instruction scheduling.
+//
+// This pass tries to improve the quality of the generated code by reordering
+// instructions in the graph to avoid execution delays caused by execution
+// dependencies.
+// Currently, scheduling is performed at the block level, so no `HInstruction`
+// ever leaves its block in this pass.
+//
+// The scheduling process iterates through blocks in the graph. For blocks that
+// we can and want to schedule:
+// 1) Build a dependency graph for instructions.
+// It includes data dependencies (inputs/uses), but also environment
+// dependencies and side-effect dependencies.
+// 2) Schedule the dependency graph.
+// This is a topological sort of the dependency graph, using heuristics to
+// decide what node to scheduler first when there are multiple candidates.
+//
+// A few factors impacting the quality of the scheduling are:
+// - The heuristics used to decide what node to schedule in the topological sort
+// when there are multiple valid candidates. There is a wide range of
+// complexity possible here, going from a simple model only considering
+// latencies, to a super detailed CPU pipeline model.
+// - Fewer dependencies in the dependency graph give more freedom for the
+// scheduling heuristics. For example de-aliasing can allow possibilities for
+// reordering of memory accesses.
+// - The level of abstraction of the IR. It is easier to evaluate scheduling for
+// IRs that translate to a single assembly instruction than for IRs
+// that generate multiple assembly instructions or generate different code
+// depending on properties of the IR.
+// - Scheduling is performed before register allocation, it is not aware of the
+// impact of moving instructions on register allocation.
+//
+//
+// The scheduling code uses the terms predecessors, successors, and dependencies.
+// This can be confusing at times, so here are clarifications.
+// These terms are used from the point of view of the program dependency graph. So
+// the inputs of an instruction are part of its dependencies, and hence part its
+// predecessors. So the uses of an instruction are (part of) its successors.
+// (Side-effect dependencies can yield predecessors or successors that are not
+// inputs or uses.)
+//
+// Here is a trivial example. For the Java code:
+//
+// int a = 1 + 2;
+//
+// we would have the instructions
+//
+// i1 HIntConstant 1
+// i2 HIntConstant 2
+// i3 HAdd [i1,i2]
+//
+// `i1` and `i2` are predecessors of `i3`.
+// `i3` is a successor of `i1` and a successor of `i2`.
+// In a scheduling graph for this code we would have three nodes `n1`, `n2`,
+// and `n3` (respectively for instructions `i1`, `i1`, and `i3`).
+// Conceptually the program dependency graph for this would contain two edges
+//
+// n1 -> n3
+// n2 -> n3
+//
+// Since we schedule backwards (starting from the last instruction in each basic
+// block), the implementation of nodes keeps a list of pointers their
+// predecessors. So `n3` would keep pointers to its predecessors `n1` and `n2`.
+//
+// Node dependencies are also referred to from the program dependency graph
+// point of view: we say that node `B` immediately depends on `A` if there is an
+// edge from `A` to `B` in the program dependency graph. `A` is a predecessor of
+// `B`, `B` is a successor of `A`. In the example above `n3` depends on `n1` and
+// `n2`.
+// Since nodes in the scheduling graph keep a list of their predecessors, node
+// `B` will have a pointer to its predecessor `A`.
+// As we schedule backwards, `B` will be selected for scheduling before `A` is.
+//
+// So the scheduling for the example above could happen as follow
+//
+// |---------------------------+------------------------|
+// | candidates for scheduling | instructions scheduled |
+// | --------------------------+------------------------|
+//
+// The only node without successors is `n3`, so it is the only initial
+// candidate.
+//
+// | n3 | (none) |
+//
+// We schedule `n3` as the last (and only) instruction. All its predecessors
+// that do not have any unscheduled successors become candidate. That is, `n1`
+// and `n2` become candidates.
+//
+// | n1, n2 | n3 |
+//
+// One of the candidates is selected. In practice this is where scheduling
+// heuristics kick in, to decide which of the candidates should be selected.
+// In this example, let it be `n1`. It is scheduled before previously scheduled
+// nodes (in program order). There are no other nodes to add to the list of
+// candidates.
+//
+// | n2 | n1 |
+// | | n3 |
+//
+// The only candidate available for scheduling is `n2`. Schedule it before
+// (in program order) the previously scheduled nodes.
+//
+// | (none) | n2 |
+// | | n1 |
+// | | n3 |
+// |---------------------------+------------------------|
+//
+// So finally the instructions will be executed in the order `i2`, `i1`, and `i3`.
+// In this trivial example, it does not matter which of `i1` and `i2` is
+// scheduled first since they are constants. However the same process would
+// apply if `i1` and `i2` were actual operations (for example `HMul` and `HDiv`).
+
+// Set to true to have instruction scheduling dump scheduling graphs to the file
+// `scheduling_graphs.dot`. See `SchedulingGraph::DumpAsDotGraph()`.
+static constexpr bool kDumpDotSchedulingGraphs = false;
+
+// Typically used as a default instruction latency.
+static constexpr uint32_t kGenericInstructionLatency = 1;
+
+class HScheduler;
+
+/**
+ * A node representing an `HInstruction` in the `SchedulingGraph`.
+ */
+class SchedulingNode : public ArenaObject<kArenaAllocScheduler> {
+ public:
+ SchedulingNode(HInstruction* instr, ArenaAllocator* arena, bool is_scheduling_barrier)
+ : latency_(0),
+ internal_latency_(0),
+ critical_path_(0),
+ instruction_(instr),
+ is_scheduling_barrier_(is_scheduling_barrier),
+ data_predecessors_(arena->Adapter(kArenaAllocScheduler)),
+ other_predecessors_(arena->Adapter(kArenaAllocScheduler)),
+ num_unscheduled_successors_(0) {
+ data_predecessors_.reserve(kPreallocatedPredecessors);
+ }
+
+ void AddDataPredecessor(SchedulingNode* predecessor) {
+ data_predecessors_.push_back(predecessor);
+ predecessor->num_unscheduled_successors_++;
+ }
+
+ void AddOtherPredecessor(SchedulingNode* predecessor) {
+ other_predecessors_.push_back(predecessor);
+ predecessor->num_unscheduled_successors_++;
+ }
+
+ void DecrementNumberOfUnscheduledSuccessors() {
+ num_unscheduled_successors_--;
+ }
+
+ void MaybeUpdateCriticalPath(uint32_t other_critical_path) {
+ critical_path_ = std::max(critical_path_, other_critical_path);
+ }
+
+ bool HasUnscheduledSuccessors() const {
+ return num_unscheduled_successors_ != 0;
+ }
+
+ HInstruction* GetInstruction() const { return instruction_; }
+ uint32_t GetLatency() const { return latency_; }
+ void SetLatency(uint32_t latency) { latency_ = latency; }
+ uint32_t GetInternalLatency() const { return internal_latency_; }
+ void SetInternalLatency(uint32_t internal_latency) { internal_latency_ = internal_latency; }
+ uint32_t GetCriticalPath() const { return critical_path_; }
+ bool IsSchedulingBarrier() const { return is_scheduling_barrier_; }
+ const ArenaVector<SchedulingNode*>& GetDataPredecessors() const { return data_predecessors_; }
+ const ArenaVector<SchedulingNode*>& GetOtherPredecessors() const { return other_predecessors_; }
+
+ private:
+ // The latency of this node. It represents the latency between the moment the
+ // last instruction for this node has executed to the moment the result
+ // produced by this node is available to users.
+ uint32_t latency_;
+ // This represents the time spent *within* the generated code for this node.
+ // It should be zero for nodes that only generate a single instruction.
+ uint32_t internal_latency_;
+
+ // The critical path from this instruction to the end of scheduling. It is
+ // used by the scheduling heuristics to measure the priority of this instruction.
+ // It is defined as
+ // critical_path_ = latency_ + max((use.internal_latency_ + use.critical_path_) for all uses)
+ // (Note that here 'uses' is equivalent to 'data successors'. Also see comments in
+ // `HScheduler::Schedule(SchedulingNode* scheduling_node)`).
+ uint32_t critical_path_;
+
+ // The instruction that this node represents.
+ HInstruction* const instruction_;
+
+ // If a node is scheduling barrier, other nodes cannot be scheduled before it.
+ const bool is_scheduling_barrier_;
+
+ // The lists of predecessors. They cannot be scheduled before this node. Once
+ // this node is scheduled, we check whether any of its predecessors has become a
+ // valid candidate for scheduling.
+ // Predecessors in `data_predecessors_` are data dependencies. Those in
+ // `other_predecessors_` contain side-effect dependencies, environment
+ // dependencies, and scheduling barrier dependencies.
+ ArenaVector<SchedulingNode*> data_predecessors_;
+ ArenaVector<SchedulingNode*> other_predecessors_;
+
+ // The number of unscheduled successors for this node. This number is
+ // decremented as successors are scheduled. When it reaches zero this node
+ // becomes a valid candidate to schedule.
+ uint32_t num_unscheduled_successors_;
+
+ static constexpr size_t kPreallocatedPredecessors = 4;
+};
+
+/*
+ * Directed acyclic graph for scheduling.
+ */
+class SchedulingGraph : public ValueObject {
+ public:
+ SchedulingGraph(const HScheduler* scheduler, ArenaAllocator* arena)
+ : scheduler_(scheduler),
+ arena_(arena),
+ contains_scheduling_barrier_(false),
+ nodes_map_(arena_->Adapter(kArenaAllocScheduler)) {}
+
+ SchedulingNode* AddNode(HInstruction* instr, bool is_scheduling_barrier = false) {
+ SchedulingNode* node = new (arena_) SchedulingNode(instr, arena_, is_scheduling_barrier);
+ nodes_map_.Insert(std::make_pair(instr, node));
+ contains_scheduling_barrier_ |= is_scheduling_barrier;
+ AddDependencies(instr, is_scheduling_barrier);
+ return node;
+ }
+
+ void Clear() {
+ nodes_map_.Clear();
+ contains_scheduling_barrier_ = false;
+ }
+
+ SchedulingNode* GetNode(const HInstruction* instr) const {
+ auto it = nodes_map_.Find(instr);
+ if (it == nodes_map_.end()) {
+ return nullptr;
+ } else {
+ return it->second;
+ }
+ }
+
+ bool IsSchedulingBarrier(const HInstruction* instruction) const;
+
+ bool HasImmediateDataDependency(const SchedulingNode* node, const SchedulingNode* other) const;
+ bool HasImmediateDataDependency(const HInstruction* node, const HInstruction* other) const;
+ bool HasImmediateOtherDependency(const SchedulingNode* node, const SchedulingNode* other) const;
+ bool HasImmediateOtherDependency(const HInstruction* node, const HInstruction* other) const;
+
+ size_t Size() const {
+ return nodes_map_.Size();
+ }
+
+ // Dump the scheduling graph, in dot file format, appending it to the file
+ // `scheduling_graphs.dot`.
+ void DumpAsDotGraph(const std::string& description,
+ const ArenaVector<SchedulingNode*>& initial_candidates);
+
+ protected:
+ void AddDependency(SchedulingNode* node, SchedulingNode* dependency, bool is_data_dependency);
+ void AddDataDependency(SchedulingNode* node, SchedulingNode* dependency) {
+ AddDependency(node, dependency, /*is_data_dependency*/true);
+ }
+ void AddOtherDependency(SchedulingNode* node, SchedulingNode* dependency) {
+ AddDependency(node, dependency, /*is_data_dependency*/false);
+ }
+
+ // Add dependencies nodes for the given `HInstruction`: inputs, environments, and side-effects.
+ void AddDependencies(HInstruction* instruction, bool is_scheduling_barrier = false);
+
+ const HScheduler* const scheduler_;
+
+ ArenaAllocator* const arena_;
+
+ bool contains_scheduling_barrier_;
+
+ ArenaHashMap<const HInstruction*, SchedulingNode*> nodes_map_;
+};
+
+/*
+ * The visitors derived from this base class are used by schedulers to evaluate
+ * the latencies of `HInstruction`s.
+ */
+class SchedulingLatencyVisitor : public HGraphDelegateVisitor {
+ public:
+ // This class and its sub-classes will never be used to drive a visit of an
+ // `HGraph` but only to visit `HInstructions` one at a time, so we do not need
+ // to pass a valid graph to `HGraphDelegateVisitor()`.
+ SchedulingLatencyVisitor() : HGraphDelegateVisitor(nullptr) {}
+
+ void VisitInstruction(HInstruction* instruction) OVERRIDE {
+ LOG(FATAL) << "Error visiting " << instruction->DebugName() << ". "
+ "Architecture-specific scheduling latency visitors must handle all instructions"
+ " (potentially by overriding the generic `VisitInstruction()`.";
+ UNREACHABLE();
+ }
+
+ void Visit(HInstruction* instruction) {
+ instruction->Accept(this);
+ }
+
+ void CalculateLatency(SchedulingNode* node) {
+ // By default nodes have no internal latency.
+ last_visited_internal_latency_ = 0;
+ Visit(node->GetInstruction());
+ }
+
+ uint32_t GetLastVisitedLatency() const { return last_visited_latency_; }
+ uint32_t GetLastVisitedInternalLatency() const { return last_visited_internal_latency_; }
+
+ protected:
+ // The latency of the most recent visited SchedulingNode.
+ // This is for reporting the latency value to the user of this visitor.
+ uint32_t last_visited_latency_;
+ // This represents the time spent *within* the generated code for the most recent visited
+ // SchedulingNode. This is for reporting the internal latency value to the user of this visitor.
+ uint32_t last_visited_internal_latency_;
+};
+
+class SchedulingNodeSelector : public ArenaObject<kArenaAllocScheduler> {
+ public:
+ virtual SchedulingNode* PopHighestPriorityNode(ArenaVector<SchedulingNode*>* nodes,
+ const SchedulingGraph& graph) = 0;
+ virtual ~SchedulingNodeSelector() {}
+ protected:
+ static void DeleteNodeAtIndex(ArenaVector<SchedulingNode*>* nodes, size_t index) {
+ (*nodes)[index] = nodes->back();
+ nodes->pop_back();
+ }
+};
+
+/*
+ * Select a `SchedulingNode` at random within the candidates.
+ */
+class RandomSchedulingNodeSelector : public SchedulingNodeSelector {
+ public:
+ explicit RandomSchedulingNodeSelector() : seed_(0) {
+ seed_ = static_cast<uint32_t>(NanoTime());
+ srand(seed_);
+ }
+
+ SchedulingNode* PopHighestPriorityNode(ArenaVector<SchedulingNode*>* nodes,
+ const SchedulingGraph& graph) OVERRIDE {
+ UNUSED(graph);
+ DCHECK(!nodes->empty());
+ size_t select = rand_r(&seed_) % nodes->size();
+ SchedulingNode* select_node = (*nodes)[select];
+ DeleteNodeAtIndex(nodes, select);
+ return select_node;
+ }
+
+ uint32_t seed_;
+};
+
+/*
+ * Select a `SchedulingNode` according to critical path information,
+ * with heuristics to favor certain instruction patterns like materialized condition.
+ */
+class CriticalPathSchedulingNodeSelector : public SchedulingNodeSelector {
+ public:
+ CriticalPathSchedulingNodeSelector() : prev_select_(nullptr) {}
+
+ SchedulingNode* PopHighestPriorityNode(ArenaVector<SchedulingNode*>* nodes,
+ const SchedulingGraph& graph) OVERRIDE;
+
+ protected:
+ SchedulingNode* GetHigherPrioritySchedulingNode(SchedulingNode* candidate,
+ SchedulingNode* check) const;
+
+ SchedulingNode* SelectMaterializedCondition(ArenaVector<SchedulingNode*>* nodes,
+ const SchedulingGraph& graph) const;
+
+ private:
+ const SchedulingNode* prev_select_;
+};
+
+class HScheduler {
+ public:
+ HScheduler(ArenaAllocator* arena,
+ SchedulingLatencyVisitor* latency_visitor,
+ SchedulingNodeSelector* selector)
+ : arena_(arena),
+ latency_visitor_(latency_visitor),
+ selector_(selector),
+ only_optimize_loop_blocks_(true),
+ scheduling_graph_(this, arena),
+ candidates_(arena_->Adapter(kArenaAllocScheduler)) {}
+ virtual ~HScheduler() {}
+
+ void Schedule(HGraph* graph);
+
+ void SetOnlyOptimizeLoopBlocks(bool loop_only) { only_optimize_loop_blocks_ = loop_only; }
+
+ // Instructions can not be rescheduled across a scheduling barrier.
+ virtual bool IsSchedulingBarrier(const HInstruction* instruction) const;
+
+ protected:
+ void Schedule(HBasicBlock* block);
+ void Schedule(SchedulingNode* scheduling_node);
+ void Schedule(HInstruction* instruction);
+
+ // Any instruction returning `false` via this method will prevent its
+ // containing basic block from being scheduled.
+ // This method is used to restrict scheduling to instructions that we know are
+ // safe to handle.
+ virtual bool IsSchedulable(const HInstruction* instruction) const;
+ bool IsSchedulable(const HBasicBlock* block) const;
+
+ void CalculateLatency(SchedulingNode* node) {
+ latency_visitor_->CalculateLatency(node);
+ node->SetLatency(latency_visitor_->GetLastVisitedLatency());
+ node->SetInternalLatency(latency_visitor_->GetLastVisitedInternalLatency());
+ }
+
+ ArenaAllocator* const arena_;
+ SchedulingLatencyVisitor* const latency_visitor_;
+ SchedulingNodeSelector* const selector_;
+ bool only_optimize_loop_blocks_;
+
+ // We instantiate the members below as part of this class to avoid
+ // instantiating them locally for every chunk scheduled.
+ SchedulingGraph scheduling_graph_;
+ // A pointer indicating where the next instruction to be scheduled will be inserted.
+ HInstruction* cursor_;
+ // The list of candidates for scheduling. A node becomes a candidate when all
+ // its predecessors have been scheduled.
+ ArenaVector<SchedulingNode*> candidates_;
+
+ private:
+ DISALLOW_COPY_AND_ASSIGN(HScheduler);
+};
+
+inline bool SchedulingGraph::IsSchedulingBarrier(const HInstruction* instruction) const {
+ return scheduler_->IsSchedulingBarrier(instruction);
+}
+
+class HInstructionScheduling : public HOptimization {
+ public:
+ HInstructionScheduling(HGraph* graph, InstructionSet instruction_set)
+ : HOptimization(graph, kInstructionScheduling),
+ instruction_set_(instruction_set) {}
+
+ void Run() {
+ Run(/*only_optimize_loop_blocks*/ true, /*schedule_randomly*/ false);
+ }
+ void Run(bool only_optimize_loop_blocks, bool schedule_randomly);
+
+ static constexpr const char* kInstructionScheduling = "scheduler";
+
+ const InstructionSet instruction_set_;
+
+ private:
+ DISALLOW_COPY_AND_ASSIGN(HInstructionScheduling);
+};
+
+} // namespace art
+
+#endif // ART_COMPILER_OPTIMIZING_SCHEDULER_H_
diff --git a/compiler/optimizing/scheduler_arm64.cc b/compiler/optimizing/scheduler_arm64.cc
new file mode 100644
index 0000000000..e3701fbcb1
--- /dev/null
+++ b/compiler/optimizing/scheduler_arm64.cc
@@ -0,0 +1,196 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "scheduler_arm64.h"
+#include "code_generator_utils.h"
+
+namespace art {
+namespace arm64 {
+
+void SchedulingLatencyVisitorARM64::VisitBinaryOperation(HBinaryOperation* instr) {
+ last_visited_latency_ = Primitive::IsFloatingPointType(instr->GetResultType())
+ ? kArm64FloatingPointOpLatency
+ : kArm64IntegerOpLatency;
+}
+
+void SchedulingLatencyVisitorARM64::VisitBitwiseNegatedRight(
+ HBitwiseNegatedRight* ATTRIBUTE_UNUSED) {
+ last_visited_latency_ = kArm64IntegerOpLatency;
+}
+
+void SchedulingLatencyVisitorARM64::VisitArm64DataProcWithShifterOp(
+ HArm64DataProcWithShifterOp* ATTRIBUTE_UNUSED) {
+ last_visited_latency_ = kArm64DataProcWithShifterOpLatency;
+}
+
+void SchedulingLatencyVisitorARM64::VisitIntermediateAddress(
+ HIntermediateAddress* ATTRIBUTE_UNUSED) {
+ // Although the code generated is a simple `add` instruction, we found through empirical results
+ // that spacing it from its use in memory accesses was beneficial.
+ last_visited_latency_ = kArm64IntegerOpLatency + 2;
+}
+
+void SchedulingLatencyVisitorARM64::VisitMultiplyAccumulate(HMultiplyAccumulate* ATTRIBUTE_UNUSED) {
+ last_visited_latency_ = kArm64MulIntegerLatency;
+}
+
+void SchedulingLatencyVisitorARM64::VisitArrayGet(HArrayGet* instruction) {
+ if (!instruction->GetArray()->IsIntermediateAddress()) {
+ // Take the intermediate address computation into account.
+ last_visited_internal_latency_ = kArm64IntegerOpLatency;
+ }
+ last_visited_latency_ = kArm64MemoryLoadLatency;
+}
+
+void SchedulingLatencyVisitorARM64::VisitArrayLength(HArrayLength* ATTRIBUTE_UNUSED) {
+ last_visited_latency_ = kArm64MemoryLoadLatency;
+}
+
+void SchedulingLatencyVisitorARM64::VisitArraySet(HArraySet* ATTRIBUTE_UNUSED) {
+ last_visited_latency_ = kArm64MemoryStoreLatency;
+}
+
+void SchedulingLatencyVisitorARM64::VisitBoundsCheck(HBoundsCheck* ATTRIBUTE_UNUSED) {
+ last_visited_internal_latency_ = kArm64IntegerOpLatency;
+ // Users do not use any data results.
+ last_visited_latency_ = 0;
+}
+
+void SchedulingLatencyVisitorARM64::VisitDiv(HDiv* instr) {
+ Primitive::Type type = instr->GetResultType();
+ switch (type) {
+ case Primitive::kPrimFloat:
+ last_visited_latency_ = kArm64DivFloatLatency;
+ break;
+ case Primitive::kPrimDouble:
+ last_visited_latency_ = kArm64DivDoubleLatency;
+ break;
+ default:
+ // Follow the code path used by code generation.
+ if (instr->GetRight()->IsConstant()) {
+ int64_t imm = Int64FromConstant(instr->GetRight()->AsConstant());
+ if (imm == 0) {
+ last_visited_internal_latency_ = 0;
+ last_visited_latency_ = 0;
+ } else if (imm == 1 || imm == -1) {
+ last_visited_internal_latency_ = 0;
+ last_visited_latency_ = kArm64IntegerOpLatency;
+ } else if (IsPowerOfTwo(AbsOrMin(imm))) {
+ last_visited_internal_latency_ = 4 * kArm64IntegerOpLatency;
+ last_visited_latency_ = kArm64IntegerOpLatency;
+ } else {
+ DCHECK(imm <= -2 || imm >= 2);
+ last_visited_internal_latency_ = 4 * kArm64IntegerOpLatency;
+ last_visited_latency_ = kArm64MulIntegerLatency;
+ }
+ } else {
+ last_visited_latency_ = kArm64DivIntegerLatency;
+ }
+ break;
+ }
+}
+
+void SchedulingLatencyVisitorARM64::VisitInstanceFieldGet(HInstanceFieldGet* ATTRIBUTE_UNUSED) {
+ last_visited_latency_ = kArm64MemoryLoadLatency;
+}
+
+void SchedulingLatencyVisitorARM64::VisitInstanceOf(HInstanceOf* ATTRIBUTE_UNUSED) {
+ last_visited_internal_latency_ = kArm64CallInternalLatency;
+ last_visited_latency_ = kArm64IntegerOpLatency;
+}
+
+void SchedulingLatencyVisitorARM64::VisitInvoke(HInvoke* ATTRIBUTE_UNUSED) {
+ last_visited_internal_latency_ = kArm64CallInternalLatency;
+ last_visited_latency_ = kArm64CallLatency;
+}
+
+void SchedulingLatencyVisitorARM64::VisitLoadString(HLoadString* ATTRIBUTE_UNUSED) {
+ last_visited_internal_latency_ = kArm64LoadStringInternalLatency;
+ last_visited_latency_ = kArm64MemoryLoadLatency;
+}
+
+void SchedulingLatencyVisitorARM64::VisitMul(HMul* instr) {
+ last_visited_latency_ = Primitive::IsFloatingPointType(instr->GetResultType())
+ ? kArm64MulFloatingPointLatency
+ : kArm64MulIntegerLatency;
+}
+
+void SchedulingLatencyVisitorARM64::VisitNewArray(HNewArray* ATTRIBUTE_UNUSED) {
+ last_visited_internal_latency_ = kArm64IntegerOpLatency + kArm64CallInternalLatency;
+ last_visited_latency_ = kArm64CallLatency;
+}
+
+void SchedulingLatencyVisitorARM64::VisitNewInstance(HNewInstance* instruction) {
+ if (instruction->IsStringAlloc()) {
+ last_visited_internal_latency_ = 2 + kArm64MemoryLoadLatency + kArm64CallInternalLatency;
+ } else {
+ last_visited_internal_latency_ = kArm64CallInternalLatency;
+ }
+ last_visited_latency_ = kArm64CallLatency;
+}
+
+void SchedulingLatencyVisitorARM64::VisitRem(HRem* instruction) {
+ if (Primitive::IsFloatingPointType(instruction->GetResultType())) {
+ last_visited_internal_latency_ = kArm64CallInternalLatency;
+ last_visited_latency_ = kArm64CallLatency;
+ } else {
+ // Follow the code path used by code generation.
+ if (instruction->GetRight()->IsConstant()) {
+ int64_t imm = Int64FromConstant(instruction->GetRight()->AsConstant());
+ if (imm == 0) {
+ last_visited_internal_latency_ = 0;
+ last_visited_latency_ = 0;
+ } else if (imm == 1 || imm == -1) {
+ last_visited_internal_latency_ = 0;
+ last_visited_latency_ = kArm64IntegerOpLatency;
+ } else if (IsPowerOfTwo(AbsOrMin(imm))) {
+ last_visited_internal_latency_ = 4 * kArm64IntegerOpLatency;
+ last_visited_latency_ = kArm64IntegerOpLatency;
+ } else {
+ DCHECK(imm <= -2 || imm >= 2);
+ last_visited_internal_latency_ = 4 * kArm64IntegerOpLatency;
+ last_visited_latency_ = kArm64MulIntegerLatency;
+ }
+ } else {
+ last_visited_internal_latency_ = kArm64DivIntegerLatency;
+ last_visited_latency_ = kArm64MulIntegerLatency;
+ }
+ }
+}
+
+void SchedulingLatencyVisitorARM64::VisitStaticFieldGet(HStaticFieldGet* ATTRIBUTE_UNUSED) {
+ last_visited_latency_ = kArm64MemoryLoadLatency;
+}
+
+void SchedulingLatencyVisitorARM64::VisitSuspendCheck(HSuspendCheck* instruction) {
+ HBasicBlock* block = instruction->GetBlock();
+ DCHECK((block->GetLoopInformation() != nullptr) ||
+ (block->IsEntryBlock() && instruction->GetNext()->IsGoto()));
+ // Users do not use any data results.
+ last_visited_latency_ = 0;
+}
+
+void SchedulingLatencyVisitorARM64::VisitTypeConversion(HTypeConversion* instr) {
+ if (Primitive::IsFloatingPointType(instr->GetResultType()) ||
+ Primitive::IsFloatingPointType(instr->GetInputType())) {
+ last_visited_latency_ = kArm64TypeConversionFloatingPointIntegerLatency;
+ } else {
+ last_visited_latency_ = kArm64IntegerOpLatency;
+ }
+}
+
+} // namespace arm64
+} // namespace art
diff --git a/compiler/optimizing/scheduler_arm64.h b/compiler/optimizing/scheduler_arm64.h
new file mode 100644
index 0000000000..702027c535
--- /dev/null
+++ b/compiler/optimizing/scheduler_arm64.h
@@ -0,0 +1,117 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#ifndef ART_COMPILER_OPTIMIZING_SCHEDULER_ARM64_H_
+#define ART_COMPILER_OPTIMIZING_SCHEDULER_ARM64_H_
+
+#include "scheduler.h"
+
+namespace art {
+namespace arm64 {
+
+static constexpr uint32_t kArm64MemoryLoadLatency = 5;
+static constexpr uint32_t kArm64MemoryStoreLatency = 3;
+
+static constexpr uint32_t kArm64CallInternalLatency = 10;
+static constexpr uint32_t kArm64CallLatency = 5;
+
+// AArch64 instruction latency.
+// We currently assume that all arm64 CPUs share the same instruction latency list.
+static constexpr uint32_t kArm64IntegerOpLatency = 2;
+static constexpr uint32_t kArm64FloatingPointOpLatency = 5;
+
+
+static constexpr uint32_t kArm64DataProcWithShifterOpLatency = 3;
+static constexpr uint32_t kArm64DivDoubleLatency = 30;
+static constexpr uint32_t kArm64DivFloatLatency = 15;
+static constexpr uint32_t kArm64DivIntegerLatency = 5;
+static constexpr uint32_t kArm64LoadStringInternalLatency = 7;
+static constexpr uint32_t kArm64MulFloatingPointLatency = 6;
+static constexpr uint32_t kArm64MulIntegerLatency = 6;
+static constexpr uint32_t kArm64TypeConversionFloatingPointIntegerLatency = 5;
+
+class SchedulingLatencyVisitorARM64 : public SchedulingLatencyVisitor {
+ public:
+ // Default visitor for instructions not handled specifically below.
+ void VisitInstruction(HInstruction* ATTRIBUTE_UNUSED) {
+ last_visited_latency_ = kArm64IntegerOpLatency;
+ }
+
+// We add a second unused parameter to be able to use this macro like the others
+// defined in `nodes.h`.
+#define FOR_EACH_SCHEDULED_COMMON_INSTRUCTION(M) \
+ M(ArrayGet , unused) \
+ M(ArrayLength , unused) \
+ M(ArraySet , unused) \
+ M(BinaryOperation , unused) \
+ M(BoundsCheck , unused) \
+ M(Div , unused) \
+ M(InstanceFieldGet , unused) \
+ M(InstanceOf , unused) \
+ M(Invoke , unused) \
+ M(LoadString , unused) \
+ M(Mul , unused) \
+ M(NewArray , unused) \
+ M(NewInstance , unused) \
+ M(Rem , unused) \
+ M(StaticFieldGet , unused) \
+ M(SuspendCheck , unused) \
+ M(TypeConversion , unused)
+
+#define FOR_EACH_SCHEDULED_SHARED_INSTRUCTION(M) \
+ M(BitwiseNegatedRight, unused) \
+ M(MultiplyAccumulate, unused) \
+ M(IntermediateAddress, unused)
+
+#define DECLARE_VISIT_INSTRUCTION(type, unused) \
+ void Visit##type(H##type* instruction) OVERRIDE;
+
+ FOR_EACH_SCHEDULED_COMMON_INSTRUCTION(DECLARE_VISIT_INSTRUCTION)
+ FOR_EACH_SCHEDULED_SHARED_INSTRUCTION(DECLARE_VISIT_INSTRUCTION)
+ FOR_EACH_CONCRETE_INSTRUCTION_ARM64(DECLARE_VISIT_INSTRUCTION)
+
+#undef DECLARE_VISIT_INSTRUCTION
+};
+
+class HSchedulerARM64 : public HScheduler {
+ public:
+ HSchedulerARM64(ArenaAllocator* arena, SchedulingNodeSelector* selector)
+ : HScheduler(arena, &arm64_latency_visitor_, selector) {}
+ ~HSchedulerARM64() OVERRIDE {}
+
+ bool IsSchedulable(const HInstruction* instruction) const OVERRIDE {
+#define CASE_INSTRUCTION_KIND(type, unused) case \
+ HInstruction::InstructionKind::k##type:
+ switch (instruction->GetKind()) {
+ FOR_EACH_SCHEDULED_SHARED_INSTRUCTION(CASE_INSTRUCTION_KIND)
+ return true;
+ FOR_EACH_CONCRETE_INSTRUCTION_ARM64(CASE_INSTRUCTION_KIND)
+ return true;
+ default:
+ return HScheduler::IsSchedulable(instruction);
+ }
+#undef CASE_INSTRUCTION_KIND
+ }
+
+ private:
+ SchedulingLatencyVisitorARM64 arm64_latency_visitor_;
+ DISALLOW_COPY_AND_ASSIGN(HSchedulerARM64);
+};
+
+} // namespace arm64
+} // namespace art
+
+#endif // ART_COMPILER_OPTIMIZING_SCHEDULER_ARM64_H_
diff --git a/compiler/optimizing/scheduler_test.cc b/compiler/optimizing/scheduler_test.cc
new file mode 100644
index 0000000000..31d13e2a26
--- /dev/null
+++ b/compiler/optimizing/scheduler_test.cc
@@ -0,0 +1,238 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "base/arena_allocator.h"
+#include "builder.h"
+#include "codegen_test_utils.h"
+#include "common_compiler_test.h"
+#include "nodes.h"
+#include "optimizing_unit_test.h"
+#include "pc_relative_fixups_x86.h"
+#include "register_allocator.h"
+#include "scheduler.h"
+
+#ifdef ART_ENABLE_CODEGEN_arm64
+#include "scheduler_arm64.h"
+#endif
+
+namespace art {
+
+// Return all combinations of ISA and code generator that are executable on
+// hardware, or on simulator, and that we'd like to test.
+static ::std::vector<CodegenTargetConfig> GetTargetConfigs() {
+ ::std::vector<CodegenTargetConfig> v;
+ ::std::vector<CodegenTargetConfig> test_config_candidates = {
+#ifdef ART_ENABLE_CODEGEN_arm
+ CodegenTargetConfig(kArm, create_codegen_arm),
+ CodegenTargetConfig(kThumb2, create_codegen_arm),
+#endif
+#ifdef ART_ENABLE_CODEGEN_arm64
+ CodegenTargetConfig(kArm64, create_codegen_arm64),
+#endif
+#ifdef ART_ENABLE_CODEGEN_x86
+ CodegenTargetConfig(kX86, create_codegen_x86),
+#endif
+#ifdef ART_ENABLE_CODEGEN_x86_64
+ CodegenTargetConfig(kX86_64, create_codegen_x86_64),
+#endif
+#ifdef ART_ENABLE_CODEGEN_mips
+ CodegenTargetConfig(kMips, create_codegen_mips),
+#endif
+#ifdef ART_ENABLE_CODEGEN_mips64
+ CodegenTargetConfig(kMips64, create_codegen_mips64)
+#endif
+ };
+
+ for (auto test_config : test_config_candidates) {
+ if (CanExecute(test_config.GetInstructionSet())) {
+ v.push_back(test_config);
+ }
+ }
+
+ return v;
+}
+
+class SchedulerTest : public CommonCompilerTest {};
+
+#ifdef ART_ENABLE_CODEGEN_arm64
+TEST_F(SchedulerTest, DependencyGraph) {
+ ArenaPool pool;
+ ArenaAllocator allocator(&pool);
+ HGraph* graph = CreateGraph(&allocator);
+ HBasicBlock* entry = new (&allocator) HBasicBlock(graph);
+ HBasicBlock* block1 = new (&allocator) HBasicBlock(graph);
+ graph->AddBlock(entry);
+ graph->AddBlock(block1);
+ graph->SetEntryBlock(entry);
+
+ // entry:
+ // array ParameterValue
+ // c1 IntConstant
+ // c2 IntConstant
+ // block1:
+ // add1 Add [c1, c2]
+ // add2 Add [add1, c2]
+ // mul Mul [add1, add2]
+ // div_check DivZeroCheck [add2] (env: add2, mul)
+ // div Div [add1, div_check]
+ // array_get1 ArrayGet [array, add1]
+ // array_set1 ArraySet [array, add1, add2]
+ // array_get2 ArrayGet [array, add1]
+ // array_set2 ArraySet [array, add1, add2]
+
+ HInstruction* array = new (&allocator) HParameterValue(graph->GetDexFile(),
+ dex::TypeIndex(0),
+ 0,
+ Primitive::kPrimNot);
+ HInstruction* c1 = graph->GetIntConstant(1);
+ HInstruction* c2 = graph->GetIntConstant(10);
+ HInstruction* add1 = new (&allocator) HAdd(Primitive::kPrimInt, c1, c2);
+ HInstruction* add2 = new (&allocator) HAdd(Primitive::kPrimInt, add1, c2);
+ HInstruction* mul = new (&allocator) HMul(Primitive::kPrimInt, add1, add2);
+ HInstruction* div_check = new (&allocator) HDivZeroCheck(add2, 0);
+ HInstruction* div = new (&allocator) HDiv(Primitive::kPrimInt, add1, div_check, 0);
+ HInstruction* array_get1 = new (&allocator) HArrayGet(array, add1, Primitive::kPrimInt, 0);
+ HInstruction* array_set1 = new (&allocator) HArraySet(array, add1, add2, Primitive::kPrimInt, 0);
+ HInstruction* array_get2 = new (&allocator) HArrayGet(array, add1, Primitive::kPrimInt, 0);
+ HInstruction* array_set2 = new (&allocator) HArraySet(array, add1, add2, Primitive::kPrimInt, 0);
+
+ DCHECK(div_check->CanThrow());
+
+ entry->AddInstruction(array);
+
+ HInstruction* block_instructions[] = {add1,
+ add2,
+ mul,
+ div_check,
+ div,
+ array_get1,
+ array_set1,
+ array_get2,
+ array_set2};
+ for (auto instr : block_instructions) {
+ block1->AddInstruction(instr);
+ }
+
+ HEnvironment* environment = new (&allocator) HEnvironment(&allocator,
+ 2,
+ graph->GetArtMethod(),
+ 0,
+ div_check);
+ div_check->SetRawEnvironment(environment);
+ environment->SetRawEnvAt(0, add2);
+ add2->AddEnvUseAt(div_check->GetEnvironment(), 0);
+ environment->SetRawEnvAt(1, mul);
+ mul->AddEnvUseAt(div_check->GetEnvironment(), 1);
+
+ ArenaAllocator* arena = graph->GetArena();
+ CriticalPathSchedulingNodeSelector critical_path_selector;
+ arm64::HSchedulerARM64 scheduler(arena, &critical_path_selector);
+ SchedulingGraph scheduling_graph(&scheduler, arena);
+ // Instructions must be inserted in reverse order into the scheduling graph.
+ for (auto instr : ReverseRange(block_instructions)) {
+ scheduling_graph.AddNode(instr);
+ }
+
+ // Should not have dependencies cross basic blocks.
+ ASSERT_FALSE(scheduling_graph.HasImmediateDataDependency(add1, c1));
+ ASSERT_FALSE(scheduling_graph.HasImmediateDataDependency(add2, c2));
+
+ // Define-use dependency.
+ ASSERT_TRUE(scheduling_graph.HasImmediateDataDependency(add2, add1));
+ ASSERT_FALSE(scheduling_graph.HasImmediateDataDependency(add1, add2));
+ ASSERT_TRUE(scheduling_graph.HasImmediateDataDependency(div_check, add2));
+ ASSERT_FALSE(scheduling_graph.HasImmediateDataDependency(div_check, add1));
+ ASSERT_TRUE(scheduling_graph.HasImmediateDataDependency(div, div_check));
+ ASSERT_TRUE(scheduling_graph.HasImmediateDataDependency(array_set1, add1));
+ ASSERT_TRUE(scheduling_graph.HasImmediateDataDependency(array_set1, add2));
+
+ // Read and write dependencies
+ ASSERT_TRUE(scheduling_graph.HasImmediateOtherDependency(array_set1, array_get1));
+ ASSERT_TRUE(scheduling_graph.HasImmediateOtherDependency(array_set2, array_get2));
+ ASSERT_TRUE(scheduling_graph.HasImmediateOtherDependency(array_get2, array_set1));
+ ASSERT_TRUE(scheduling_graph.HasImmediateOtherDependency(array_set2, array_set1));
+
+ // Env dependency.
+ ASSERT_TRUE(scheduling_graph.HasImmediateOtherDependency(div_check, mul));
+ ASSERT_FALSE(scheduling_graph.HasImmediateOtherDependency(mul, div_check));
+
+ // CanThrow.
+ ASSERT_TRUE(scheduling_graph.HasImmediateOtherDependency(array_set1, div_check));
+}
+#endif
+
+static void CompileWithRandomSchedulerAndRun(const uint16_t* data,
+ bool has_result,
+ int expected) {
+ for (CodegenTargetConfig target_config : GetTargetConfigs()) {
+ ArenaPool pool;
+ ArenaAllocator arena(&pool);
+ HGraph* graph = CreateCFG(&arena, data);
+
+ // Schedule the graph randomly.
+ HInstructionScheduling scheduling(graph, target_config.GetInstructionSet());
+ scheduling.Run(/*only_optimize_loop_blocks*/ false, /*schedule_randomly*/ true);
+
+ RunCode(target_config,
+ graph,
+ [](HGraph* graph_arg) { RemoveSuspendChecks(graph_arg); },
+ has_result, expected);
+ }
+}
+
+TEST_F(SchedulerTest, RandomScheduling) {
+ //
+ // Java source: crafted code to make sure (random) scheduling should get correct result.
+ //
+ // int result = 0;
+ // float fr = 10.0f;
+ // for (int i = 1; i < 10; i++) {
+ // fr ++;
+ // int t1 = result >> i;
+ // int t2 = result * i;
+ // result = result + t1 - t2;
+ // fr = fr / i;
+ // result += (int)fr;
+ // }
+ // return result;
+ //
+ const uint16_t data[] = SIX_REGISTERS_CODE_ITEM(
+ Instruction::CONST_4 | 0 << 12 | 2 << 8, // const/4 v2, #int 0
+ Instruction::CONST_HIGH16 | 0 << 8, 0x4120, // const/high16 v0, #float 10.0 // #41200000
+ Instruction::CONST_4 | 1 << 12 | 1 << 8, // const/4 v1, #int 1
+ Instruction::CONST_16 | 5 << 8, 0x000a, // const/16 v5, #int 10
+ Instruction::IF_GE | 5 << 12 | 1 << 8, 0x0014, // if-ge v1, v5, 001a // +0014
+ Instruction::CONST_HIGH16 | 5 << 8, 0x3f80, // const/high16 v5, #float 1.0 // #3f800000
+ Instruction::ADD_FLOAT_2ADDR | 5 << 12 | 0 << 8, // add-float/2addr v0, v5
+ Instruction::SHR_INT | 3 << 8, 1 << 8 | 2 , // shr-int v3, v2, v1
+ Instruction::MUL_INT | 4 << 8, 1 << 8 | 2, // mul-int v4, v2, v1
+ Instruction::ADD_INT | 5 << 8, 3 << 8 | 2, // add-int v5, v2, v3
+ Instruction::SUB_INT | 2 << 8, 4 << 8 | 5, // sub-int v2, v5, v4
+ Instruction::INT_TO_FLOAT | 1 << 12 | 5 << 8, // int-to-float v5, v1
+ Instruction::DIV_FLOAT_2ADDR | 5 << 12 | 0 << 8, // div-float/2addr v0, v5
+ Instruction::FLOAT_TO_INT | 0 << 12 | 5 << 8, // float-to-int v5, v0
+ Instruction::ADD_INT_2ADDR | 5 << 12 | 2 << 8, // add-int/2addr v2, v5
+ Instruction::ADD_INT_LIT8 | 1 << 8, 1 << 8 | 1, // add-int/lit8 v1, v1, #int 1 // #01
+ Instruction::GOTO | 0xeb << 8, // goto 0004 // -0015
+ Instruction::RETURN | 2 << 8); // return v2
+
+ constexpr int kNumberOfRuns = 10;
+ for (int i = 0; i < kNumberOfRuns; ++i) {
+ CompileWithRandomSchedulerAndRun(data, true, 138774);
+ }
+}
+
+} // namespace art
diff --git a/compiler/optimizing/sharpening.cc b/compiler/optimizing/sharpening.cc
index c5294107ae..e745c73091 100644
--- a/compiler/optimizing/sharpening.cc
+++ b/compiler/optimizing/sharpening.cc
@@ -97,7 +97,9 @@ void HSharpening::ProcessInvokeStaticOrDirect(HInvokeStaticOrDirect* invoke) {
// class is initialized already or being initialized, and the call will not
// be invoked once the method is deoptimized.
- if (callee == codegen_->GetGraph()->GetArtMethod()) {
+ // We don't optimize for debuggable as it would prevent us from obsoleting the method in some
+ // situations.
+ if (callee == codegen_->GetGraph()->GetArtMethod() && !codegen_->GetGraph()->IsDebuggable()) {
// Recursive call.
method_load_kind = HInvokeStaticOrDirect::MethodLoadKind::kRecursive;
code_ptr_location = HInvokeStaticOrDirect::CodePtrLocation::kCallSelf;
diff --git a/compiler/optimizing/ssa_builder.cc b/compiler/optimizing/ssa_builder.cc
index d6edb650ba..ae1e369999 100644
--- a/compiler/optimizing/ssa_builder.cc
+++ b/compiler/optimizing/ssa_builder.cc
@@ -497,11 +497,7 @@ GraphAnalysisResult SsaBuilder::BuildSsa() {
// 4) Compute type of reference type instructions. The pass assumes that
// NullConstant has been fixed up.
- ReferenceTypePropagation(graph_,
- class_loader_,
- dex_cache_,
- handles_,
- /* is_first_run */ true).Run();
+ ReferenceTypePropagation(graph_, dex_cache_, handles_, /* is_first_run */ true).Run();
// 5) HInstructionBuilder duplicated ArrayGet instructions with ambiguous type
// (int/float or long/double) and marked ArraySets with ambiguous input type.
diff --git a/compiler/optimizing/ssa_builder.h b/compiler/optimizing/ssa_builder.h
index 978f113ec4..45dac54115 100644
--- a/compiler/optimizing/ssa_builder.h
+++ b/compiler/optimizing/ssa_builder.h
@@ -48,11 +48,9 @@ namespace art {
class SsaBuilder : public ValueObject {
public:
SsaBuilder(HGraph* graph,
- Handle<mirror::ClassLoader> class_loader,
Handle<mirror::DexCache> dex_cache,
VariableSizedHandleScope* handles)
: graph_(graph),
- class_loader_(class_loader),
dex_cache_(dex_cache),
handles_(handles),
agets_fixed_(false),
@@ -117,7 +115,6 @@ class SsaBuilder : public ValueObject {
void RemoveRedundantUninitializedStrings();
HGraph* graph_;
- Handle<mirror::ClassLoader> class_loader_;
Handle<mirror::DexCache> dex_cache_;
VariableSizedHandleScope* const handles_;
diff --git a/compiler/optimizing/stack_map_stream.cc b/compiler/optimizing/stack_map_stream.cc
index 1b9bd7eb31..668108daa4 100644
--- a/compiler/optimizing/stack_map_stream.cc
+++ b/compiler/optimizing/stack_map_stream.cc
@@ -16,6 +16,9 @@
#include "stack_map_stream.h"
+#include <unordered_map>
+
+#include "base/stl_util.h"
#include "art_method.h"
#include "runtime.h"
#include "scoped_thread_state_change-inl.h"
@@ -40,6 +43,7 @@ void StackMapStream::BeginStackMapEntry(uint32_t dex_pc,
current_entry_.inline_infos_start_index = inline_infos_.size();
current_entry_.dex_register_map_hash = 0;
current_entry_.same_dex_register_map_as_ = kNoSameDexMapFound;
+ current_entry_.stack_mask_index = 0;
if (num_dex_registers != 0) {
current_entry_.live_dex_registers_mask =
ArenaBitVector::Create(allocator_, num_dex_registers, true, kArenaAllocStackMapStream);
@@ -153,32 +157,43 @@ CodeOffset StackMapStream::ComputeMaxNativePcCodeOffset() const {
}
size_t StackMapStream::PrepareForFillIn() {
- int stack_mask_number_of_bits = stack_mask_max_ + 1; // Need room for max element too.
+ const size_t stack_mask_size_in_bits = stack_mask_max_ + 1; // Need room for max element too.
+ const size_t number_of_stack_masks = PrepareStackMasks(stack_mask_size_in_bits);
+ const size_t register_mask_size_in_bits = MinimumBitsToStore(register_mask_max_);
+ const size_t number_of_register_masks = PrepareRegisterMasks();
dex_register_maps_size_ = ComputeDexRegisterMapsSize();
ComputeInlineInfoEncoding(); // needs dex_register_maps_size_.
inline_info_size_ = inline_infos_.size() * inline_info_encoding_.GetEntrySize();
CodeOffset max_native_pc_offset = ComputeMaxNativePcCodeOffset();
- // The stack map contains compressed native offsets.
- size_t stack_map_size = stack_map_encoding_.SetFromSizes(max_native_pc_offset.CompressedValue(),
- dex_pc_max_,
- dex_register_maps_size_,
- inline_info_size_,
- register_mask_max_,
- stack_mask_number_of_bits);
+ // The stack map contains compressed native PC offsets.
+ const size_t stack_map_size = stack_map_encoding_.SetFromSizes(
+ max_native_pc_offset.CompressedValue(),
+ dex_pc_max_,
+ dex_register_maps_size_,
+ inline_info_size_,
+ number_of_register_masks,
+ number_of_stack_masks);
stack_maps_size_ = RoundUp(stack_maps_.size() * stack_map_size, kBitsPerByte) / kBitsPerByte;
dex_register_location_catalog_size_ = ComputeDexRegisterLocationCatalogSize();
-
- size_t non_header_size =
+ const size_t stack_masks_bits = number_of_stack_masks * stack_mask_size_in_bits;
+ const size_t register_masks_bits = number_of_register_masks * register_mask_size_in_bits;
+ // Register masks are last, stack masks are right before that last.
+ // They are both bit packed / aligned.
+ const size_t non_header_size =
stack_maps_size_ +
dex_register_location_catalog_size_ +
dex_register_maps_size_ +
- inline_info_size_;
+ inline_info_size_ +
+ RoundUp(stack_masks_bits + register_masks_bits, kBitsPerByte) / kBitsPerByte;
// Prepare the CodeInfo variable-sized encoding.
CodeInfoEncoding code_info_encoding;
code_info_encoding.non_header_size = non_header_size;
code_info_encoding.number_of_stack_maps = stack_maps_.size();
- code_info_encoding.stack_map_size_in_bits = stack_map_size;
+ code_info_encoding.number_of_stack_masks = number_of_stack_masks;
+ code_info_encoding.number_of_register_masks = number_of_register_masks;
+ code_info_encoding.stack_mask_size_in_bits = stack_mask_size_in_bits;
+ code_info_encoding.register_mask_size_in_bits = register_mask_size_in_bits;
code_info_encoding.stack_map_encoding = stack_map_encoding_;
code_info_encoding.inline_info_encoding = inline_info_encoding_;
code_info_encoding.number_of_location_catalog_entries = location_catalog_entries_.size();
@@ -321,18 +336,8 @@ void StackMapStream::FillIn(MemoryRegion region) {
stack_map.SetDexPc(stack_map_encoding_, entry.dex_pc);
stack_map.SetNativePcCodeOffset(stack_map_encoding_, entry.native_pc_code_offset);
- stack_map.SetRegisterMask(stack_map_encoding_, entry.register_mask);
- size_t number_of_stack_mask_bits = code_info.GetNumberOfStackMaskBits(encoding);
- if (entry.sp_mask != nullptr) {
- for (size_t bit = 0; bit < number_of_stack_mask_bits; bit++) {
- stack_map.SetStackMaskBit(stack_map_encoding_, bit, entry.sp_mask->IsBitSet(bit));
- }
- } else {
- // The MemoryRegion does not have to be zeroed, so make sure we clear the bits.
- for (size_t bit = 0; bit < number_of_stack_mask_bits; bit++) {
- stack_map.SetStackMaskBit(stack_map_encoding_, bit, false);
- }
- }
+ stack_map.SetRegisterMaskIndex(stack_map_encoding_, entry.register_mask_index);
+ stack_map.SetStackMaskIndex(stack_map_encoding_, entry.stack_mask_index);
if (entry.num_dex_registers == 0 || (entry.live_dex_registers_mask->NumSetBits() == 0)) {
// No dex map available.
@@ -353,7 +358,7 @@ void StackMapStream::FillIn(MemoryRegion region) {
next_dex_register_map_offset += register_region.size();
DexRegisterMap dex_register_map(register_region);
stack_map.SetDexRegisterMapOffset(
- stack_map_encoding_, register_region.start() - dex_register_locations_region.start());
+ stack_map_encoding_, register_region.begin() - dex_register_locations_region.begin());
// Set the dex register location.
FillInDexRegisterMap(dex_register_map,
@@ -373,7 +378,7 @@ void StackMapStream::FillIn(MemoryRegion region) {
// Currently relative to the dex register map.
stack_map.SetInlineDescriptorOffset(
- stack_map_encoding_, inline_region.start() - dex_register_locations_region.start());
+ stack_map_encoding_, inline_region.begin() - dex_register_locations_region.begin());
inline_info.SetDepth(inline_info_encoding_, entry.inlining_depth);
DCHECK_LE(entry.inline_infos_start_index + entry.inlining_depth, inline_infos_.size());
@@ -408,7 +413,7 @@ void StackMapStream::FillIn(MemoryRegion region) {
DexRegisterMap dex_register_map(register_region);
inline_info.SetDexRegisterMapOffsetAtDepth(
inline_info_encoding_,
- depth, register_region.start() - dex_register_locations_region.start());
+ depth, register_region.begin() - dex_register_locations_region.begin());
FillInDexRegisterMap(dex_register_map,
inline_entry.num_dex_registers,
@@ -423,6 +428,25 @@ void StackMapStream::FillIn(MemoryRegion region) {
}
}
+ // Write stack masks table.
+ size_t stack_mask_bits = encoding.stack_mask_size_in_bits;
+ if (stack_mask_bits > 0) {
+ size_t stack_mask_bytes = RoundUp(stack_mask_bits, kBitsPerByte) / kBitsPerByte;
+ for (size_t i = 0; i < encoding.number_of_stack_masks; ++i) {
+ MemoryRegion source(&stack_masks_[i * stack_mask_bytes], stack_mask_bytes);
+ BitMemoryRegion stack_mask = code_info.GetStackMask(encoding, i);
+ for (size_t bit_index = 0; bit_index < encoding.stack_mask_size_in_bits; ++bit_index) {
+ stack_mask.StoreBit(bit_index, source.LoadBit(bit_index));
+ }
+ }
+ }
+
+ // Write register masks table.
+ for (size_t i = 0; i < encoding.number_of_register_masks; ++i) {
+ BitMemoryRegion register_mask = code_info.GetRegisterMask(encoding, i);
+ register_mask.StoreBits(0, register_masks_[i], encoding.register_mask_size_in_bits);
+ }
+
// Verify all written data in debug build.
if (kIsDebugBuild) {
CheckCodeInfo(region);
@@ -536,6 +560,38 @@ void StackMapStream::CheckDexRegisterMap(const CodeInfo& code_info,
}
}
+size_t StackMapStream::PrepareRegisterMasks() {
+ register_masks_.resize(stack_maps_.size(), 0u);
+ std::unordered_map<uint32_t, size_t> dedupe;
+ for (StackMapEntry& stack_map : stack_maps_) {
+ const size_t index = dedupe.size();
+ stack_map.register_mask_index = dedupe.emplace(stack_map.register_mask, index).first->second;
+ register_masks_[index] = stack_map.register_mask;
+ }
+ return dedupe.size();
+}
+
+size_t StackMapStream::PrepareStackMasks(size_t entry_size_in_bits) {
+ // Preallocate memory since we do not want it to move (the dedup map will point into it).
+ const size_t byte_entry_size = RoundUp(entry_size_in_bits, kBitsPerByte) / kBitsPerByte;
+ stack_masks_.resize(byte_entry_size * stack_maps_.size(), 0u);
+ // For deduplicating we store the stack masks as byte packed for simplicity. We can bit pack later
+ // when copying out from stack_masks_.
+ std::unordered_map<MemoryRegion,
+ size_t,
+ FNVHash<MemoryRegion>,
+ MemoryRegion::ContentEquals> dedup(stack_maps_.size());
+ for (StackMapEntry& stack_map : stack_maps_) {
+ size_t index = dedup.size();
+ MemoryRegion stack_mask(stack_masks_.data() + index * byte_entry_size, byte_entry_size);
+ for (size_t i = 0; i < entry_size_in_bits; i++) {
+ stack_mask.StoreBit(i, stack_map.sp_mask != nullptr && stack_map.sp_mask->IsBitSet(i));
+ }
+ stack_map.stack_mask_index = dedup.emplace(stack_mask, index).first->second;
+ }
+ return dedup.size();
+}
+
// Check that all StackMapStream inputs are correctly encoded by trying to read them back.
void StackMapStream::CheckCodeInfo(MemoryRegion region) const {
CodeInfo code_info(region);
@@ -550,16 +606,19 @@ void StackMapStream::CheckCodeInfo(MemoryRegion region) const {
DCHECK_EQ(stack_map.GetNativePcOffset(stack_map_encoding, instruction_set_),
entry.native_pc_code_offset.Uint32Value(instruction_set_));
DCHECK_EQ(stack_map.GetDexPc(stack_map_encoding), entry.dex_pc);
- DCHECK_EQ(stack_map.GetRegisterMask(stack_map_encoding), entry.register_mask);
- size_t num_stack_mask_bits = code_info.GetNumberOfStackMaskBits(encoding);
+ DCHECK_EQ(stack_map.GetRegisterMaskIndex(stack_map_encoding), entry.register_mask_index);
+ DCHECK_EQ(code_info.GetRegisterMaskOf(encoding, stack_map), entry.register_mask);
+ const size_t num_stack_mask_bits = code_info.GetNumberOfStackMaskBits(encoding);
+ DCHECK_EQ(stack_map.GetStackMaskIndex(stack_map_encoding), entry.stack_mask_index);
+ BitMemoryRegion stack_mask = code_info.GetStackMaskOf(encoding, stack_map);
if (entry.sp_mask != nullptr) {
- DCHECK_GE(num_stack_mask_bits, entry.sp_mask->GetNumberOfBits());
+ DCHECK_GE(stack_mask.size_in_bits(), entry.sp_mask->GetNumberOfBits());
for (size_t b = 0; b < num_stack_mask_bits; b++) {
- DCHECK_EQ(stack_map.GetStackMaskBit(stack_map_encoding, b), entry.sp_mask->IsBitSet(b));
+ DCHECK_EQ(stack_mask.LoadBit(b), entry.sp_mask->IsBitSet(b));
}
} else {
for (size_t b = 0; b < num_stack_mask_bits; b++) {
- DCHECK_EQ(stack_map.GetStackMaskBit(stack_map_encoding, b), 0u);
+ DCHECK_EQ(stack_mask.LoadBit(b), 0u);
}
}
diff --git a/compiler/optimizing/stack_map_stream.h b/compiler/optimizing/stack_map_stream.h
index 8fec472437..b1069a17be 100644
--- a/compiler/optimizing/stack_map_stream.h
+++ b/compiler/optimizing/stack_map_stream.h
@@ -68,6 +68,8 @@ class StackMapStream : public ValueObject {
location_catalog_entries_indices_(allocator->Adapter(kArenaAllocStackMapStream)),
dex_register_locations_(allocator->Adapter(kArenaAllocStackMapStream)),
inline_infos_(allocator->Adapter(kArenaAllocStackMapStream)),
+ stack_masks_(allocator->Adapter(kArenaAllocStackMapStream)),
+ register_masks_(allocator->Adapter(kArenaAllocStackMapStream)),
stack_mask_max_(-1),
dex_pc_max_(0),
register_mask_max_(0),
@@ -107,6 +109,8 @@ class StackMapStream : public ValueObject {
BitVector* live_dex_registers_mask;
uint32_t dex_register_map_hash;
size_t same_dex_register_map_as_;
+ uint32_t stack_mask_index;
+ uint32_t register_mask_index;
};
struct InlineInfoEntry {
@@ -160,6 +164,12 @@ class StackMapStream : public ValueObject {
CodeOffset ComputeMaxNativePcCodeOffset() const;
+ // Returns the number of unique stack masks.
+ size_t PrepareStackMasks(size_t entry_size_in_bits);
+
+ // Returns the number of unique register masks.
+ size_t PrepareRegisterMasks();
+
// Returns the index of an entry with the same dex register map as the current_entry,
// or kNoSameDexMapFound if no such entry exists.
size_t FindEntryWithTheSameDexMap();
@@ -193,6 +203,8 @@ class StackMapStream : public ValueObject {
// A set of concatenated maps of Dex register locations indices to `location_catalog_entries_`.
ArenaVector<size_t> dex_register_locations_;
ArenaVector<InlineInfoEntry> inline_infos_;
+ ArenaVector<uint8_t> stack_masks_;
+ ArenaVector<uint32_t> register_masks_;
int stack_mask_max_;
uint32_t dex_pc_max_;
uint32_t register_mask_max_;
diff --git a/compiler/optimizing/stack_map_test.cc b/compiler/optimizing/stack_map_test.cc
index da4597e385..ce6d5c2b22 100644
--- a/compiler/optimizing/stack_map_test.cc
+++ b/compiler/optimizing/stack_map_test.cc
@@ -27,15 +27,16 @@ namespace art {
// Check that the stack mask of given stack map is identical
// to the given bit vector. Returns true if they are same.
static bool CheckStackMask(
- int number_of_bits,
+ const CodeInfo& code_info,
+ const CodeInfoEncoding& encoding,
const StackMap& stack_map,
- StackMapEncoding& encoding,
const BitVector& bit_vector) {
- if (bit_vector.GetHighestBitSet() >= number_of_bits) {
+ BitMemoryRegion stack_mask = code_info.GetStackMaskOf(encoding, stack_map);
+ if (bit_vector.GetNumberOfBits() > encoding.stack_mask_size_in_bits) {
return false;
}
- for (int i = 0; i < number_of_bits; ++i) {
- if (stack_map.GetStackMaskBit(encoding, i) != bit_vector.IsBitSet(i)) {
+ for (size_t i = 0; i < encoding.stack_mask_size_in_bits; ++i) {
+ if (stack_mask.LoadBit(i) != bit_vector.IsBitSet(i)) {
return false;
}
}
@@ -79,12 +80,9 @@ TEST(StackMapTest, Test1) {
ASSERT_TRUE(stack_map.Equals(code_info.GetStackMapForNativePcOffset(64, encoding)));
ASSERT_EQ(0u, stack_map.GetDexPc(encoding.stack_map_encoding));
ASSERT_EQ(64u, stack_map.GetNativePcOffset(encoding.stack_map_encoding, kRuntimeISA));
- ASSERT_EQ(0x3u, stack_map.GetRegisterMask(encoding.stack_map_encoding));
+ ASSERT_EQ(0x3u, code_info.GetRegisterMaskOf(encoding, stack_map));
- ASSERT_TRUE(CheckStackMask(code_info.GetNumberOfStackMaskBits(encoding),
- stack_map,
- encoding.stack_map_encoding,
- sp_mask));
+ ASSERT_TRUE(CheckStackMask(code_info, encoding, stack_map, sp_mask));
ASSERT_TRUE(stack_map.HasDexRegisterMap(encoding.stack_map_encoding));
DexRegisterMap dex_register_map =
@@ -197,12 +195,9 @@ TEST(StackMapTest, Test2) {
ASSERT_TRUE(stack_map.Equals(code_info.GetStackMapForNativePcOffset(64, encoding)));
ASSERT_EQ(0u, stack_map.GetDexPc(encoding.stack_map_encoding));
ASSERT_EQ(64u, stack_map.GetNativePcOffset(encoding.stack_map_encoding, kRuntimeISA));
- ASSERT_EQ(0x3u, stack_map.GetRegisterMask(encoding.stack_map_encoding));
+ ASSERT_EQ(0x3u, code_info.GetRegisterMaskOf(encoding, stack_map));
- ASSERT_TRUE(CheckStackMask(code_info.GetNumberOfStackMaskBits(encoding),
- stack_map,
- encoding.stack_map_encoding,
- sp_mask1));
+ ASSERT_TRUE(CheckStackMask(code_info, encoding, stack_map, sp_mask1));
ASSERT_TRUE(stack_map.HasDexRegisterMap(encoding.stack_map_encoding));
DexRegisterMap dex_register_map =
@@ -259,12 +254,9 @@ TEST(StackMapTest, Test2) {
ASSERT_TRUE(stack_map.Equals(code_info.GetStackMapForNativePcOffset(128u, encoding)));
ASSERT_EQ(1u, stack_map.GetDexPc(encoding.stack_map_encoding));
ASSERT_EQ(128u, stack_map.GetNativePcOffset(encoding.stack_map_encoding, kRuntimeISA));
- ASSERT_EQ(0xFFu, stack_map.GetRegisterMask(encoding.stack_map_encoding));
+ ASSERT_EQ(0xFFu, code_info.GetRegisterMaskOf(encoding, stack_map));
- ASSERT_TRUE(CheckStackMask(code_info.GetNumberOfStackMaskBits(encoding),
- stack_map,
- encoding.stack_map_encoding,
- sp_mask2));
+ ASSERT_TRUE(CheckStackMask(code_info, encoding, stack_map, sp_mask2));
ASSERT_TRUE(stack_map.HasDexRegisterMap(encoding.stack_map_encoding));
DexRegisterMap dex_register_map =
@@ -316,12 +308,9 @@ TEST(StackMapTest, Test2) {
ASSERT_TRUE(stack_map.Equals(code_info.GetStackMapForNativePcOffset(192u, encoding)));
ASSERT_EQ(2u, stack_map.GetDexPc(encoding.stack_map_encoding));
ASSERT_EQ(192u, stack_map.GetNativePcOffset(encoding.stack_map_encoding, kRuntimeISA));
- ASSERT_EQ(0xABu, stack_map.GetRegisterMask(encoding.stack_map_encoding));
+ ASSERT_EQ(0xABu, code_info.GetRegisterMaskOf(encoding, stack_map));
- ASSERT_TRUE(CheckStackMask(code_info.GetNumberOfStackMaskBits(encoding),
- stack_map,
- encoding.stack_map_encoding,
- sp_mask3));
+ ASSERT_TRUE(CheckStackMask(code_info, encoding, stack_map, sp_mask3));
ASSERT_TRUE(stack_map.HasDexRegisterMap(encoding.stack_map_encoding));
DexRegisterMap dex_register_map =
@@ -373,12 +362,9 @@ TEST(StackMapTest, Test2) {
ASSERT_TRUE(stack_map.Equals(code_info.GetStackMapForNativePcOffset(256u, encoding)));
ASSERT_EQ(3u, stack_map.GetDexPc(encoding.stack_map_encoding));
ASSERT_EQ(256u, stack_map.GetNativePcOffset(encoding.stack_map_encoding, kRuntimeISA));
- ASSERT_EQ(0xCDu, stack_map.GetRegisterMask(encoding.stack_map_encoding));
+ ASSERT_EQ(0xCDu, code_info.GetRegisterMaskOf(encoding, stack_map));
- ASSERT_TRUE(CheckStackMask(code_info.GetNumberOfStackMaskBits(encoding),
- stack_map,
- encoding.stack_map_encoding,
- sp_mask4));
+ ASSERT_TRUE(CheckStackMask(code_info, encoding, stack_map, sp_mask4));
ASSERT_TRUE(stack_map.HasDexRegisterMap(encoding.stack_map_encoding));
DexRegisterMap dex_register_map =
@@ -458,7 +444,7 @@ TEST(StackMapTest, TestNonLiveDexRegisters) {
ASSERT_TRUE(stack_map.Equals(code_info.GetStackMapForNativePcOffset(64, encoding)));
ASSERT_EQ(0u, stack_map.GetDexPc(encoding.stack_map_encoding));
ASSERT_EQ(64u, stack_map.GetNativePcOffset(encoding.stack_map_encoding, kRuntimeISA));
- ASSERT_EQ(0x3u, stack_map.GetRegisterMask(encoding.stack_map_encoding));
+ ASSERT_EQ(0x3u, code_info.GetRegisterMaskOf(encoding, stack_map));
ASSERT_TRUE(stack_map.HasDexRegisterMap(encoding.stack_map_encoding));
DexRegisterMap dex_register_map =
@@ -657,7 +643,7 @@ TEST(StackMapTest, TestNoDexRegisterMap) {
ASSERT_TRUE(stack_map.Equals(code_info.GetStackMapForNativePcOffset(64, encoding)));
ASSERT_EQ(0u, stack_map.GetDexPc(encoding.stack_map_encoding));
ASSERT_EQ(64u, stack_map.GetNativePcOffset(encoding.stack_map_encoding, kRuntimeISA));
- ASSERT_EQ(0x3u, stack_map.GetRegisterMask(encoding.stack_map_encoding));
+ ASSERT_EQ(0x3u, code_info.GetRegisterMaskOf(encoding, stack_map));
ASSERT_FALSE(stack_map.HasDexRegisterMap(encoding.stack_map_encoding));
ASSERT_FALSE(stack_map.HasInlineInfo(encoding.stack_map_encoding));
@@ -667,7 +653,7 @@ TEST(StackMapTest, TestNoDexRegisterMap) {
ASSERT_TRUE(stack_map.Equals(code_info.GetStackMapForNativePcOffset(68, encoding)));
ASSERT_EQ(1u, stack_map.GetDexPc(encoding.stack_map_encoding));
ASSERT_EQ(68u, stack_map.GetNativePcOffset(encoding.stack_map_encoding, kRuntimeISA));
- ASSERT_EQ(0x4u, stack_map.GetRegisterMask(encoding.stack_map_encoding));
+ ASSERT_EQ(0x4u, code_info.GetRegisterMaskOf(encoding, stack_map));
ASSERT_FALSE(stack_map.HasDexRegisterMap(encoding.stack_map_encoding));
ASSERT_FALSE(stack_map.HasInlineInfo(encoding.stack_map_encoding));
@@ -854,4 +840,33 @@ TEST(StackMapTest, CodeOffsetTest) {
EXPECT_EQ(offset_mips64.Uint32Value(kMips64), kMips64InstructionAlignment);
}
+
+TEST(StackMapTest, TestDeduplicateStackMask) {
+ ArenaPool pool;
+ ArenaAllocator arena(&pool);
+ StackMapStream stream(&arena, kRuntimeISA);
+
+ ArenaBitVector sp_mask(&arena, 0, true);
+ sp_mask.SetBit(1);
+ sp_mask.SetBit(4);
+ stream.BeginStackMapEntry(0, 4, 0x3, &sp_mask, 0, 0);
+ stream.EndStackMapEntry();
+ stream.BeginStackMapEntry(0, 8, 0x3, &sp_mask, 0, 0);
+ stream.EndStackMapEntry();
+
+ size_t size = stream.PrepareForFillIn();
+ void* memory = arena.Alloc(size, kArenaAllocMisc);
+ MemoryRegion region(memory, size);
+ stream.FillIn(region);
+
+ CodeInfo code_info(region);
+ CodeInfoEncoding encoding = code_info.ExtractEncoding();
+ ASSERT_EQ(2u, code_info.GetNumberOfStackMaps(encoding));
+
+ StackMap stack_map1 = code_info.GetStackMapForNativePcOffset(4, encoding);
+ StackMap stack_map2 = code_info.GetStackMapForNativePcOffset(8, encoding);
+ EXPECT_EQ(stack_map1.GetStackMaskIndex(encoding.stack_map_encoding),
+ stack_map2.GetStackMaskIndex(encoding.stack_map_encoding));
+}
+
} // namespace art
diff --git a/compiler/utils/assembler_test_base.h b/compiler/utils/assembler_test_base.h
index e7edf96722..d76cb1c1df 100644
--- a/compiler/utils/assembler_test_base.h
+++ b/compiler/utils/assembler_test_base.h
@@ -26,6 +26,7 @@
#include "android-base/strings.h"
#include "common_runtime_test.h" // For ScratchFile
+#include "exec_utils.h"
#include "utils.h"
namespace art {
diff --git a/compiler/utils/x86/assembler_x86.cc b/compiler/utils/x86/assembler_x86.cc
index d3b15ac8cf..a24d49e08d 100644
--- a/compiler/utils/x86/assembler_x86.cc
+++ b/compiler/utils/x86/assembler_x86.cc
@@ -1057,6 +1057,25 @@ void X86Assembler::andpd(XmmRegister dst, const Address& src) {
}
+void X86Assembler::shufpd(XmmRegister dst, XmmRegister src, const Immediate& imm) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitUint8(0x0F);
+ EmitUint8(0xC6);
+ EmitXmmRegisterOperand(dst, src);
+ EmitUint8(imm.value());
+}
+
+
+void X86Assembler::shufps(XmmRegister dst, XmmRegister src, const Immediate& imm) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x0F);
+ EmitUint8(0xC6);
+ EmitXmmRegisterOperand(dst, src);
+ EmitUint8(imm.value());
+}
+
+
void X86Assembler::fldl(const Address& src) {
AssemblerBuffer::EnsureCapacity ensured(&buffer_);
EmitUint8(0xDD);
diff --git a/compiler/utils/x86/assembler_x86.h b/compiler/utils/x86/assembler_x86.h
index a93616c3e5..4056ca67fb 100644
--- a/compiler/utils/x86/assembler_x86.h
+++ b/compiler/utils/x86/assembler_x86.h
@@ -472,6 +472,9 @@ class X86Assembler FINAL : public Assembler {
void orpd(XmmRegister dst, XmmRegister src);
void orps(XmmRegister dst, XmmRegister src);
+ void shufpd(XmmRegister dst, XmmRegister src, const Immediate& imm);
+ void shufps(XmmRegister dst, XmmRegister src, const Immediate& imm);
+
void flds(const Address& src);
void fstps(const Address& dst);
void fsts(const Address& dst);
diff --git a/compiler/utils/x86/assembler_x86_test.cc b/compiler/utils/x86/assembler_x86_test.cc
index 4d60a12cb9..1768d8b715 100644
--- a/compiler/utils/x86/assembler_x86_test.cc
+++ b/compiler/utils/x86/assembler_x86_test.cc
@@ -468,51 +468,43 @@ TEST_F(AssemblerX86Test, MovupdAddr) {
}
TEST_F(AssemblerX86Test, AddPS) {
- GetAssembler()->addps(x86::XmmRegister(x86::XMM0), x86::XmmRegister(x86::XMM1));
- const char* expected = "addps %xmm1, %xmm0\n";
- DriverStr(expected, "addps");
+ DriverStr(RepeatFF(&x86::X86Assembler::addps, "addps %{reg2}, %{reg1}"), "addps");
}
TEST_F(AssemblerX86Test, AddPD) {
- GetAssembler()->addpd(x86::XmmRegister(x86::XMM0), x86::XmmRegister(x86::XMM1));
- const char* expected = "addpd %xmm1, %xmm0\n";
- DriverStr(expected, "addpd");
+ DriverStr(RepeatFF(&x86::X86Assembler::addpd, "addpd %{reg2}, %{reg1}"), "addpd");
}
TEST_F(AssemblerX86Test, SubPS) {
- GetAssembler()->subps(x86::XmmRegister(x86::XMM0), x86::XmmRegister(x86::XMM1));
- const char* expected = "subps %xmm1, %xmm0\n";
- DriverStr(expected, "subps");
+ DriverStr(RepeatFF(&x86::X86Assembler::subps, "subps %{reg2}, %{reg1}"), "subps");
}
TEST_F(AssemblerX86Test, SubPD) {
- GetAssembler()->subpd(x86::XmmRegister(x86::XMM0), x86::XmmRegister(x86::XMM1));
- const char* expected = "subpd %xmm1, %xmm0\n";
- DriverStr(expected, "subpd");
+ DriverStr(RepeatFF(&x86::X86Assembler::subpd, "subpd %{reg2}, %{reg1}"), "subpd");
}
TEST_F(AssemblerX86Test, MulPS) {
- GetAssembler()->mulps(x86::XmmRegister(x86::XMM0), x86::XmmRegister(x86::XMM1));
- const char* expected = "mulps %xmm1, %xmm0\n";
- DriverStr(expected, "mulps");
+ DriverStr(RepeatFF(&x86::X86Assembler::mulps, "mulps %{reg2}, %{reg1}"), "mulps");
}
TEST_F(AssemblerX86Test, MulPD) {
- GetAssembler()->mulpd(x86::XmmRegister(x86::XMM0), x86::XmmRegister(x86::XMM1));
- const char* expected = "mulpd %xmm1, %xmm0\n";
- DriverStr(expected, "mulpd");
+ DriverStr(RepeatFF(&x86::X86Assembler::mulpd, "mulpd %{reg2}, %{reg1}"), "mulpd");
}
TEST_F(AssemblerX86Test, DivPS) {
- GetAssembler()->divps(x86::XmmRegister(x86::XMM0), x86::XmmRegister(x86::XMM1));
- const char* expected = "divps %xmm1, %xmm0\n";
- DriverStr(expected, "divps");
+ DriverStr(RepeatFF(&x86::X86Assembler::divps, "divps %{reg2}, %{reg1}"), "divps");
}
TEST_F(AssemblerX86Test, DivPD) {
- GetAssembler()->divpd(x86::XmmRegister(x86::XMM0), x86::XmmRegister(x86::XMM1));
- const char* expected = "divpd %xmm1, %xmm0\n";
- DriverStr(expected, "divpd");
+ DriverStr(RepeatFF(&x86::X86Assembler::divpd, "divpd %{reg2}, %{reg1}"), "divpd");
+}
+
+TEST_F(AssemblerX86Test, ShufPS) {
+ DriverStr(RepeatFFI(&x86::X86Assembler::shufps, 1, "shufps ${imm}, %{reg2}, %{reg1}"), "shufps");
+}
+
+TEST_F(AssemblerX86Test, ShufPD) {
+ DriverStr(RepeatFFI(&x86::X86Assembler::shufpd, 1, "shufpd ${imm}, %{reg2}, %{reg1}"), "shufpd");
}
/////////////////
diff --git a/compiler/utils/x86_64/assembler_x86_64.cc b/compiler/utils/x86_64/assembler_x86_64.cc
index 2366b68f11..c2c44ab58c 100644
--- a/compiler/utils/x86_64/assembler_x86_64.cc
+++ b/compiler/utils/x86_64/assembler_x86_64.cc
@@ -1213,6 +1213,28 @@ void X86_64Assembler::orps(XmmRegister dst, XmmRegister src) {
EmitXmmRegisterOperand(dst.LowBits(), src);
}
+
+void X86_64Assembler::shufpd(XmmRegister dst, XmmRegister src, const Immediate& imm) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitOptionalRex32(dst, src);
+ EmitUint8(0x0F);
+ EmitUint8(0xC6);
+ EmitXmmRegisterOperand(dst.LowBits(), src);
+ EmitUint8(imm.value());
+}
+
+
+void X86_64Assembler::shufps(XmmRegister dst, XmmRegister src, const Immediate& imm) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitOptionalRex32(dst, src);
+ EmitUint8(0x0F);
+ EmitUint8(0xC6);
+ EmitXmmRegisterOperand(dst.LowBits(), src);
+ EmitUint8(imm.value());
+}
+
+
void X86_64Assembler::fldl(const Address& src) {
AssemblerBuffer::EnsureCapacity ensured(&buffer_);
EmitUint8(0xDD);
diff --git a/compiler/utils/x86_64/assembler_x86_64.h b/compiler/utils/x86_64/assembler_x86_64.h
index 5923a41fe3..e140b45a00 100644
--- a/compiler/utils/x86_64/assembler_x86_64.h
+++ b/compiler/utils/x86_64/assembler_x86_64.h
@@ -495,6 +495,9 @@ class X86_64Assembler FINAL : public Assembler {
void orpd(XmmRegister dst, XmmRegister src);
void orps(XmmRegister dst, XmmRegister src);
+ void shufpd(XmmRegister dst, XmmRegister src, const Immediate& imm);
+ void shufps(XmmRegister dst, XmmRegister src, const Immediate& imm);
+
void flds(const Address& src);
void fstps(const Address& dst);
void fsts(const Address& dst);
diff --git a/compiler/utils/x86_64/assembler_x86_64_test.cc b/compiler/utils/x86_64/assembler_x86_64_test.cc
index 2812c34406..efa5cc97ea 100644
--- a/compiler/utils/x86_64/assembler_x86_64_test.cc
+++ b/compiler/utils/x86_64/assembler_x86_64_test.cc
@@ -1203,6 +1203,14 @@ TEST_F(AssemblerX86_64Test, Orpd) {
DriverStr(RepeatFF(&x86_64::X86_64Assembler::orpd, "orpd %{reg2}, %{reg1}"), "orpd");
}
+TEST_F(AssemblerX86_64Test, Shufps) {
+ DriverStr(RepeatFFI(&x86_64::X86_64Assembler::shufps, 1, "shufps ${imm}, %{reg2}, %{reg1}"), "shufps");
+}
+
+TEST_F(AssemblerX86_64Test, Shufpd) {
+ DriverStr(RepeatFFI(&x86_64::X86_64Assembler::shufpd, 1, "shufpd ${imm}, %{reg2}, %{reg1}"), "shufpd");
+}
+
TEST_F(AssemblerX86_64Test, UcomissAddress) {
GetAssembler()->ucomiss(x86_64::XmmRegister(x86_64::XMM0), x86_64::Address(
x86_64::CpuRegister(x86_64::RDI), x86_64::CpuRegister(x86_64::RBX), x86_64::TIMES_4, 12));
diff --git a/dex2oat/dex2oat.cc b/dex2oat/dex2oat.cc
index 19f0f1c182..196d8d4220 100644
--- a/dex2oat/dex2oat.cc
+++ b/dex2oat/dex2oat.cc
@@ -1282,13 +1282,10 @@ class Dex2Oat FINAL {
DCHECK_EQ(input_vdex_fd_, -1);
if (!input_vdex_.empty()) {
std::string error_msg;
- input_vdex_file_.reset(VdexFile::Open(input_vdex_,
- /* writable */ false,
- /* low_4gb */ false,
- &error_msg));
- if (input_vdex_file_ != nullptr && !input_vdex_file_->IsValid()) {
- input_vdex_file_.reset(nullptr);
- }
+ input_vdex_file_ = VdexFile::Open(input_vdex_,
+ /* writable */ false,
+ /* low_4gb */ false,
+ &error_msg);
}
DCHECK_EQ(output_vdex_fd_, -1);
@@ -1330,19 +1327,16 @@ class Dex2Oat FINAL {
PLOG(WARNING) << "Failed getting length of vdex file";
} else {
std::string error_msg;
- input_vdex_file_.reset(VdexFile::Open(input_vdex_fd_,
- s.st_size,
- "vdex",
- /* writable */ false,
- /* low_4gb */ false,
- &error_msg));
+ input_vdex_file_ = VdexFile::Open(input_vdex_fd_,
+ s.st_size,
+ "vdex",
+ /* writable */ false,
+ /* low_4gb */ false,
+ &error_msg);
// If there's any problem with the passed vdex, just warn and proceed
// without it.
if (input_vdex_file_ == nullptr) {
- PLOG(WARNING) << "Failed opening vdex file " << error_msg;
- } else if (!input_vdex_file_->IsValid()) {
- PLOG(WARNING) << "Existing vdex file is invalid";
- input_vdex_file_.reset(nullptr);
+ PLOG(WARNING) << "Failed opening vdex file: " << error_msg;
}
}
}
diff --git a/dexdump/dexdump_test.cc b/dexdump/dexdump_test.cc
index 53dda6a995..640f387a80 100644
--- a/dexdump/dexdump_test.cc
+++ b/dexdump/dexdump_test.cc
@@ -23,6 +23,7 @@
#include "common_runtime_test.h"
#include "runtime/arch/instruction_set.h"
+#include "runtime/exec_utils.h"
#include "runtime/os.h"
#include "runtime/utils.h"
#include "utils.h"
diff --git a/dexlayout/dexlayout_test.cc b/dexlayout/dexlayout_test.cc
index 46a1c43548..da1e1d26dc 100644
--- a/dexlayout/dexlayout_test.cc
+++ b/dexlayout/dexlayout_test.cc
@@ -23,6 +23,7 @@
#include "base/unix_file/fd_file.h"
#include "common_runtime_test.h"
+#include "exec_utils.h"
#include "utils.h"
namespace art {
diff --git a/dexlist/dexlist_test.cc b/dexlist/dexlist_test.cc
index 13209427c9..173a456982 100644
--- a/dexlist/dexlist_test.cc
+++ b/dexlist/dexlist_test.cc
@@ -23,6 +23,7 @@
#include "common_runtime_test.h"
#include "runtime/arch/instruction_set.h"
+#include "runtime/exec_utils.h"
#include "runtime/gc/heap.h"
#include "runtime/gc/space/image_space.h"
#include "runtime/os.h"
diff --git a/imgdiag/imgdiag_test.cc b/imgdiag/imgdiag_test.cc
index 3f2afc0696..0d46b2ea7a 100644
--- a/imgdiag/imgdiag_test.cc
+++ b/imgdiag/imgdiag_test.cc
@@ -24,6 +24,7 @@
#include "runtime/os.h"
#include "runtime/arch/instruction_set.h"
+#include "runtime/exec_utils.h"
#include "runtime/utils.h"
#include "runtime/gc/space/image_space.h"
#include "runtime/gc/heap.h"
diff --git a/oatdump/oatdump.cc b/oatdump/oatdump.cc
index 9b4d3e1156..0f02da77a1 100644
--- a/oatdump/oatdump.cc
+++ b/oatdump/oatdump.cc
@@ -589,16 +589,17 @@ class OatDumper {
kByteKindCodeInfoInlineInfo,
kByteKindCodeInfoEncoding,
kByteKindCodeInfoOther,
+ kByteKindCodeInfoStackMasks,
+ kByteKindCodeInfoRegisterMasks,
kByteKindStackMapNativePc,
kByteKindStackMapDexPc,
kByteKindStackMapDexRegisterMap,
kByteKindStackMapInlineInfo,
- kByteKindStackMapRegisterMask,
- kByteKindStackMapMask,
- kByteKindStackMapOther,
+ kByteKindStackMapRegisterMaskIndex,
+ kByteKindStackMapStackMaskIndex,
kByteKindCount,
kByteKindStackMapFirst = kByteKindCodeInfoOther,
- kByteKindStackMapLast = kByteKindStackMapOther,
+ kByteKindStackMapLast = kByteKindStackMapStackMaskIndex,
};
int64_t bits[kByteKindCount] = {};
// Since code has deduplication, seen tracks already seen pointers to avoid double counting
@@ -626,48 +627,45 @@ class OatDumper {
const int64_t stack_map_bits = std::accumulate(bits + kByteKindStackMapFirst,
bits + kByteKindStackMapLast + 1,
0u);
- Dump(os, "Code ", bits[kByteKindCode], sum);
- Dump(os, "QuickMethodHeader ", bits[kByteKindQuickMethodHeader], sum);
- Dump(os, "CodeInfoEncoding ", bits[kByteKindCodeInfoEncoding], sum);
- Dump(os, "CodeInfoLocationCatalog ", bits[kByteKindCodeInfoLocationCatalog], sum);
- Dump(os, "CodeInfoDexRegisterMap ", bits[kByteKindCodeInfoDexRegisterMap], sum);
- Dump(os, "CodeInfoInlineInfo ", bits[kByteKindCodeInfoInlineInfo], sum);
- Dump(os, "CodeInfoStackMap ", stack_map_bits, sum);
+ Dump(os, "Code ", bits[kByteKindCode], sum);
+ Dump(os, "QuickMethodHeader ", bits[kByteKindQuickMethodHeader], sum);
+ Dump(os, "CodeInfoEncoding ", bits[kByteKindCodeInfoEncoding], sum);
+ Dump(os, "CodeInfoLocationCatalog ", bits[kByteKindCodeInfoLocationCatalog], sum);
+ Dump(os, "CodeInfoDexRegisterMap ", bits[kByteKindCodeInfoDexRegisterMap], sum);
+ Dump(os, "CodeInfoInlineInfo ", bits[kByteKindCodeInfoInlineInfo], sum);
+ Dump(os, "CodeInfoStackMasks ", bits[kByteKindCodeInfoStackMasks], sum);
+ Dump(os, "CodeInfoRegisterMasks ", bits[kByteKindCodeInfoRegisterMasks], sum);
+ Dump(os, "CodeInfoStackMap ", stack_map_bits, sum);
{
ScopedIndentation indent1(&os);
Dump(os,
- "StackMapNativePc ",
+ "StackMapNativePc ",
bits[kByteKindStackMapNativePc],
stack_map_bits,
"stack map");
Dump(os,
- "StackMapDexPcEncoding ",
+ "StackMapDexPcEncoding ",
bits[kByteKindStackMapDexPc],
stack_map_bits,
"stack map");
Dump(os,
- "StackMapDexRegisterMap ",
+ "StackMapDexRegisterMap ",
bits[kByteKindStackMapDexRegisterMap],
stack_map_bits,
"stack map");
Dump(os,
- "StackMapInlineInfo ",
+ "StackMapInlineInfo ",
bits[kByteKindStackMapInlineInfo],
stack_map_bits,
"stack map");
Dump(os,
- "StackMapRegisterMaskEncoding ",
- bits[kByteKindStackMapRegisterMask],
+ "StackMapRegisterMaskIndex ",
+ bits[kByteKindStackMapRegisterMaskIndex],
stack_map_bits,
"stack map");
Dump(os,
- "StackMapMask ",
- bits[kByteKindStackMapMask],
- stack_map_bits,
- "stack map");
- Dump(os,
- "StackMapOther ",
- bits[kByteKindStackMapOther],
+ "StackMapStackMaskIndex ",
+ bits[kByteKindStackMapStackMaskIndex],
stack_map_bits,
"stack map");
}
@@ -1573,18 +1571,18 @@ class OatDumper {
Stats::kByteKindStackMapInlineInfo,
stack_map_encoding.GetInlineInfoEncoding().BitSize() * num_stack_maps);
stats_.AddBits(
- Stats::kByteKindStackMapRegisterMask,
- stack_map_encoding.GetRegisterMaskEncoding().BitSize() * num_stack_maps);
- const size_t stack_mask_bits = encoding.stack_map_size_in_bits -
- stack_map_encoding.GetStackMaskBitOffset();
+ Stats::kByteKindStackMapRegisterMaskIndex,
+ stack_map_encoding.GetRegisterMaskIndexEncoding().BitSize() * num_stack_maps);
+ stats_.AddBits(
+ Stats::kByteKindStackMapStackMaskIndex,
+ stack_map_encoding.GetStackMaskIndexEncoding().BitSize() * num_stack_maps);
stats_.AddBits(
- Stats::kByteKindStackMapMask,
- stack_mask_bits * num_stack_maps);
- const size_t stack_map_bits =
- stack_map_encoding.GetStackMaskBitOffset() + stack_mask_bits;
+ Stats::kByteKindCodeInfoStackMasks,
+ helper.GetCodeInfo().GetNumberOfStackMaskBits(encoding) *
+ encoding.number_of_stack_masks);
stats_.AddBits(
- Stats::kByteKindStackMapOther,
- (encoding.stack_map_size_in_bits - stack_map_bits) * num_stack_maps);
+ Stats::kByteKindCodeInfoRegisterMasks,
+ encoding.register_mask_size_in_bits * encoding.number_of_stack_masks);
const size_t stack_map_bytes = helper.GetCodeInfo().GetStackMapsSize(encoding);
const size_t location_catalog_bytes =
helper.GetCodeInfo().GetDexRegisterLocationCatalogSize(encoding);
@@ -2180,14 +2178,9 @@ class ImageDumper {
ScopedIndentation indent2(&state->vios_);
auto* resolved_types = dex_cache->GetResolvedTypes();
for (size_t i = 0; i < num_types; ++i) {
- auto pair = resolved_types[i].load(std::memory_order_relaxed);
+ auto* elem = resolved_types[i].Read();
size_t run = 0;
- for (size_t j = i + 1; j != num_types; ++j) {
- auto other_pair = resolved_types[j].load(std::memory_order_relaxed);
- if (pair.index != other_pair.index ||
- pair.object.Read() != other_pair.object.Read()) {
- break;
- }
+ for (size_t j = i + 1; j != num_types && elem == resolved_types[j].Read(); ++j) {
++run;
}
if (run == 0) {
@@ -2197,13 +2190,12 @@ class ImageDumper {
i = i + run;
}
std::string msg;
- auto* elem = pair.object.Read();
if (elem == nullptr) {
msg = "null";
} else {
msg = elem->PrettyClass();
}
- os << StringPrintf("%p %u %s\n", elem, pair.index, msg.c_str());
+ os << StringPrintf("%p %s\n", elem, msg.c_str());
}
}
}
diff --git a/oatdump/oatdump_test.cc b/oatdump/oatdump_test.cc
index ba57d1860c..503cd4d581 100644
--- a/oatdump/oatdump_test.cc
+++ b/oatdump/oatdump_test.cc
@@ -24,6 +24,7 @@
#include "base/unix_file/fd_file.h"
#include "runtime/arch/instruction_set.h"
+#include "runtime/exec_utils.h"
#include "runtime/gc/heap.h"
#include "runtime/gc/space/image_space.h"
#include "runtime/os.h"
diff --git a/patchoat/patchoat.cc b/patchoat/patchoat.cc
index 2546822613..9a73830f99 100644
--- a/patchoat/patchoat.cc
+++ b/patchoat/patchoat.cc
@@ -643,8 +643,8 @@ void PatchOat::PatchDexFileArrays(mirror::ObjectArray<mirror::Object>* img_roots
if (orig_strings != nullptr) {
orig_dex_cache->FixupStrings(RelocatedCopyOf(orig_strings), RelocatedPointerVisitor(this));
}
- mirror::TypeDexCacheType* orig_types = orig_dex_cache->GetResolvedTypes();
- mirror::TypeDexCacheType* relocated_types = RelocatedAddressOfPointer(orig_types);
+ GcRoot<mirror::Class>* orig_types = orig_dex_cache->GetResolvedTypes();
+ GcRoot<mirror::Class>* relocated_types = RelocatedAddressOfPointer(orig_types);
copy_dex_cache->SetField64<false>(
mirror::DexCache::ResolvedTypesOffset(),
static_cast<int64_t>(reinterpret_cast<uintptr_t>(relocated_types)));
diff --git a/profman/profile_assistant_test.cc b/profman/profile_assistant_test.cc
index 2f40fef42e..a6c3cf067b 100644
--- a/profman/profile_assistant_test.cc
+++ b/profman/profile_assistant_test.cc
@@ -18,6 +18,7 @@
#include "base/unix_file/fd_file.h"
#include "common_runtime_test.h"
+#include "exec_utils.h"
#include "profile_assistant.h"
#include "jit/profile_compilation_info.h"
#include "utils.h"
diff --git a/runtime/Android.bp b/runtime/Android.bp
index 540df5a554..276f3043d9 100644
--- a/runtime/Android.bp
+++ b/runtime/Android.bp
@@ -57,6 +57,7 @@ cc_defaults {
"dex_file_verifier.cc",
"dex_instruction.cc",
"elf_file.cc",
+ "exec_utils.cc",
"fault_handler.cc",
"gc/allocation_record.cc",
"gc/allocator/dlmalloc.cc",
@@ -576,6 +577,7 @@ art_cc_test {
"type_lookup_table_test.cc",
"utf_test.cc",
"utils_test.cc",
+ "vdex_file_test.cc",
"verifier/method_verifier_test.cc",
"verifier/reg_type_test.cc",
"zip_archive_test.cc",
diff --git a/runtime/arch/instruction_set.h b/runtime/arch/instruction_set.h
index 99aea62468..7ef9a7abb5 100644
--- a/runtime/arch/instruction_set.h
+++ b/runtime/arch/instruction_set.h
@@ -68,8 +68,8 @@ static constexpr size_t kArmAlignment = 8;
// ARM64 instruction alignment. This is the recommended alignment for maximum performance.
static constexpr size_t kArm64Alignment = 16;
-// MIPS instruction alignment. MIPS processors require code to be 4-byte aligned.
-// TODO: Can this be 4?
+// MIPS instruction alignment. MIPS processors require code to be 4-byte aligned,
+// but 64-bit literals must be 8-byte aligned.
static constexpr size_t kMipsAlignment = 8;
// X86 instruction alignment. This is the recommended alignment for maximum performance.
@@ -80,8 +80,8 @@ static constexpr size_t kThumb2InstructionAlignment = 2;
static constexpr size_t kArm64InstructionAlignment = 4;
static constexpr size_t kX86InstructionAlignment = 1;
static constexpr size_t kX86_64InstructionAlignment = 1;
-static constexpr size_t kMipsInstructionAlignment = 2;
-static constexpr size_t kMips64InstructionAlignment = 2;
+static constexpr size_t kMipsInstructionAlignment = 4;
+static constexpr size_t kMips64InstructionAlignment = 4;
const char* GetInstructionSetString(InstructionSet isa);
diff --git a/runtime/art_field-inl.h b/runtime/art_field-inl.h
index 16b73c681f..80af8e7bde 100644
--- a/runtime/art_field-inl.h
+++ b/runtime/art_field-inl.h
@@ -311,8 +311,6 @@ inline bool ArtField::IsPrimitiveType() REQUIRES_SHARED(Locks::mutator_lock_) {
template <bool kResolve>
inline ObjPtr<mirror::Class> ArtField::GetType() {
- // TODO: Refactor this function into two functions, ResolveType() and LookupType()
- // so that we can properly annotate it with no-suspension possible / suspension possible.
const uint32_t field_index = GetDexFieldIndex();
ObjPtr<mirror::Class> declaring_class = GetDeclaringClass();
if (UNLIKELY(declaring_class->IsProxyClass())) {
@@ -322,16 +320,9 @@ inline ObjPtr<mirror::Class> ArtField::GetType() {
const DexFile* const dex_file = dex_cache->GetDexFile();
const DexFile::FieldId& field_id = dex_file->GetFieldId(field_index);
ObjPtr<mirror::Class> type = dex_cache->GetResolvedType(field_id.type_idx_);
- if (UNLIKELY(type == nullptr)) {
- ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
- if (kResolve) {
- type = class_linker->ResolveType(*dex_file, field_id.type_idx_, declaring_class);
- CHECK(type != nullptr || Thread::Current()->IsExceptionPending());
- } else {
- type = class_linker->LookupResolvedType(
- *dex_file, field_id.type_idx_, dex_cache, declaring_class->GetClassLoader());
- DCHECK(!Thread::Current()->IsExceptionPending());
- }
+ if (kResolve && UNLIKELY(type == nullptr)) {
+ type = ResolveGetType(field_id.type_idx_);
+ CHECK(type != nullptr || Thread::Current()->IsExceptionPending());
}
return type;
}
diff --git a/runtime/art_field.cc b/runtime/art_field.cc
index 7e131040be..a4a6e5a4fb 100644
--- a/runtime/art_field.cc
+++ b/runtime/art_field.cc
@@ -48,6 +48,10 @@ ObjPtr<mirror::Class> ArtField::ProxyFindSystemClass(const char* descriptor) {
return Runtime::Current()->GetClassLinker()->FindSystemClass(Thread::Current(), descriptor);
}
+ObjPtr<mirror::Class> ArtField::ResolveGetType(dex::TypeIndex type_idx) {
+ return Runtime::Current()->GetClassLinker()->ResolveType(type_idx, this);
+}
+
ObjPtr<mirror::String> ArtField::ResolveGetStringName(Thread* self,
const DexFile& dex_file,
dex::StringIndex string_idx,
diff --git a/runtime/art_field.h b/runtime/art_field.h
index 75dd981136..427e103749 100644
--- a/runtime/art_field.h
+++ b/runtime/art_field.h
@@ -217,6 +217,8 @@ class ArtField FINAL {
private:
ObjPtr<mirror::Class> ProxyFindSystemClass(const char* descriptor)
REQUIRES_SHARED(Locks::mutator_lock_);
+ ObjPtr<mirror::Class> ResolveGetType(dex::TypeIndex type_idx)
+ REQUIRES_SHARED(Locks::mutator_lock_);
ObjPtr<mirror::String> ResolveGetStringName(Thread* self,
const DexFile& dex_file,
dex::StringIndex string_idx,
diff --git a/runtime/art_method-inl.h b/runtime/art_method-inl.h
index efcdbbff5a..950f1aa9f4 100644
--- a/runtime/art_method-inl.h
+++ b/runtime/art_method-inl.h
@@ -175,19 +175,12 @@ inline bool ArtMethod::HasSameDexCacheResolvedMethods(ArtMethod* other, PointerS
}
inline mirror::Class* ArtMethod::GetClassFromTypeIndex(dex::TypeIndex type_idx, bool resolve) {
- // TODO: Refactor this function into two functions, Resolve...() and Lookup...()
- // so that we can properly annotate it with no-suspension possible / suspension possible.
ObjPtr<mirror::DexCache> dex_cache = GetDexCache();
ObjPtr<mirror::Class> type = dex_cache->GetResolvedType(type_idx);
- if (UNLIKELY(type == nullptr)) {
+ if (UNLIKELY(type == nullptr) && resolve) {
ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
- if (resolve) {
- type = class_linker->ResolveType(type_idx, this);
- CHECK(type != nullptr || Thread::Current()->IsExceptionPending());
- } else {
- type = class_linker->LookupResolvedType(
- *dex_cache->GetDexFile(), type_idx, dex_cache, GetClassLoader());
- }
+ type = class_linker->ResolveType(type_idx, this);
+ CHECK(type != nullptr || Thread::Current()->IsExceptionPending());
}
return type.Ptr();
}
@@ -381,9 +374,10 @@ inline mirror::DexCache* ArtMethod::GetDexCache() {
}
}
-template<ReadBarrierOption kReadBarrierOption>
inline bool ArtMethod::IsProxyMethod() {
- return GetDeclaringClass<kReadBarrierOption>()->IsProxyClass();
+ // Avoid read barrier since the from-space version of the class will have the correct proxy class
+ // flags since they are constant for the lifetime of the class.
+ return GetDeclaringClass<kWithoutReadBarrier>()->IsProxyClass();
}
inline ArtMethod* ArtMethod::GetInterfaceMethodIfProxy(PointerSize pointer_size) {
diff --git a/runtime/art_method.cc b/runtime/art_method.cc
index 61ff41742b..6cb8544617 100644
--- a/runtime/art_method.cc
+++ b/runtime/art_method.cc
@@ -446,6 +446,8 @@ static const OatFile::OatMethod FindOatMethodFor(ArtMethod* method,
PointerSize pointer_size,
bool* found)
REQUIRES_SHARED(Locks::mutator_lock_) {
+ // We shouldn't be calling this with obsolete methods.
+ DCHECK(!method->IsObsolete());
// Although we overwrite the trampoline of non-static methods, we may get here via the resolution
// method for direct methods (or virtual methods made direct).
mirror::Class* declaring_class = method->GetDeclaringClass();
diff --git a/runtime/art_method.h b/runtime/art_method.h
index e4db2c7324..383630363e 100644
--- a/runtime/art_method.h
+++ b/runtime/art_method.h
@@ -201,6 +201,10 @@ class ArtMethod FINAL {
return (GetAccessFlags() & kAccCompileDontBother) == 0;
}
+ void SetDontCompile() {
+ AddAccessFlags(kAccCompileDontBother);
+ }
+
// A default conflict method is a special sentinel method that stands for a conflict between
// multiple default methods. It cannot be invoked, throwing an IncompatibleClassChangeError if one
// attempts to do so.
@@ -226,7 +230,7 @@ class ArtMethod FINAL {
void SetIsObsolete() {
// TODO We should really support redefining intrinsic if possible.
DCHECK(!IsIntrinsic());
- SetAccessFlags(GetAccessFlags() | kAccObsoleteMethod);
+ AddAccessFlags(kAccObsoleteMethod);
}
template <ReadBarrierOption kReadBarrierOption = kWithReadBarrier>
@@ -251,7 +255,6 @@ class ArtMethod FINAL {
return (GetAccessFlags() & kAccVarargs) != 0;
}
- template<ReadBarrierOption kReadBarrierOption = kWithReadBarrier>
bool IsProxyMethod() REQUIRES_SHARED(Locks::mutator_lock_);
bool SkipAccessChecks() {
diff --git a/runtime/base/arena_allocator.cc b/runtime/base/arena_allocator.cc
index 61e0aabbaf..9fdb0cc9d0 100644
--- a/runtime/base/arena_allocator.cc
+++ b/runtime/base/arena_allocator.cc
@@ -84,6 +84,7 @@ const char* const ArenaAllocatorStatsImpl<kCount>::kAllocNames[] = {
"Verifier ",
"CallingConv ",
"CHA ",
+ "Scheduler ",
};
template <bool kCount>
@@ -144,8 +145,11 @@ void ArenaAllocatorStatsImpl<kCount>::Dump(std::ostream& os, const Arena* first,
}
}
+#pragma GCC diagnostic push
+#pragma GCC diagnostic ignored "-Winstantiation-after-specialization"
// Explicitly instantiate the used implementation.
template class ArenaAllocatorStatsImpl<kArenaAllocatorCountAllocations>;
+#pragma GCC diagnostic pop
void ArenaAllocatorMemoryTool::DoMakeDefined(void* ptr, size_t size) {
MEMORY_TOOL_MAKE_DEFINED(ptr, size);
diff --git a/runtime/base/arena_allocator.h b/runtime/base/arena_allocator.h
index 6c764cb715..245ab3b24f 100644
--- a/runtime/base/arena_allocator.h
+++ b/runtime/base/arena_allocator.h
@@ -96,6 +96,7 @@ enum ArenaAllocKind {
kArenaAllocVerifier,
kArenaAllocCallingConvention,
kArenaAllocCHA,
+ kArenaAllocScheduler,
kNumArenaAllocKinds
};
diff --git a/runtime/base/iteration_range.h b/runtime/base/iteration_range.h
index 9d45707596..3f6f5d6221 100644
--- a/runtime/base/iteration_range.h
+++ b/runtime/base/iteration_range.h
@@ -55,7 +55,7 @@ inline IterationRange<Iter> MakeEmptyIterationRange(const Iter& it) {
}
template <typename Container>
-inline auto ReverseRange(Container& c) {
+inline auto ReverseRange(Container&& c) {
typedef typename std::reverse_iterator<decltype(c.begin())> riter;
return MakeIterationRange(riter(c.end()), riter(c.begin()));
}
diff --git a/runtime/bit_memory_region.h b/runtime/bit_memory_region.h
index 90a198193e..c3b5be458e 100644
--- a/runtime/bit_memory_region.h
+++ b/runtime/bit_memory_region.h
@@ -26,7 +26,7 @@ namespace art {
class BitMemoryRegion FINAL : public ValueObject {
public:
BitMemoryRegion() = default;
- BitMemoryRegion(MemoryRegion region, size_t bit_offset, size_t bit_size) {
+ ALWAYS_INLINE BitMemoryRegion(MemoryRegion region, size_t bit_offset, size_t bit_size) {
bit_start_ = bit_offset % kBitsPerByte;
const size_t start = bit_offset / kBitsPerByte;
const size_t end = (bit_offset + bit_size + kBitsPerByte - 1) / kBitsPerByte;
diff --git a/runtime/check_reference_map_visitor.h b/runtime/check_reference_map_visitor.h
index 93fdaa6161..a955cb5acb 100644
--- a/runtime/check_reference_map_visitor.h
+++ b/runtime/check_reference_map_visitor.h
@@ -67,7 +67,8 @@ class CheckReferenceMapVisitor : public StackVisitor {
uint16_t number_of_dex_registers = m->GetCodeItem()->registers_size_;
DexRegisterMap dex_register_map =
code_info.GetDexRegisterMapOf(stack_map, encoding, number_of_dex_registers);
- uint32_t register_mask = stack_map.GetRegisterMask(encoding.stack_map_encoding);
+ uint32_t register_mask = code_info.GetRegisterMaskOf(encoding, stack_map);
+ BitMemoryRegion stack_mask = code_info.GetStackMaskOf(encoding, stack_map);
for (int i = 0; i < number_of_references; ++i) {
int reg = registers[i];
CHECK(reg < m->GetCodeItem()->registers_size_);
@@ -80,8 +81,7 @@ class CheckReferenceMapVisitor : public StackVisitor {
break;
case DexRegisterLocation::Kind::kInStack:
DCHECK_EQ(location.GetValue() % kFrameSlotSize, 0);
- CHECK(stack_map.GetStackMaskBit(encoding.stack_map_encoding,
- location.GetValue() / kFrameSlotSize));
+ CHECK(stack_mask.LoadBit(location.GetValue() / kFrameSlotSize));
break;
case DexRegisterLocation::Kind::kInRegister:
case DexRegisterLocation::Kind::kInRegisterHigh:
diff --git a/runtime/class_linker-inl.h b/runtime/class_linker-inl.h
index e928344fb6..3438810069 100644
--- a/runtime/class_linker-inl.h
+++ b/runtime/class_linker-inl.h
@@ -78,18 +78,6 @@ inline mirror::String* ClassLinker::ResolveString(dex::StringIndex string_idx,
return string.Ptr();
}
-inline ObjPtr<mirror::Class> ClassLinker::LookupResolvedType(
- dex::TypeIndex type_idx,
- ObjPtr<mirror::DexCache> dex_cache,
- ObjPtr<mirror::ClassLoader> class_loader) {
- ObjPtr<mirror::Class> type = dex_cache->GetResolvedType(type_idx);
- if (type == nullptr) {
- type = Runtime::Current()->GetClassLinker()->LookupResolvedType(
- *dex_cache->GetDexFile(), type_idx, dex_cache, class_loader);
- }
- return type;
-}
-
inline mirror::Class* ClassLinker::ResolveType(dex::TypeIndex type_idx, ArtMethod* referrer) {
Thread::PoisonObjectPointersIfDebug();
if (kIsDebugBuild) {
@@ -103,6 +91,25 @@ inline mirror::Class* ClassLinker::ResolveType(dex::TypeIndex type_idx, ArtMetho
Handle<mirror::ClassLoader> class_loader(hs.NewHandle(declaring_class->GetClassLoader()));
const DexFile& dex_file = *dex_cache->GetDexFile();
resolved_type = ResolveType(dex_file, type_idx, dex_cache, class_loader);
+ // Note: We cannot check here to see whether we added the type to the cache. The type
+ // might be an erroneous class, which results in it being hidden from us.
+ }
+ return resolved_type.Ptr();
+}
+
+inline mirror::Class* ClassLinker::ResolveType(dex::TypeIndex type_idx, ArtField* referrer) {
+ Thread::PoisonObjectPointersIfDebug();
+ ObjPtr<mirror::Class> declaring_class = referrer->GetDeclaringClass();
+ ObjPtr<mirror::DexCache> dex_cache_ptr = declaring_class->GetDexCache();
+ ObjPtr<mirror::Class> resolved_type = dex_cache_ptr->GetResolvedType(type_idx);
+ if (UNLIKELY(resolved_type == nullptr)) {
+ StackHandleScope<2> hs(Thread::Current());
+ Handle<mirror::DexCache> dex_cache(hs.NewHandle(dex_cache_ptr));
+ Handle<mirror::ClassLoader> class_loader(hs.NewHandle(declaring_class->GetClassLoader()));
+ const DexFile& dex_file = *dex_cache->GetDexFile();
+ resolved_type = ResolveType(dex_file, type_idx, dex_cache, class_loader);
+ // Note: We cannot check here to see whether we added the type to the cache. The type
+ // might be an erroneous class, which results in it being hidden from us.
}
return resolved_type.Ptr();
}
@@ -226,7 +233,7 @@ template<ReadBarrierOption kReadBarrierOption>
ArtMethod* ClassLinker::FindMethodForProxy(ObjPtr<mirror::Class> proxy_class,
ArtMethod* proxy_method) {
DCHECK(proxy_class->IsProxyClass());
- DCHECK(proxy_method->IsProxyMethod<kReadBarrierOption>());
+ DCHECK(proxy_method->IsProxyMethod());
{
Thread* const self = Thread::Current();
ReaderMutexLock mu(self, *Locks::dex_lock_);
diff --git a/runtime/class_linker.cc b/runtime/class_linker.cc
index 866936739a..edd6e3b522 100644
--- a/runtime/class_linker.cc
+++ b/runtime/class_linker.cc
@@ -1171,23 +1171,6 @@ static void CopyNonNull(const T* src, size_t count, T* dst, const NullPred& pred
}
}
-template <typename T>
-static void CopyDexCachePairs(const std::atomic<mirror::DexCachePair<T>>* src,
- size_t count,
- std::atomic<mirror::DexCachePair<T>>* dst) {
- DCHECK_NE(count, 0u);
- DCHECK(!src[0].load(std::memory_order_relaxed).object.IsNull() ||
- src[0].load(std::memory_order_relaxed).index != 0u);
- for (size_t i = 0; i < count; ++i) {
- DCHECK_EQ(dst[i].load(std::memory_order_relaxed).index, 0u);
- DCHECK(dst[i].load(std::memory_order_relaxed).object.IsNull());
- mirror::DexCachePair<T> source = src[i].load(std::memory_order_relaxed);
- if (source.index != 0u || !source.object.IsNull()) {
- dst[i].store(source, std::memory_order_relaxed);
- }
- }
-}
-
bool ClassLinker::UpdateAppImageClassLoadersAndDexCaches(
gc::space::ImageSpace* space,
Handle<mirror::ClassLoader> class_loader,
@@ -1241,10 +1224,7 @@ bool ClassLinker::UpdateAppImageClassLoadersAndDexCaches(
if (dex_file->NumStringIds() < num_strings) {
num_strings = dex_file->NumStringIds();
}
- size_t num_types = mirror::DexCache::kDexCacheTypeCacheSize;
- if (dex_file->NumTypeIds() < num_types) {
- num_types = dex_file->NumTypeIds();
- }
+ const size_t num_types = dex_file->NumTypeIds();
const size_t num_methods = dex_file->NumMethodIds();
const size_t num_fields = dex_file->NumFieldIds();
size_t num_method_types = mirror::DexCache::kDexCacheMethodTypeCacheSize;
@@ -1263,14 +1243,28 @@ bool ClassLinker::UpdateAppImageClassLoadersAndDexCaches(
mirror::StringDexCacheType* const image_resolved_strings = dex_cache->GetStrings();
mirror::StringDexCacheType* const strings =
reinterpret_cast<mirror::StringDexCacheType*>(raw_arrays + layout.StringsOffset());
- CopyDexCachePairs(image_resolved_strings, num_strings, strings);
+ for (size_t j = 0; j < num_strings; ++j) {
+ DCHECK_EQ(strings[j].load(std::memory_order_relaxed).index, 0u);
+ DCHECK(strings[j].load(std::memory_order_relaxed).object.IsNull());
+ strings[j].store(image_resolved_strings[j].load(std::memory_order_relaxed),
+ std::memory_order_relaxed);
+ }
+ mirror::StringDexCachePair::Initialize(strings);
dex_cache->SetStrings(strings);
}
if (num_types != 0u) {
- mirror::TypeDexCacheType* const image_resolved_types = dex_cache->GetResolvedTypes();
- mirror::TypeDexCacheType* const types =
- reinterpret_cast<mirror::TypeDexCacheType*>(raw_arrays + layout.TypesOffset());
- CopyDexCachePairs(image_resolved_types, num_types, types);
+ GcRoot<mirror::Class>* const image_resolved_types = dex_cache->GetResolvedTypes();
+ GcRoot<mirror::Class>* const types =
+ reinterpret_cast<GcRoot<mirror::Class>*>(raw_arrays + layout.TypesOffset());
+ for (size_t j = 0; kIsDebugBuild && j < num_types; ++j) {
+ DCHECK(types[j].IsNull());
+ }
+ CopyNonNull(image_resolved_types,
+ num_types,
+ types,
+ [](const GcRoot<mirror::Class>& elem) {
+ return elem.IsNull();
+ });
dex_cache->SetResolvedTypes(types);
}
if (num_methods != 0u) {
@@ -1311,7 +1305,15 @@ bool ClassLinker::UpdateAppImageClassLoadersAndDexCaches(
mirror::MethodTypeDexCacheType* const method_types =
reinterpret_cast<mirror::MethodTypeDexCacheType*>(
raw_arrays + layout.MethodTypesOffset());
- CopyDexCachePairs(image_resolved_method_types, num_method_types, method_types);
+ for (size_t j = 0; j < num_method_types; ++j) {
+ DCHECK_EQ(method_types[j].load(std::memory_order_relaxed).index, 0u);
+ DCHECK(method_types[j].load(std::memory_order_relaxed).object.IsNull());
+ method_types[j].store(
+ image_resolved_method_types[j].load(std::memory_order_relaxed),
+ std::memory_order_relaxed);
+ }
+
+ mirror::MethodTypeDexCachePair::Initialize(method_types);
dex_cache->SetResolvedMethodTypes(method_types);
}
}
@@ -1333,11 +1335,11 @@ bool ClassLinker::UpdateAppImageClassLoadersAndDexCaches(
}
if (kIsDebugBuild) {
CHECK(new_class_set != nullptr);
- mirror::TypeDexCacheType* const types = dex_cache->GetResolvedTypes();
+ GcRoot<mirror::Class>* const types = dex_cache->GetResolvedTypes();
const size_t num_types = dex_cache->NumResolvedTypes();
- for (size_t j = 0; j != num_types; ++j) {
+ for (int32_t j = 0; j < static_cast<int32_t>(num_types); j++) {
// The image space is not yet added to the heap, avoid read barriers.
- ObjPtr<mirror::Class> klass = types[j].load(std::memory_order_relaxed).object.Read();
+ ObjPtr<mirror::Class> klass = types[j].Read();
if (space->HasAddress(klass.Ptr())) {
DCHECK(!klass->IsErroneous()) << klass->GetStatus();
auto it = new_class_set->Find(ClassTable::TableSlot(klass));
@@ -1698,9 +1700,9 @@ bool ClassLinker::AddImageSpace(
// The current dex file field is bogus, overwrite it so that we can get the dex file in the
// loop below.
h_dex_cache->SetDexFile(dex_file.get());
- mirror::TypeDexCacheType* const types = h_dex_cache->GetResolvedTypes();
+ GcRoot<mirror::Class>* const types = h_dex_cache->GetResolvedTypes();
for (int32_t j = 0, num_types = h_dex_cache->NumResolvedTypes(); j < num_types; j++) {
- ObjPtr<mirror::Class> klass = types[j].load(std::memory_order_relaxed).object.Read();
+ ObjPtr<mirror::Class> klass = types[j].Read();
if (klass != nullptr) {
DCHECK(!klass->IsErroneous()) << klass->GetStatus();
}
@@ -7696,9 +7698,7 @@ mirror::String* ClassLinker::ResolveString(const DexFile& dex_file,
uint32_t utf16_length;
const char* utf8_data = dex_file.StringDataAndUtf16LengthByIdx(string_idx, &utf16_length);
ObjPtr<mirror::String> string = intern_table_->InternStrong(utf16_length, utf8_data);
- if (string != nullptr) {
- dex_cache->SetResolvedString(string_idx, string);
- }
+ dex_cache->SetResolvedString(string_idx, string);
return string.Ptr();
}
@@ -7741,7 +7741,6 @@ ObjPtr<mirror::Class> ClassLinker::LookupResolvedType(const DexFile& dex_file,
}
}
if (type != nullptr && type->IsResolved()) {
- dex_cache->SetResolvedType(type_idx, type);
return type.Ptr();
}
return nullptr;
@@ -7764,12 +7763,6 @@ mirror::Class* ClassLinker::ResolveType(const DexFile& dex_file,
Thread::PoisonObjectPointersIfDebug();
ObjPtr<mirror::Class> resolved = dex_cache->GetResolvedType(type_idx);
if (resolved == nullptr) {
- // TODO: Avoid this lookup as it duplicates work done in FindClass(). It is here
- // as a workaround for FastNative JNI to avoid AssertNoPendingException() when
- // trying to resolve annotations while an exception may be pending. Bug: 34659969
- resolved = LookupResolvedType(dex_file, type_idx, dex_cache.Get(), class_loader.Get());
- }
- if (resolved == nullptr) {
Thread* self = Thread::Current();
const char* descriptor = dex_file.StringByTypeIdx(type_idx);
resolved = FindClass(self, descriptor, class_loader);
diff --git a/runtime/class_linker.h b/runtime/class_linker.h
index 21edd513ac..5042fb7609 100644
--- a/runtime/class_linker.h
+++ b/runtime/class_linker.h
@@ -262,6 +262,10 @@ class ClassLinker {
REQUIRES_SHARED(Locks::mutator_lock_)
REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_);
+ mirror::Class* ResolveType(dex::TypeIndex type_idx, ArtField* referrer)
+ REQUIRES_SHARED(Locks::mutator_lock_)
+ REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_);
+
// Look up a resolved type with the given ID from the DexFile. The ClassLoader is used to search
// for the type, since it may be referenced from but not contained within the given DexFile.
ObjPtr<mirror::Class> LookupResolvedType(const DexFile& dex_file,
@@ -269,10 +273,6 @@ class ClassLinker {
ObjPtr<mirror::DexCache> dex_cache,
ObjPtr<mirror::ClassLoader> class_loader)
REQUIRES_SHARED(Locks::mutator_lock_);
- static ObjPtr<mirror::Class> LookupResolvedType(dex::TypeIndex type_idx,
- ObjPtr<mirror::DexCache> dex_cache,
- ObjPtr<mirror::ClassLoader> class_loader)
- REQUIRES_SHARED(Locks::mutator_lock_);
// Resolve a type with the given ID from the DexFile, storing the
// result in DexCache. The ClassLoader is used to search for the
diff --git a/runtime/class_linker_test.cc b/runtime/class_linker_test.cc
index 6eee0bd617..17510bb598 100644
--- a/runtime/class_linker_test.cc
+++ b/runtime/class_linker_test.cc
@@ -914,7 +914,7 @@ TEST_F(ClassLinkerTest, LookupResolvedType) {
class_linker_->LookupResolvedType(dex_file, type_idx, dex_cache, class_loader.Get()),
klass);
// Zero out the resolved type and make sure LookupResolvedType still finds it.
- dex_cache->ClearResolvedType(type_idx);
+ dex_cache->SetResolvedType(type_idx, nullptr);
EXPECT_TRUE(dex_cache->GetResolvedType(type_idx) == nullptr);
EXPECT_OBJ_PTR_EQ(
class_linker_->LookupResolvedType(dex_file, type_idx, dex_cache, class_loader.Get()),
@@ -949,7 +949,7 @@ TEST_F(ClassLinkerTest, LookupResolvedTypeArray) {
class_linker_->LookupResolvedType(dex_file, array_idx, dex_cache.Get(), class_loader.Get()),
array_klass);
// Zero out the resolved type and make sure LookupResolvedType() still finds it.
- dex_cache->ClearResolvedType(array_idx);
+ dex_cache->SetResolvedType(array_idx, nullptr);
EXPECT_TRUE(dex_cache->GetResolvedType(array_idx) == nullptr);
EXPECT_OBJ_PTR_EQ(
class_linker_->LookupResolvedType(dex_file, array_idx, dex_cache.Get(), class_loader.Get()),
@@ -972,7 +972,7 @@ TEST_F(ClassLinkerTest, LookupResolvedTypeErroneousInit) {
class_linker_->LookupResolvedType(dex_file, type_idx, dex_cache.Get(), class_loader.Get()),
klass.Get());
// Zero out the resolved type and make sure LookupResolvedType still finds it.
- dex_cache->ClearResolvedType(type_idx);
+ dex_cache->SetResolvedType(type_idx, nullptr);
EXPECT_TRUE(dex_cache->GetResolvedType(type_idx) == nullptr);
EXPECT_OBJ_PTR_EQ(
class_linker_->LookupResolvedType(dex_file, type_idx, dex_cache.Get(), class_loader.Get()),
@@ -990,7 +990,7 @@ TEST_F(ClassLinkerTest, LookupResolvedTypeErroneousInit) {
class_linker_->LookupResolvedType(dex_file, type_idx, dex_cache.Get(), class_loader.Get()),
klass.Get());
// Zero out the resolved type and make sure LookupResolvedType() still finds it.
- dex_cache->ClearResolvedType(type_idx);
+ dex_cache->SetResolvedType(type_idx, nullptr);
EXPECT_TRUE(dex_cache->GetResolvedType(type_idx) == nullptr);
EXPECT_OBJ_PTR_EQ(
class_linker_->LookupResolvedType(dex_file, type_idx, dex_cache.Get(), class_loader.Get()),
diff --git a/runtime/dex2oat_environment_test.h b/runtime/dex2oat_environment_test.h
index 7ae9f03c83..8b0c51c998 100644
--- a/runtime/dex2oat_environment_test.h
+++ b/runtime/dex2oat_environment_test.h
@@ -25,6 +25,7 @@
#include "common_runtime_test.h"
#include "compiler_callbacks.h"
+#include "exec_utils.h"
#include "gc/heap.h"
#include "gc/space/image_space.h"
#include "oat_file_assistant.h"
diff --git a/runtime/dex_file_test.cc b/runtime/dex_file_test.cc
index 0fec856865..9dca4c0621 100644
--- a/runtime/dex_file_test.cc
+++ b/runtime/dex_file_test.cc
@@ -338,13 +338,16 @@ TEST_F(DexFileTest, ClassDefs) {
ScopedObjectAccess soa(Thread::Current());
std::unique_ptr<const DexFile> raw(OpenTestDexFile("Nested"));
ASSERT_TRUE(raw.get() != nullptr);
- EXPECT_EQ(2U, raw->NumClassDefs());
+ EXPECT_EQ(3U, raw->NumClassDefs());
const DexFile::ClassDef& c0 = raw->GetClassDef(0);
- EXPECT_STREQ("LNested$Inner;", raw->GetClassDescriptor(c0));
+ EXPECT_STREQ("LNested$1;", raw->GetClassDescriptor(c0));
const DexFile::ClassDef& c1 = raw->GetClassDef(1);
- EXPECT_STREQ("LNested;", raw->GetClassDescriptor(c1));
+ EXPECT_STREQ("LNested$Inner;", raw->GetClassDescriptor(c1));
+
+ const DexFile::ClassDef& c2 = raw->GetClassDef(2);
+ EXPECT_STREQ("LNested;", raw->GetClassDescriptor(c2));
}
TEST_F(DexFileTest, GetMethodSignature) {
diff --git a/runtime/entrypoints/entrypoint_utils-inl.h b/runtime/entrypoints/entrypoint_utils-inl.h
index 1b267eb991..28aca6c905 100644
--- a/runtime/entrypoints/entrypoint_utils-inl.h
+++ b/runtime/entrypoints/entrypoint_utils-inl.h
@@ -76,6 +76,10 @@ inline ArtMethod* GetResolvedMethod(ArtMethod* outer_method,
// Lookup the declaring class of the inlined method.
const DexFile* dex_file = caller->GetDexFile();
const DexFile::MethodId& method_id = dex_file->GetMethodId(method_index);
+ ArtMethod* inlined_method = caller->GetDexCacheResolvedMethod(method_index, kRuntimePointerSize);
+ if (inlined_method != nullptr && !inlined_method->IsRuntimeMethod()) {
+ return inlined_method;
+ }
const char* descriptor = dex_file->StringByTypeIdx(method_id.class_idx_);
ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
Thread* self = Thread::Current();
@@ -92,8 +96,7 @@ inline ArtMethod* GetResolvedMethod(ArtMethod* outer_method,
const char* method_name = dex_file->GetMethodName(method_id);
const Signature signature = dex_file->GetMethodSignature(method_id);
- ArtMethod* inlined_method =
- klass->FindDeclaredDirectMethod(method_name, signature, kRuntimePointerSize);
+ inlined_method = klass->FindDeclaredDirectMethod(method_name, signature, kRuntimePointerSize);
if (inlined_method == nullptr) {
inlined_method = klass->FindDeclaredVirtualMethod(method_name, signature, kRuntimePointerSize);
if (inlined_method == nullptr) {
@@ -103,6 +106,7 @@ inline ArtMethod* GetResolvedMethod(ArtMethod* outer_method,
<< "This must be due to duplicate classes or playing wrongly with class loaders";
}
}
+ caller->SetDexCacheResolvedMethod(method_index, inlined_method, kRuntimePointerSize);
return inlined_method;
}
@@ -705,10 +709,10 @@ inline ArtMethod* FindMethodFast(uint32_t method_idx,
return resolved_method;
} else if (type == kSuper) {
// TODO This lookup is rather slow.
- ObjPtr<mirror::DexCache> dex_cache = referrer->GetDexCache();
- dex::TypeIndex method_type_idx = dex_cache->GetDexFile()->GetMethodId(method_idx).class_idx_;
- ObjPtr<mirror::Class> method_reference_class = ClassLinker::LookupResolvedType(
- method_type_idx, dex_cache, referrer->GetClassLoader());
+ dex::TypeIndex method_type_idx =
+ referrer->GetDexFile()->GetMethodId(method_idx).class_idx_;
+ mirror::Class* method_reference_class =
+ referrer->GetDexCache()->GetResolvedType(method_type_idx);
if (method_reference_class == nullptr) {
// Need to do full type resolution...
return nullptr;
diff --git a/runtime/exec_utils.cc b/runtime/exec_utils.cc
new file mode 100644
index 0000000000..9efb1a353c
--- /dev/null
+++ b/runtime/exec_utils.cc
@@ -0,0 +1,102 @@
+/*
+ * Copyright (C) 2011 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "exec_utils.h"
+
+#include <sys/types.h>
+#include <sys/wait.h>
+#include <string>
+#include <vector>
+
+#include "android-base/stringprintf.h"
+#include "android-base/strings.h"
+
+#include "runtime.h"
+
+namespace art {
+
+using android::base::StringAppendF;
+using android::base::StringPrintf;
+
+int ExecAndReturnCode(std::vector<std::string>& arg_vector, std::string* error_msg) {
+ const std::string command_line(android::base::Join(arg_vector, ' '));
+ CHECK_GE(arg_vector.size(), 1U) << command_line;
+
+ // Convert the args to char pointers.
+ const char* program = arg_vector[0].c_str();
+ std::vector<char*> args;
+ for (size_t i = 0; i < arg_vector.size(); ++i) {
+ const std::string& arg = arg_vector[i];
+ char* arg_str = const_cast<char*>(arg.c_str());
+ CHECK(arg_str != nullptr) << i;
+ args.push_back(arg_str);
+ }
+ args.push_back(nullptr);
+
+ // fork and exec
+ pid_t pid = fork();
+ if (pid == 0) {
+ // no allocation allowed between fork and exec
+
+ // change process groups, so we don't get reaped by ProcessManager
+ setpgid(0, 0);
+
+ // (b/30160149): protect subprocesses from modifications to LD_LIBRARY_PATH, etc.
+ // Use the snapshot of the environment from the time the runtime was created.
+ char** envp = (Runtime::Current() == nullptr) ? nullptr : Runtime::Current()->GetEnvSnapshot();
+ if (envp == nullptr) {
+ execv(program, &args[0]);
+ } else {
+ execve(program, &args[0], envp);
+ }
+ PLOG(ERROR) << "Failed to execve(" << command_line << ")";
+ // _exit to avoid atexit handlers in child.
+ _exit(1);
+ } else {
+ if (pid == -1) {
+ *error_msg = StringPrintf("Failed to execv(%s) because fork failed: %s",
+ command_line.c_str(), strerror(errno));
+ return -1;
+ }
+
+ // wait for subprocess to finish
+ int status = -1;
+ pid_t got_pid = TEMP_FAILURE_RETRY(waitpid(pid, &status, 0));
+ if (got_pid != pid) {
+ *error_msg = StringPrintf("Failed after fork for execv(%s) because waitpid failed: "
+ "wanted %d, got %d: %s",
+ command_line.c_str(), pid, got_pid, strerror(errno));
+ return -1;
+ }
+ if (WIFEXITED(status)) {
+ return WEXITSTATUS(status);
+ }
+ return -1;
+ }
+}
+
+bool Exec(std::vector<std::string>& arg_vector, std::string* error_msg) {
+ int status = ExecAndReturnCode(arg_vector, error_msg);
+ if (status != 0) {
+ const std::string command_line(android::base::Join(arg_vector, ' '));
+ *error_msg = StringPrintf("Failed execv(%s) because non-0 exit status",
+ command_line.c_str());
+ return false;
+ }
+ return true;
+}
+
+} // namespace art
diff --git a/runtime/exec_utils.h b/runtime/exec_utils.h
new file mode 100644
index 0000000000..093f7b8d80
--- /dev/null
+++ b/runtime/exec_utils.h
@@ -0,0 +1,34 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#ifndef ART_RUNTIME_EXEC_UTILS_H_
+#define ART_RUNTIME_EXEC_UTILS_H_
+
+#include <string>
+#include <vector>
+
+namespace art {
+
+// Wrapper on fork/execv to run a command in a subprocess.
+// Both of these spawn child processes using the environment as it was set when the single instance
+// of the runtime (Runtime::Current()) was started. If no instance of the runtime was started, it
+// will use the current environment settings.
+bool Exec(std::vector<std::string>& arg_vector, std::string* error_msg);
+int ExecAndReturnCode(std::vector<std::string>& arg_vector, std::string* error_msg);
+
+} // namespace art
+
+#endif // ART_RUNTIME_EXEC_UTILS_H_
diff --git a/runtime/gc/collector/concurrent_copying.cc b/runtime/gc/collector/concurrent_copying.cc
index 6044053b4f..0819ba04f7 100644
--- a/runtime/gc/collector/concurrent_copying.cc
+++ b/runtime/gc/collector/concurrent_copying.cc
@@ -25,6 +25,7 @@
#include "gc/accounting/heap_bitmap-inl.h"
#include "gc/accounting/mod_union_table-inl.h"
#include "gc/accounting/space_bitmap-inl.h"
+#include "gc/gc_pause_listener.h"
#include "gc/reference_processor.h"
#include "gc/space/image_space.h"
#include "gc/space/space-inl.h"
@@ -139,7 +140,7 @@ void ConcurrentCopying::RunPhases() {
// Verify no from space refs. This causes a pause.
if (kEnableNoFromSpaceRefsVerification || kIsDebugBuild) {
TimingLogger::ScopedTiming split("(Paused)VerifyNoFromSpaceReferences", GetTimings());
- ScopedPause pause(this);
+ ScopedPause pause(this, false);
CheckEmptyMarkStack();
if (kVerboseMode) {
LOG(INFO) << "Verifying no from-space refs";
@@ -439,8 +440,27 @@ void ConcurrentCopying::FlipThreadRoots() {
gc_barrier_->Init(self, 0);
ThreadFlipVisitor thread_flip_visitor(this, heap_->use_tlab_);
FlipCallback flip_callback(this);
+
+ // This is the point where Concurrent-Copying will pause all threads. We report a pause here, if
+ // necessary. This is slightly over-reporting, as this includes the time to actually suspend
+ // threads.
+ {
+ GcPauseListener* pause_listener = GetHeap()->GetGcPauseListener();
+ if (pause_listener != nullptr) {
+ pause_listener->StartPause();
+ }
+ }
+
size_t barrier_count = Runtime::Current()->FlipThreadRoots(
&thread_flip_visitor, &flip_callback, this);
+
+ {
+ GcPauseListener* pause_listener = GetHeap()->GetGcPauseListener();
+ if (pause_listener != nullptr) {
+ pause_listener->EndPause();
+ }
+ }
+
{
ScopedThreadStateChange tsc(self, kWaitingForCheckPointsToRun);
gc_barrier_->Increment(self, barrier_count);
@@ -857,7 +877,10 @@ void ConcurrentCopying::IssueEmptyCheckpoint() {
thread->ReadFlag(kEmptyCheckpointRequest)) {
// Found a runnable thread that hasn't responded to the empty checkpoint request.
// Assume it's stuck and safe to dump its stack.
- thread->Dump(LOG_STREAM(FATAL_WITHOUT_ABORT));
+ thread->Dump(LOG_STREAM(FATAL_WITHOUT_ABORT),
+ /*dump_native_stack*/ true,
+ /*backtrace_map*/ nullptr,
+ /*force_dump_stack*/ true);
}
}
}
diff --git a/runtime/gc/collector/garbage_collector.cc b/runtime/gc/collector/garbage_collector.cc
index 01bcb7df19..14fd332b57 100644
--- a/runtime/gc/collector/garbage_collector.cc
+++ b/runtime/gc/collector/garbage_collector.cc
@@ -158,22 +158,26 @@ void GarbageCollector::ResetMeasurements() {
total_freed_bytes_ = 0;
}
-GarbageCollector::ScopedPause::ScopedPause(GarbageCollector* collector)
- : start_time_(NanoTime()), collector_(collector) {
+GarbageCollector::ScopedPause::ScopedPause(GarbageCollector* collector, bool with_reporting)
+ : start_time_(NanoTime()), collector_(collector), with_reporting_(with_reporting) {
Runtime* runtime = Runtime::Current();
runtime->GetThreadList()->SuspendAll(__FUNCTION__);
- GcPauseListener* pause_listener = runtime->GetHeap()->GetGcPauseListener();
- if (pause_listener != nullptr) {
- pause_listener->StartPause();
+ if (with_reporting) {
+ GcPauseListener* pause_listener = runtime->GetHeap()->GetGcPauseListener();
+ if (pause_listener != nullptr) {
+ pause_listener->StartPause();
+ }
}
}
GarbageCollector::ScopedPause::~ScopedPause() {
collector_->RegisterPause(NanoTime() - start_time_);
Runtime* runtime = Runtime::Current();
- GcPauseListener* pause_listener = runtime->GetHeap()->GetGcPauseListener();
- if (pause_listener != nullptr) {
- pause_listener->EndPause();
+ if (with_reporting_) {
+ GcPauseListener* pause_listener = runtime->GetHeap()->GetGcPauseListener();
+ if (pause_listener != nullptr) {
+ pause_listener->EndPause();
+ }
}
runtime->GetThreadList()->ResumeAll();
}
diff --git a/runtime/gc/collector/garbage_collector.h b/runtime/gc/collector/garbage_collector.h
index 0177e2a1ad..95601d736d 100644
--- a/runtime/gc/collector/garbage_collector.h
+++ b/runtime/gc/collector/garbage_collector.h
@@ -126,12 +126,14 @@ class GarbageCollector : public RootVisitor, public IsMarkedVisitor, public Mark
public:
class SCOPED_LOCKABLE ScopedPause {
public:
- explicit ScopedPause(GarbageCollector* collector) EXCLUSIVE_LOCK_FUNCTION(Locks::mutator_lock_);
+ explicit ScopedPause(GarbageCollector* collector, bool with_reporting = true)
+ EXCLUSIVE_LOCK_FUNCTION(Locks::mutator_lock_);
~ScopedPause() UNLOCK_FUNCTION();
private:
const uint64_t start_time_;
GarbageCollector* const collector_;
+ bool with_reporting_;
};
GarbageCollector(Heap* heap, const std::string& name);
diff --git a/runtime/gc/heap.cc b/runtime/gc/heap.cc
index 70449797c1..aa15714595 100644
--- a/runtime/gc/heap.cc
+++ b/runtime/gc/heap.cc
@@ -293,8 +293,13 @@ Heap::Heap(size_t initial_size,
if (foreground_collector_type_ == kCollectorTypeCC) {
// Need to use a low address so that we can allocate a contiguous
// 2 * Xmx space when there's no image (dex2oat for target).
+#if defined(__LP64__)
CHECK_GE(300 * MB, non_moving_space_capacity);
requested_alloc_space_begin = reinterpret_cast<uint8_t*>(300 * MB) - non_moving_space_capacity;
+#else
+ // For 32-bit, use 0x20000000 because asan reserves 0x04000000 - 0x20000000.
+ requested_alloc_space_begin = reinterpret_cast<uint8_t*>(0x20000000);
+#endif
}
// Load image space(s).
@@ -369,7 +374,12 @@ Heap::Heap(size_t initial_size,
&error_str));
CHECK(non_moving_space_mem_map != nullptr) << error_str;
// Try to reserve virtual memory at a lower address if we have a separate non moving space.
+#if defined(__LP64__)
request_begin = reinterpret_cast<uint8_t*>(300 * MB);
+#else
+ // For 32-bit, use 0x20000000 because asan reserves 0x04000000 - 0x20000000.
+ request_begin = reinterpret_cast<uint8_t*>(0x20000000) + non_moving_space_capacity;
+#endif
}
// Attempt to create 2 mem maps at or after the requested begin.
if (foreground_collector_type_ != kCollectorTypeCC) {
@@ -3352,7 +3362,7 @@ void Heap::PreGcVerificationPaused(collector::GarbageCollector* gc) {
void Heap::PreGcVerification(collector::GarbageCollector* gc) {
if (verify_pre_gc_heap_ || verify_missing_card_marks_ || verify_mod_union_table_) {
- collector::GarbageCollector::ScopedPause pause(gc);
+ collector::GarbageCollector::ScopedPause pause(gc, false);
PreGcVerificationPaused(gc);
}
}
@@ -3420,7 +3430,7 @@ void Heap::PostGcVerificationPaused(collector::GarbageCollector* gc) {
void Heap::PostGcVerification(collector::GarbageCollector* gc) {
if (verify_system_weaks_ || verify_post_gc_rosalloc_ || verify_post_gc_heap_) {
- collector::GarbageCollector::ScopedPause pause(gc);
+ collector::GarbageCollector::ScopedPause pause(gc, false);
PostGcVerificationPaused(gc);
}
}
diff --git a/runtime/gc/space/image_space.cc b/runtime/gc/space/image_space.cc
index e56f0dc613..ffbca525d9 100644
--- a/runtime/gc/space/image_space.cc
+++ b/runtime/gc/space/image_space.cc
@@ -32,6 +32,7 @@
#include "base/scoped_flock.h"
#include "base/systrace.h"
#include "base/time_utils.h"
+#include "exec_utils.h"
#include "gc/accounting/space_bitmap-inl.h"
#include "image-inl.h"
#include "image_space_fs.h"
@@ -1225,9 +1226,9 @@ class ImageSpaceLoader {
}
dex_cache->FixupStrings<kWithoutReadBarrier>(new_strings, fixup_adapter);
}
- mirror::TypeDexCacheType* types = dex_cache->GetResolvedTypes();
+ GcRoot<mirror::Class>* types = dex_cache->GetResolvedTypes();
if (types != nullptr) {
- mirror::TypeDexCacheType* new_types = fixup_adapter.ForwardObject(types);
+ GcRoot<mirror::Class>* new_types = fixup_adapter.ForwardObject(types);
if (types != new_types) {
dex_cache->SetResolvedTypes(new_types);
}
diff --git a/runtime/image.cc b/runtime/image.cc
index 87f429568d..54b099eb14 100644
--- a/runtime/image.cc
+++ b/runtime/image.cc
@@ -25,7 +25,7 @@
namespace art {
const uint8_t ImageHeader::kImageMagic[] = { 'a', 'r', 't', '\n' };
-const uint8_t ImageHeader::kImageVersion[] = { '0', '3', '7', '\0' }; // hash-based DexCache types
+const uint8_t ImageHeader::kImageVersion[] = { '0', '3', '6', '\0' }; // Erroneous resolved class.
ImageHeader::ImageHeader(uint32_t image_begin,
uint32_t image_size,
diff --git a/runtime/interpreter/interpreter_common.cc b/runtime/interpreter/interpreter_common.cc
index c235317020..28bcb97105 100644
--- a/runtime/interpreter/interpreter_common.cc
+++ b/runtime/interpreter/interpreter_common.cc
@@ -438,22 +438,14 @@ void AbortTransactionV(Thread* self, const char* fmt, va_list args) {
// about ALWAYS_INLINE (-Werror, -Wgcc-compat) in definitions.
//
-// b/30419309
-#if defined(__i386__)
-#define IF_X86_OPTNONE_ELSE_ALWAYS_INLINE __attribute__((optnone))
-#else
-#define IF_X86_OPTNONE_ELSE_ALWAYS_INLINE ALWAYS_INLINE
-#endif
-
template <bool is_range, bool do_assignability_check>
-IF_X86_OPTNONE_ELSE_ALWAYS_INLINE
-static bool DoCallCommon(ArtMethod* called_method,
- Thread* self,
- ShadowFrame& shadow_frame,
- JValue* result,
- uint16_t number_of_inputs,
- uint32_t (&arg)[Instruction::kMaxVarArgRegs],
- uint32_t vregC) REQUIRES_SHARED(Locks::mutator_lock_);
+static ALWAYS_INLINE bool DoCallCommon(ArtMethod* called_method,
+ Thread* self,
+ ShadowFrame& shadow_frame,
+ JValue* result,
+ uint16_t number_of_inputs,
+ uint32_t (&arg)[Instruction::kMaxVarArgRegs],
+ uint32_t vregC) REQUIRES_SHARED(Locks::mutator_lock_);
template <bool is_range>
ALWAYS_INLINE void CopyRegisters(ShadowFrame& caller_frame,
diff --git a/runtime/interpreter/mterp/mips64/bincmp.S b/runtime/interpreter/mterp/mips64/bincmp.S
index 07b12100fd..c2bca91ebf 100644
--- a/runtime/interpreter/mterp/mips64/bincmp.S
+++ b/runtime/interpreter/mterp/mips64/bincmp.S
@@ -6,7 +6,6 @@
* For: if-eq, if-ne, if-lt, if-ge, if-gt, if-le
*/
/* if-cmp vA, vB, +CCCC */
- .extern MterpProfileBranch
ext a2, rINST, 8, 4 # a2 <- A
ext a3, rINST, 12, 4 # a3 <- B
lh rINST, 2(rPC) # rINST <- offset (sign-extended CCCC)
diff --git a/runtime/interpreter/mterp/mips64/op_packed_switch.S b/runtime/interpreter/mterp/mips64/op_packed_switch.S
index 27ce580642..44e77a41d8 100644
--- a/runtime/interpreter/mterp/mips64/op_packed_switch.S
+++ b/runtime/interpreter/mterp/mips64/op_packed_switch.S
@@ -10,7 +10,6 @@
*/
/* op vAA, +BBBBBBBB */
.extern $func
- .extern MterpProfileBranch
lh a0, 2(rPC) # a0 <- bbbb (lo)
lh a1, 4(rPC) # a1 <- BBBB (hi)
srl a3, rINST, 8 # a3 <- AA
diff --git a/runtime/interpreter/mterp/mterp.cc b/runtime/interpreter/mterp/mterp.cc
index 369c2614a7..75ab91acba 100644
--- a/runtime/interpreter/mterp/mterp.cc
+++ b/runtime/interpreter/mterp/mterp.cc
@@ -768,38 +768,32 @@ extern "C" ssize_t MterpAddHotnessBatch(ArtMethod* method,
return MterpSetUpHotnessCountdown(method, shadow_frame);
}
-// TUNING: Unused by arm/arm64/x86/x86_64. Remove when mips/mips64 mterps support batch updates.
-extern "C" size_t MterpProfileBranch(Thread* self, ShadowFrame* shadow_frame, int32_t offset)
- REQUIRES_SHARED(Locks::mutator_lock_) {
- ArtMethod* method = shadow_frame->GetMethod();
- JValue* result = shadow_frame->GetResultRegister();
- uint32_t dex_pc = shadow_frame->GetDexPC();
- jit::Jit* jit = Runtime::Current()->GetJit();
- if ((jit != nullptr) && (offset <= 0)) {
- jit->AddSamples(self, method, 1, /*with_backedges*/ true);
- }
- int16_t countdown_value = MterpSetUpHotnessCountdown(method, shadow_frame);
- if (countdown_value == jit::kJitCheckForOSR) {
- return jit::Jit::MaybeDoOnStackReplacement(self, method, dex_pc, offset, result);
- } else {
- return false;
- }
-}
-
extern "C" size_t MterpMaybeDoOnStackReplacement(Thread* self,
ShadowFrame* shadow_frame,
int32_t offset)
REQUIRES_SHARED(Locks::mutator_lock_) {
- ArtMethod* method = shadow_frame->GetMethod();
- JValue* result = shadow_frame->GetResultRegister();
- uint32_t dex_pc = shadow_frame->GetDexPC();
- jit::Jit* jit = Runtime::Current()->GetJit();
- if (offset <= 0) {
- // Keep updating hotness in case a compilation request was dropped. Eventually it will retry.
- jit->AddSamples(self, method, 1, /*with_backedges*/ true);
+ int16_t osr_countdown = shadow_frame->GetCachedHotnessCountdown() - 1;
+ bool did_osr = false;
+ /*
+ * To reduce the cost of polling the compiler to determine whether the requested OSR
+ * compilation has completed, only check every Nth time. NOTE: the "osr_countdown <= 0"
+ * condition is satisfied either by the decrement below or the initial setting of
+ * the cached countdown field to kJitCheckForOSR, which elsewhere is asserted to be -1.
+ */
+ if (osr_countdown <= 0) {
+ ArtMethod* method = shadow_frame->GetMethod();
+ JValue* result = shadow_frame->GetResultRegister();
+ uint32_t dex_pc = shadow_frame->GetDexPC();
+ jit::Jit* jit = Runtime::Current()->GetJit();
+ osr_countdown = jit::Jit::kJitRecheckOSRThreshold;
+ if (offset <= 0) {
+ // Keep updating hotness in case a compilation request was dropped. Eventually it will retry.
+ jit->AddSamples(self, method, osr_countdown, /*with_backedges*/ true);
+ }
+ did_osr = jit::Jit::MaybeDoOnStackReplacement(self, method, dex_pc, offset, result);
}
- // Assumes caller has already determined that an OSR check is appropriate.
- return jit::Jit::MaybeDoOnStackReplacement(self, method, dex_pc, offset, result);
+ shadow_frame->SetCachedHotnessCountdown(osr_countdown);
+ return did_osr;
}
} // namespace interpreter
diff --git a/runtime/interpreter/mterp/out/mterp_mips64.S b/runtime/interpreter/mterp/out/mterp_mips64.S
index bf096664df..013bb32e8f 100644
--- a/runtime/interpreter/mterp/out/mterp_mips64.S
+++ b/runtime/interpreter/mterp/out/mterp_mips64.S
@@ -1174,7 +1174,6 @@ artMterpAsmInstructionStart = .L_op_nop
*/
/* op vAA, +BBBBBBBB */
.extern MterpDoPackedSwitch
- .extern MterpProfileBranch
lh a0, 2(rPC) # a0 <- bbbb (lo)
lh a1, 4(rPC) # a1 <- BBBB (hi)
srl a3, rINST, 8 # a3 <- AA
@@ -1201,7 +1200,6 @@ artMterpAsmInstructionStart = .L_op_nop
*/
/* op vAA, +BBBBBBBB */
.extern MterpDoSparseSwitch
- .extern MterpProfileBranch
lh a0, 2(rPC) # a0 <- bbbb (lo)
lh a1, 4(rPC) # a1 <- BBBB (hi)
srl a3, rINST, 8 # a3 <- AA
@@ -1396,7 +1394,6 @@ artMterpAsmInstructionStart = .L_op_nop
* For: if-eq, if-ne, if-lt, if-ge, if-gt, if-le
*/
/* if-cmp vA, vB, +CCCC */
- .extern MterpProfileBranch
ext a2, rINST, 8, 4 # a2 <- A
ext a3, rINST, 12, 4 # a3 <- B
lh rINST, 2(rPC) # rINST <- offset (sign-extended CCCC)
@@ -1423,7 +1420,6 @@ artMterpAsmInstructionStart = .L_op_nop
* For: if-eq, if-ne, if-lt, if-ge, if-gt, if-le
*/
/* if-cmp vA, vB, +CCCC */
- .extern MterpProfileBranch
ext a2, rINST, 8, 4 # a2 <- A
ext a3, rINST, 12, 4 # a3 <- B
lh rINST, 2(rPC) # rINST <- offset (sign-extended CCCC)
@@ -1450,7 +1446,6 @@ artMterpAsmInstructionStart = .L_op_nop
* For: if-eq, if-ne, if-lt, if-ge, if-gt, if-le
*/
/* if-cmp vA, vB, +CCCC */
- .extern MterpProfileBranch
ext a2, rINST, 8, 4 # a2 <- A
ext a3, rINST, 12, 4 # a3 <- B
lh rINST, 2(rPC) # rINST <- offset (sign-extended CCCC)
@@ -1477,7 +1472,6 @@ artMterpAsmInstructionStart = .L_op_nop
* For: if-eq, if-ne, if-lt, if-ge, if-gt, if-le
*/
/* if-cmp vA, vB, +CCCC */
- .extern MterpProfileBranch
ext a2, rINST, 8, 4 # a2 <- A
ext a3, rINST, 12, 4 # a3 <- B
lh rINST, 2(rPC) # rINST <- offset (sign-extended CCCC)
@@ -1504,7 +1498,6 @@ artMterpAsmInstructionStart = .L_op_nop
* For: if-eq, if-ne, if-lt, if-ge, if-gt, if-le
*/
/* if-cmp vA, vB, +CCCC */
- .extern MterpProfileBranch
ext a2, rINST, 8, 4 # a2 <- A
ext a3, rINST, 12, 4 # a3 <- B
lh rINST, 2(rPC) # rINST <- offset (sign-extended CCCC)
@@ -1531,7 +1524,6 @@ artMterpAsmInstructionStart = .L_op_nop
* For: if-eq, if-ne, if-lt, if-ge, if-gt, if-le
*/
/* if-cmp vA, vB, +CCCC */
- .extern MterpProfileBranch
ext a2, rINST, 8, 4 # a2 <- A
ext a3, rINST, 12, 4 # a3 <- B
lh rINST, 2(rPC) # rINST <- offset (sign-extended CCCC)
diff --git a/runtime/interpreter/unstarted_runtime.cc b/runtime/interpreter/unstarted_runtime.cc
index feb6e0857a..371e2f1e65 100644
--- a/runtime/interpreter/unstarted_runtime.cc
+++ b/runtime/interpreter/unstarted_runtime.cc
@@ -401,6 +401,25 @@ void UnstartedRuntime::UnstartedClassGetDeclaredConstructor(
result->SetL(constructor);
}
+void UnstartedRuntime::UnstartedClassGetDeclaringClass(
+ Thread* self, ShadowFrame* shadow_frame, JValue* result, size_t arg_offset) {
+ StackHandleScope<1> hs(self);
+ Handle<mirror::Class> klass(hs.NewHandle(
+ reinterpret_cast<mirror::Class*>(shadow_frame->GetVRegReference(arg_offset))));
+ if (klass->IsProxyClass() || klass->GetDexCache() == nullptr) {
+ result->SetL(nullptr);
+ return;
+ }
+ // Return null for anonymous classes.
+ JValue is_anon_result;
+ UnstartedClassIsAnonymousClass(self, shadow_frame, &is_anon_result, arg_offset);
+ if (is_anon_result.GetZ() != 0) {
+ result->SetL(nullptr);
+ return;
+ }
+ result->SetL(annotations::GetDeclaringClass(klass));
+}
+
void UnstartedRuntime::UnstartedClassGetEnclosingClass(
Thread* self, ShadowFrame* shadow_frame, JValue* result, size_t arg_offset) {
StackHandleScope<1> hs(self);
@@ -420,6 +439,23 @@ void UnstartedRuntime::UnstartedClassGetInnerClassFlags(
result->SetI(mirror::Class::GetInnerClassFlags(klass, default_value));
}
+void UnstartedRuntime::UnstartedClassIsAnonymousClass(
+ Thread* self, ShadowFrame* shadow_frame, JValue* result, size_t arg_offset) {
+ StackHandleScope<1> hs(self);
+ Handle<mirror::Class> klass(hs.NewHandle(
+ reinterpret_cast<mirror::Class*>(shadow_frame->GetVRegReference(arg_offset))));
+ if (klass->IsProxyClass() || klass->GetDexCache() == nullptr) {
+ result->SetZ(false);
+ return;
+ }
+ mirror::String* class_name = nullptr;
+ if (!annotations::GetInnerClass(klass, &class_name)) {
+ result->SetZ(false);
+ return;
+ }
+ result->SetZ(class_name == nullptr);
+}
+
static std::unique_ptr<MemMap> FindAndExtractEntry(const std::string& jar_file,
const char* entry_name,
size_t* size,
diff --git a/runtime/interpreter/unstarted_runtime_list.h b/runtime/interpreter/unstarted_runtime_list.h
index b8553b5771..96b35e4e9c 100644
--- a/runtime/interpreter/unstarted_runtime_list.h
+++ b/runtime/interpreter/unstarted_runtime_list.h
@@ -28,8 +28,10 @@
V(ClassGetDeclaredField, "java.lang.reflect.Field java.lang.Class.getDeclaredField(java.lang.String)") \
V(ClassGetDeclaredMethod, "java.lang.reflect.Method java.lang.Class.getDeclaredMethodInternal(java.lang.String, java.lang.Class[])") \
V(ClassGetDeclaredConstructor, "java.lang.reflect.Constructor java.lang.Class.getDeclaredConstructorInternal(java.lang.Class[])") \
+ V(ClassGetDeclaringClass, "java.lang.Class java.lang.Class.getDeclaringClass()") \
V(ClassGetEnclosingClass, "java.lang.Class java.lang.Class.getEnclosingClass()") \
V(ClassGetInnerClassFlags, "int java.lang.Class.getInnerClassFlags(int)") \
+ V(ClassIsAnonymousClass, "boolean java.lang.Class.isAnonymousClass()") \
V(ClassLoaderGetResourceAsStream, "java.io.InputStream java.lang.ClassLoader.getResourceAsStream(java.lang.String)") \
V(VmClassLoaderFindLoadedClass, "java.lang.Class java.lang.VMClassLoader.findLoadedClass(java.lang.ClassLoader, java.lang.String)") \
V(VoidLookupType, "java.lang.Class java.lang.Void.lookupType()") \
diff --git a/runtime/interpreter/unstarted_runtime_test.cc b/runtime/interpreter/unstarted_runtime_test.cc
index b190c81aff..ae55f4c2ef 100644
--- a/runtime/interpreter/unstarted_runtime_test.cc
+++ b/runtime/interpreter/unstarted_runtime_test.cc
@@ -885,5 +885,64 @@ TEST_F(UnstartedRuntimeTest, Pow) {
ShadowFrame::DeleteDeoptimizedFrame(tmp);
}
+TEST_F(UnstartedRuntimeTest, IsAnonymousClass) {
+ Thread* self = Thread::Current();
+ ScopedObjectAccess soa(self);
+
+ JValue result;
+ ShadowFrame* shadow_frame = ShadowFrame::CreateDeoptimizedFrame(10, nullptr, nullptr, 0);
+
+ mirror::Class* class_klass = mirror::Class::GetJavaLangClass();
+ shadow_frame->SetVRegReference(0, class_klass);
+ UnstartedClassIsAnonymousClass(self, shadow_frame, &result, 0);
+ EXPECT_EQ(result.GetZ(), 0);
+
+ jobject class_loader = LoadDex("Nested");
+ StackHandleScope<1> hs(soa.Self());
+ Handle<mirror::ClassLoader> loader(
+ hs.NewHandle(soa.Decode<mirror::ClassLoader>(class_loader)));
+ mirror::Class* c = class_linker_->FindClass(soa.Self(), "LNested$1;", loader);
+ ASSERT_TRUE(c != nullptr);
+ shadow_frame->SetVRegReference(0, c);
+ UnstartedClassIsAnonymousClass(self, shadow_frame, &result, 0);
+ EXPECT_EQ(result.GetZ(), 1);
+
+ ShadowFrame::DeleteDeoptimizedFrame(shadow_frame);
+}
+
+TEST_F(UnstartedRuntimeTest, GetDeclaringClass) {
+ Thread* self = Thread::Current();
+ ScopedObjectAccess soa(self);
+
+ JValue result;
+ ShadowFrame* shadow_frame = ShadowFrame::CreateDeoptimizedFrame(10, nullptr, nullptr, 0);
+
+ jobject class_loader = LoadDex("Nested");
+ StackHandleScope<4> hs(self);
+ Handle<mirror::ClassLoader> loader(
+ hs.NewHandle(soa.Decode<mirror::ClassLoader>(class_loader)));
+
+ Handle<mirror::Class> nested_klass(hs.NewHandle(
+ class_linker_->FindClass(soa.Self(), "LNested;", loader)));
+ Handle<mirror::Class> inner_klass(hs.NewHandle(
+ class_linker_->FindClass(soa.Self(), "LNested$Inner;", loader)));
+ Handle<mirror::Class> anon_klass(hs.NewHandle(
+ class_linker_->FindClass(soa.Self(), "LNested$1;", loader)));
+
+ shadow_frame->SetVRegReference(0, nested_klass.Get());
+ UnstartedClassGetDeclaringClass(self, shadow_frame, &result, 0);
+ EXPECT_EQ(result.GetL(), nullptr);
+
+ shadow_frame->SetVRegReference(0, inner_klass.Get());
+ UnstartedClassGetDeclaringClass(self, shadow_frame, &result, 0);
+ EXPECT_EQ(result.GetL(), nested_klass.Get());
+
+ shadow_frame->SetVRegReference(0, anon_klass.Get());
+ UnstartedClassGetDeclaringClass(self, shadow_frame, &result, 0);
+ EXPECT_EQ(result.GetL(), nullptr);
+
+ ShadowFrame::DeleteDeoptimizedFrame(shadow_frame);
+}
+
} // namespace interpreter
} // namespace art
diff --git a/runtime/jit/jit.h b/runtime/jit/jit.h
index 4112142a4f..d566799340 100644
--- a/runtime/jit/jit.h
+++ b/runtime/jit/jit.h
@@ -54,6 +54,8 @@ class Jit {
static constexpr size_t kDefaultCompileThreshold = kStressMode ? 2 : 10000;
static constexpr size_t kDefaultPriorityThreadWeightRatio = 1000;
static constexpr size_t kDefaultInvokeTransitionWeightRatio = 500;
+ // How frequently should the interpreter check to see if OSR compilation is ready.
+ static constexpr int16_t kJitRecheckOSRThreshold = 100;
virtual ~Jit();
static Jit* Create(JitOptions* options, std::string* error_msg);
diff --git a/runtime/jit/jit_code_cache.cc b/runtime/jit/jit_code_cache.cc
index 45611a93f7..f5151b588a 100644
--- a/runtime/jit/jit_code_cache.cc
+++ b/runtime/jit/jit_code_cache.cc
@@ -1141,8 +1141,17 @@ OatQuickMethodHeader* JitCodeCache::LookupMethodHeader(uintptr_t pc, ArtMethod*
return nullptr;
}
if (kIsDebugBuild && method != nullptr) {
- DCHECK_EQ(it->second, method)
- << ArtMethod::PrettyMethod(method) << " " << ArtMethod::PrettyMethod(it->second) << " "
+ // When we are walking the stack to redefine classes and creating obsolete methods it is
+ // possible that we might have updated the method_code_map by making this method obsolete in a
+ // previous frame. Therefore we should just check that the non-obsolete version of this method
+ // is the one we expect. We change to the non-obsolete versions in the error message since the
+ // obsolete version of the method might not be fully initialized yet. This situation can only
+ // occur when we are in the process of allocating and setting up obsolete methods. Otherwise
+ // method and it->second should be identical. (See runtime/openjdkjvmti/ti_redefine.cc for more
+ // information.)
+ DCHECK_EQ(it->second->GetNonObsoleteMethod(), method->GetNonObsoleteMethod())
+ << ArtMethod::PrettyMethod(method->GetNonObsoleteMethod()) << " "
+ << ArtMethod::PrettyMethod(it->second->GetNonObsoleteMethod()) << " "
<< std::hex << pc;
}
return method_header;
diff --git a/runtime/memory_region.cc b/runtime/memory_region.cc
index b0ecab40c5..13cc5c99bc 100644
--- a/runtime/memory_region.cc
+++ b/runtime/memory_region.cc
@@ -29,8 +29,7 @@ void MemoryRegion::CopyFrom(size_t offset, const MemoryRegion& from) const {
CHECK_GT(from.size(), 0U);
CHECK_GE(this->size(), from.size());
CHECK_LE(offset, this->size() - from.size());
- memmove(reinterpret_cast<void*>(start() + offset),
- from.pointer(), from.size());
+ memmove(reinterpret_cast<void*>(begin() + offset), from.pointer(), from.size());
}
void MemoryRegion::StoreBits(uintptr_t bit_offset, uint32_t value, size_t length) {
diff --git a/runtime/memory_region.h b/runtime/memory_region.h
index f55dff7a50..7cf5d49d70 100644
--- a/runtime/memory_region.h
+++ b/runtime/memory_region.h
@@ -35,6 +35,12 @@ namespace art {
// of the region.
class MemoryRegion FINAL : public ValueObject {
public:
+ struct ContentEquals {
+ constexpr bool operator()(const MemoryRegion& lhs, const MemoryRegion& rhs) const {
+ return lhs.size() == rhs.size() && memcmp(lhs.begin(), rhs.begin(), lhs.size()) == 0;
+ }
+ };
+
MemoryRegion() : pointer_(nullptr), size_(0) {}
MemoryRegion(void* pointer_in, uintptr_t size_in) : pointer_(pointer_in), size_(size_in) {}
@@ -46,8 +52,8 @@ class MemoryRegion FINAL : public ValueObject {
return OFFSETOF_MEMBER(MemoryRegion, pointer_);
}
- uint8_t* start() const { return reinterpret_cast<uint8_t*>(pointer_); }
- uint8_t* end() const { return start() + size_; }
+ uint8_t* begin() const { return reinterpret_cast<uint8_t*>(pointer_); }
+ uint8_t* end() const { return begin() + size_; }
// Load value of type `T` at `offset`. The memory address corresponding
// to `offset` should be word-aligned (on ARM, this is a requirement).
@@ -131,7 +137,7 @@ class MemoryRegion FINAL : public ValueObject {
// Do not touch any memory if the range is empty.
return 0;
}
- const uint8_t* address = start() + bit_offset / kBitsPerByte;
+ const uint8_t* address = begin() + bit_offset / kBitsPerByte;
const uint32_t shift = bit_offset & (kBitsPerByte - 1);
// Load the value (reading only the strictly needed bytes).
const uint32_t load_bit_count = shift + length;
@@ -165,11 +171,18 @@ class MemoryRegion FINAL : public ValueObject {
void CopyFrom(size_t offset, const MemoryRegion& from) const;
+ template<class Vector>
+ void CopyFromVector(size_t offset, Vector& vector) const {
+ if (!vector.empty()) {
+ CopyFrom(offset, MemoryRegion(vector.data(), vector.size()));
+ }
+ }
+
// Compute a sub memory region based on an existing one.
ALWAYS_INLINE MemoryRegion Subregion(uintptr_t offset, uintptr_t size_in) const {
CHECK_GE(this->size(), size_in);
CHECK_LE(offset, this->size() - size_in);
- return MemoryRegion(reinterpret_cast<void*>(start() + offset), size_in);
+ return MemoryRegion(reinterpret_cast<void*>(begin() + offset), size_in);
}
// Compute an extended memory region based on an existing one.
@@ -183,7 +196,7 @@ class MemoryRegion FINAL : public ValueObject {
ALWAYS_INLINE T* ComputeInternalPointer(size_t offset) const {
CHECK_GE(size(), sizeof(T));
CHECK_LE(offset, size() - sizeof(T));
- return reinterpret_cast<T*>(start() + offset);
+ return reinterpret_cast<T*>(begin() + offset);
}
// Locate the bit with the given offset. Returns a pointer to the byte
diff --git a/runtime/mirror/class.cc b/runtime/mirror/class.cc
index 85636fb5b1..f08d4daf95 100644
--- a/runtime/mirror/class.cc
+++ b/runtime/mirror/class.cc
@@ -951,8 +951,7 @@ ObjPtr<Class> Class::GetDirectInterface(Thread* self, ObjPtr<Class> klass, uint3
return interfaces->Get(idx);
} else {
dex::TypeIndex type_idx = klass->GetDirectInterfaceTypeIdx(idx);
- ObjPtr<Class> interface = ClassLinker::LookupResolvedType(
- type_idx, klass->GetDexCache(), klass->GetClassLoader());
+ ObjPtr<Class> interface = klass->GetDexCache()->GetResolvedType(type_idx);
return interface;
}
}
diff --git a/runtime/mirror/dex_cache-inl.h b/runtime/mirror/dex_cache-inl.h
index bef3ad29a3..a59bb7b880 100644
--- a/runtime/mirror/dex_cache-inl.h
+++ b/runtime/mirror/dex_cache-inl.h
@@ -40,22 +40,14 @@ inline uint32_t DexCache::ClassSize(PointerSize pointer_size) {
return Class::ComputeClassSize(true, vtable_entries, 0, 0, 0, 0, 0, pointer_size);
}
-inline uint32_t DexCache::StringSlotIndex(dex::StringIndex string_idx) {
+inline mirror::String* DexCache::GetResolvedString(dex::StringIndex string_idx) {
DCHECK_LT(string_idx.index_, GetDexFile()->NumStringIds());
- const uint32_t slot_idx = string_idx.index_ % kDexCacheStringCacheSize;
- DCHECK_LT(slot_idx, NumStrings());
- return slot_idx;
+ return StringDexCachePair::Lookup(GetStrings(), string_idx.index_, NumStrings()).Read();
}
-inline String* DexCache::GetResolvedString(dex::StringIndex string_idx) {
- return GetStrings()[StringSlotIndex(string_idx)].load(
- std::memory_order_relaxed).GetObjectForIndex(string_idx.index_);
-}
-
-inline void DexCache::SetResolvedString(dex::StringIndex string_idx, ObjPtr<String> resolved) {
- DCHECK(resolved != nullptr);
- GetStrings()[StringSlotIndex(string_idx)].store(
- StringDexCachePair(resolved, string_idx.index_), std::memory_order_relaxed);
+inline void DexCache::SetResolvedString(dex::StringIndex string_idx,
+ ObjPtr<mirror::String> resolved) {
+ StringDexCachePair::Assign(GetStrings(), string_idx.index_, resolved.Ptr(), NumStrings());
Runtime* const runtime = Runtime::Current();
if (UNLIKELY(runtime->IsActiveTransaction())) {
DCHECK(runtime->IsAotCompiler());
@@ -66,70 +58,50 @@ inline void DexCache::SetResolvedString(dex::StringIndex string_idx, ObjPtr<Stri
}
inline void DexCache::ClearString(dex::StringIndex string_idx) {
+ const uint32_t slot_idx = string_idx.index_ % NumStrings();
DCHECK(Runtime::Current()->IsAotCompiler());
- uint32_t slot_idx = StringSlotIndex(string_idx);
StringDexCacheType* slot = &GetStrings()[slot_idx];
// This is racy but should only be called from the transactional interpreter.
if (slot->load(std::memory_order_relaxed).index == string_idx.index_) {
- StringDexCachePair cleared(nullptr, StringDexCachePair::InvalidIndexForSlot(slot_idx));
+ StringDexCachePair cleared(
+ nullptr,
+ StringDexCachePair::InvalidIndexForSlot(slot_idx));
slot->store(cleared, std::memory_order_relaxed);
}
}
-inline uint32_t DexCache::TypeSlotIndex(dex::TypeIndex type_idx) {
- DCHECK_LT(type_idx.index_, GetDexFile()->NumTypeIds());
- const uint32_t slot_idx = type_idx.index_ % kDexCacheTypeCacheSize;
- DCHECK_LT(slot_idx, NumResolvedTypes());
- return slot_idx;
-}
-
inline Class* DexCache::GetResolvedType(dex::TypeIndex type_idx) {
// It is theorized that a load acquire is not required since obtaining the resolved class will
// always have an address dependency or a lock.
- return GetResolvedTypes()[TypeSlotIndex(type_idx)].load(
- std::memory_order_relaxed).GetObjectForIndex(type_idx.index_);
+ DCHECK_LT(type_idx.index_, NumResolvedTypes());
+ return GetResolvedTypes()[type_idx.index_].Read();
}
inline void DexCache::SetResolvedType(dex::TypeIndex type_idx, ObjPtr<Class> resolved) {
- DCHECK(resolved != nullptr);
+ DCHECK_LT(type_idx.index_, NumResolvedTypes()); // NOTE: Unchecked, i.e. not throwing AIOOB.
// TODO default transaction support.
// Use a release store for SetResolvedType. This is done to prevent other threads from seeing a
// class but not necessarily seeing the loaded members like the static fields array.
// See b/32075261.
- GetResolvedTypes()[TypeSlotIndex(type_idx)].store(
- TypeDexCachePair(resolved, type_idx.index_), std::memory_order_release);
+ reinterpret_cast<Atomic<GcRoot<mirror::Class>>&>(GetResolvedTypes()[type_idx.index_]).
+ StoreRelease(GcRoot<Class>(resolved));
// TODO: Fine-grained marking, so that we don't need to go through all arrays in full.
Runtime::Current()->GetHeap()->WriteBarrierEveryFieldOf(this);
}
-inline void DexCache::ClearResolvedType(dex::TypeIndex type_idx) {
- DCHECK(Runtime::Current()->IsAotCompiler());
- uint32_t slot_idx = TypeSlotIndex(type_idx);
- TypeDexCacheType* slot = &GetResolvedTypes()[slot_idx];
- // This is racy but should only be called from the single-threaded ImageWriter and tests.
- if (slot->load(std::memory_order_relaxed).index == type_idx.index_) {
- TypeDexCachePair cleared(nullptr, TypeDexCachePair::InvalidIndexForSlot(slot_idx));
- slot->store(cleared, std::memory_order_relaxed);
- }
-}
-
-inline uint32_t DexCache::MethodTypeSlotIndex(uint32_t proto_idx) {
+inline MethodType* DexCache::GetResolvedMethodType(uint32_t proto_idx) {
DCHECK(Runtime::Current()->IsMethodHandlesEnabled());
DCHECK_LT(proto_idx, GetDexFile()->NumProtoIds());
- const uint32_t slot_idx = proto_idx % kDexCacheMethodTypeCacheSize;
- DCHECK_LT(slot_idx, NumResolvedMethodTypes());
- return slot_idx;
-}
-
-inline MethodType* DexCache::GetResolvedMethodType(uint32_t proto_idx) {
- return GetResolvedMethodTypes()[MethodTypeSlotIndex(proto_idx)].load(
- std::memory_order_relaxed).GetObjectForIndex(proto_idx);
+ return MethodTypeDexCachePair::Lookup(
+ GetResolvedMethodTypes(), proto_idx, NumResolvedMethodTypes()).Read();
}
inline void DexCache::SetResolvedMethodType(uint32_t proto_idx, MethodType* resolved) {
- DCHECK(resolved != nullptr);
- GetResolvedMethodTypes()[MethodTypeSlotIndex(proto_idx)].store(
- MethodTypeDexCachePair(resolved, proto_idx), std::memory_order_relaxed);
+ DCHECK(Runtime::Current()->IsMethodHandlesEnabled());
+ DCHECK_LT(proto_idx, GetDexFile()->NumProtoIds());
+
+ MethodTypeDexCachePair::Assign(GetResolvedMethodTypes(), proto_idx, resolved,
+ NumResolvedMethodTypes());
// TODO: Fine-grained marking, so that we don't need to go through all arrays in full.
Runtime::Current()->GetHeap()->WriteBarrierEveryFieldOf(this);
}
@@ -226,49 +198,49 @@ inline void DexCache::VisitReferences(ObjPtr<Class> klass, const Visitor& visito
VisitInstanceFieldsReferences<kVerifyFlags, kReadBarrierOption>(klass, visitor);
// Visit arrays after.
if (kVisitNativeRoots) {
- VisitDexCachePairs<String, kReadBarrierOption, Visitor>(
+ VisitDexCachePairs<mirror::String, kReadBarrierOption, Visitor>(
GetStrings(), NumStrings(), visitor);
- VisitDexCachePairs<Class, kReadBarrierOption, Visitor>(
- GetResolvedTypes(), NumResolvedTypes(), visitor);
+ GcRoot<mirror::Class>* resolved_types = GetResolvedTypes();
+ for (size_t i = 0, num_types = NumResolvedTypes(); i != num_types; ++i) {
+ visitor.VisitRootIfNonNull(resolved_types[i].AddressWithoutBarrier());
+ }
- VisitDexCachePairs<MethodType, kReadBarrierOption, Visitor>(
+ VisitDexCachePairs<mirror::MethodType, kReadBarrierOption, Visitor>(
GetResolvedMethodTypes(), NumResolvedMethodTypes(), visitor);
}
}
template <ReadBarrierOption kReadBarrierOption, typename Visitor>
-inline void DexCache::FixupStrings(StringDexCacheType* dest, const Visitor& visitor) {
- StringDexCacheType* src = GetStrings();
+inline void DexCache::FixupStrings(mirror::StringDexCacheType* dest, const Visitor& visitor) {
+ mirror::StringDexCacheType* src = GetStrings();
for (size_t i = 0, count = NumStrings(); i < count; ++i) {
StringDexCachePair source = src[i].load(std::memory_order_relaxed);
- String* ptr = source.object.Read<kReadBarrierOption>();
- String* new_source = visitor(ptr);
+ mirror::String* ptr = source.object.Read<kReadBarrierOption>();
+ mirror::String* new_source = visitor(ptr);
source.object = GcRoot<String>(new_source);
dest[i].store(source, std::memory_order_relaxed);
}
}
template <ReadBarrierOption kReadBarrierOption, typename Visitor>
-inline void DexCache::FixupResolvedTypes(TypeDexCacheType* dest, const Visitor& visitor) {
- TypeDexCacheType* src = GetResolvedTypes();
+inline void DexCache::FixupResolvedTypes(GcRoot<mirror::Class>* dest, const Visitor& visitor) {
+ GcRoot<mirror::Class>* src = GetResolvedTypes();
for (size_t i = 0, count = NumResolvedTypes(); i < count; ++i) {
- TypeDexCachePair source = src[i].load(std::memory_order_relaxed);
- Class* ptr = source.object.Read<kReadBarrierOption>();
- Class* new_source = visitor(ptr);
- source.object = GcRoot<Class>(new_source);
- dest[i].store(source, std::memory_order_relaxed);
+ mirror::Class* source = src[i].Read<kReadBarrierOption>();
+ mirror::Class* new_source = visitor(source);
+ dest[i] = GcRoot<mirror::Class>(new_source);
}
}
template <ReadBarrierOption kReadBarrierOption, typename Visitor>
-inline void DexCache::FixupResolvedMethodTypes(MethodTypeDexCacheType* dest,
+inline void DexCache::FixupResolvedMethodTypes(mirror::MethodTypeDexCacheType* dest,
const Visitor& visitor) {
- MethodTypeDexCacheType* src = GetResolvedMethodTypes();
+ mirror::MethodTypeDexCacheType* src = GetResolvedMethodTypes();
for (size_t i = 0, count = NumResolvedMethodTypes(); i < count; ++i) {
MethodTypeDexCachePair source = src[i].load(std::memory_order_relaxed);
- MethodType* ptr = source.object.Read<kReadBarrierOption>();
- MethodType* new_source = visitor(ptr);
+ mirror::MethodType* ptr = source.object.Read<kReadBarrierOption>();
+ mirror::MethodType* new_source = visitor(ptr);
source.object = GcRoot<MethodType>(new_source);
dest[i].store(source, std::memory_order_relaxed);
}
diff --git a/runtime/mirror/dex_cache.cc b/runtime/mirror/dex_cache.cc
index 3103a92c83..741cf3bb47 100644
--- a/runtime/mirror/dex_cache.cc
+++ b/runtime/mirror/dex_cache.cc
@@ -58,8 +58,8 @@ void DexCache::InitializeDexCache(Thread* self,
mirror::StringDexCacheType* strings = (dex_file->NumStringIds() == 0u) ? nullptr :
reinterpret_cast<mirror::StringDexCacheType*>(raw_arrays + layout.StringsOffset());
- mirror::TypeDexCacheType* types = (dex_file->NumTypeIds() == 0u) ? nullptr :
- reinterpret_cast<mirror::TypeDexCacheType*>(raw_arrays + layout.TypesOffset());
+ GcRoot<mirror::Class>* types = (dex_file->NumTypeIds() == 0u) ? nullptr :
+ reinterpret_cast<GcRoot<mirror::Class>*>(raw_arrays + layout.TypesOffset());
ArtMethod** methods = (dex_file->NumMethodIds() == 0u) ? nullptr :
reinterpret_cast<ArtMethod**>(raw_arrays + layout.MethodsOffset());
ArtField** fields = (dex_file->NumFieldIds() == 0u) ? nullptr :
@@ -69,10 +69,6 @@ void DexCache::InitializeDexCache(Thread* self,
if (dex_file->NumStringIds() < num_strings) {
num_strings = dex_file->NumStringIds();
}
- size_t num_types = mirror::DexCache::kDexCacheTypeCacheSize;
- if (dex_file->NumTypeIds() < num_types) {
- num_types = dex_file->NumTypeIds();
- }
// Note that we allocate the method type dex caches regardless of this flag,
// and we make sure here that they're not used by the runtime. This is in the
@@ -108,9 +104,8 @@ void DexCache::InitializeDexCache(Thread* self,
CHECK_EQ(strings[i].load(std::memory_order_relaxed).index, 0u);
CHECK(strings[i].load(std::memory_order_relaxed).object.IsNull());
}
- for (size_t i = 0; i < num_types; ++i) {
- CHECK_EQ(types[i].load(std::memory_order_relaxed).index, 0u);
- CHECK(types[i].load(std::memory_order_relaxed).object.IsNull());
+ for (size_t i = 0; i < dex_file->NumTypeIds(); ++i) {
+ CHECK(types[i].IsNull());
}
for (size_t i = 0; i < dex_file->NumMethodIds(); ++i) {
CHECK(mirror::DexCache::GetElementPtrSize(methods, i, image_pointer_size) == nullptr);
@@ -126,9 +121,6 @@ void DexCache::InitializeDexCache(Thread* self,
if (strings != nullptr) {
mirror::StringDexCachePair::Initialize(strings);
}
- if (types != nullptr) {
- mirror::TypeDexCachePair::Initialize(types);
- }
if (method_types != nullptr) {
mirror::MethodTypeDexCachePair::Initialize(method_types);
}
@@ -137,7 +129,7 @@ void DexCache::InitializeDexCache(Thread* self,
strings,
num_strings,
types,
- num_types,
+ dex_file->NumTypeIds(),
methods,
dex_file->NumMethodIds(),
fields,
@@ -151,7 +143,7 @@ void DexCache::Init(const DexFile* dex_file,
ObjPtr<String> location,
StringDexCacheType* strings,
uint32_t num_strings,
- TypeDexCacheType* resolved_types,
+ GcRoot<Class>* resolved_types,
uint32_t num_resolved_types,
ArtMethod** resolved_methods,
uint32_t num_resolved_methods,
diff --git a/runtime/mirror/dex_cache.h b/runtime/mirror/dex_cache.h
index e68b0c7219..6f88cc5df4 100644
--- a/runtime/mirror/dex_cache.h
+++ b/runtime/mirror/dex_cache.h
@@ -18,14 +18,14 @@
#define ART_RUNTIME_MIRROR_DEX_CACHE_H_
#include "array.h"
-#include "base/bit_utils.h"
+#include "art_field.h"
+#include "class.h"
#include "dex_file_types.h"
#include "object.h"
#include "object_array.h"
namespace art {
-class ArtField;
class ArtMethod;
struct DexCacheOffsets;
class DexFile;
@@ -36,7 +36,6 @@ class Thread;
namespace mirror {
-class Class;
class MethodType;
class String;
@@ -61,7 +60,7 @@ template <typename T> struct PACKED(8) DexCachePair {
// it's always non-null if the id branch succeeds (except for the 0th id).
// Set the initial state for the 0th entry to be {0,1} which is guaranteed to fail
// the lookup id == stored id branch.
- DexCachePair(ObjPtr<T> object, uint32_t index)
+ DexCachePair(T* object, uint32_t index)
: object(object),
index(index) {}
DexCachePair() = default;
@@ -75,28 +74,39 @@ template <typename T> struct PACKED(8) DexCachePair {
dex_cache[0].store(first_elem, std::memory_order_relaxed);
}
+ static GcRoot<T> Lookup(std::atomic<DexCachePair<T>>* dex_cache,
+ uint32_t idx,
+ uint32_t cache_size) {
+ DCHECK_NE(cache_size, 0u);
+ DexCachePair<T> element = dex_cache[idx % cache_size].load(std::memory_order_relaxed);
+ if (idx != element.index) {
+ return GcRoot<T>(nullptr);
+ }
+
+ DCHECK(!element.object.IsNull());
+ return element.object;
+ }
+
+ static void Assign(std::atomic<DexCachePair<T>>* dex_cache,
+ uint32_t idx,
+ T* object,
+ uint32_t cache_size) {
+ DCHECK_LT(idx % cache_size, cache_size);
+ dex_cache[idx % cache_size].store(
+ DexCachePair<T>(object, idx), std::memory_order_relaxed);
+ }
+
static uint32_t InvalidIndexForSlot(uint32_t slot) {
// Since the cache size is a power of two, 0 will always map to slot 0.
// Use 1 for slot 0 and 0 for all other slots.
return (slot == 0) ? 1u : 0u;
}
-
- T* GetObjectForIndex(uint32_t idx) REQUIRES_SHARED(Locks::mutator_lock_) {
- if (idx != index) {
- return nullptr;
- }
- DCHECK(!object.IsNull());
- return object.Read();
- }
};
-using TypeDexCachePair = DexCachePair<Class>;
-using TypeDexCacheType = std::atomic<TypeDexCachePair>;
-
-using StringDexCachePair = DexCachePair<String>;
+using StringDexCachePair = DexCachePair<mirror::String>;
using StringDexCacheType = std::atomic<StringDexCachePair>;
-using MethodTypeDexCachePair = DexCachePair<MethodType>;
+using MethodTypeDexCachePair = DexCachePair<mirror::MethodType>;
using MethodTypeDexCacheType = std::atomic<MethodTypeDexCachePair>;
// C++ mirror of java.lang.DexCache.
@@ -105,11 +115,6 @@ class MANAGED DexCache FINAL : public Object {
// Size of java.lang.DexCache.class.
static uint32_t ClassSize(PointerSize pointer_size);
- // Size of type dex cache. Needs to be a power of 2 for entrypoint assumptions to hold.
- static constexpr size_t kDexCacheTypeCacheSize = 1024;
- static_assert(IsPowerOfTwo(kDexCacheTypeCacheSize),
- "Type dex cache size is not a power of 2.");
-
// Size of string dex cache. Needs to be a power of 2 for entrypoint assumptions to hold.
static constexpr size_t kDexCacheStringCacheSize = 1024;
static_assert(IsPowerOfTwo(kDexCacheStringCacheSize),
@@ -121,10 +126,6 @@ class MANAGED DexCache FINAL : public Object {
static_assert(IsPowerOfTwo(kDexCacheMethodTypeCacheSize),
"MethodType dex cache size is not a power of 2.");
- static constexpr size_t StaticTypeSize() {
- return kDexCacheTypeCacheSize;
- }
-
static constexpr size_t StaticStringSize() {
return kDexCacheStringCacheSize;
}
@@ -155,7 +156,7 @@ class MANAGED DexCache FINAL : public Object {
REQUIRES_SHARED(Locks::mutator_lock_);
template <ReadBarrierOption kReadBarrierOption = kWithReadBarrier, typename Visitor>
- void FixupResolvedTypes(TypeDexCacheType* dest, const Visitor& visitor)
+ void FixupResolvedTypes(GcRoot<mirror::Class>* dest, const Visitor& visitor)
REQUIRES_SHARED(Locks::mutator_lock_);
template <ReadBarrierOption kReadBarrierOption = kWithReadBarrier, typename Visitor>
@@ -210,7 +211,7 @@ class MANAGED DexCache FINAL : public Object {
return OFFSET_OF_OBJECT_MEMBER(DexCache, num_resolved_method_types_);
}
- String* GetResolvedString(dex::StringIndex string_idx) ALWAYS_INLINE
+ mirror::String* GetResolvedString(dex::StringIndex string_idx) ALWAYS_INLINE
REQUIRES_SHARED(Locks::mutator_lock_);
void SetResolvedString(dex::StringIndex string_idx, ObjPtr<mirror::String> resolved) ALWAYS_INLINE
@@ -225,8 +226,6 @@ class MANAGED DexCache FINAL : public Object {
void SetResolvedType(dex::TypeIndex type_idx, ObjPtr<Class> resolved)
REQUIRES_SHARED(Locks::mutator_lock_);
- void ClearResolvedType(dex::TypeIndex type_idx) REQUIRES_SHARED(Locks::mutator_lock_);
-
ALWAYS_INLINE ArtMethod* GetResolvedMethod(uint32_t method_idx, PointerSize ptr_size)
REQUIRES_SHARED(Locks::mutator_lock_);
@@ -255,11 +254,11 @@ class MANAGED DexCache FINAL : public Object {
SetFieldPtr<false>(StringsOffset(), strings);
}
- TypeDexCacheType* GetResolvedTypes() ALWAYS_INLINE REQUIRES_SHARED(Locks::mutator_lock_) {
- return GetFieldPtr<TypeDexCacheType*>(ResolvedTypesOffset());
+ GcRoot<Class>* GetResolvedTypes() ALWAYS_INLINE REQUIRES_SHARED(Locks::mutator_lock_) {
+ return GetFieldPtr<GcRoot<Class>*>(ResolvedTypesOffset());
}
- void SetResolvedTypes(TypeDexCacheType* resolved_types)
+ void SetResolvedTypes(GcRoot<Class>* resolved_types)
ALWAYS_INLINE
REQUIRES_SHARED(Locks::mutator_lock_) {
SetFieldPtr<false>(ResolvedTypesOffset(), resolved_types);
@@ -324,7 +323,7 @@ class MANAGED DexCache FINAL : public Object {
SetFieldPtr<false>(OFFSET_OF_OBJECT_MEMBER(DexCache, dex_file_), dex_file);
}
- void SetLocation(ObjPtr<String> location) REQUIRES_SHARED(Locks::mutator_lock_);
+ void SetLocation(ObjPtr<mirror::String> location) REQUIRES_SHARED(Locks::mutator_lock_);
// NOTE: Get/SetElementPtrSize() are intended for working with ArtMethod** and ArtField**
// provided by GetResolvedMethods/Fields() and ArtMethod::GetDexCacheResolvedMethods(),
@@ -341,7 +340,7 @@ class MANAGED DexCache FINAL : public Object {
ObjPtr<String> location,
StringDexCacheType* strings,
uint32_t num_strings,
- TypeDexCacheType* resolved_types,
+ GcRoot<Class>* resolved_types,
uint32_t num_resolved_types,
ArtMethod** resolved_methods,
uint32_t num_resolved_methods,
@@ -352,16 +351,12 @@ class MANAGED DexCache FINAL : public Object {
PointerSize pointer_size)
REQUIRES_SHARED(Locks::mutator_lock_);
- uint32_t StringSlotIndex(dex::StringIndex string_idx) REQUIRES_SHARED(Locks::mutator_lock_);
- uint32_t TypeSlotIndex(dex::TypeIndex type_idx) REQUIRES_SHARED(Locks::mutator_lock_);
- uint32_t MethodTypeSlotIndex(uint32_t proto_idx) REQUIRES_SHARED(Locks::mutator_lock_);
-
// Visit instance fields of the dex cache as well as its associated arrays.
template <bool kVisitNativeRoots,
VerifyObjectFlags kVerifyFlags = kDefaultVerifyFlags,
ReadBarrierOption kReadBarrierOption = kWithReadBarrier,
typename Visitor>
- void VisitReferences(ObjPtr<Class> klass, const Visitor& visitor)
+ void VisitReferences(ObjPtr<mirror::Class> klass, const Visitor& visitor)
REQUIRES_SHARED(Locks::mutator_lock_) REQUIRES(Locks::heap_bitmap_lock_);
HeapReference<Object> dex_;
@@ -371,7 +366,7 @@ class MANAGED DexCache FINAL : public Object {
uint64_t resolved_method_types_; // std::atomic<MethodTypeDexCachePair>* array with
// num_resolved_method_types_ elements.
uint64_t resolved_methods_; // ArtMethod*, array with num_resolved_methods_ elements.
- uint64_t resolved_types_; // TypeDexCacheType*, array with num_resolved_types_ elements.
+ uint64_t resolved_types_; // GcRoot<Class>*, array with num_resolved_types_ elements.
uint64_t strings_; // std::atomic<StringDexCachePair>*, array with num_strings_
// elements.
diff --git a/runtime/mirror/dex_cache_test.cc b/runtime/mirror/dex_cache_test.cc
index 5693f67646..8f978e122c 100644
--- a/runtime/mirror/dex_cache_test.cc
+++ b/runtime/mirror/dex_cache_test.cc
@@ -51,8 +51,7 @@ TEST_F(DexCacheTest, Open) {
EXPECT_TRUE(dex_cache->StaticStringSize() == dex_cache->NumStrings()
|| java_lang_dex_file_->NumStringIds() == dex_cache->NumStrings());
- EXPECT_TRUE(dex_cache->StaticTypeSize() == dex_cache->NumResolvedTypes()
- || java_lang_dex_file_->NumTypeIds() == dex_cache->NumResolvedTypes());
+ EXPECT_EQ(java_lang_dex_file_->NumTypeIds(), dex_cache->NumResolvedTypes());
EXPECT_EQ(java_lang_dex_file_->NumMethodIds(), dex_cache->NumResolvedMethods());
EXPECT_EQ(java_lang_dex_file_->NumFieldIds(), dex_cache->NumResolvedFields());
EXPECT_TRUE(dex_cache->StaticMethodTypeSize() == dex_cache->NumResolvedMethodTypes()
diff --git a/runtime/native/java_lang_DexCache.cc b/runtime/native/java_lang_DexCache.cc
index 0b667fec45..f1c350f23c 100644
--- a/runtime/native/java_lang_DexCache.cc
+++ b/runtime/native/java_lang_DexCache.cc
@@ -53,7 +53,7 @@ static jobject DexCache_getDexNative(JNIEnv* env, jobject javaDexCache) {
static jobject DexCache_getResolvedType(JNIEnv* env, jobject javaDexCache, jint type_index) {
ScopedFastNativeObjectAccess soa(env);
ObjPtr<mirror::DexCache> dex_cache = soa.Decode<mirror::DexCache>(javaDexCache);
- CHECK_LT(static_cast<size_t>(type_index), dex_cache->GetDexFile()->NumTypeIds());
+ CHECK_LT(static_cast<size_t>(type_index), dex_cache->NumResolvedTypes());
return soa.AddLocalReference<jobject>(dex_cache->GetResolvedType(dex::TypeIndex(type_index)));
}
@@ -69,11 +69,8 @@ static void DexCache_setResolvedType(JNIEnv* env, jobject javaDexCache, jint typ
jobject type) {
ScopedFastNativeObjectAccess soa(env);
ObjPtr<mirror::DexCache> dex_cache = soa.Decode<mirror::DexCache>(javaDexCache);
- CHECK_LT(static_cast<size_t>(type_index), dex_cache->GetDexFile()->NumTypeIds());
- ObjPtr<mirror::Class> t = soa.Decode<mirror::Class>(type);
- if (t != nullptr) {
- dex_cache->SetResolvedType(dex::TypeIndex(type_index), t);
- }
+ CHECK_LT(static_cast<size_t>(type_index), dex_cache->NumResolvedTypes());
+ dex_cache->SetResolvedType(dex::TypeIndex(type_index), soa.Decode<mirror::Class>(type));
}
static void DexCache_setResolvedString(JNIEnv* env, jobject javaDexCache, jint string_index,
@@ -81,10 +78,7 @@ static void DexCache_setResolvedString(JNIEnv* env, jobject javaDexCache, jint s
ScopedFastNativeObjectAccess soa(env);
ObjPtr<mirror::DexCache> dex_cache = soa.Decode<mirror::DexCache>(javaDexCache);
CHECK_LT(static_cast<size_t>(string_index), dex_cache->GetDexFile()->NumStringIds());
- ObjPtr<mirror::String> s = soa.Decode<mirror::String>(string);
- if (s != nullptr) {
- dex_cache->SetResolvedString(dex::StringIndex(string_index), s);
- }
+ dex_cache->SetResolvedString(dex::StringIndex(string_index), soa.Decode<mirror::String>(string));
}
static JNINativeMethod gMethods[] = {
diff --git a/runtime/oat.h b/runtime/oat.h
index 62f010ba97..532c9681c3 100644
--- a/runtime/oat.h
+++ b/runtime/oat.h
@@ -32,7 +32,7 @@ class InstructionSetFeatures;
class PACKED(4) OatHeader {
public:
static constexpr uint8_t kOatMagic[] = { 'o', 'a', 't', '\n' };
- static constexpr uint8_t kOatVersion[] = { '1', '0', '6', '\0' }; // hash-based DexCache types
+ static constexpr uint8_t kOatVersion[] = { '1', '0', '9', '\0' }; // Register mask change.
static constexpr const char* kImageLocationKey = "image-location";
static constexpr const char* kDex2OatCmdLineKey = "dex2oat-cmdline";
diff --git a/runtime/oat_file.cc b/runtime/oat_file.cc
index d47f1b5611..31eb1ccdc8 100644
--- a/runtime/oat_file.cc
+++ b/runtime/oat_file.cc
@@ -193,7 +193,7 @@ bool OatFileBase::LoadVdex(const std::string& vdex_filename,
bool writable,
bool low_4gb,
std::string* error_msg) {
- vdex_.reset(VdexFile::Open(vdex_filename, writable, low_4gb, error_msg));
+ vdex_ = VdexFile::Open(vdex_filename, writable, low_4gb, error_msg);
if (vdex_.get() == nullptr) {
*error_msg = StringPrintf("Failed to load vdex file '%s' %s",
vdex_filename.c_str(),
diff --git a/runtime/oat_file_assistant.cc b/runtime/oat_file_assistant.cc
index b19ace5464..77cdd28d3a 100644
--- a/runtime/oat_file_assistant.cc
+++ b/runtime/oat_file_assistant.cc
@@ -25,6 +25,7 @@
#include "base/logging.h"
#include "compiler_filter.h"
#include "class_linker.h"
+#include "exec_utils.h"
#include "gc/heap.h"
#include "gc/space/image_space.h"
#include "image.h"
@@ -33,6 +34,7 @@
#include "runtime.h"
#include "scoped_thread_state_change-inl.h"
#include "utils.h"
+#include "vdex_file.h"
namespace art {
@@ -216,28 +218,38 @@ std::string OatFileAssistant::GetStatusDump() {
bool oat_file_exists = false;
bool odex_file_exists = false;
if (oat_.Status() != kOatCannotOpen) {
- // If we can open the file, neither Filename nor GetFile should return null.
+ // If we can open the file, Filename should not return null.
CHECK(oat_.Filename() != nullptr);
- CHECK(oat_.GetFile() != nullptr);
oat_file_exists = true;
- status << *oat_.Filename() << " [compilation_filter=";
- status << CompilerFilter::NameOfFilter(oat_.GetFile()->GetCompilerFilter());
- status << ", status=" << oat_.Status();
+ status << *oat_.Filename() << "[status=" << oat_.Status() << ", ";
+ const OatFile* file = oat_.GetFile();
+ if (file == nullptr) {
+ // If the file is null even though the status is not kOatCannotOpen, it
+ // means we must have a vdex file with no corresponding oat file. In
+ // this case we cannot determine the compilation filter. Indicate that
+ // we have only the vdex file instead.
+ status << "vdex-only";
+ } else {
+ status << "compilation_filter=" << CompilerFilter::NameOfFilter(file->GetCompilerFilter());
+ }
}
if (odex_.Status() != kOatCannotOpen) {
- // If we can open the file, neither Filename nor GetFile should return null.
+ // If we can open the file, Filename should not return null.
CHECK(odex_.Filename() != nullptr);
- CHECK(odex_.GetFile() != nullptr);
odex_file_exists = true;
if (oat_file_exists) {
status << "] ";
}
- status << *odex_.Filename() << " [compilation_filter=";
- status << CompilerFilter::NameOfFilter(odex_.GetFile()->GetCompilerFilter());
- status << ", status=" << odex_.Status();
+ status << *odex_.Filename() << "[status=" << odex_.Status() << ", ";
+ const OatFile* file = odex_.GetFile();
+ if (file == nullptr) {
+ status << "vdex-only";
+ } else {
+ status << "compilation_filter=" << CompilerFilter::NameOfFilter(file->GetCompilerFilter());
+ }
}
if (!oat_file_exists && !odex_file_exists) {
@@ -303,24 +315,60 @@ OatFileAssistant::OatStatus OatFileAssistant::OatFileStatus() {
return oat_.Status();
}
-OatFileAssistant::OatStatus OatFileAssistant::GivenOatFileStatus(const OatFile& file) {
- // Verify the ART_USE_READ_BARRIER state.
- const bool is_cc = file.GetOatHeader().IsConcurrentCopying();
- constexpr bool kRuntimeIsCC = kUseReadBarrier;
- if (is_cc != kRuntimeIsCC) {
- return kOatCannotOpen;
+bool OatFileAssistant::DexChecksumUpToDate(const VdexFile& file, std::string* error_msg) {
+ if (file.GetHeader().GetNumberOfDexFiles() <= 0) {
+ VLOG(oat) << "Vdex does not contain any dex files";
+ return false;
}
- // Verify the dex checksum.
+ // TODO: Use GetRequiredDexChecksum to get secondary checksums as well, not
+ // just the primary. Because otherwise we may fail to see a secondary
+ // checksum failure in the case when the original (multidex) files are
+ // stripped but we have a newer odex file.
+ const uint32_t* dex_checksum_pointer = GetRequiredDexChecksum();
+ if (dex_checksum_pointer != nullptr) {
+ uint32_t actual_checksum = file.GetLocationChecksum(0);
+ if (*dex_checksum_pointer != actual_checksum) {
+ VLOG(oat) << "Dex checksum does not match for primary dex: " << dex_location_
+ << ". Expected: " << *dex_checksum_pointer
+ << ", Actual: " << actual_checksum;
+ return false;
+ }
+ }
+
+ // Verify the dex checksums for any secondary multidex files
+ for (uint32_t i = 1; i < file.GetHeader().GetNumberOfDexFiles(); i++) {
+ std::string secondary_dex_location = DexFile::GetMultiDexLocation(i, dex_location_.c_str());
+ uint32_t expected_secondary_checksum = 0;
+ if (DexFile::GetChecksum(secondary_dex_location.c_str(),
+ &expected_secondary_checksum,
+ error_msg)) {
+ uint32_t actual_secondary_checksum = file.GetLocationChecksum(i);
+ if (expected_secondary_checksum != actual_secondary_checksum) {
+ VLOG(oat) << "Dex checksum does not match for secondary dex: "
+ << secondary_dex_location
+ << ". Expected: " << expected_secondary_checksum
+ << ", Actual: " << actual_secondary_checksum;
+ return false;
+ }
+ } else {
+ // If we can't get the checksum for the secondary location, we assume
+ // the dex checksum is up to date for this and all other secondary dex
+ // files.
+ break;
+ }
+ }
+ return true;
+}
+
+bool OatFileAssistant::DexChecksumUpToDate(const OatFile& file, std::string* error_msg) {
// Note: GetOatDexFile will return null if the dex checksum doesn't match
// what we provide, which verifies the primary dex checksum for us.
- std::string error_msg;
const uint32_t* dex_checksum_pointer = GetRequiredDexChecksum();
const OatFile::OatDexFile* oat_dex_file = file.GetOatDexFile(
- dex_location_.c_str(), dex_checksum_pointer, &error_msg);
+ dex_location_.c_str(), dex_checksum_pointer, error_msg);
if (oat_dex_file == nullptr) {
- LOG(ERROR) << error_msg;
- return kOatDexOutOfDate;
+ return false;
}
// Verify the dex checksums for any secondary multidex files
@@ -335,7 +383,7 @@ OatFileAssistant::OatStatus OatFileAssistant::GivenOatFileStatus(const OatFile&
uint32_t expected_secondary_checksum = 0;
if (DexFile::GetChecksum(secondary_dex_location.c_str(),
- &expected_secondary_checksum, &error_msg)) {
+ &expected_secondary_checksum, error_msg)) {
uint32_t actual_secondary_checksum
= secondary_oat_dex_file->GetDexFileLocationChecksum();
if (expected_secondary_checksum != actual_secondary_checksum) {
@@ -343,7 +391,7 @@ OatFileAssistant::OatStatus OatFileAssistant::GivenOatFileStatus(const OatFile&
<< secondary_dex_location
<< ". Expected: " << expected_secondary_checksum
<< ", Actual: " << actual_secondary_checksum;
- return kOatDexOutOfDate;
+ return false;
}
} else {
// If we can't get the checksum for the secondary location, we assume
@@ -352,6 +400,35 @@ OatFileAssistant::OatStatus OatFileAssistant::GivenOatFileStatus(const OatFile&
break;
}
}
+ return true;
+}
+
+OatFileAssistant::OatStatus OatFileAssistant::GivenOatFileStatus(const OatFile& file) {
+ // Verify the ART_USE_READ_BARRIER state.
+ // TODO: Don't fully reject files due to read barrier state. If they contain
+ // compiled code and are otherwise okay, we should return something like
+ // kOatRelocationOutOfDate. If they don't contain compiled code, the read
+ // barrier state doesn't matter.
+ const bool is_cc = file.GetOatHeader().IsConcurrentCopying();
+ constexpr bool kRuntimeIsCC = kUseReadBarrier;
+ if (is_cc != kRuntimeIsCC) {
+ return kOatCannotOpen;
+ }
+
+ // Verify the dex checksum.
+ std::string error_msg;
+ if (kIsVdexEnabled) {
+ VdexFile* vdex = file.GetVdexFile();
+ if (!DexChecksumUpToDate(*vdex, &error_msg)) {
+ LOG(ERROR) << error_msg;
+ return kOatDexOutOfDate;
+ }
+ } else {
+ if (!DexChecksumUpToDate(file, &error_msg)) {
+ LOG(ERROR) << error_msg;
+ return kOatDexOutOfDate;
+ }
+ }
CompilerFilter::Filter current_compiler_filter = file.GetCompilerFilter();
@@ -777,7 +854,27 @@ OatFileAssistant::OatStatus OatFileAssistant::OatFileInfo::Status() {
status_attempted_ = true;
const OatFile* file = GetFile();
if (file == nullptr) {
- status_ = kOatCannotOpen;
+ // Check to see if there is a vdex file we can make use of.
+ std::string error_msg;
+ std::string vdex_filename = ReplaceFileExtension(filename_, "vdex");
+ std::unique_ptr<VdexFile> vdex = VdexFile::Open(vdex_filename,
+ /*writeable*/false,
+ /*low_4gb*/false,
+ &error_msg);
+ if (vdex == nullptr) {
+ status_ = kOatCannotOpen;
+ VLOG(oat) << "unable to open vdex file " << vdex_filename << ": " << error_msg;
+ } else {
+ if (oat_file_assistant_->DexChecksumUpToDate(*vdex, &error_msg)) {
+ // The vdex file does not contain enough information to determine
+ // whether it is up to date with respect to the boot image, so we
+ // assume it is out of date.
+ VLOG(oat) << error_msg;
+ status_ = kOatBootImageOutOfDate;
+ } else {
+ status_ = kOatDexOutOfDate;
+ }
+ }
} else {
status_ = oat_file_assistant_->GivenOatFileStatus(*file);
VLOG(oat) << file->GetLocation() << " is " << status_
diff --git a/runtime/oat_file_assistant.h b/runtime/oat_file_assistant.h
index 588a698be7..6d47ad2228 100644
--- a/runtime/oat_file_assistant.h
+++ b/runtime/oat_file_assistant.h
@@ -379,6 +379,16 @@ class OatFileAssistant {
// Return info for the best oat file.
OatFileInfo& GetBestInfo();
+ // Returns true if the dex checksums in the given vdex file are up to date
+ // with respect to the dex location. If the dex checksums are not up to
+ // date, error_msg is updated with a message describing the problem.
+ bool DexChecksumUpToDate(const VdexFile& file, std::string* error_msg);
+
+ // Returns true if the dex checksums in the given oat file are up to date
+ // with respect to the dex location. If the dex checksums are not up to
+ // date, error_msg is updated with a message describing the problem.
+ bool DexChecksumUpToDate(const OatFile& file, std::string* error_msg);
+
// Return the status for a given opened oat file with respect to the dex
// location.
OatStatus GivenOatFileStatus(const OatFile& file);
diff --git a/runtime/oat_file_assistant_test.cc b/runtime/oat_file_assistant_test.cc
index 577200847a..f777340cfd 100644
--- a/runtime/oat_file_assistant_test.cc
+++ b/runtime/oat_file_assistant_test.cc
@@ -111,27 +111,84 @@ TEST_F(OatFileAssistantTest, OatUpToDate) {
EXPECT_TRUE(oat_file_assistant.HasOriginalDexFiles());
}
-// Case: We have a DEX file and ODEX file for a different dex location.
-// Expect: The status is kDex2OatNeeded.
-TEST_F(OatFileAssistantTest, OatForDifferentDex) {
- // Generate an odex file for OatForDifferentDex_A.jar
- std::string dex_location_a = GetScratchDir() + "/OatForDifferentDex_A.jar";
- std::string odex_location = GetOdexDir() + "/OatForDifferentDex.odex";
- Copy(GetDexSrc1(), dex_location_a);
- GenerateOdexForTest(dex_location_a, odex_location, CompilerFilter::kSpeed);
-
- // Try to use that odex file for OatForDifferentDex.jar
- std::string dex_location = GetScratchDir() + "/OatForDifferentDex.jar";
+// Case: We have a DEX file and up-to-date (ODEX) VDEX file for it, but no
+// ODEX file.
+TEST_F(OatFileAssistantTest, VdexUpToDateNoOdex) {
+ // This test case is only meaningful if vdex is enabled.
+ if (!kIsVdexEnabled) {
+ return;
+ }
+
+ std::string dex_location = GetScratchDir() + "/VdexUpToDateNoOdex.jar";
+ std::string oat_location = GetOdexDir() + "/VdexUpToDateNoOdex.oat";
+
Copy(GetDexSrc1(), dex_location);
- OatFileAssistant oat_file_assistant(dex_location.c_str(), kRuntimeISA, false);
+ // Generating and deleting the oat file should have the side effect of
+ // creating an up-to-date vdex file.
+ GenerateOdexForTest(dex_location, oat_location, CompilerFilter::kSpeed);
+ ASSERT_EQ(0, unlink(oat_location.c_str()));
+
+ OatFileAssistant oat_file_assistant(dex_location.c_str(),
+ oat_location.c_str(),
+ kRuntimeISA,
+ false);
+
+ // Even though the vdex file is up to date, because we don't have the oat
+ // file, we can't know that the vdex depends on the boot image and is up to
+ // date with respect to the boot image. Instead we must assume the vdex file
+ // depends on the boot image and is out of date with respect to the boot
+ // image.
+ EXPECT_EQ(-OatFileAssistant::kDex2OatForBootImage,
+ oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeed));
+
+ // Make sure we don't crash in this case when we dump the status. We don't
+ // care what the actual dumped value is.
+ oat_file_assistant.GetStatusDump();
+}
+
+// Case: We have a DEX file and empty VDEX and ODEX files.
+TEST_F(OatFileAssistantTest, EmptyVdexOdex) {
+ std::string dex_location = GetScratchDir() + "/EmptyVdexOdex.jar";
+ std::string odex_location = GetOdexDir() + "/EmptyVdexOdex.oat";
+ std::string vdex_location = GetOdexDir() + "/EmptyVdexOdex.vdex";
+
+ Copy(GetDexSrc1(), dex_location);
+ ScratchFile vdex_file(vdex_location.c_str());
+ ScratchFile odex_file(odex_location.c_str());
+ OatFileAssistant oat_file_assistant(dex_location.c_str(), kRuntimeISA, false);
EXPECT_EQ(OatFileAssistant::kDex2OatFromScratch,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeed));
+}
- EXPECT_FALSE(oat_file_assistant.IsInBootClassPath());
- EXPECT_EQ(OatFileAssistant::kOatDexOutOfDate, oat_file_assistant.OdexFileStatus());
- EXPECT_EQ(OatFileAssistant::kOatCannotOpen, oat_file_assistant.OatFileStatus());
+// Case: We have a DEX file and up-to-date (OAT) VDEX file for it, but no OAT
+// file.
+TEST_F(OatFileAssistantTest, VdexUpToDateNoOat) {
+ // This test case is only meaningful if vdex is enabled.
+ if (!kIsVdexEnabled) {
+ return;
+ }
+
+ std::string dex_location = GetScratchDir() + "/VdexUpToDateNoOat.jar";
+ std::string oat_location;
+ std::string error_msg;
+ ASSERT_TRUE(OatFileAssistant::DexLocationToOatFilename(
+ dex_location, kRuntimeISA, &oat_location, &error_msg)) << error_msg;
+
+ Copy(GetDexSrc1(), dex_location);
+ GenerateOatForTest(dex_location.c_str(), CompilerFilter::kSpeed);
+ ASSERT_EQ(0, unlink(oat_location.c_str()));
+
+ OatFileAssistant oat_file_assistant(dex_location.c_str(), kRuntimeISA, false);
+
+ // Even though the vdex file is up to date, because we don't have the oat
+ // file, we can't know that the vdex depends on the boot image and is up to
+ // date with respect to the boot image. Instead we must assume the vdex file
+ // depends on the boot image and is out of date with respect to the boot
+ // image.
+ EXPECT_EQ(OatFileAssistant::kDex2OatForBootImage,
+ oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeed));
}
// Case: We have a DEX file and speed-profile OAT file for it.
@@ -254,6 +311,56 @@ TEST_F(OatFileAssistantTest, OatDexOutOfDate) {
EXPECT_TRUE(oat_file_assistant.HasOriginalDexFiles());
}
+// Case: We have a DEX file and an (ODEX) VDEX file out of date with respect
+// to the dex checksum, but no ODEX file.
+TEST_F(OatFileAssistantTest, VdexDexOutOfDate) {
+ // This test case is only meaningful if vdex is enabled.
+ if (!kIsVdexEnabled) {
+ return;
+ }
+
+ std::string dex_location = GetScratchDir() + "/VdexDexOutOfDate.jar";
+ std::string oat_location = GetOdexDir() + "/VdexDexOutOfDate.oat";
+
+ Copy(GetDexSrc1(), dex_location);
+ GenerateOdexForTest(dex_location, oat_location, CompilerFilter::kSpeed);
+ ASSERT_EQ(0, unlink(oat_location.c_str()));
+ Copy(GetDexSrc2(), dex_location);
+
+ OatFileAssistant oat_file_assistant(dex_location.c_str(),
+ oat_location.c_str(),
+ kRuntimeISA,
+ false);
+
+ EXPECT_EQ(OatFileAssistant::kDex2OatFromScratch,
+ oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeed));
+}
+
+// Case: We have a MultiDEX (ODEX) VDEX file where the secondary dex file is
+// out of date and there is no corresponding ODEX file.
+TEST_F(OatFileAssistantTest, VdexMultiDexSecondaryOutOfDate) {
+ // This test case is only meaningful if vdex is enabled.
+ if (!kIsVdexEnabled) {
+ return;
+ }
+
+ std::string dex_location = GetScratchDir() + "/VdexMultiDexSecondaryOutOfDate.jar";
+ std::string oat_location = GetOdexDir() + "/VdexMultiDexSecondaryOutOfDate.oat";
+
+ Copy(GetMultiDexSrc1(), dex_location);
+ GenerateOdexForTest(dex_location, oat_location, CompilerFilter::kSpeed);
+ ASSERT_EQ(0, unlink(oat_location.c_str()));
+ Copy(GetMultiDexSrc2(), dex_location);
+
+ OatFileAssistant oat_file_assistant(dex_location.c_str(),
+ oat_location.c_str(),
+ kRuntimeISA,
+ false);
+
+ EXPECT_EQ(OatFileAssistant::kDex2OatFromScratch,
+ oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeed));
+}
+
// Case: We have a DEX file and an OAT file out of date with respect to the
// boot image.
TEST_F(OatFileAssistantTest, OatImageOutOfDate) {
@@ -945,6 +1052,4 @@ TEST_F(OatFileAssistantTest, DexOptStatusValues) {
// - Dex is stripped, don't have odex.
// - Oat file corrupted after status check, before reload unexecutable
// because it's unrelocated and no dex2oat
-// * Test unrelocated specific target compilation type can be relocated to
-// make it up to date.
} // namespace art
diff --git a/runtime/openjdkjvmti/ti_class_loader.cc b/runtime/openjdkjvmti/ti_class_loader.cc
index b68fc60c6c..afec0bfac0 100644
--- a/runtime/openjdkjvmti/ti_class_loader.cc
+++ b/runtime/openjdkjvmti/ti_class_loader.cc
@@ -61,14 +61,20 @@ namespace openjdkjvmti {
bool ClassLoaderHelper::AddToClassLoader(art::Thread* self,
art::Handle<art::mirror::ClassLoader> loader,
const art::DexFile* dex_file) {
- art::StackHandleScope<2> hs(self);
- art::Handle<art::mirror::Object> java_dex_file_obj(hs.NewHandle(FindSourceDexFileObject(self,
- loader)));
+ art::ScopedObjectAccessUnchecked soa(self);
+ art::StackHandleScope<3> hs(self);
+ if (art::ClassLinker::IsBootClassLoader(soa, loader.Get())) {
+ art::Runtime::Current()->GetClassLinker()->AppendToBootClassPath(self, *dex_file);
+ return true;
+ }
+ art::Handle<art::mirror::Object> java_dex_file_obj(
+ hs.NewHandle(FindSourceDexFileObject(self, loader)));
if (java_dex_file_obj.IsNull()) {
return false;
}
+ art::Handle<art::mirror::LongArray> old_cookie(hs.NewHandle(GetDexFileCookie(java_dex_file_obj)));
art::Handle<art::mirror::LongArray> cookie(hs.NewHandle(
- AllocateNewDexFileCookie(self, java_dex_file_obj, dex_file)));
+ AllocateNewDexFileCookie(self, old_cookie, dex_file)));
if (cookie.IsNull()) {
return false;
}
@@ -94,12 +100,8 @@ void ClassLoaderHelper::UpdateJavaDexFile(art::ObjPtr<art::mirror::Object> java_
}
}
-// TODO Really wishing I had that mirror of java.lang.DexFile now.
-art::ObjPtr<art::mirror::LongArray> ClassLoaderHelper::AllocateNewDexFileCookie(
- art::Thread* self,
- art::Handle<art::mirror::Object> java_dex_file_obj,
- const art::DexFile* dex_file) {
- art::StackHandleScope<2> hs(self);
+art::ObjPtr<art::mirror::LongArray> ClassLoaderHelper::GetDexFileCookie(
+ art::Handle<art::mirror::Object> java_dex_file_obj) {
// mCookie is nulled out if the DexFile has been closed but mInternalCookie sticks around until
// the object is finalized. Since they always point to the same array if mCookie is not null we
// just use the mInternalCookie field. We will update one or both of these fields later.
@@ -108,9 +110,15 @@ art::ObjPtr<art::mirror::LongArray> ClassLoaderHelper::AllocateNewDexFileCookie(
"mInternalCookie", "Ljava/lang/Object;");
// TODO Add check that mCookie is either null or same as mInternalCookie
CHECK(internal_cookie_field != nullptr);
- art::Handle<art::mirror::LongArray> cookie(
- hs.NewHandle(internal_cookie_field->GetObject(java_dex_file_obj.Get())->AsLongArray()));
- // TODO Maybe make these non-fatal.
+ return internal_cookie_field->GetObject(java_dex_file_obj.Get())->AsLongArray();
+}
+
+// TODO Really wishing I had that mirror of java.lang.DexFile now.
+art::ObjPtr<art::mirror::LongArray> ClassLoaderHelper::AllocateNewDexFileCookie(
+ art::Thread* self,
+ art::Handle<art::mirror::LongArray> cookie,
+ const art::DexFile* dex_file) {
+ art::StackHandleScope<1> hs(self);
CHECK(cookie.Get() != nullptr);
CHECK_GE(cookie->GetLength(), 1);
art::Handle<art::mirror::LongArray> new_cookie(
@@ -123,8 +131,9 @@ art::ObjPtr<art::mirror::LongArray> ClassLoaderHelper::AllocateNewDexFileCookie(
// TODO Should I clear this field?
// TODO This is a really crappy thing here with the first element being different.
new_cookie->SetWithoutChecks<false>(0, cookie->GetWithoutChecks(0));
+ // This must match the casts in runtime/native/dalvik_system_DexFile.cc:ConvertDexFilesToJavaArray
new_cookie->SetWithoutChecks<false>(
- 1, static_cast<int64_t>(reinterpret_cast<intptr_t>(dex_file)));
+ 1, static_cast<int64_t>(reinterpret_cast<uintptr_t>(dex_file)));
new_cookie->Memcpy(2, cookie.Get(), 1, cookie->GetLength() - 1);
return new_cookie.Get();
}
diff --git a/runtime/openjdkjvmti/ti_class_loader.h b/runtime/openjdkjvmti/ti_class_loader.h
index 17ed0eb196..1ac49886cb 100644
--- a/runtime/openjdkjvmti/ti_class_loader.h
+++ b/runtime/openjdkjvmti/ti_class_loader.h
@@ -82,9 +82,12 @@ class ClassLoaderHelper {
art::Thread* self, art::Handle<art::mirror::ClassLoader> loader)
REQUIRES_SHARED(art::Locks::mutator_lock_);
+ static art::ObjPtr<art::mirror::LongArray> GetDexFileCookie(
+ art::Handle<art::mirror::Object> java_dex_file) REQUIRES_SHARED(art::Locks::mutator_lock_);
+
static art::ObjPtr<art::mirror::LongArray> AllocateNewDexFileCookie(
art::Thread* self,
- art::Handle<art::mirror::Object> java_dex_file,
+ art::Handle<art::mirror::LongArray> old_dex_file_cookie,
const art::DexFile* new_dex_file) REQUIRES_SHARED(art::Locks::mutator_lock_);
static void UpdateJavaDexFile(art::ObjPtr<art::mirror::Object> java_dex_file,
diff --git a/runtime/openjdkjvmti/ti_redefine.cc b/runtime/openjdkjvmti/ti_redefine.cc
index da4757f50f..b7257f8994 100644
--- a/runtime/openjdkjvmti/ti_redefine.cc
+++ b/runtime/openjdkjvmti/ti_redefine.cc
@@ -121,6 +121,7 @@ class ObsoleteMethodStackVisitor : public art::StackVisitor {
new_obsolete_method->CopyFrom(old_method, ptr_size);
DCHECK_EQ(new_obsolete_method->GetDeclaringClass(), old_method->GetDeclaringClass());
new_obsolete_method->SetIsObsolete();
+ new_obsolete_method->SetDontCompile();
obsolete_maps_->insert({old_method, new_obsolete_method});
// Update JIT Data structures to point to the new method.
art::jit::Jit* jit = art::Runtime::Current()->GetJit();
@@ -445,7 +446,8 @@ void Redefiner::ClassRedefinition::FindAndAllocateObsoleteMethods(art::mirror::C
art::ScopedAssertNoThreadSuspension ns("No thread suspension during thread stack walking");
art::mirror::ClassExt* ext = art_klass->GetExtData();
CHECK(ext->GetObsoleteMethods() != nullptr);
- CallbackCtx ctx(art_klass->GetClassLoader()->GetAllocator());
+ art::ClassLinker* linker = driver_->runtime_->GetClassLinker();
+ CallbackCtx ctx(linker->GetAllocatorForClassLoader(art_klass->GetClassLoader()));
// Add all the declared methods to the map
for (auto& m : art_klass->GetDeclaredMethods(art::kRuntimePointerSize)) {
ctx.obsolete_methods.insert(&m);
@@ -700,35 +702,85 @@ class RedefinitionDataHolder {
DISALLOW_COPY_AND_ASSIGN(RedefinitionDataHolder);
};
+// Looks through the previously allocated cookies to see if we need to update them with another new
+// dexfile. This is so that even if multiple classes with the same classloader are redefined at
+// once they are all added to the classloader.
+bool Redefiner::ClassRedefinition::AllocateAndRememberNewDexFileCookie(
+ int32_t klass_index,
+ art::Handle<art::mirror::ClassLoader> source_class_loader,
+ art::Handle<art::mirror::Object> dex_file_obj,
+ /*out*/RedefinitionDataHolder* holder) {
+ art::StackHandleScope<2> hs(driver_->self_);
+ art::MutableHandle<art::mirror::LongArray> old_cookie(
+ hs.NewHandle<art::mirror::LongArray>(nullptr));
+ bool has_older_cookie = false;
+ // See if we already have a cookie that a previous redefinition got from the same classloader.
+ for (int32_t i = 0; i < klass_index; i++) {
+ if (holder->GetSourceClassLoader(i) == source_class_loader.Get()) {
+ // Since every instance of this classloader should have the same cookie associated with it we
+ // can stop looking here.
+ has_older_cookie = true;
+ old_cookie.Assign(holder->GetNewDexFileCookie(i));
+ break;
+ }
+ }
+ if (old_cookie.IsNull()) {
+ // No older cookie. Get it directly from the dex_file_obj
+ // We should not have seen this classloader elsewhere.
+ CHECK(!has_older_cookie);
+ old_cookie.Assign(ClassLoaderHelper::GetDexFileCookie(dex_file_obj));
+ }
+ // Use the old cookie to generate the new one with the new DexFile* added in.
+ art::Handle<art::mirror::LongArray>
+ new_cookie(hs.NewHandle(ClassLoaderHelper::AllocateNewDexFileCookie(driver_->self_,
+ old_cookie,
+ dex_file_.get())));
+ // Make sure the allocation worked.
+ if (new_cookie.IsNull()) {
+ return false;
+ }
+
+ // Save the cookie.
+ holder->SetNewDexFileCookie(klass_index, new_cookie.Get());
+ // If there are other copies of this same classloader we need to make sure that we all have the
+ // same cookie.
+ if (has_older_cookie) {
+ for (int32_t i = 0; i < klass_index; i++) {
+ // We will let the GC take care of the cookie we allocated for this one.
+ if (holder->GetSourceClassLoader(i) == source_class_loader.Get()) {
+ holder->SetNewDexFileCookie(i, new_cookie.Get());
+ }
+ }
+ }
+
+ return true;
+}
+
bool Redefiner::ClassRedefinition::FinishRemainingAllocations(
int32_t klass_index, /*out*/RedefinitionDataHolder* holder) {
+ art::ScopedObjectAccessUnchecked soa(driver_->self_);
art::StackHandleScope<2> hs(driver_->self_);
holder->SetMirrorClass(klass_index, GetMirrorClass());
// This shouldn't allocate
art::Handle<art::mirror::ClassLoader> loader(hs.NewHandle(GetClassLoader()));
- holder->SetSourceClassLoader(klass_index, loader.Get());
- if (loader.Get() == nullptr) {
- // TODO Better error msg.
- RecordFailure(ERR(INTERNAL), "Unable to find class loader!");
- return false;
- }
- art::Handle<art::mirror::Object> dex_file_obj(hs.NewHandle(
- ClassLoaderHelper::FindSourceDexFileObject(driver_->self_, loader)));
- holder->SetJavaDexFile(klass_index, dex_file_obj.Get());
- if (dex_file_obj.Get() == nullptr) {
- // TODO Better error msg.
- RecordFailure(ERR(INTERNAL), "Unable to find class loader!");
- return false;
- }
- holder->SetNewDexFileCookie(klass_index,
- ClassLoaderHelper::AllocateNewDexFileCookie(driver_->self_,
- dex_file_obj,
- dex_file_.get()).Ptr());
- if (holder->GetNewDexFileCookie(klass_index) == nullptr) {
- driver_->self_->AssertPendingOOMException();
- driver_->self_->ClearException();
- RecordFailure(ERR(OUT_OF_MEMORY), "Unable to allocate dex file array for class loader");
- return false;
+ // The bootclasspath is handled specially so it doesn't have a j.l.DexFile.
+ if (!art::ClassLinker::IsBootClassLoader(soa, loader.Get())) {
+ holder->SetSourceClassLoader(klass_index, loader.Get());
+ art::Handle<art::mirror::Object> dex_file_obj(hs.NewHandle(
+ ClassLoaderHelper::FindSourceDexFileObject(driver_->self_, loader)));
+ holder->SetJavaDexFile(klass_index, dex_file_obj.Get());
+ if (dex_file_obj.Get() == nullptr) {
+ // TODO Better error msg.
+ RecordFailure(ERR(INTERNAL), "Unable to find dex file!");
+ return false;
+ }
+ // Allocate the new dex file cookie.
+ if (!AllocateAndRememberNewDexFileCookie(klass_index, loader, dex_file_obj, holder)) {
+ driver_->self_->AssertPendingOOMException();
+ driver_->self_->ClearException();
+ RecordFailure(ERR(OUT_OF_MEMORY), "Unable to allocate dex file array for class loader");
+ return false;
+ }
}
holder->SetNewDexCache(klass_index, CreateNewDexCache(loader));
if (holder->GetNewDexCache(klass_index) == nullptr) {
@@ -815,6 +867,13 @@ jvmtiError Redefiner::Run() {
// cleaned up by the GC eventually.
return result_;
}
+ int32_t counter = 0;
+ for (Redefiner::ClassRedefinition& redef : redefinitions_) {
+ if (holder.GetSourceClassLoader(counter) == nullptr) {
+ runtime_->GetClassLinker()->AppendToBootClassPath(self_, redef.GetDexFile());
+ }
+ counter++;
+ }
// Disable GC and wait for it to be done if we are a moving GC. This is fine since we are done
// allocating so no deadlocks.
art::gc::Heap* heap = runtime_->GetHeap();
@@ -833,16 +892,19 @@ jvmtiError Redefiner::Run() {
// TODO We need to update all debugger MethodIDs so they note the method they point to is
// obsolete or implement some other well defined semantics.
// TODO We need to decide on & implement semantics for JNI jmethodids when we redefine methods.
- int32_t cnt = 0;
+ counter = 0;
for (Redefiner::ClassRedefinition& redef : redefinitions_) {
art::ScopedAssertNoThreadSuspension nts("Updating runtime objects for redefinition");
- art::mirror::Class* klass = holder.GetMirrorClass(cnt);
- ClassLoaderHelper::UpdateJavaDexFile(holder.GetJavaDexFile(cnt),
- holder.GetNewDexFileCookie(cnt));
+ if (holder.GetSourceClassLoader(counter) != nullptr) {
+ ClassLoaderHelper::UpdateJavaDexFile(holder.GetJavaDexFile(counter),
+ holder.GetNewDexFileCookie(counter));
+ }
+ art::mirror::Class* klass = holder.GetMirrorClass(counter);
// TODO Rewrite so we don't do a stack walk for each and every class.
redef.FindAndAllocateObsoleteMethods(klass);
- redef.UpdateClass(klass, holder.GetNewDexCache(cnt), holder.GetOriginalDexFileBytes(cnt));
- cnt++;
+ redef.UpdateClass(klass, holder.GetNewDexCache(counter),
+ holder.GetOriginalDexFileBytes(counter));
+ counter++;
}
// TODO Verify the new Class.
// TODO Shrink the obsolete method maps if possible?
diff --git a/runtime/openjdkjvmti/ti_redefine.h b/runtime/openjdkjvmti/ti_redefine.h
index fc7a3b3dec..5aa7dde55c 100644
--- a/runtime/openjdkjvmti/ti_redefine.h
+++ b/runtime/openjdkjvmti/ti_redefine.h
@@ -127,6 +127,10 @@ class Redefiner {
art::mirror::Class* GetMirrorClass() REQUIRES_SHARED(art::Locks::mutator_lock_);
art::mirror::ClassLoader* GetClassLoader() REQUIRES_SHARED(art::Locks::mutator_lock_);
+ const art::DexFile& GetDexFile() {
+ return *dex_file_;
+ }
+
art::mirror::DexCache* CreateNewDexCache(art::Handle<art::mirror::ClassLoader> loader)
REQUIRES_SHARED(art::Locks::mutator_lock_);
@@ -141,6 +145,13 @@ class Redefiner {
bool FinishRemainingAllocations(int32_t klass_index, /*out*/RedefinitionDataHolder* holder)
REQUIRES_SHARED(art::Locks::mutator_lock_);
+ bool AllocateAndRememberNewDexFileCookie(
+ int32_t klass_index,
+ art::Handle<art::mirror::ClassLoader> source_class_loader,
+ art::Handle<art::mirror::Object> dex_file_obj,
+ /*out*/RedefinitionDataHolder* holder)
+ REQUIRES_SHARED(art::Locks::mutator_lock_);
+
void FindAndAllocateObsoleteMethods(art::mirror::Class* art_klass)
REQUIRES(art::Locks::mutator_lock_);
diff --git a/runtime/quick_exception_handler.cc b/runtime/quick_exception_handler.cc
index 4e76951189..bf995095de 100644
--- a/runtime/quick_exception_handler.cc
+++ b/runtime/quick_exception_handler.cc
@@ -407,7 +407,8 @@ class DeoptimizeStackVisitor FINAL : public StackVisitor {
CodeInfoEncoding encoding = code_info.ExtractEncoding();
StackMap stack_map = code_info.GetStackMapForNativePcOffset(native_pc_offset, encoding);
const size_t number_of_vregs = m->GetCodeItem()->registers_size_;
- uint32_t register_mask = stack_map.GetRegisterMask(encoding.stack_map_encoding);
+ uint32_t register_mask = code_info.GetRegisterMaskOf(encoding, stack_map);
+ BitMemoryRegion stack_mask = code_info.GetStackMaskOf(encoding, stack_map);
DexRegisterMap vreg_map = IsInInlinedFrame()
? code_info.GetDexRegisterMapAtDepth(GetCurrentInliningDepth() - 1,
code_info.GetInlineInfoOf(stack_map, encoding),
@@ -440,8 +441,7 @@ class DeoptimizeStackVisitor FINAL : public StackVisitor {
const uint8_t* addr = reinterpret_cast<const uint8_t*>(GetCurrentQuickFrame()) + offset;
value = *reinterpret_cast<const uint32_t*>(addr);
uint32_t bit = (offset >> 2);
- if (code_info.GetNumberOfStackMaskBits(encoding) > bit &&
- stack_map.GetStackMaskBit(encoding.stack_map_encoding, bit)) {
+ if (bit < encoding.stack_mask_size_in_bits && stack_mask.LoadBit(bit)) {
is_reference = true;
}
break;
diff --git a/runtime/runtime_common.cc b/runtime/runtime_common.cc
index 70aff37961..36901293bb 100644
--- a/runtime/runtime_common.cc
+++ b/runtime/runtime_common.cc
@@ -136,12 +136,14 @@ struct UContext {
void DumpRegister64(std::ostream& os, const char* name, uint64_t value) const;
void DumpX86Flags(std::ostream& os, uint32_t flags) const;
+ // Print some of the information from the status register (CPSR on ARMv7, PSTATE on ARMv8).
+ template <typename RegisterType>
+ void DumpArmStatusRegister(std::ostream& os, RegisterType status_register) const;
mcontext_t& context;
};
void UContext::Dump(std::ostream& os) const {
- // TODO: support non-x86 hosts.
#if defined(__APPLE__) && defined(__i386__)
DumpRegister32(os, "eax", context->__ss.__eax);
DumpRegister32(os, "ebx", context->__ss.__ebx);
@@ -229,7 +231,53 @@ void UContext::Dump(std::ostream& os) const {
DumpRegister32(os, "gs", (context.gregs[REG_CSGSFS] >> 16) & 0x0FFFF);
DumpRegister32(os, "fs", (context.gregs[REG_CSGSFS] >> 32) & 0x0FFFF);
os << '\n';
+#elif defined(__linux__) && defined(__arm__)
+ DumpRegister32(os, "r0", context.arm_r0);
+ DumpRegister32(os, "r1", context.arm_r1);
+ DumpRegister32(os, "r2", context.arm_r2);
+ DumpRegister32(os, "r3", context.arm_r3);
+ os << '\n';
+
+ DumpRegister32(os, "r4", context.arm_r4);
+ DumpRegister32(os, "r5", context.arm_r5);
+ DumpRegister32(os, "r6", context.arm_r6);
+ DumpRegister32(os, "r7", context.arm_r7);
+ os << '\n';
+
+ DumpRegister32(os, "r8", context.arm_r8);
+ DumpRegister32(os, "r9", context.arm_r9);
+ DumpRegister32(os, "r10", context.arm_r10);
+ DumpRegister32(os, "fp", context.arm_fp);
+ os << '\n';
+
+ DumpRegister32(os, "ip", context.arm_ip);
+ DumpRegister32(os, "sp", context.arm_sp);
+ DumpRegister32(os, "lr", context.arm_lr);
+ DumpRegister32(os, "pc", context.arm_pc);
+ os << '\n';
+
+ DumpRegister32(os, "cpsr", context.arm_cpsr);
+ DumpArmStatusRegister(os, context.arm_cpsr);
+ os << '\n';
+#elif defined(__linux__) && defined(__aarch64__)
+ for (size_t i = 0; i <= 30; ++i) {
+ std::string reg_name = "x" + std::to_string(i);
+ DumpRegister64(os, reg_name.c_str(), context.regs[i]);
+ if (i % 4 == 3) {
+ os << '\n';
+ }
+ }
+ os << '\n';
+
+ DumpRegister64(os, "sp", context.sp);
+ DumpRegister64(os, "pc", context.pc);
+ os << '\n';
+
+ DumpRegister64(os, "pstate", context.pstate);
+ DumpArmStatusRegister(os, context.pstate);
+ os << '\n';
#else
+ // TODO: Add support for MIPS32 and MIPS64.
os << "Unknown architecture/word size/OS in ucontext dump";
#endif
}
@@ -274,6 +322,30 @@ void UContext::DumpX86Flags(std::ostream& os, uint32_t flags) const {
os << " ]";
}
+template <typename RegisterType>
+void UContext::DumpArmStatusRegister(std::ostream& os, RegisterType status_register) const {
+ // Condition flags.
+ constexpr RegisterType kFlagV = 1U << 28;
+ constexpr RegisterType kFlagC = 1U << 29;
+ constexpr RegisterType kFlagZ = 1U << 30;
+ constexpr RegisterType kFlagN = 1U << 31;
+
+ os << " [";
+ if ((status_register & kFlagN) != 0) {
+ os << " N";
+ }
+ if ((status_register & kFlagZ) != 0) {
+ os << " Z";
+ }
+ if ((status_register & kFlagC) != 0) {
+ os << " C";
+ }
+ if ((status_register & kFlagV) != 0) {
+ os << " V";
+ }
+ os << " ]";
+}
+
int GetTimeoutSignal() {
#if defined(__APPLE__)
// Mac does not support realtime signals.
diff --git a/runtime/stack.cc b/runtime/stack.cc
index f9efc0b88f..5ad00a4e55 100644
--- a/runtime/stack.cc
+++ b/runtime/stack.cc
@@ -625,7 +625,7 @@ void StackVisitor::SetMethod(ArtMethod* method) {
} else {
DCHECK(cur_quick_frame_ != nullptr);
CHECK(!IsInInlinedFrame()) << "We do not support setting inlined method's ArtMethod!";
- *cur_quick_frame_ = method;
+ *cur_quick_frame_ = method;
}
}
diff --git a/runtime/stack_map.cc b/runtime/stack_map.cc
index e093293e75..4e7c3f4f9f 100644
--- a/runtime/stack_map.cc
+++ b/runtime/stack_map.cc
@@ -97,8 +97,9 @@ void StackMapEncoding::Dump(VariableIndentationOutputStream* vios) const {
<< ", dex_pc_bit_offset=" << static_cast<uint32_t>(dex_pc_bit_offset_)
<< ", dex_register_map_bit_offset=" << static_cast<uint32_t>(dex_register_map_bit_offset_)
<< ", inline_info_bit_offset=" << static_cast<uint32_t>(inline_info_bit_offset_)
- << ", register_mask_bit_offset=" << static_cast<uint32_t>(register_mask_bit_offset_)
- << ", stack_mask_bit_offset=" << static_cast<uint32_t>(stack_mask_bit_offset_)
+ << ", register_mask_bit_offset=" << static_cast<uint32_t>(register_mask_index_bit_offset_)
+ << ", stack_mask_index_bit_offset=" << static_cast<uint32_t>(stack_mask_index_bit_offset_)
+ << ", total_bit_size=" << static_cast<uint32_t>(total_bit_size_)
<< ")\n";
}
@@ -198,16 +199,17 @@ void StackMap::Dump(VariableIndentationOutputStream* vios,
<< "StackMap" << header_suffix
<< std::hex
<< " [native_pc=0x" << code_offset + pc_offset << "]"
- << " [entry_size=0x" << encoding.stack_map_size_in_bits << " bits]"
+ << " [entry_size=0x" << encoding.stack_map_encoding.BitSize() << " bits]"
<< " (dex_pc=0x" << GetDexPc(stack_map_encoding)
<< ", native_pc_offset=0x" << pc_offset
<< ", dex_register_map_offset=0x" << GetDexRegisterMapOffset(stack_map_encoding)
<< ", inline_info_offset=0x" << GetInlineDescriptorOffset(stack_map_encoding)
- << ", register_mask=0x" << GetRegisterMask(stack_map_encoding)
+ << ", register_mask=0x" << code_info.GetRegisterMaskOf(encoding, *this)
<< std::dec
<< ", stack_mask=0b";
- for (size_t i = 0, e = code_info.GetNumberOfStackMaskBits(encoding); i < e; ++i) {
- vios->Stream() << GetStackMaskBit(stack_map_encoding, e - i - 1);
+ BitMemoryRegion stack_mask = code_info.GetStackMaskOf(encoding, *this);
+ for (size_t i = 0, e = encoding.stack_mask_size_in_bits; i < e; ++i) {
+ vios->Stream() << stack_mask.LoadBit(e - i - 1);
}
vios->Stream() << ")\n";
if (HasDexRegisterMap(stack_map_encoding)) {
diff --git a/runtime/stack_map.h b/runtime/stack_map.h
index 679218d5be..062404dbf2 100644
--- a/runtime/stack_map.h
+++ b/runtime/stack_map.h
@@ -694,35 +694,35 @@ class StackMapEncoding {
size_t dex_pc_max,
size_t dex_register_map_size,
size_t inline_info_size,
- size_t register_mask_max,
- size_t stack_mask_bit_size) {
- size_t bit_offset = 0;
- DCHECK_EQ(kNativePcBitOffset, bit_offset);
- bit_offset += MinimumBitsToStore(native_pc_max);
+ size_t number_of_register_masks,
+ size_t number_of_stack_masks) {
+ total_bit_size_ = 0;
+ DCHECK_EQ(kNativePcBitOffset, total_bit_size_);
+ total_bit_size_ += MinimumBitsToStore(native_pc_max);
- dex_pc_bit_offset_ = dchecked_integral_cast<uint8_t>(bit_offset);
- bit_offset += MinimumBitsToStore(1 /* kNoDexPc */ + dex_pc_max);
+ dex_pc_bit_offset_ = total_bit_size_;
+ total_bit_size_ += MinimumBitsToStore(1 /* kNoDexPc */ + dex_pc_max);
// We also need +1 for kNoDexRegisterMap, but since the size is strictly
// greater than any offset we might try to encode, we already implicitly have it.
- dex_register_map_bit_offset_ = dchecked_integral_cast<uint8_t>(bit_offset);
- bit_offset += MinimumBitsToStore(dex_register_map_size);
+ dex_register_map_bit_offset_ = total_bit_size_;
+ total_bit_size_ += MinimumBitsToStore(dex_register_map_size);
// We also need +1 for kNoInlineInfo, but since the inline_info_size is strictly
// greater than the offset we might try to encode, we already implicitly have it.
// If inline_info_size is zero, we can encode only kNoInlineInfo (in zero bits).
- inline_info_bit_offset_ = dchecked_integral_cast<uint8_t>(bit_offset);
+ inline_info_bit_offset_ = total_bit_size_;
if (inline_info_size != 0) {
- bit_offset += MinimumBitsToStore(dex_register_map_size + inline_info_size);
+ total_bit_size_ += MinimumBitsToStore(dex_register_map_size + inline_info_size);
}
- register_mask_bit_offset_ = dchecked_integral_cast<uint8_t>(bit_offset);
- bit_offset += MinimumBitsToStore(register_mask_max);
+ register_mask_index_bit_offset_ = total_bit_size_;
+ total_bit_size_ += MinimumBitsToStore(number_of_register_masks);
- stack_mask_bit_offset_ = dchecked_integral_cast<uint8_t>(bit_offset);
- bit_offset += stack_mask_bit_size;
+ stack_mask_index_bit_offset_ = total_bit_size_;
+ total_bit_size_ += MinimumBitsToStore(number_of_stack_masks);
- return bit_offset;
+ return total_bit_size_;
}
ALWAYS_INLINE FieldEncoding GetNativePcEncoding() const {
@@ -735,18 +735,18 @@ class StackMapEncoding {
return FieldEncoding(dex_register_map_bit_offset_, inline_info_bit_offset_, -1 /* min_value */);
}
ALWAYS_INLINE FieldEncoding GetInlineInfoEncoding() const {
- return FieldEncoding(inline_info_bit_offset_, register_mask_bit_offset_, -1 /* min_value */);
+ return FieldEncoding(inline_info_bit_offset_,
+ register_mask_index_bit_offset_,
+ -1 /* min_value */);
}
- ALWAYS_INLINE FieldEncoding GetRegisterMaskEncoding() const {
- return FieldEncoding(register_mask_bit_offset_, stack_mask_bit_offset_);
+ ALWAYS_INLINE FieldEncoding GetRegisterMaskIndexEncoding() const {
+ return FieldEncoding(register_mask_index_bit_offset_, stack_mask_index_bit_offset_);
}
- ALWAYS_INLINE size_t GetStackMaskBitOffset() const {
- // The end offset is not encoded. It is implicitly the end of stack map entry.
- return stack_mask_bit_offset_;
+ ALWAYS_INLINE FieldEncoding GetStackMaskIndexEncoding() const {
+ return FieldEncoding(stack_mask_index_bit_offset_, total_bit_size_);
}
- ALWAYS_INLINE size_t GetNumberOfStackMaskBits(size_t stack_map_bits) const {
- // Note that the stack mask bits are last.
- return stack_map_bits - GetStackMaskBitOffset();
+ ALWAYS_INLINE size_t BitSize() const {
+ return total_bit_size_;
}
void Dump(VariableIndentationOutputStream* vios) const;
@@ -756,8 +756,9 @@ class StackMapEncoding {
uint8_t dex_pc_bit_offset_;
uint8_t dex_register_map_bit_offset_;
uint8_t inline_info_bit_offset_;
- uint8_t register_mask_bit_offset_;
- uint8_t stack_mask_bit_offset_;
+ uint8_t register_mask_index_bit_offset_;
+ uint8_t stack_mask_index_bit_offset_;
+ uint8_t total_bit_size_;
};
/**
@@ -770,8 +771,8 @@ class StackMapEncoding {
*
* The information is of the form:
*
- * [native_pc_offset, dex_pc, dex_register_map_offset, inlining_info_offset, register_mask,
- * stack_mask].
+ * [native_pc_offset, dex_pc, dex_register_map_offset, inlining_info_offset, register_mask_index,
+ * stack_mask_index].
*/
class StackMap {
public:
@@ -816,20 +817,20 @@ class StackMap {
encoding.GetInlineInfoEncoding().Store(region_, offset);
}
- ALWAYS_INLINE uint32_t GetRegisterMask(const StackMapEncoding& encoding) const {
- return encoding.GetRegisterMaskEncoding().Load(region_);
+ ALWAYS_INLINE uint32_t GetRegisterMaskIndex(const StackMapEncoding& encoding) const {
+ return encoding.GetRegisterMaskIndexEncoding().Load(region_);
}
- ALWAYS_INLINE void SetRegisterMask(const StackMapEncoding& encoding, uint32_t mask) {
- encoding.GetRegisterMaskEncoding().Store(region_, mask);
+ ALWAYS_INLINE void SetRegisterMaskIndex(const StackMapEncoding& encoding, uint32_t mask) {
+ encoding.GetRegisterMaskIndexEncoding().Store(region_, mask);
}
- ALWAYS_INLINE bool GetStackMaskBit(const StackMapEncoding& encoding, size_t index) const {
- return region_.LoadBit(encoding.GetStackMaskBitOffset() + index);
+ ALWAYS_INLINE uint32_t GetStackMaskIndex(const StackMapEncoding& encoding) const {
+ return encoding.GetStackMaskIndexEncoding().Load(region_);
}
- ALWAYS_INLINE void SetStackMaskBit(const StackMapEncoding& encoding, size_t index, bool value) {
- region_.StoreBit(encoding.GetStackMaskBitOffset() + index, value);
+ ALWAYS_INLINE void SetStackMaskIndex(const StackMapEncoding& encoding, uint32_t mask) {
+ encoding.GetStackMaskIndexEncoding().Store(region_, mask);
}
ALWAYS_INLINE bool HasDexRegisterMap(const StackMapEncoding& encoding) const {
@@ -1031,7 +1032,10 @@ class InlineInfo {
struct CodeInfoEncoding {
uint32_t non_header_size;
uint32_t number_of_stack_maps;
- uint32_t stack_map_size_in_bits;
+ uint32_t number_of_stack_masks;
+ uint32_t number_of_register_masks;
+ uint32_t stack_mask_size_in_bits;
+ uint32_t register_mask_size_in_bits;
uint32_t number_of_location_catalog_entries;
StackMapEncoding stack_map_encoding;
InlineInfoEncoding inline_info_encoding;
@@ -1043,7 +1047,10 @@ struct CodeInfoEncoding {
const uint8_t* ptr = reinterpret_cast<const uint8_t*>(data);
non_header_size = DecodeUnsignedLeb128(&ptr);
number_of_stack_maps = DecodeUnsignedLeb128(&ptr);
- stack_map_size_in_bits = DecodeUnsignedLeb128(&ptr);
+ number_of_stack_masks = DecodeUnsignedLeb128(&ptr);
+ number_of_register_masks = DecodeUnsignedLeb128(&ptr);
+ stack_mask_size_in_bits = DecodeUnsignedLeb128(&ptr);
+ register_mask_size_in_bits = DecodeUnsignedLeb128(&ptr);
number_of_location_catalog_entries = DecodeUnsignedLeb128(&ptr);
static_assert(alignof(StackMapEncoding) == 1,
"StackMapEncoding should not require alignment");
@@ -1064,7 +1071,10 @@ struct CodeInfoEncoding {
void Compress(Vector* dest) const {
EncodeUnsignedLeb128(dest, non_header_size);
EncodeUnsignedLeb128(dest, number_of_stack_maps);
- EncodeUnsignedLeb128(dest, stack_map_size_in_bits);
+ EncodeUnsignedLeb128(dest, number_of_stack_masks);
+ EncodeUnsignedLeb128(dest, number_of_register_masks);
+ EncodeUnsignedLeb128(dest, stack_mask_size_in_bits);
+ EncodeUnsignedLeb128(dest, register_mask_size_in_bits);
EncodeUnsignedLeb128(dest, number_of_location_catalog_entries);
const uint8_t* stack_map_ptr = reinterpret_cast<const uint8_t*>(&stack_map_encoding);
dest->insert(dest->end(), stack_map_ptr, stack_map_ptr + sizeof(StackMapEncoding));
@@ -1098,7 +1108,7 @@ class CodeInfo {
}
CodeInfoEncoding ExtractEncoding() const {
- CodeInfoEncoding encoding(region_.start());
+ CodeInfoEncoding encoding(region_.begin());
AssertValidStackMap(encoding);
return encoding;
}
@@ -1114,14 +1124,42 @@ class CodeInfo {
}
ALWAYS_INLINE size_t GetNumberOfStackMaskBits(const CodeInfoEncoding& encoding) const {
- return encoding.stack_map_encoding.GetNumberOfStackMaskBits(encoding.stack_map_size_in_bits);
+ return encoding.stack_mask_size_in_bits;
}
ALWAYS_INLINE StackMap GetStackMapAt(size_t i, const CodeInfoEncoding& encoding) const {
- const size_t map_size = encoding.stack_map_size_in_bits;
+ const size_t map_size = encoding.stack_map_encoding.BitSize();
return StackMap(BitMemoryRegion(GetStackMaps(encoding), i * map_size, map_size));
}
+ BitMemoryRegion GetStackMask(const CodeInfoEncoding& encoding, size_t stack_mask_index) const {
+ // All stack mask data is stored before register map data (which is at the very end).
+ const size_t entry_size = GetNumberOfStackMaskBits(encoding);
+ const size_t register_mask_bits =
+ encoding.register_mask_size_in_bits * encoding.number_of_register_masks;
+ return BitMemoryRegion(region_,
+ region_.size_in_bits() - register_mask_bits -
+ entry_size * (stack_mask_index + 1),
+ entry_size);
+ }
+
+ BitMemoryRegion GetStackMaskOf(const CodeInfoEncoding& encoding,
+ const StackMap& stack_map) const {
+ return GetStackMask(encoding, stack_map.GetStackMaskIndex(encoding.stack_map_encoding));
+ }
+
+ BitMemoryRegion GetRegisterMask(const CodeInfoEncoding& encoding, size_t index) const {
+ const size_t entry_size = encoding.register_mask_size_in_bits;
+ return BitMemoryRegion(region_,
+ region_.size_in_bits() - entry_size * (index + 1),
+ entry_size);
+ }
+
+ uint32_t GetRegisterMaskOf(const CodeInfoEncoding& encoding, const StackMap& stack_map) const {
+ size_t index = stack_map.GetRegisterMaskIndex(encoding.stack_map_encoding);
+ return GetRegisterMask(encoding, index).LoadBits(0u, encoding.register_mask_size_in_bits);
+ }
+
uint32_t GetNumberOfLocationCatalogEntries(const CodeInfoEncoding& encoding) const {
return encoding.number_of_location_catalog_entries;
}
@@ -1135,10 +1173,14 @@ class CodeInfo {
return encoding.number_of_stack_maps;
}
+ // Get the size of all the stack maps of this CodeInfo object, in bits. Not byte aligned.
+ ALWAYS_INLINE size_t GetStackMapsSizeInBits(const CodeInfoEncoding& encoding) const {
+ return encoding.stack_map_encoding.BitSize() * GetNumberOfStackMaps(encoding);
+ }
+
// Get the size of all the stack maps of this CodeInfo object, in bytes.
size_t GetStackMapsSize(const CodeInfoEncoding& encoding) const {
- return RoundUp(encoding.stack_map_size_in_bits * GetNumberOfStackMaps(encoding), kBitsPerByte) /
- kBitsPerByte;
+ return RoundUp(GetStackMapsSizeInBits(encoding), kBitsPerByte) / kBitsPerByte;
}
uint32_t GetDexRegisterLocationCatalogOffset(const CodeInfoEncoding& encoding) const {
@@ -1288,7 +1330,7 @@ class CodeInfo {
<< encoding.non_header_size << "\n"
<< encoding.number_of_location_catalog_entries << "\n"
<< encoding.number_of_stack_maps << "\n"
- << encoding.stack_map_size_in_bits;
+ << encoding.stack_map_encoding.BitSize();
}
}
diff --git a/runtime/thread.cc b/runtime/thread.cc
index 3c7a71aba9..d843de5e7f 100644
--- a/runtime/thread.cc
+++ b/runtime/thread.cc
@@ -1047,9 +1047,10 @@ void Thread::ShortDump(std::ostream& os) const {
<< "]";
}
-void Thread::Dump(std::ostream& os, bool dump_native_stack, BacktraceMap* backtrace_map) const {
+void Thread::Dump(std::ostream& os, bool dump_native_stack, BacktraceMap* backtrace_map,
+ bool force_dump_stack) const {
DumpState(os);
- DumpStack(os, dump_native_stack, backtrace_map);
+ DumpStack(os, dump_native_stack, backtrace_map, force_dump_stack);
}
mirror::String* Thread::GetThreadName() const {
@@ -1750,7 +1751,8 @@ void Thread::DumpJavaStack(std::ostream& os) const {
void Thread::DumpStack(std::ostream& os,
bool dump_native_stack,
- BacktraceMap* backtrace_map) const {
+ BacktraceMap* backtrace_map,
+ bool force_dump_stack) const {
// TODO: we call this code when dying but may not have suspended the thread ourself. The
// IsSuspended check is therefore racy with the use for dumping (normally we inhibit
// the race with the thread_suspend_count_lock_).
@@ -1761,11 +1763,11 @@ void Thread::DumpStack(std::ostream& os,
// thread's stack in debug builds where we'll hit the not suspended check in the stack walk.
safe_to_dump = (safe_to_dump || dump_for_abort);
}
- if (safe_to_dump) {
+ if (safe_to_dump || force_dump_stack) {
// If we're currently in native code, dump that stack before dumping the managed stack.
- if (dump_native_stack && (dump_for_abort || ShouldShowNativeStack(this))) {
+ if (dump_native_stack && (dump_for_abort || force_dump_stack || ShouldShowNativeStack(this))) {
DumpKernelStack(os, GetTid(), " kernel: ", false);
- ArtMethod* method = GetCurrentMethod(nullptr, !dump_for_abort);
+ ArtMethod* method = GetCurrentMethod(nullptr, !(dump_for_abort || force_dump_stack));
DumpNativeStack(os, GetTid(), backtrace_map, " native: ", method);
}
DumpJavaStack(os);
@@ -2188,12 +2190,18 @@ void Thread::SetClassLoaderOverride(jobject class_loader_override) {
tlsPtr_.class_loader_override = GetJniEnv()->NewGlobalRef(class_loader_override);
}
-class CountStackDepthVisitor : public StackVisitor {
+using ArtMethodDexPcPair = std::pair<ArtMethod*, uint32_t>;
+
+// Counts the stack trace depth and also fetches the first max_saved_frames frames.
+class FetchStackTraceVisitor : public StackVisitor {
public:
- explicit CountStackDepthVisitor(Thread* thread)
+ explicit FetchStackTraceVisitor(Thread* thread,
+ ArtMethodDexPcPair* saved_frames = nullptr,
+ size_t max_saved_frames = 0)
REQUIRES_SHARED(Locks::mutator_lock_)
: StackVisitor(thread, nullptr, StackVisitor::StackWalkKind::kIncludeInlinedFrames),
- depth_(0), skip_depth_(0), skipping_(true) {}
+ saved_frames_(saved_frames),
+ max_saved_frames_(max_saved_frames) {}
bool VisitFrame() REQUIRES_SHARED(Locks::mutator_lock_) {
// We want to skip frames up to and including the exception's constructor.
@@ -2206,6 +2214,10 @@ class CountStackDepthVisitor : public StackVisitor {
}
if (!skipping_) {
if (!m->IsRuntimeMethod()) { // Ignore runtime frames (in particular callee save).
+ if (depth_ < max_saved_frames_) {
+ saved_frames_[depth_].first = m;
+ saved_frames_[depth_].second = m->IsProxyMethod() ? DexFile::kDexNoIndex : GetDexPc();
+ }
++depth_;
}
} else {
@@ -2214,20 +2226,22 @@ class CountStackDepthVisitor : public StackVisitor {
return true;
}
- int GetDepth() const {
+ uint32_t GetDepth() const {
return depth_;
}
- int GetSkipDepth() const {
+ uint32_t GetSkipDepth() const {
return skip_depth_;
}
private:
- uint32_t depth_;
- uint32_t skip_depth_;
- bool skipping_;
+ uint32_t depth_ = 0;
+ uint32_t skip_depth_ = 0;
+ bool skipping_ = true;
+ ArtMethodDexPcPair* saved_frames_;
+ const size_t max_saved_frames_;
- DISALLOW_COPY_AND_ASSIGN(CountStackDepthVisitor);
+ DISALLOW_COPY_AND_ASSIGN(FetchStackTraceVisitor);
};
template<bool kTransactionActive>
@@ -2237,8 +2251,6 @@ class BuildInternalStackTraceVisitor : public StackVisitor {
: StackVisitor(thread, nullptr, StackVisitor::StackWalkKind::kIncludeInlinedFrames),
self_(self),
skip_depth_(skip_depth),
- count_(0),
- trace_(nullptr),
pointer_size_(Runtime::Current()->GetClassLinker()->GetImagePointerSize()) {}
bool Init(int depth) REQUIRES_SHARED(Locks::mutator_lock_) ACQUIRE(Roles::uninterruptible_) {
@@ -2290,17 +2302,21 @@ class BuildInternalStackTraceVisitor : public StackVisitor {
if (m->IsRuntimeMethod()) {
return true; // Ignore runtime frames (in particular callee save).
}
+ AddFrame(m, m->IsProxyMethod() ? DexFile::kDexNoIndex : GetDexPc());
+ return true;
+ }
+
+ void AddFrame(ArtMethod* method, uint32_t dex_pc) REQUIRES_SHARED(Locks::mutator_lock_) {
ObjPtr<mirror::PointerArray> trace_methods_and_pcs = GetTraceMethodsAndPCs();
- trace_methods_and_pcs->SetElementPtrSize<kTransactionActive>(count_, m, pointer_size_);
+ trace_methods_and_pcs->SetElementPtrSize<kTransactionActive>(count_, method, pointer_size_);
trace_methods_and_pcs->SetElementPtrSize<kTransactionActive>(
trace_methods_and_pcs->GetLength() / 2 + count_,
- m->IsProxyMethod() ? DexFile::kDexNoIndex : GetDexPc(),
+ dex_pc,
pointer_size_);
// Save the declaring class of the method to ensure that the declaring classes of the methods
// do not get unloaded while the stack trace is live.
- trace_->Set(count_ + 1, m->GetDeclaringClass());
+ trace_->Set(count_ + 1, method->GetDeclaringClass());
++count_;
- return true;
}
ObjPtr<mirror::PointerArray> GetTraceMethodsAndPCs() const REQUIRES_SHARED(Locks::mutator_lock_) {
@@ -2316,12 +2332,12 @@ class BuildInternalStackTraceVisitor : public StackVisitor {
// How many more frames to skip.
int32_t skip_depth_;
// Current position down stack trace.
- uint32_t count_;
+ uint32_t count_ = 0;
// An object array where the first element is a pointer array that contains the ArtMethod
// pointers on the stack and dex PCs. The rest of the elements are the declaring
// class of the ArtMethod pointers. trace_[i+1] contains the declaring class of the ArtMethod of
// the i'th frame.
- mirror::ObjectArray<mirror::Object>* trace_;
+ mirror::ObjectArray<mirror::Object>* trace_ = nullptr;
// For cross compilation.
const PointerSize pointer_size_;
@@ -2330,11 +2346,15 @@ class BuildInternalStackTraceVisitor : public StackVisitor {
template<bool kTransactionActive>
jobject Thread::CreateInternalStackTrace(const ScopedObjectAccessAlreadyRunnable& soa) const {
- // Compute depth of stack
- CountStackDepthVisitor count_visitor(const_cast<Thread*>(this));
+ // Compute depth of stack, save frames if possible to avoid needing to recompute many.
+ constexpr size_t kMaxSavedFrames = 256;
+ std::unique_ptr<ArtMethodDexPcPair[]> saved_frames(new ArtMethodDexPcPair[kMaxSavedFrames]);
+ FetchStackTraceVisitor count_visitor(const_cast<Thread*>(this),
+ &saved_frames[0],
+ kMaxSavedFrames);
count_visitor.WalkStack();
- int32_t depth = count_visitor.GetDepth();
- int32_t skip_depth = count_visitor.GetSkipDepth();
+ const uint32_t depth = count_visitor.GetDepth();
+ const uint32_t skip_depth = count_visitor.GetSkipDepth();
// Build internal stack trace.
BuildInternalStackTraceVisitor<kTransactionActive> build_trace_visitor(soa.Self(),
@@ -2343,7 +2363,16 @@ jobject Thread::CreateInternalStackTrace(const ScopedObjectAccessAlreadyRunnable
if (!build_trace_visitor.Init(depth)) {
return nullptr; // Allocation failed.
}
- build_trace_visitor.WalkStack();
+ // If we saved all of the frames we don't even need to do the actual stack walk. This is faster
+ // than doing the stack walk twice.
+ if (depth < kMaxSavedFrames) {
+ for (size_t i = 0; i < depth; ++i) {
+ build_trace_visitor.AddFrame(saved_frames[i].first, saved_frames[i].second);
+ }
+ } else {
+ build_trace_visitor.WalkStack();
+ }
+
mirror::ObjectArray<mirror::Object>* trace = build_trace_visitor.GetInternalStackTrace();
if (kIsDebugBuild) {
ObjPtr<mirror::PointerArray> trace_methods = build_trace_visitor.GetTraceMethodsAndPCs();
@@ -2362,9 +2391,10 @@ template jobject Thread::CreateInternalStackTrace<true>(
const ScopedObjectAccessAlreadyRunnable& soa) const;
bool Thread::IsExceptionThrownByCurrentMethod(ObjPtr<mirror::Throwable> exception) const {
- CountStackDepthVisitor count_visitor(const_cast<Thread*>(this));
+ // Only count the depth since we do not pass a stack frame array as an argument.
+ FetchStackTraceVisitor count_visitor(const_cast<Thread*>(this));
count_visitor.WalkStack();
- return count_visitor.GetDepth() == exception->GetStackDepth();
+ return count_visitor.GetDepth() == static_cast<uint32_t>(exception->GetStackDepth());
}
jobjectArray Thread::InternalStackTraceToStackTraceElementArray(
@@ -3038,9 +3068,10 @@ class ReferenceMapVisitor : public StackVisitor {
T vreg_info(m, code_info, encoding, map, visitor_);
// Visit stack entries that hold pointers.
- size_t number_of_bits = code_info.GetNumberOfStackMaskBits(encoding);
+ const size_t number_of_bits = code_info.GetNumberOfStackMaskBits(encoding);
+ BitMemoryRegion stack_mask = code_info.GetStackMaskOf(encoding, map);
for (size_t i = 0; i < number_of_bits; ++i) {
- if (map.GetStackMaskBit(encoding.stack_map_encoding, i)) {
+ if (stack_mask.LoadBit(i)) {
auto* ref_addr = vreg_base + i;
mirror::Object* ref = ref_addr->AsMirrorPtr();
if (ref != nullptr) {
@@ -3048,12 +3079,12 @@ class ReferenceMapVisitor : public StackVisitor {
vreg_info.VisitStack(&new_ref, i, this);
if (ref != new_ref) {
ref_addr->Assign(new_ref);
- }
+ }
}
}
}
// Visit callee-save registers that hold pointers.
- uint32_t register_mask = map.GetRegisterMask(encoding.stack_map_encoding);
+ uint32_t register_mask = code_info.GetRegisterMaskOf(encoding, map);
for (size_t i = 0; i < BitSizeOf<uint32_t>(); ++i) {
if (register_mask & (1 << i)) {
mirror::Object** ref_addr = reinterpret_cast<mirror::Object**>(GetGPRAddress(i));
diff --git a/runtime/thread.h b/runtime/thread.h
index b609e723e9..b59eac68e9 100644
--- a/runtime/thread.h
+++ b/runtime/thread.h
@@ -196,7 +196,8 @@ class Thread {
// Dumps the detailed thread state and the thread stack (used for SIGQUIT).
void Dump(std::ostream& os,
bool dump_native_stack = true,
- BacktraceMap* backtrace_map = nullptr) const
+ BacktraceMap* backtrace_map = nullptr,
+ bool force_dump_stack = false) const
REQUIRES(!Locks::thread_suspend_count_lock_)
REQUIRES_SHARED(Locks::mutator_lock_);
@@ -1204,7 +1205,8 @@ class Thread {
void DumpState(std::ostream& os) const REQUIRES_SHARED(Locks::mutator_lock_);
void DumpStack(std::ostream& os,
bool dump_native_stack = true,
- BacktraceMap* backtrace_map = nullptr) const
+ BacktraceMap* backtrace_map = nullptr,
+ bool force_dump_stack = false) const
REQUIRES(!Locks::thread_suspend_count_lock_)
REQUIRES_SHARED(Locks::mutator_lock_);
diff --git a/runtime/utils.cc b/runtime/utils.cc
index 80a427b1e7..6a20eaf9e0 100644
--- a/runtime/utils.cc
+++ b/runtime/utils.cc
@@ -929,74 +929,6 @@ std::string GetSystemImageFilename(const char* location, const InstructionSet is
return filename;
}
-int ExecAndReturnCode(std::vector<std::string>& arg_vector, std::string* error_msg) {
- const std::string command_line(android::base::Join(arg_vector, ' '));
- CHECK_GE(arg_vector.size(), 1U) << command_line;
-
- // Convert the args to char pointers.
- const char* program = arg_vector[0].c_str();
- std::vector<char*> args;
- for (size_t i = 0; i < arg_vector.size(); ++i) {
- const std::string& arg = arg_vector[i];
- char* arg_str = const_cast<char*>(arg.c_str());
- CHECK(arg_str != nullptr) << i;
- args.push_back(arg_str);
- }
- args.push_back(nullptr);
-
- // fork and exec
- pid_t pid = fork();
- if (pid == 0) {
- // no allocation allowed between fork and exec
-
- // change process groups, so we don't get reaped by ProcessManager
- setpgid(0, 0);
-
- // (b/30160149): protect subprocesses from modifications to LD_LIBRARY_PATH, etc.
- // Use the snapshot of the environment from the time the runtime was created.
- char** envp = (Runtime::Current() == nullptr) ? nullptr : Runtime::Current()->GetEnvSnapshot();
- if (envp == nullptr) {
- execv(program, &args[0]);
- } else {
- execve(program, &args[0], envp);
- }
- PLOG(ERROR) << "Failed to execve(" << command_line << ")";
- // _exit to avoid atexit handlers in child.
- _exit(1);
- } else {
- if (pid == -1) {
- *error_msg = StringPrintf("Failed to execv(%s) because fork failed: %s",
- command_line.c_str(), strerror(errno));
- return -1;
- }
-
- // wait for subprocess to finish
- int status = -1;
- pid_t got_pid = TEMP_FAILURE_RETRY(waitpid(pid, &status, 0));
- if (got_pid != pid) {
- *error_msg = StringPrintf("Failed after fork for execv(%s) because waitpid failed: "
- "wanted %d, got %d: %s",
- command_line.c_str(), pid, got_pid, strerror(errno));
- return -1;
- }
- if (WIFEXITED(status)) {
- return WEXITSTATUS(status);
- }
- return -1;
- }
-}
-
-bool Exec(std::vector<std::string>& arg_vector, std::string* error_msg) {
- int status = ExecAndReturnCode(arg_vector, error_msg);
- if (status != 0) {
- const std::string command_line(android::base::Join(arg_vector, ' '));
- *error_msg = StringPrintf("Failed execv(%s) because non-0 exit status",
- command_line.c_str());
- return false;
- }
- return true;
-}
-
bool FileExists(const std::string& filename) {
struct stat buffer;
return stat(filename.c_str(), &buffer) == 0;
diff --git a/runtime/utils.h b/runtime/utils.h
index 5f53608f65..67438b5881 100644
--- a/runtime/utils.h
+++ b/runtime/utils.h
@@ -175,13 +175,6 @@ bool GetDalvikCacheFilename(const char* file_location, const char* cache_locatio
// Returns the system location for an image
std::string GetSystemImageFilename(const char* location, InstructionSet isa);
-// Wrapper on fork/execv to run a command in a subprocess.
-// Both of these spawn child processes using the environment as it was set when the single instance
-// of the runtime (Runtime::Current()) was started. If no instance of the runtime was started, it
-// will use the current environment settings.
-bool Exec(std::vector<std::string>& arg_vector, std::string* error_msg);
-int ExecAndReturnCode(std::vector<std::string>& arg_vector, std::string* error_msg);
-
// Returns true if the file exists.
bool FileExists(const std::string& filename);
bool FileExistsAndNotEmpty(const std::string& filename);
diff --git a/runtime/utils/dex_cache_arrays_layout-inl.h b/runtime/utils/dex_cache_arrays_layout-inl.h
index 2812c21004..bd1b044dae 100644
--- a/runtime/utils/dex_cache_arrays_layout-inl.h
+++ b/runtime/utils/dex_cache_arrays_layout-inl.h
@@ -48,11 +48,9 @@ inline DexCacheArraysLayout::DexCacheArraysLayout(PointerSize pointer_size, cons
: DexCacheArraysLayout(pointer_size, dex_file->GetHeader()) {
}
-constexpr size_t DexCacheArraysLayout::Alignment() {
- // mirror::Type/String/MethodTypeDexCacheType alignment is 8,
- // i.e. higher than or equal to the pointer alignment.
- static_assert(alignof(mirror::TypeDexCacheType) == 8,
- "Expecting alignof(ClassDexCacheType) == 8");
+inline constexpr size_t DexCacheArraysLayout::Alignment() {
+ // GcRoot<> alignment is 4, i.e. lower than or equal to the pointer alignment.
+ static_assert(alignof(GcRoot<mirror::Class>) == 4, "Expecting alignof(GcRoot<>) == 4");
static_assert(alignof(mirror::StringDexCacheType) == 8,
"Expecting alignof(StringDexCacheType) == 8");
static_assert(alignof(mirror::MethodTypeDexCacheType) == 8,
@@ -62,22 +60,17 @@ constexpr size_t DexCacheArraysLayout::Alignment() {
}
template <typename T>
-constexpr PointerSize GcRootAsPointerSize() {
+static constexpr PointerSize GcRootAsPointerSize() {
static_assert(sizeof(GcRoot<T>) == 4U, "Unexpected GcRoot size");
return PointerSize::k32;
}
inline size_t DexCacheArraysLayout::TypeOffset(dex::TypeIndex type_idx) const {
- return types_offset_ + ElementOffset(PointerSize::k64,
- type_idx.index_ % mirror::DexCache::kDexCacheTypeCacheSize);
+ return types_offset_ + ElementOffset(GcRootAsPointerSize<mirror::Class>(), type_idx.index_);
}
inline size_t DexCacheArraysLayout::TypesSize(size_t num_elements) const {
- size_t cache_size = mirror::DexCache::kDexCacheTypeCacheSize;
- if (num_elements < cache_size) {
- cache_size = num_elements;
- }
- return ArraySize(PointerSize::k64, cache_size);
+ return ArraySize(GcRootAsPointerSize<mirror::Class>(), num_elements);
}
inline size_t DexCacheArraysLayout::TypesAlignment() const {
diff --git a/runtime/utils_test.cc b/runtime/utils_test.cc
index 82d92fc2fc..02f1e1bbfe 100644
--- a/runtime/utils_test.cc
+++ b/runtime/utils_test.cc
@@ -21,6 +21,7 @@
#include "base/enums.h"
#include "class_linker-inl.h"
#include "common_runtime_test.h"
+#include "exec_utils.h"
#include "mirror/array.h"
#include "mirror/array-inl.h"
#include "mirror/object-inl.h"
diff --git a/runtime/vdex_file.cc b/runtime/vdex_file.cc
index dabf8c8e93..2481c8ba46 100644
--- a/runtime/vdex_file.cc
+++ b/runtime/vdex_file.cc
@@ -49,10 +49,10 @@ VdexFile::Header::Header(uint32_t number_of_dex_files,
DCHECK(IsVersionValid());
}
-VdexFile* VdexFile::Open(const std::string& vdex_filename,
- bool writable,
- bool low_4gb,
- std::string* error_msg) {
+std::unique_ptr<VdexFile> VdexFile::Open(const std::string& vdex_filename,
+ bool writable,
+ bool low_4gb,
+ std::string* error_msg) {
if (!OS::FileExists(vdex_filename.c_str())) {
*error_msg = "File " + vdex_filename + " does not exist.";
return nullptr;
@@ -79,12 +79,12 @@ VdexFile* VdexFile::Open(const std::string& vdex_filename,
return Open(vdex_file->Fd(), vdex_length, vdex_filename, writable, low_4gb, error_msg);
}
-VdexFile* VdexFile::Open(int file_fd,
- size_t vdex_length,
- const std::string& vdex_filename,
- bool writable,
- bool low_4gb,
- std::string* error_msg) {
+std::unique_ptr<VdexFile> VdexFile::Open(int file_fd,
+ size_t vdex_length,
+ const std::string& vdex_filename,
+ bool writable,
+ bool low_4gb,
+ std::string* error_msg) {
std::unique_ptr<MemMap> mmap(MemMap::MapFile(vdex_length,
writable ? PROT_READ | PROT_WRITE : PROT_READ,
MAP_SHARED,
@@ -98,8 +98,14 @@ VdexFile* VdexFile::Open(int file_fd,
return nullptr;
}
+ std::unique_ptr<VdexFile> vdex(new VdexFile(mmap.release()));
+ if (!vdex->IsValid()) {
+ *error_msg = "Vdex file is not valid";
+ return nullptr;
+ }
+
*error_msg = "Success";
- return new VdexFile(mmap.release());
+ return vdex;
}
const uint8_t* VdexFile::GetNextDexFileData(const uint8_t* cursor) const {
diff --git a/runtime/vdex_file.h b/runtime/vdex_file.h
index 330b955c2a..7daf2f8d7b 100644
--- a/runtime/vdex_file.h
+++ b/runtime/vdex_file.h
@@ -73,17 +73,19 @@ class VdexFile {
typedef uint32_t VdexChecksum;
- static VdexFile* Open(const std::string& vdex_filename,
- bool writable,
- bool low_4gb,
- std::string* error_msg);
-
- static VdexFile* Open(int file_fd,
- size_t vdex_length,
- const std::string& vdex_filename,
- bool writable,
- bool low_4gb,
- std::string* error_msg);
+ // Returns nullptr if the vdex file cannot be opened or is not valid.
+ static std::unique_ptr<VdexFile> Open(const std::string& vdex_filename,
+ bool writable,
+ bool low_4gb,
+ std::string* error_msg);
+
+ // Returns nullptr if the vdex file cannot be opened or is not valid.
+ static std::unique_ptr<VdexFile> Open(int file_fd,
+ size_t vdex_length,
+ const std::string& vdex_filename,
+ bool writable,
+ bool low_4gb,
+ std::string* error_msg);
const uint8_t* Begin() const { return mmap_->Begin(); }
const uint8_t* End() const { return mmap_->End(); }
diff --git a/runtime/vdex_file_test.cc b/runtime/vdex_file_test.cc
new file mode 100644
index 0000000000..909e117ccc
--- /dev/null
+++ b/runtime/vdex_file_test.cc
@@ -0,0 +1,46 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "vdex_file.h"
+
+#include <string>
+
+#include <gtest/gtest.h>
+
+#include "common_runtime_test.h"
+
+namespace art {
+
+class VdexFileTest : public CommonRuntimeTest {
+};
+
+TEST_F(VdexFileTest, OpenEmptyVdex) {
+ // Verify we fail to open an empty vdex file.
+ ScratchFile tmp;
+ std::string error_msg;
+ std::unique_ptr<VdexFile> vdex = VdexFile::Open(tmp.GetFd(),
+ 0,
+ tmp.GetFilename(),
+ /*writable*/false,
+ /*low_4gb*/false,
+ &error_msg);
+ EXPECT_TRUE(vdex == nullptr);
+
+ vdex = VdexFile::Open(tmp.GetFilename(), /*writable*/false, /*low_4gb*/false, &error_msg);
+ EXPECT_TRUE(vdex == nullptr);
+}
+
+} // namespace art
diff --git a/runtime/verifier/method_verifier.cc b/runtime/verifier/method_verifier.cc
index ba429d8c3e..5f55f3fd29 100644
--- a/runtime/verifier/method_verifier.cc
+++ b/runtime/verifier/method_verifier.cc
@@ -415,12 +415,12 @@ MethodVerifier::FailureData MethodVerifier::VerifyMethod(Thread* self,
result.kind = kSoftFailure;
if (method != nullptr &&
!CanCompilerHandleVerificationFailure(verifier.encountered_failure_types_)) {
- method->AddAccessFlags(kAccCompileDontBother);
+ method->SetDontCompile();
}
}
if (method != nullptr) {
if (verifier.HasInstructionThatWillThrow()) {
- method->AddAccessFlags(kAccCompileDontBother);
+ method->SetDontCompile();
if (Runtime::Current()->IsAotCompiler() &&
(callbacks != nullptr) && !callbacks->IsBootImage()) {
// When compiling apps, make HasInstructionThatWillThrow a soft error to trigger
@@ -2399,8 +2399,7 @@ bool MethodVerifier::CodeFlowVerifyInstruction(uint32_t* start_guess) {
const RegType& res_type = ResolveClassAndCheckAccess(type_idx);
if (res_type.IsConflict()) {
// If this is a primitive type, fail HARD.
- ObjPtr<mirror::Class> klass =
- ClassLinker::LookupResolvedType(type_idx, dex_cache_.Get(), class_loader_.Get());
+ mirror::Class* klass = dex_cache_->GetResolvedType(type_idx);
if (klass != nullptr && klass->IsPrimitive()) {
Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "using primitive type "
<< dex_file_->StringByTypeIdx(type_idx) << " in instanceof in "
@@ -3685,10 +3684,9 @@ inline bool MethodVerifier::IsInstantiableOrPrimitive(mirror::Class* klass) {
}
const RegType& MethodVerifier::ResolveClassAndCheckAccess(dex::TypeIndex class_idx) {
- mirror::Class* klass =
- ClassLinker::LookupResolvedType(class_idx, dex_cache_.Get(), class_loader_.Get()).Ptr();
+ mirror::Class* klass = dex_cache_->GetResolvedType(class_idx);
const RegType* result = nullptr;
- if (klass != nullptr && !klass->IsErroneous()) {
+ if (klass != nullptr) {
bool precise = klass->CannotBeAssignedFromOtherTypes();
if (precise && !IsInstantiableOrPrimitive(klass)) {
const char* descriptor = dex_file_->StringByTypeIdx(class_idx);
diff --git a/test/082-inline-execute/src/Main.java b/test/082-inline-execute/src/Main.java
index fad8a9f100..072f0e68ee 100644
--- a/test/082-inline-execute/src/Main.java
+++ b/test/082-inline-execute/src/Main.java
@@ -535,6 +535,8 @@ public class Main {
Assert.assertEquals(Math.min(0.0f, Float.MAX_VALUE), 0.0f);
Assert.assertEquals(Math.min(Float.MIN_VALUE, 0.0f), 0.0f);
Assert.assertEquals(Math.min(Float.MIN_VALUE, Float.MAX_VALUE), Float.MIN_VALUE);
+ // Should not have flush-to-zero behavior.
+ Assert.assertEquals(Math.min(Float.MIN_VALUE, Float.MIN_VALUE), Float.MIN_VALUE);
}
public static void test_Math_max_F() {
@@ -548,8 +550,10 @@ public class Main {
Assert.assertEquals(Math.max(1.0f, 0.0f), 1.0f);
Assert.assertEquals(Math.max(0.0f, 1.0f), 1.0f);
Assert.assertEquals(Math.max(0.0f, Float.MAX_VALUE), Float.MAX_VALUE);
- Assert.assertEquals(Math.max(Float.MIN_VALUE, 0.0f), Float.MIN_VALUE);
Assert.assertEquals(Math.max(Float.MIN_VALUE, Float.MAX_VALUE), Float.MAX_VALUE);
+ // Should not have flush-to-zero behavior.
+ Assert.assertEquals(Math.max(Float.MIN_VALUE, 0.0f), Float.MIN_VALUE);
+ Assert.assertEquals(Math.max(Float.MIN_VALUE, Float.MIN_VALUE), Float.MIN_VALUE);
}
public static void test_Math_min_D() {
@@ -565,6 +569,8 @@ public class Main {
Assert.assertEquals(Math.min(0.0d, Double.MAX_VALUE), 0.0d);
Assert.assertEquals(Math.min(Double.MIN_VALUE, 0.0d), 0.0d);
Assert.assertEquals(Math.min(Double.MIN_VALUE, Double.MAX_VALUE), Double.MIN_VALUE);
+ // Should not have flush-to-zero behavior.
+ Assert.assertEquals(Math.min(Double.MIN_VALUE, Double.MIN_VALUE), Double.MIN_VALUE);
}
public static void test_Math_max_D() {
@@ -580,6 +586,9 @@ public class Main {
Assert.assertEquals(Math.max(0.0d, Double.MAX_VALUE), Double.MAX_VALUE);
Assert.assertEquals(Math.max(Double.MIN_VALUE, 0.0d), Double.MIN_VALUE);
Assert.assertEquals(Math.max(Double.MIN_VALUE, Double.MAX_VALUE), Double.MAX_VALUE);
+ // Should not have flush-to-zero behavior.
+ Assert.assertEquals(Math.max(Double.MIN_VALUE, 0.0d), Double.MIN_VALUE);
+ Assert.assertEquals(Math.max(Double.MIN_VALUE, Double.MIN_VALUE), Double.MIN_VALUE);
}
public static void test_Math_sqrt() {
diff --git a/test/623-checker-loop-regressions/src/Main.java b/test/623-checker-loop-regressions/src/Main.java
index 7cc0b8b652..7509d9b4f3 100644
--- a/test/623-checker-loop-regressions/src/Main.java
+++ b/test/623-checker-loop-regressions/src/Main.java
@@ -154,8 +154,8 @@ public class Main {
/// CHECK-NOT: Phi
//
/// CHECK-START: int Main.polynomialInt() instruction_simplifier$after_bce (after)
- /// CHECK-DAG: <<Int:i\d+>> IntConstant -45 loop:none
- /// CHECK-DAG: Return [<<Int>>] loop:none
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant -45 loop:none
+ /// CHECK-DAG: Return [<<Int>>] loop:none
static int polynomialInt() {
int x = 0;
for (int i = 0; i < 10; i++) {
@@ -164,6 +164,81 @@ public class Main {
return x;
}
+ // Regression test for b/34779592 (found with fuzz testing): overflow for last value
+ // of division truncates to zero, for multiplication it simply truncates.
+ //
+ /// CHECK-START: int Main.geoIntDivLastValue(int) loop_optimization (before)
+ /// CHECK-DAG: Phi loop:<<Loop:B\d+>> outer_loop:none
+ /// CHECK-DAG: Phi loop:<<Loop>> outer_loop:none
+ //
+ /// CHECK-START: int Main.geoIntDivLastValue(int) loop_optimization (after)
+ /// CHECK-NOT: Phi
+ //
+ /// CHECK-START: int Main.geoIntDivLastValue(int) instruction_simplifier$after_bce (after)
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant 0 loop:none
+ /// CHECK-DAG: Return [<<Int>>] loop:none
+ static int geoIntDivLastValue(int x) {
+ for (int i = 0; i < 2; i++) {
+ x /= 1081788608;
+ }
+ return x;
+ }
+
+ /// CHECK-START: int Main.geoIntMulLastValue(int) loop_optimization (before)
+ /// CHECK-DAG: Phi loop:<<Loop:B\d+>> outer_loop:none
+ /// CHECK-DAG: Phi loop:<<Loop>> outer_loop:none
+ //
+ /// CHECK-START: int Main.geoIntMulLastValue(int) loop_optimization (after)
+ /// CHECK-NOT: Phi
+ //
+ /// CHECK-START: int Main.geoIntMulLastValue(int) instruction_simplifier$after_bce (after)
+ /// CHECK-DAG: <<Par:i\d+>> ParameterValue loop:none
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant -194211840 loop:none
+ /// CHECK-DAG: <<Mul:i\d+>> Mul [<<Par>>,<<Int>>] loop:none
+ /// CHECK-DAG: Return [<<Mul>>] loop:none
+ static int geoIntMulLastValue(int x) {
+ for (int i = 0; i < 2; i++) {
+ x *= 1081788608;
+ }
+ return x;
+ }
+
+ /// CHECK-START: long Main.geoLongDivLastValue(long) loop_optimization (before)
+ /// CHECK-DAG: Phi loop:<<Loop:B\d+>> outer_loop:none
+ /// CHECK-DAG: Phi loop:<<Loop>> outer_loop:none
+ //
+ /// CHECK-START: long Main.geoLongDivLastValue(long) loop_optimization (after)
+ /// CHECK-NOT: Phi
+ //
+ /// CHECK-START: long Main.geoLongDivLastValue(long) instruction_simplifier$after_bce (after)
+ /// CHECK-DAG: <<Long:j\d+>> LongConstant 0 loop:none
+ /// CHECK-DAG: Return [<<Long>>] loop:none
+ static long geoLongDivLastValue(long x) {
+ for (int i = 0; i < 10; i++) {
+ x /= 1081788608;
+ }
+ return x;
+ }
+
+ /// CHECK-START: long Main.geoLongMulLastValue(long) loop_optimization (before)
+ /// CHECK-DAG: Phi loop:<<Loop:B\d+>> outer_loop:none
+ /// CHECK-DAG: Phi loop:<<Loop>> outer_loop:none
+ //
+ /// CHECK-START: long Main.geoLongMulLastValue(long) loop_optimization (after)
+ /// CHECK-NOT: Phi
+ //
+ /// CHECK-START: long Main.geoLongMulLastValue(long) instruction_simplifier$after_bce (after)
+ /// CHECK-DAG: <<Par:j\d+>> ParameterValue loop:none
+ /// CHECK-DAG: <<Long:j\d+>> LongConstant -8070450532247928832 loop:none
+ /// CHECK-DAG: <<Mul:j\d+>> Mul [<<Par>>,<<Long>>] loop:none
+ /// CHECK-DAG: Return [<<Mul>>] loop:none
+ static long geoLongMulLastValue(long x) {
+ for (int i = 0; i < 10; i++) {
+ x *= 1081788608;
+ }
+ return x;
+ }
+
public static void main(String[] args) {
expectEquals(10, earlyExitFirst(-1));
for (int i = 0; i <= 10; i++) {
@@ -185,6 +260,42 @@ public class Main {
expectEquals(-45, polynomialIntFromLong());
expectEquals(-45, polynomialInt());
+ expectEquals(0, geoIntDivLastValue(0));
+ expectEquals(0, geoIntDivLastValue(1));
+ expectEquals(0, geoIntDivLastValue(2));
+ expectEquals(0, geoIntDivLastValue(1081788608));
+ expectEquals(0, geoIntDivLastValue(-1081788608));
+ expectEquals(0, geoIntDivLastValue(2147483647));
+ expectEquals(0, geoIntDivLastValue(-2147483648));
+
+ expectEquals( 0, geoIntMulLastValue(0));
+ expectEquals( -194211840, geoIntMulLastValue(1));
+ expectEquals( -388423680, geoIntMulLastValue(2));
+ expectEquals(-1041498112, geoIntMulLastValue(1081788608));
+ expectEquals( 1041498112, geoIntMulLastValue(-1081788608));
+ expectEquals( 194211840, geoIntMulLastValue(2147483647));
+ expectEquals( 0, geoIntMulLastValue(-2147483648));
+
+ expectEquals(0L, geoLongDivLastValue(0L));
+ expectEquals(0L, geoLongDivLastValue(1L));
+ expectEquals(0L, geoLongDivLastValue(2L));
+ expectEquals(0L, geoLongDivLastValue(1081788608L));
+ expectEquals(0L, geoLongDivLastValue(-1081788608L));
+ expectEquals(0L, geoLongDivLastValue(2147483647L));
+ expectEquals(0L, geoLongDivLastValue(-2147483648L));
+ expectEquals(0L, geoLongDivLastValue(9223372036854775807L));
+ expectEquals(0L, geoLongDivLastValue(-9223372036854775808L));
+
+ expectEquals( 0L, geoLongMulLastValue(0L));
+ expectEquals(-8070450532247928832L, geoLongMulLastValue(1L));
+ expectEquals( 2305843009213693952L, geoLongMulLastValue(2L));
+ expectEquals( 0L, geoLongMulLastValue(1081788608L));
+ expectEquals( 0L, geoLongMulLastValue(-1081788608L));
+ expectEquals( 8070450532247928832L, geoLongMulLastValue(2147483647L));
+ expectEquals( 0L, geoLongMulLastValue(-2147483648L));
+ expectEquals( 8070450532247928832L, geoLongMulLastValue(9223372036854775807L));
+ expectEquals( 0L, geoLongMulLastValue(-9223372036854775808L));
+
System.out.println("passed");
}
@@ -193,4 +304,10 @@ public class Main {
throw new Error("Expected: " + expected + ", found: " + result);
}
}
+
+ private static void expectEquals(long expected, long result) {
+ if (expected != result) {
+ throw new Error("Expected: " + expected + ", found: " + result);
+ }
+ }
}
diff --git a/test/626-checker-arm64-scratch-register/src/Main.java b/test/626-checker-arm64-scratch-register/src/Main.java
index aa211be33c..6dd4374116 100644
--- a/test/626-checker-arm64-scratch-register/src/Main.java
+++ b/test/626-checker-arm64-scratch-register/src/Main.java
@@ -95,8 +95,8 @@ public class Main {
/// CHECK: str s1, [sp, #28]
/// CHECK: ldr s1, [sp, #32]
/// CHECK: str s31, [sp, #32]
- /// CHECK: ldr w16, [sp, #20]
- /// CHECK: str w16, [sp, #40]
+ /// CHECK: ldr s31, [sp, #20]
+ /// CHECK: str s31, [sp, #40]
/// CHECK: str s12, [sp, #20]
/// CHECK: fmov d12, d11
/// CHECK: fmov d11, d10
diff --git a/test/626-const-class-linking/clear_dex_cache_types.cc b/test/626-const-class-linking/clear_dex_cache_types.cc
index 6d4b645db6..b035896166 100644
--- a/test/626-const-class-linking/clear_dex_cache_types.cc
+++ b/test/626-const-class-linking/clear_dex_cache_types.cc
@@ -24,8 +24,7 @@ extern "C" JNIEXPORT void JNICALL Java_Main_nativeClearResolvedTypes(JNIEnv*, jc
ScopedObjectAccess soa(Thread::Current());
mirror::DexCache* dex_cache = soa.Decode<mirror::Class>(cls)->GetDexCache();
for (size_t i = 0, num_types = dex_cache->NumResolvedTypes(); i != num_types; ++i) {
- mirror::TypeDexCachePair cleared(nullptr, mirror::TypeDexCachePair::InvalidIndexForSlot(i));
- dex_cache->GetResolvedTypes()[i].store(cleared, std::memory_order_relaxed);
+ dex_cache->SetResolvedType(dex::TypeIndex(i), ObjPtr<mirror::Class>(nullptr));
}
}
diff --git a/test/706-checker-scheduler/expected.txt b/test/706-checker-scheduler/expected.txt
new file mode 100644
index 0000000000..e69de29bb2
--- /dev/null
+++ b/test/706-checker-scheduler/expected.txt
diff --git a/test/706-checker-scheduler/info.txt b/test/706-checker-scheduler/info.txt
new file mode 100644
index 0000000000..b4ad9b4378
--- /dev/null
+++ b/test/706-checker-scheduler/info.txt
@@ -0,0 +1 @@
+Tests for HInstruction scheduler.
diff --git a/test/706-checker-scheduler/src/Main.java b/test/706-checker-scheduler/src/Main.java
new file mode 100644
index 0000000000..1721e4294e
--- /dev/null
+++ b/test/706-checker-scheduler/src/Main.java
@@ -0,0 +1,82 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class Main {
+
+ static int static_variable = 0;
+
+ /// CHECK-START-ARM64: int Main.arrayAccess() scheduler (before)
+ /// CHECK: <<Const1:i\d+>> IntConstant 1
+ /// CHECK: <<i0:i\d+>> Phi
+ /// CHECK: <<res0:i\d+>> Phi
+ /// CHECK: <<Array:i\d+>> IntermediateAddress
+ /// CHECK: <<ArrayGet1:i\d+>> ArrayGet [<<Array>>,<<i0>>]
+ /// CHECK: <<res1:i\d+>> Add [<<res0>>,<<ArrayGet1>>]
+ /// CHECK: <<i1:i\d+>> Add [<<i0>>,<<Const1>>]
+ /// CHECK: <<ArrayGet2:i\d+>> ArrayGet [<<Array>>,<<i1>>]
+ /// CHECK: Add [<<res1>>,<<ArrayGet2>>]
+
+ /// CHECK-START-ARM64: int Main.arrayAccess() scheduler (after)
+ /// CHECK: <<Const1:i\d+>> IntConstant 1
+ /// CHECK: <<i0:i\d+>> Phi
+ /// CHECK: <<res0:i\d+>> Phi
+ /// CHECK: <<Array:i\d+>> IntermediateAddress
+ /// CHECK: <<ArrayGet1:i\d+>> ArrayGet [<<Array>>,<<i0>>]
+ /// CHECK: <<i1:i\d+>> Add [<<i0>>,<<Const1>>]
+ /// CHECK: <<ArrayGet2:i\d+>> ArrayGet [<<Array>>,<<i1>>]
+ /// CHECK: <<res1:i\d+>> Add [<<res0>>,<<ArrayGet1>>]
+ /// CHECK: Add [<<res1>>,<<ArrayGet2>>]
+
+ public static int arrayAccess() {
+ int res = 0;
+ int [] array = new int[10];
+ for (int i = 0; i < 9; i++) {
+ res += array[i];
+ res += array[i + 1];
+ }
+ return res;
+ }
+
+ /// CHECK-START-ARM64: int Main.intDiv(int) scheduler (before)
+ /// CHECK: Sub
+ /// CHECK: DivZeroCheck
+ /// CHECK: Div
+ /// CHECK: StaticFieldSet
+
+ /// CHECK-START-ARM64: int Main.intDiv(int) scheduler (after)
+ /// CHECK: Sub
+ /// CHECK-NOT: StaticFieldSet
+ /// CHECK: DivZeroCheck
+ /// CHECK-NOT: Sub
+ /// CHECK: Div
+ public static int intDiv(int arg) {
+ int res = 0;
+ int tmp = arg;
+ for (int i = 1; i < arg; i++) {
+ tmp -= i;
+ res = res / i; // div-zero check barrier.
+ static_variable++;
+ }
+ res += tmp;
+ return res;
+ }
+
+ public static void main(String[] args) {
+ if ((arrayAccess() + intDiv(10)) != -35) {
+ System.out.println("FAIL");
+ }
+ }
+}
diff --git a/test/908-gc-start-finish/gc_callbacks.cc b/test/908-gc-start-finish/gc_callbacks.cc
index 59801ff648..8f96ee63ef 100644
--- a/test/908-gc-start-finish/gc_callbacks.cc
+++ b/test/908-gc-start-finish/gc_callbacks.cc
@@ -38,43 +38,32 @@ static void JNICALL GarbageCollectionStart(jvmtiEnv* ti_env ATTRIBUTE_UNUSED) {
}
extern "C" JNIEXPORT void JNICALL Java_Main_setupGcCallback(
- JNIEnv* env ATTRIBUTE_UNUSED, jclass klass ATTRIBUTE_UNUSED) {
+ JNIEnv* env, jclass klass ATTRIBUTE_UNUSED) {
jvmtiEventCallbacks callbacks;
memset(&callbacks, 0, sizeof(jvmtiEventCallbacks));
callbacks.GarbageCollectionFinish = GarbageCollectionFinish;
callbacks.GarbageCollectionStart = GarbageCollectionStart;
jvmtiError ret = jvmti_env->SetEventCallbacks(&callbacks, sizeof(callbacks));
- if (ret != JVMTI_ERROR_NONE) {
- char* err;
- jvmti_env->GetErrorName(ret, &err);
- printf("Error setting callbacks: %s\n", err);
- jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(err));
- }
+ JvmtiErrorToException(env, ret);
}
-extern "C" JNIEXPORT void JNICALL Java_Main_enableGcTracking(JNIEnv* env ATTRIBUTE_UNUSED,
+extern "C" JNIEXPORT void JNICALL Java_Main_enableGcTracking(JNIEnv* env,
jclass klass ATTRIBUTE_UNUSED,
jboolean enable) {
jvmtiError ret = jvmti_env->SetEventNotificationMode(
enable ? JVMTI_ENABLE : JVMTI_DISABLE,
JVMTI_EVENT_GARBAGE_COLLECTION_START,
nullptr);
- if (ret != JVMTI_ERROR_NONE) {
- char* err;
- jvmti_env->GetErrorName(ret, &err);
- printf("Error enabling/disabling gc callbacks: %s\n", err);
- jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(err));
+ if (JvmtiErrorToException(env, ret)) {
+ return;
}
ret = jvmti_env->SetEventNotificationMode(
enable ? JVMTI_ENABLE : JVMTI_DISABLE,
JVMTI_EVENT_GARBAGE_COLLECTION_FINISH,
nullptr);
- if (ret != JVMTI_ERROR_NONE) {
- char* err;
- jvmti_env->GetErrorName(ret, &err);
- printf("Error enabling/disabling gc callbacks: %s\n", err);
- jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(err));
+ if (JvmtiErrorToException(env, ret)) {
+ return;
}
}
diff --git a/test/934-load-transform/src/Main.java b/test/934-load-transform/src/Main.java
index 3bd913bfe0..de312b03da 100644
--- a/test/934-load-transform/src/Main.java
+++ b/test/934-load-transform/src/Main.java
@@ -66,6 +66,9 @@ class Main {
}
public static void main(String[] args) {
+ // Don't pop transformations. Make sure that even if 2 threads race to define the class both
+ // will get the same result.
+ setPopRetransformations(false);
addCommonTransformationResult("Transform", CLASS_BYTES, DEX_BYTES);
enableCommonRetransformation(true);
try {
@@ -83,6 +86,7 @@ class Main {
}
}
+ private static native void setPopRetransformations(boolean should_pop);
// Transforms the class
private static native void enableCommonRetransformation(boolean enable);
private static native void addCommonTransformationResult(String target_name,
diff --git a/test/935-non-retransformable/src-ex/TestMain.java b/test/935-non-retransformable/src-ex/TestMain.java
index aebcdee851..d412fba37a 100644
--- a/test/935-non-retransformable/src-ex/TestMain.java
+++ b/test/935-non-retransformable/src-ex/TestMain.java
@@ -17,19 +17,14 @@
import java.lang.reflect.Method;
public class TestMain {
- public static void runTest() {
+ public static void runTest() throws Exception {
Transform t = new Transform();
- try {
- // Call functions with reflection. Since the sayGoodbye function does not exist in the
- // LTransform; when we compile this for the first time we need to use reflection.
- Method hi = Transform.class.getMethod("sayHi");
- Method bye = Transform.class.getMethod("sayGoodbye");
- hi.invoke(t);
- t.sayHi();
- bye.invoke(t);
- } catch (Exception e) {
- System.out.println("Unexpected error occured! " + e.toString());
- e.printStackTrace();
- }
+ // Call functions with reflection. Since the sayGoodbye function does not exist in the
+ // LTransform; when we compile this for the first time we need to use reflection.
+ Method hi = Transform.class.getMethod("sayHi");
+ Method bye = Transform.class.getMethod("sayGoodbye");
+ hi.invoke(t);
+ t.sayHi();
+ bye.invoke(t);
}
}
diff --git a/test/935-non-retransformable/src/Main.java b/test/935-non-retransformable/src/Main.java
index 0d103ab86d..82ba197b7e 100644
--- a/test/935-non-retransformable/src/Main.java
+++ b/test/935-non-retransformable/src/Main.java
@@ -74,6 +74,7 @@ class Main {
}
public static void main(String[] args) {
+ setPopRetransformations(false);
addCommonTransformationResult("Transform", CLASS_BYTES, DEX_BYTES);
enableCommonRetransformation(true);
try {
@@ -86,6 +87,8 @@ class Main {
Method run_test = klass.getMethod("runTest");
run_test.invoke(null);
+ // Remove the original transformation. It has been used by now.
+ popTransformationFor("Transform");
// Make sure we don't get called for transformation again.
addCommonTransformationResult("Transform", new byte[0], new byte[0]);
doCommonClassRetransformation(new_loader.loadClass("Transform"));
@@ -102,4 +105,6 @@ class Main {
private static native void addCommonTransformationResult(String target_name,
byte[] class_bytes,
byte[] dex_bytes);
+ private static native void setPopRetransformations(boolean should_pop);
+ private static native void popTransformationFor(String target_name);
}
diff --git a/test/938-load-transform-bcp/build b/test/938-load-transform-bcp/build
new file mode 100755
index 0000000000..898e2e54a2
--- /dev/null
+++ b/test/938-load-transform-bcp/build
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-build "$@" --experimental agents
diff --git a/test/938-load-transform-bcp/expected.txt b/test/938-load-transform-bcp/expected.txt
new file mode 100644
index 0000000000..16c3f8f726
--- /dev/null
+++ b/test/938-load-transform-bcp/expected.txt
@@ -0,0 +1,2 @@
+ol.foo() -> 'This is foo for val=123'
+ol.toString() -> 'This is toString() for val=123'
diff --git a/test/938-load-transform-bcp/info.txt b/test/938-load-transform-bcp/info.txt
new file mode 100644
index 0000000000..875a5f6ec1
--- /dev/null
+++ b/test/938-load-transform-bcp/info.txt
@@ -0,0 +1 @@
+Tests basic functions in the jvmti plugin.
diff --git a/test/938-load-transform-bcp/run b/test/938-load-transform-bcp/run
new file mode 100755
index 0000000000..adb1a1c507
--- /dev/null
+++ b/test/938-load-transform-bcp/run
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-run "$@" --jvmti --no-app-image
diff --git a/test/938-load-transform-bcp/src-ex/TestMain.java b/test/938-load-transform-bcp/src-ex/TestMain.java
new file mode 100644
index 0000000000..3757a0f778
--- /dev/null
+++ b/test/938-load-transform-bcp/src-ex/TestMain.java
@@ -0,0 +1,35 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.lang.reflect.Method;
+import java.util.OptionalLong;
+public class TestMain {
+ public static void runTest() {
+ // This should be our redefined OptionalLong.
+ OptionalLong ol = OptionalLong.of(123);
+ try {
+ // OptionalLong is a class that is unlikely to be used by the time this test starts.
+ Method foo = OptionalLong.class.getMethod("foo");
+ System.out.println("ol.foo() -> '" + (String)foo.invoke(ol) + "'");
+ System.out.println("ol.toString() -> '" + ol.toString() + "'");
+ } catch (Exception e) {
+ System.out.println(
+ "Exception occured (did something load OptionalLong before this test method!: "
+ + e.toString());
+ e.printStackTrace();
+ }
+ }
+}
diff --git a/test/938-load-transform-bcp/src/Main.java b/test/938-load-transform-bcp/src/Main.java
new file mode 100644
index 0000000000..548489939e
--- /dev/null
+++ b/test/938-load-transform-bcp/src/Main.java
@@ -0,0 +1,123 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.lang.reflect.*;
+import java.util.Base64;
+
+class Main {
+ public static String TEST_NAME = "938-load-transform-bcp";
+
+ /**
+ * base64 encoded class/dex file for
+ *
+ * // Yes this version of OptionalLong is not compatible with the real one but since it isn't used
+ * // for anything in the runtime initialization it should be fine.
+ *
+ * package java.util;
+ * public final class OptionalLong {
+ * private long val;
+ *
+ * private OptionalLong(long abc) {
+ * this.val = abc;
+ * }
+ *
+ * public static OptionalLong of(long abc) {
+ * return new OptionalLong(abc);
+ * }
+ *
+ * public String foo() {
+ * return "This is foo for val=" + val;
+ * }
+ *
+ * public String toString() {
+ * return "This is toString() for val=" + val;
+ * }
+ * }
+ */
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAKQoADAAaCQADABsHABwKAAMAHQcAHgoABQAaCAAfCgAFACAKAAUAIQoABQAiCAAj" +
+ "BwAkAQADdmFsAQABSgEABjxpbml0PgEABChKKVYBAARDb2RlAQAPTGluZU51bWJlclRhYmxlAQAC" +
+ "b2YBABsoSilMamF2YS91dGlsL09wdGlvbmFsTG9uZzsBAANmb28BABQoKUxqYXZhL2xhbmcvU3Ry" +
+ "aW5nOwEACHRvU3RyaW5nAQAKU291cmNlRmlsZQEAEU9wdGlvbmFsTG9uZy5qYXZhDAAPACUMAA0A" +
+ "DgEAFmphdmEvdXRpbC9PcHRpb25hbExvbmcMAA8AEAEAF2phdmEvbGFuZy9TdHJpbmdCdWlsZGVy" +
+ "AQAUVGhpcyBpcyBmb28gZm9yIHZhbD0MACYAJwwAJgAoDAAXABYBABtUaGlzIGlzIHRvU3RyaW5n" +
+ "KCkgZm9yIHZhbD0BABBqYXZhL2xhbmcvT2JqZWN0AQADKClWAQAGYXBwZW5kAQAtKExqYXZhL2xh" +
+ "bmcvU3RyaW5nOylMamF2YS9sYW5nL1N0cmluZ0J1aWxkZXI7AQAcKEopTGphdmEvbGFuZy9TdHJp" +
+ "bmdCdWlsZGVyOwAxAAMADAAAAAEAAgANAA4AAAAEAAIADwAQAAEAEQAAACoAAwADAAAACiq3AAEq" +
+ "H7UAArEAAAABABIAAAAOAAMAAAAFAAQABgAJAAcACQATABQAAQARAAAAIQAEAAIAAAAJuwADWR63" +
+ "AASwAAAAAQASAAAABgABAAAACgABABUAFgABABEAAAAvAAMAAQAAABe7AAVZtwAGEge2AAgqtAAC" +
+ "tgAJtgAKsAAAAAEAEgAAAAYAAQAAAA4AAQAXABYAAQARAAAALwADAAEAAAAXuwAFWbcABhILtgAI" +
+ "KrQAArYACbYACrAAAAABABIAAAAGAAEAAAASAAEAGAAAAAIAGQ==");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQAOe/TYJCvVthTToFA3tveMDhwTo7uDf0IcBAAAcAAAAHhWNBIAAAAAAAAAAHwDAAAU" +
+ "AAAAcAAAAAYAAADAAAAABgAAANgAAAABAAAAIAEAAAkAAAAoAQAAAQAAAHABAACMAgAAkAEAAFYC" +
+ "AABeAgAAYQIAAGQCAABoAgAAbAIAAIACAACUAgAArwIAAMkCAADcAgAA8gIAAA8DAAASAwAAFgMA" +
+ "AB4DAAAyAwAANwMAADsDAABFAwAAAQAAAAUAAAAGAAAABwAAAAgAAAAMAAAAAgAAAAIAAAAAAAAA" +
+ "AwAAAAMAAABIAgAABAAAAAMAAABQAgAAAwAAAAQAAABIAgAADAAAAAUAAAAAAAAADQAAAAUAAABI" +
+ "AgAABAAAABMAAAABAAQAAAAAAAMABAAAAAAAAwABAA4AAAADAAIADgAAAAMAAAASAAAABAAFAAAA" +
+ "AAAEAAAAEAAAAAQAAwARAAAABAAAABIAAAAEAAAAEQAAAAEAAAAAAAAACQAAAAAAAABiAwAAAAAA" +
+ "AAQAAwABAAAASgMAAAYAAABwEAAAAQBaEgAADgAEAAIAAwAAAFIDAAAGAAAAIgAEAHAwBQAgAxEA" +
+ "BQABAAMAAABYAwAAFwAAACIAAwBwEAEAAAAbAQoAAABuIAMAEAAMAFNCAABuMAIAIAMMAG4QBAAA" +
+ "AAwAEQAAAAUAAQADAAAAXQMAABcAAAAiAAMAcBABAAAAGwELAAAAbiADABAADABTQgAAbjACACAD" +
+ "DABuEAQAAAAMABEAAAABAAAAAAAAAAEAAAACAAY8aW5pdD4AAUoAAUwAAkxKAAJMTAASTGphdmEv" +
+ "bGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAGUxqYXZhL2xhbmcvU3RyaW5nQnVpbGRl" +
+ "cjsAGExqYXZhL3V0aWwvT3B0aW9uYWxMb25nOwART3B0aW9uYWxMb25nLmphdmEAFFRoaXMgaXMg" +
+ "Zm9vIGZvciB2YWw9ABtUaGlzIGlzIHRvU3RyaW5nKCkgZm9yIHZhbD0AAVYAAlZKAAZhcHBlbmQA" +
+ "EmVtaXR0ZXI6IGphY2stNC4yMgADZm9vAAJvZgAIdG9TdHJpbmcAA3ZhbAAFAQAHDjwtAAoBAAcO" +
+ "AA4ABw4AEgAHDgAAAQICAAIFgoAEkAMCCawDBgHIAwIBiAQAAA0AAAAAAAAAAQAAAAAAAAABAAAA" +
+ "FAAAAHAAAAACAAAABgAAAMAAAAADAAAABgAAANgAAAAEAAAAAQAAACABAAAFAAAACQAAACgBAAAG" +
+ "AAAAAQAAAHABAAABIAAABAAAAJABAAABEAAAAgAAAEgCAAACIAAAFAAAAFYCAAADIAAABAAAAEoD" +
+ "AAAAIAAAAQAAAGIDAAAAEAAAAQAAAHwDAAA=");
+
+ public static ClassLoader getClassLoaderFor(String location) throws Exception {
+ try {
+ Class<?> class_loader_class = Class.forName("dalvik.system.PathClassLoader");
+ Constructor<?> ctor = class_loader_class.getConstructor(String.class, ClassLoader.class);
+ return (ClassLoader)ctor.newInstance(location + "/" + TEST_NAME + "-ex.jar",
+ Main.class.getClassLoader());
+ } catch (ClassNotFoundException e) {
+ // Running on RI. Use URLClassLoader.
+ return new java.net.URLClassLoader(
+ new java.net.URL[] { new java.net.URL("file://" + location + "/classes-ex/") });
+ }
+ }
+
+ public static void main(String[] args) {
+ setPopRetransformations(false);
+ addCommonTransformationResult("java/util/OptionalLong", CLASS_BYTES, DEX_BYTES);
+ enableCommonRetransformation(true);
+ try {
+ /* this is the "alternate" DEX/Jar file */
+ ClassLoader new_loader = getClassLoaderFor(System.getenv("DEX_LOCATION"));
+ Class<?> klass = (Class<?>)new_loader.loadClass("TestMain");
+ if (klass == null) {
+ throw new AssertionError("loadClass failed");
+ }
+ Method run_test = klass.getMethod("runTest");
+ run_test.invoke(null);
+ } catch (Exception e) {
+ System.out.println(e.toString());
+ e.printStackTrace();
+ }
+ }
+
+ private static native void setPopRetransformations(boolean should_pop);
+ // Transforms the class
+ private static native void enableCommonRetransformation(boolean enable);
+ private static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/939-hello-transformation-bcp/build b/test/939-hello-transformation-bcp/build
new file mode 100755
index 0000000000..898e2e54a2
--- /dev/null
+++ b/test/939-hello-transformation-bcp/build
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-build "$@" --experimental agents
diff --git a/test/939-hello-transformation-bcp/expected.txt b/test/939-hello-transformation-bcp/expected.txt
new file mode 100644
index 0000000000..90fd25828d
--- /dev/null
+++ b/test/939-hello-transformation-bcp/expected.txt
@@ -0,0 +1,3 @@
+ol.toString() -> 'OptionalLong[-559038737]'
+Redefining OptionalLong!
+ol.toString() -> 'Redefined OptionalLong!'
diff --git a/test/939-hello-transformation-bcp/info.txt b/test/939-hello-transformation-bcp/info.txt
new file mode 100644
index 0000000000..d230a382bd
--- /dev/null
+++ b/test/939-hello-transformation-bcp/info.txt
@@ -0,0 +1,6 @@
+Tests basic functions in the jvmti plugin.
+
+Note this function is reliant on the definition of java.util.OptionalLong not
+changing. If this classes definition changes we will need to update this class
+so that the CLASS_BYTES and DEX_BYTES fields contain dex/class bytes for an
+OptionalLong with all the same methods and fields.
diff --git a/test/939-hello-transformation-bcp/run b/test/939-hello-transformation-bcp/run
new file mode 100755
index 0000000000..c6e62ae6cd
--- /dev/null
+++ b/test/939-hello-transformation-bcp/run
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-run "$@" --jvmti
diff --git a/test/939-hello-transformation-bcp/src/Main.java b/test/939-hello-transformation-bcp/src/Main.java
new file mode 100644
index 0000000000..bdf7f592ef
--- /dev/null
+++ b/test/939-hello-transformation-bcp/src/Main.java
@@ -0,0 +1,126 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+import java.util.OptionalLong;
+public class Main {
+
+ /**
+ * This is the base64 encoded class/dex.
+ *
+ * package java.util;
+ * import java.util.function.LongConsumer;
+ * import java.util.function.LongSupplier;
+ * import java.util.function.Supplier;
+ * public final class OptionalLong {
+ * // Make sure we have a <clinit> function since the real implementation of OptionalLong does.
+ * static { EMPTY = null; }
+ * private static final OptionalLong EMPTY;
+ * private final boolean isPresent;
+ * private final long value;
+ * private OptionalLong() { isPresent = false; value = 0; }
+ * private OptionalLong(long l) { this(); }
+ * public static OptionalLong empty() { return null; }
+ * public static OptionalLong of(long value) { return null; }
+ * public long getAsLong() { return 0; }
+ * public boolean isPresent() { return false; }
+ * public void ifPresent(LongConsumer c) { }
+ * public long orElse(long l) { return 0; }
+ * public long orElseGet(LongSupplier s) { return 0; }
+ * public<X extends Throwable> long orElseThrow(Supplier<X> s) throws X { return 0; }
+ * public boolean equals(Object o) { return false; }
+ * public int hashCode() { return 0; }
+ * public String toString() { return "Redefined OptionalLong!"; }
+ * }
+ */
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAOAoACAAwCQAHADEJAAcAMgoABwAwCAAzCQAHADQHADUHADYBAAVFTVBUWQEAGExq" +
+ "YXZhL3V0aWwvT3B0aW9uYWxMb25nOwEACWlzUHJlc2VudAEAAVoBAAV2YWx1ZQEAAUoBAAY8aW5p" +
+ "dD4BAAMoKVYBAARDb2RlAQAPTGluZU51bWJlclRhYmxlAQAEKEopVgEABWVtcHR5AQAaKClMamF2" +
+ "YS91dGlsL09wdGlvbmFsTG9uZzsBAAJvZgEAGyhKKUxqYXZhL3V0aWwvT3B0aW9uYWxMb25nOwEA" +
+ "CWdldEFzTG9uZwEAAygpSgEAAygpWgEACWlmUHJlc2VudAEAJChMamF2YS91dGlsL2Z1bmN0aW9u" +
+ "L0xvbmdDb25zdW1lcjspVgEABm9yRWxzZQEABChKKUoBAAlvckVsc2VHZXQBACQoTGphdmEvdXRp" +
+ "bC9mdW5jdGlvbi9Mb25nU3VwcGxpZXI7KUoBAAtvckVsc2VUaHJvdwEAIChMamF2YS91dGlsL2Z1" +
+ "bmN0aW9uL1N1cHBsaWVyOylKAQAKRXhjZXB0aW9ucwcANwEACVNpZ25hdHVyZQEAQjxYOkxqYXZh" +
+ "L2xhbmcvVGhyb3dhYmxlOz4oTGphdmEvdXRpbC9mdW5jdGlvbi9TdXBwbGllcjxUWDs+OylKXlRY" +
+ "OwEABmVxdWFscwEAFShMamF2YS9sYW5nL09iamVjdDspWgEACGhhc2hDb2RlAQADKClJAQAIdG9T" +
+ "dHJpbmcBABQoKUxqYXZhL2xhbmcvU3RyaW5nOwEACDxjbGluaXQ+AQAKU291cmNlRmlsZQEAEU9w" +
+ "dGlvbmFsTG9uZy5qYXZhDAAPABAMAAsADAwADQAOAQAXUmVkZWZpbmVkIE9wdGlvbmFsTG9uZyEM" +
+ "AAkACgEAFmphdmEvdXRpbC9PcHRpb25hbExvbmcBABBqYXZhL2xhbmcvT2JqZWN0AQATamF2YS9s" +
+ "YW5nL1Rocm93YWJsZQAxAAcACAAAAAMAGgAJAAoAAAASAAsADAAAABIADQAOAAAADgACAA8AEAAB" +
+ "ABEAAAAnAAMAAQAAAA8qtwABKgO1AAIqCbUAA7EAAAABABIAAAAGAAEAAAALAAIADwATAAEAEQAA" +
+ "AB0AAQADAAAABSq3AASxAAAAAQASAAAABgABAAAADAAJABQAFQABABEAAAAaAAEAAAAAAAIBsAAA" +
+ "AAEAEgAAAAYAAQAAAA0ACQAWABcAAQARAAAAGgABAAIAAAACAbAAAAABABIAAAAGAAEAAAAOAAEA" +
+ "GAAZAAEAEQAAABoAAgABAAAAAgmtAAAAAQASAAAABgABAAAADwABAAsAGgABABEAAAAaAAEAAQAA" +
+ "AAIDrAAAAAEAEgAAAAYAAQAAABAAAQAbABwAAQARAAAAGQAAAAIAAAABsQAAAAEAEgAAAAYAAQAA" +
+ "ABEAAQAdAB4AAQARAAAAGgACAAMAAAACCa0AAAABABIAAAAGAAEAAAASAAEAHwAgAAEAEQAAABoA" +
+ "AgACAAAAAgmtAAAAAQASAAAABgABAAAAEwABACEAIgADABEAAAAaAAIAAgAAAAIJrQAAAAEAEgAA" +
+ "AAYAAQAAABQAIwAAAAQAAQAkACUAAAACACYAAQAnACgAAQARAAAAGgABAAIAAAACA6wAAAABABIA" +
+ "AAAGAAEAAAAVAAEAKQAqAAEAEQAAABoAAQABAAAAAgOsAAAAAQASAAAABgABAAAAFgABACsALAAB" +
+ "ABEAAAAbAAEAAQAAAAMSBbAAAAABABIAAAAGAAEAAAAXAAgALQAQAAEAEQAAAB0AAQAAAAAABQGz" +
+ "AAaxAAAAAQASAAAABgABAAAABwABAC4AAAACAC8=");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQCvAoivSJqk6GdYOgJmvrM/b2/flxhw99q8BwAAcAAAAHhWNBIAAAAAAAAAAPgGAAAq" +
+ "AAAAcAAAAA0AAAAYAQAADQAAAEwBAAADAAAA6AEAAA8AAAAAAgAAAQAAAHgCAAAkBQAAmAIAACoE" +
+ "AAA4BAAAPQQAAEcEAABPBAAAUwQAAFoEAABdBAAAYAQAAGQEAABoBAAAawQAAG8EAACOBAAAqgQA" +
+ "AL4EAADSBAAA6QQAAAMFAAAmBQAASQUAAGcFAACGBQAAmQUAALIFAAC1BQAAuQUAAL0FAADABQAA" +
+ "xAUAANgFAADfBQAA5wUAAPIFAAD8BQAABwYAABIGAAAWBgAAHgYAACkGAAA2BgAAQAYAAAYAAAAH" +
+ "AAAADAAAAA0AAAAOAAAADwAAABAAAAARAAAAEgAAABMAAAAVAAAAGAAAABsAAAAGAAAAAAAAAAAA" +
+ "AAAHAAAAAQAAAAAAAAAIAAAAAQAAAAQEAAAJAAAAAQAAAAwEAAAJAAAAAQAAABQEAAAKAAAABQAA" +
+ "AAAAAAAKAAAABwAAAAAAAAALAAAABwAAAAQEAAAYAAAACwAAAAAAAAAZAAAACwAAAAQEAAAaAAAA" +
+ "CwAAABwEAAAbAAAADAAAAAAAAAAcAAAADAAAACQEAAAHAAcABQAAAAcADAAjAAAABwABACkAAAAE" +
+ "AAgAAwAAAAcACAACAAAABwAIAAMAAAAHAAkAAwAAAAcABgAeAAAABwAMAB8AAAAHAAEAIAAAAAcA" +
+ "AAAhAAAABwAKACIAAAAHAAsAIwAAAAcABwAkAAAABwACACUAAAAHAAMAJgAAAAcABAAnAAAABwAF" +
+ "ACgAAAAHAAAAEQAAAAQAAAAAAAAAFgAAAOwDAACtBgAAAAAAAAIAAACVBgAApQYAAAEAAAAAAAAA" +
+ "RwYAAAQAAAASAGkAAAAOAAMAAQABAAAATQYAAAsAAABwEAAAAgASAFwgAQAWAAAAWiACAA4AAAAD" +
+ "AAMAAQAAAFIGAAAEAAAAcBACAAAADgABAAAAAAAAAFgGAAACAAAAEgARAAMAAgAAAAAAXQYAAAIA" +
+ "AAASABEAAwACAAAAAABjBgAAAgAAABIADwADAAEAAAAAAGkGAAADAAAAFgAAABAAAAACAAEAAAAA" +
+ "AG4GAAACAAAAEgAPAAIAAgAAAAAAcwYAAAEAAAAOAAAAAgABAAAAAAB5BgAAAgAAABIADwAFAAMA" +
+ "AAAAAH4GAAADAAAAFgAAABAAAAAEAAIAAAAAAIQGAAADAAAAFgAAABAAAAAEAAIAAAAAAIoGAAAD" +
+ "AAAAFgAAABAAAAACAAEAAAAAAJAGAAAEAAAAGwAXAAAAEQAAAAAAAAAAAAEAAAAAAAAADQAAAJgC" +
+ "AAABAAAAAQAAAAEAAAAJAAAAAQAAAAoAAAABAAAACAAAAAEAAAAEAAw8VFg7PjspSl5UWDsAAzxY" +
+ "OgAIPGNsaW5pdD4ABjxpbml0PgACPigABUVNUFRZAAFJAAFKAAJKSgACSkwAAUwAAkxKAB1MZGFs" +
+ "dmlrL2Fubm90YXRpb24vU2lnbmF0dXJlOwAaTGRhbHZpay9hbm5vdGF0aW9uL1Rocm93czsAEkxq" +
+ "YXZhL2xhbmcvT2JqZWN0OwASTGphdmEvbGFuZy9TdHJpbmc7ABVMamF2YS9sYW5nL1Rocm93YWJs" +
+ "ZTsAGExqYXZhL3V0aWwvT3B0aW9uYWxMb25nOwAhTGphdmEvdXRpbC9mdW5jdGlvbi9Mb25nQ29u" +
+ "c3VtZXI7ACFMamF2YS91dGlsL2Z1bmN0aW9uL0xvbmdTdXBwbGllcjsAHExqYXZhL3V0aWwvZnVu" +
+ "Y3Rpb24vU3VwcGxpZXIAHUxqYXZhL3V0aWwvZnVuY3Rpb24vU3VwcGxpZXI7ABFPcHRpb25hbExv" +
+ "bmcuamF2YQAXUmVkZWZpbmVkIE9wdGlvbmFsTG9uZyEAAVYAAlZKAAJWTAABWgACWkwAEmVtaXR0" +
+ "ZXI6IGphY2stNC4yMgAFZW1wdHkABmVxdWFscwAJZ2V0QXNMb25nAAhoYXNoQ29kZQAJaWZQcmVz" +
+ "ZW50AAlpc1ByZXNlbnQAAm9mAAZvckVsc2UACW9yRWxzZUdldAALb3JFbHNlVGhyb3cACHRvU3Ry" +
+ "aW5nAAV2YWx1ZQAHAAcOOQALAAcOAAwBAAcOAA0ABw4ADgEABw4AFQEABw4ADwAHDgAWAAcOABEB" +
+ "AAcOABAABw4AEgEABw4AEwEABw4AFAEABw4AFwAHDgACAgEpHAUXARcQFwQXFBcAAgMBKRwBGAYB" +
+ "AgUJABoBEgESAYiABKQFAYKABLwFAYKABOQFAQn8BQYJkAYFAaQGAQG4BgEB0AYBAeQGAQH4BgIB" +
+ "jAcBAaQHAQG8BwEB1AcAAAAQAAAAAAAAAAEAAAAAAAAAAQAAACoAAABwAAAAAgAAAA0AAAAYAQAA" +
+ "AwAAAA0AAABMAQAABAAAAAMAAADoAQAABQAAAA8AAAAAAgAABgAAAAEAAAB4AgAAAxAAAAEAAACY" +
+ "AgAAASAAAA4AAACkAgAABiAAAAEAAADsAwAAARAAAAUAAAAEBAAAAiAAACoAAAAqBAAAAyAAAA4A" +
+ "AABHBgAABCAAAAIAAACVBgAAACAAAAEAAACtBgAAABAAAAEAAAD4BgAA");
+
+ public static void main(String[] args) {
+ // OptionalLong is a class that is unlikely to be used by the time this test starts and is not
+ // likely to be changed in any meaningful way in the future.
+ OptionalLong ol = OptionalLong.of(0xDEADBEEF);
+ System.out.println("ol.toString() -> '" + ol.toString() + "'");
+ System.out.println("Redefining OptionalLong!");
+ doCommonClassRedefinition(OptionalLong.class, CLASS_BYTES, DEX_BYTES);
+ System.out.println("ol.toString() -> '" + ol.toString() + "'");
+ }
+
+ // Transforms the class
+ private static native void doCommonClassRedefinition(Class<?> target,
+ byte[] class_file,
+ byte[] dex_file);
+}
diff --git a/test/940-recursive-obsolete/build b/test/940-recursive-obsolete/build
new file mode 100755
index 0000000000..898e2e54a2
--- /dev/null
+++ b/test/940-recursive-obsolete/build
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-build "$@" --experimental agents
diff --git a/test/940-recursive-obsolete/expected.txt b/test/940-recursive-obsolete/expected.txt
new file mode 100644
index 0000000000..18ffc25d8a
--- /dev/null
+++ b/test/940-recursive-obsolete/expected.txt
@@ -0,0 +1,21 @@
+hello2
+hello1
+Not doing anything here
+hello0
+goodbye0
+goodbye1
+goodbye2
+hello2
+hello1
+transforming calling function
+Hello0 - transformed
+Goodbye0 - transformed
+goodbye1
+goodbye2
+Hello2 - transformed
+Hello1 - transformed
+Not doing anything here
+Hello0 - transformed
+Goodbye0 - transformed
+Goodbye1 - transformed
+Goodbye2 - transformed
diff --git a/test/940-recursive-obsolete/info.txt b/test/940-recursive-obsolete/info.txt
new file mode 100644
index 0000000000..c8b892cedd
--- /dev/null
+++ b/test/940-recursive-obsolete/info.txt
@@ -0,0 +1 @@
+Tests basic obsolete method support
diff --git a/test/940-recursive-obsolete/run b/test/940-recursive-obsolete/run
new file mode 100755
index 0000000000..c6e62ae6cd
--- /dev/null
+++ b/test/940-recursive-obsolete/run
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-run "$@" --jvmti
diff --git a/test/940-recursive-obsolete/src/Main.java b/test/940-recursive-obsolete/src/Main.java
new file mode 100644
index 0000000000..3766906a89
--- /dev/null
+++ b/test/940-recursive-obsolete/src/Main.java
@@ -0,0 +1,89 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+
+public class Main {
+
+ // class Transform {
+ // public void sayHi(int recur, Runnable r) {
+ // System.out.println("Hello" + recur + " - transformed");
+ // if (recur == 1) {
+ // r.run();
+ // sayHi(recur - 1, r);
+ // } else if (recur != 0) {
+ // sayHi(recur - 1, r);
+ // }
+ // System.out.println("Goodbye" + recur + " - transformed");
+ // }
+ // }
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQANwoADwAZCQAaABsHABwKAAMAGQgAHQoAAwAeCgADAB8IACAKAAMAIQoAIgAjCwAk" +
+ "ACUKAA4AJggAJwcAKAcAKQEABjxpbml0PgEAAygpVgEABENvZGUBAA9MaW5lTnVtYmVyVGFibGUB" +
+ "AAVzYXlIaQEAGChJTGphdmEvbGFuZy9SdW5uYWJsZTspVgEADVN0YWNrTWFwVGFibGUBAApTb3Vy" +
+ "Y2VGaWxlAQAOVHJhbnNmb3JtLmphdmEMABAAEQcAKgwAKwAsAQAXamF2YS9sYW5nL1N0cmluZ0J1" +
+ "aWxkZXIBAAVIZWxsbwwALQAuDAAtAC8BAA4gLSB0cmFuc2Zvcm1lZAwAMAAxBwAyDAAzADQHADUM" +
+ "ADYAEQwAFAAVAQAHR29vZGJ5ZQEACVRyYW5zZm9ybQEAEGphdmEvbGFuZy9PYmplY3QBABBqYXZh" +
+ "L2xhbmcvU3lzdGVtAQADb3V0AQAVTGphdmEvaW8vUHJpbnRTdHJlYW07AQAGYXBwZW5kAQAtKExq" +
+ "YXZhL2xhbmcvU3RyaW5nOylMamF2YS9sYW5nL1N0cmluZ0J1aWxkZXI7AQAcKEkpTGphdmEvbGFu" +
+ "Zy9TdHJpbmdCdWlsZGVyOwEACHRvU3RyaW5nAQAUKClMamF2YS9sYW5nL1N0cmluZzsBABNqYXZh" +
+ "L2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgEAEmphdmEv" +
+ "bGFuZy9SdW5uYWJsZQEAA3J1bgAgAA4ADwAAAAAAAgAAABAAEQABABIAAAAdAAEAAQAAAAUqtwAB" +
+ "sQAAAAEAEwAAAAYAAQAAAAEAAQAUABUAAQASAAAAnQADAAMAAABfsgACuwADWbcABBIFtgAGG7YA" +
+ "BxIItgAGtgAJtgAKGwSgABQsuQALAQAqGwRkLLYADKcADxuZAAsqGwRkLLYADLIAArsAA1m3AAQS" +
+ "DbYABhu2AAcSCLYABrYACbYACrEAAAACABMAAAAiAAgAAAADAB4ABAAjAAUAKQAGADQABwA4AAgA" +
+ "QAAKAF4ACwAWAAAABAACNAsAAQAXAAAAAgAY");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQA3pkIgnymz2/eri+mp2dyZo3jolQmaRPKEBAAAcAAAAHhWNBIAAAAAAAAAAOQDAAAa" +
+ "AAAAcAAAAAkAAADYAAAABgAAAPwAAAABAAAARAEAAAkAAABMAQAAAQAAAJQBAADQAgAAtAEAAJwC" +
+ "AACsAgAAtAIAAL0CAADEAgAAxwIAAMoCAADOAgAA0gIAAN8CAAD2AgAACgMAACADAAA0AwAATwMA" +
+ "AGMDAABzAwAAdgMAAHsDAAB/AwAAhwMAAJsDAACgAwAAqQMAAK4DAAC1AwAABAAAAAgAAAAJAAAA" +
+ "CgAAAAsAAAAMAAAADQAAAA4AAAAQAAAABQAAAAUAAAAAAAAABgAAAAYAAACEAgAABwAAAAYAAACM" +
+ "AgAAEAAAAAgAAAAAAAAAEQAAAAgAAACUAgAAEgAAAAgAAACMAgAABwACABUAAAABAAMAAQAAAAEA" +
+ "BAAYAAAAAgAFABYAAAADAAMAAQAAAAQAAwAXAAAABgADAAEAAAAGAAEAEwAAAAYAAgATAAAABgAA" +
+ "ABkAAAABAAAAAAAAAAMAAAAAAAAADwAAAAAAAADWAwAAAAAAAAEAAQABAAAAvwMAAAQAAABwEAMA" +
+ "AAAOAAYAAwADAAAAxAMAAFQAAABiAAAAIgEGAHAQBQABABsCAwAAAG4gBwAhAAwBbiAGAEEADAEb" +
+ "AgAAAABuIAcAIQAMAW4QCAABAAwBbiACABAAEhAzBCsAchAEAAUA2AAE/24wAQADBWIAAAAiAQYA" +
+ "cBAFAAEAGwICAAAAbiAHACEADAFuIAYAQQAMARsCAAAAAG4gBwAhAAwBbhAIAAEADAFuIAIAEAAO" +
+ "ADgE3//YAAT/bjABAAMFKNgBAAAAAAAAAAEAAAAFAAAAAgAAAAAABAAOIC0gdHJhbnNmb3JtZWQA" +
+ "Bjxpbml0PgAHR29vZGJ5ZQAFSGVsbG8AAUkAAUwAAkxJAAJMTAALTFRyYW5zZm9ybTsAFUxqYXZh" +
+ "L2lvL1ByaW50U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABRMamF2YS9sYW5nL1J1bm5hYmxl" +
+ "OwASTGphdmEvbGFuZy9TdHJpbmc7ABlMamF2YS9sYW5nL1N0cmluZ0J1aWxkZXI7ABJMamF2YS9s" +
+ "YW5nL1N5c3RlbTsADlRyYW5zZm9ybS5qYXZhAAFWAANWSUwAAlZMAAZhcHBlbmQAEmVtaXR0ZXI6" +
+ "IGphY2stNC4yNAADb3V0AAdwcmludGxuAANydW4ABXNheUhpAAh0b1N0cmluZwABAAcOAAMCAAAH" +
+ "DgEgDzw8XQEgDxktAAAAAQEAgIAEtAMBAcwDDQAAAAAAAAABAAAAAAAAAAEAAAAaAAAAcAAAAAIA" +
+ "AAAJAAAA2AAAAAMAAAAGAAAA/AAAAAQAAAABAAAARAEAAAUAAAAJAAAATAEAAAYAAAABAAAAlAEA" +
+ "AAEgAAACAAAAtAEAAAEQAAADAAAAhAIAAAIgAAAaAAAAnAIAAAMgAAACAAAAvwMAAAAgAAABAAAA" +
+ "1gMAAAAQAAABAAAA5AMAAA==");
+
+ public static void main(String[] args) {
+ doTest(new Transform());
+ }
+
+ public static void doTest(Transform t) {
+ t.sayHi(2, () -> { System.out.println("Not doing anything here"); });
+ t.sayHi(2, () -> {
+ System.out.println("transforming calling function");
+ doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+ });
+ t.sayHi(2, () -> { System.out.println("Not doing anything here"); });
+ }
+
+ // Transforms the class
+ private static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+}
diff --git a/test/940-recursive-obsolete/src/Transform.java b/test/940-recursive-obsolete/src/Transform.java
new file mode 100644
index 0000000000..97522cddf6
--- /dev/null
+++ b/test/940-recursive-obsolete/src/Transform.java
@@ -0,0 +1,28 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Transform {
+ public void sayHi(int recur, Runnable r) {
+ System.out.println("hello" + recur);
+ if (recur == 1) {
+ r.run();
+ sayHi(recur - 1, r);
+ } else if (recur != 0) {
+ sayHi(recur - 1, r);
+ }
+ System.out.println("goodbye" + recur);
+ }
+}
diff --git a/test/941-recurive-obsolete-jit/build b/test/941-recurive-obsolete-jit/build
new file mode 100755
index 0000000000..898e2e54a2
--- /dev/null
+++ b/test/941-recurive-obsolete-jit/build
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-build "$@" --experimental agents
diff --git a/test/941-recurive-obsolete-jit/expected.txt b/test/941-recurive-obsolete-jit/expected.txt
new file mode 100644
index 0000000000..086f7b03dc
--- /dev/null
+++ b/test/941-recurive-obsolete-jit/expected.txt
@@ -0,0 +1,22 @@
+hello2
+hello1
+Not doing anything here
+hello0
+goodbye0
+goodbye1
+goodbye2
+hello2
+hello1
+transforming calling function
+Hello0 - transformed
+Goodbye0 - transformed
+goodbye1
+goodbye2
+Hello2 - transformed
+Hello1 - transformed
+Not doing anything here
+Hello0 - transformed
+Goodbye0 - transformed
+Goodbye1 - transformed
+Goodbye2 - transformed
+
diff --git a/test/941-recurive-obsolete-jit/info.txt b/test/941-recurive-obsolete-jit/info.txt
new file mode 100644
index 0000000000..c8b892cedd
--- /dev/null
+++ b/test/941-recurive-obsolete-jit/info.txt
@@ -0,0 +1 @@
+Tests basic obsolete method support
diff --git a/test/941-recurive-obsolete-jit/run b/test/941-recurive-obsolete-jit/run
new file mode 100755
index 0000000000..c6e62ae6cd
--- /dev/null
+++ b/test/941-recurive-obsolete-jit/run
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-run "$@" --jvmti
diff --git a/test/941-recurive-obsolete-jit/src/Main.java b/test/941-recurive-obsolete-jit/src/Main.java
new file mode 100644
index 0000000000..f6d6416b55
--- /dev/null
+++ b/test/941-recurive-obsolete-jit/src/Main.java
@@ -0,0 +1,155 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+import java.util.function.Consumer;
+import java.lang.reflect.Method;
+
+public class Main {
+
+ // import java.util.function.Consumer;
+ // class Transform {
+ // public void sayHi(int recur, Consumer<String> reporter, Runnable r) {
+ // reporter.accept("Hello" + recur + " - transformed");
+ // if (recur == 1) {
+ // r.run();
+ // sayHi(recur - 1, reporter, r);
+ // } else if (recur != 0) {
+ // sayHi(recur - 1, reporter, r);
+ // }
+ // reporter.accept("Goodbye" + recur + " - transformed");
+ // }
+ // }
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAMwoADgAaBwAbCgACABoIABwKAAIAHQoAAgAeCAAfCgACACALACEAIgsAIwAkCgAN" +
+ "ACUIACYHACcHACgBAAY8aW5pdD4BAAMoKVYBAARDb2RlAQAPTGluZU51bWJlclRhYmxlAQAFc2F5" +
+ "SGkBADUoSUxqYXZhL3V0aWwvZnVuY3Rpb24vQ29uc3VtZXI7TGphdmEvbGFuZy9SdW5uYWJsZTsp" +
+ "VgEADVN0YWNrTWFwVGFibGUBAAlTaWduYXR1cmUBAEkoSUxqYXZhL3V0aWwvZnVuY3Rpb24vQ29u" +
+ "c3VtZXI8TGphdmEvbGFuZy9TdHJpbmc7PjtMamF2YS9sYW5nL1J1bm5hYmxlOylWAQAKU291cmNl" +
+ "RmlsZQEADlRyYW5zZm9ybS5qYXZhDAAPABABABdqYXZhL2xhbmcvU3RyaW5nQnVpbGRlcgEABUhl" +
+ "bGxvDAApACoMACkAKwEADiAtIHRyYW5zZm9ybWVkDAAsAC0HAC4MAC8AMAcAMQwAMgAQDAATABQB" +
+ "AAdHb29kYnllAQAJVHJhbnNmb3JtAQAQamF2YS9sYW5nL09iamVjdAEABmFwcGVuZAEALShMamF2" +
+ "YS9sYW5nL1N0cmluZzspTGphdmEvbGFuZy9TdHJpbmdCdWlsZGVyOwEAHChJKUxqYXZhL2xhbmcv" +
+ "U3RyaW5nQnVpbGRlcjsBAAh0b1N0cmluZwEAFCgpTGphdmEvbGFuZy9TdHJpbmc7AQAbamF2YS91" +
+ "dGlsL2Z1bmN0aW9uL0NvbnN1bWVyAQAGYWNjZXB0AQAVKExqYXZhL2xhbmcvT2JqZWN0OylWAQAS" +
+ "amF2YS9sYW5nL1J1bm5hYmxlAQADcnVuACAADQAOAAAAAAACAAAADwAQAAEAEQAAAB0AAQABAAAA" +
+ "BSq3AAGxAAAAAQASAAAABgABAAAAAgABABMAFAACABEAAACfAAQABAAAAGEsuwACWbcAAxIEtgAF" +
+ "G7YABhIHtgAFtgAIuQAJAgAbBKAAFS25AAoBACobBGQsLbYAC6cAEBuZAAwqGwRkLC22AAssuwAC" +
+ "WbcAAxIMtgAFG7YABhIHtgAFtgAIuQAJAgCxAAAAAgASAAAAIgAIAAAABAAeAAUAIwAGACkABwA1" +
+ "AAgAOQAJAEIACwBgAAwAFQAAAAQAAjUMABYAAAACABcAAQAYAAAAAgAZ");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQA7uevryhDgvad3G3EACTdspZGfNKv2i3kkBQAAcAAAAHhWNBIAAAAAAAAAAGwEAAAf" +
+ "AAAAcAAAAAkAAADsAAAABgAAABABAAAAAAAAAAAAAAkAAABYAQAAAQAAAKABAABkAwAAwAEAAMoC" +
+ "AADaAgAA3gIAAOICAADlAgAA7QIAAPECAAD6AgAAAQMAAAQDAAAHAwAACwMAAA8DAAAcAwAAOwMA" +
+ "AE8DAABlAwAAeQMAAJQDAACyAwAA0QMAAOEDAADkAwAA6gMAAO4DAAD2AwAA/gMAABIEAAAXBAAA" +
+ "HgQAACgEAAAIAAAADAAAAA0AAAAOAAAADwAAABAAAAARAAAAEwAAABUAAAAJAAAABQAAAAAAAAAK" +
+ "AAAABgAAAKgCAAALAAAABgAAALACAAAVAAAACAAAAAAAAAAWAAAACAAAALgCAAAXAAAACAAAAMQC" +
+ "AAABAAMABAAAAAEABAAcAAAAAwADAAQAAAAEAAMAGwAAAAYAAwAEAAAABgABABkAAAAGAAIAGQAA" +
+ "AAYAAAAdAAAABwAFABgAAAABAAAAAAAAAAMAAAAAAAAAFAAAAJACAABbBAAAAAAAAAEAAABHBAAA" +
+ "AQABAAEAAAAvBAAABAAAAHAQAgAAAA4ABgAEAAQAAAA0BAAAUAAAACIABgBwEAQAAAAbAQcAAABu" +
+ "IAYAEAAMAG4gBQAwAAwAGwEAAAAAbiAGABAADABuEAcAAAAMAHIgCAAEABIQMwMpAHIQAwAFANgA" +
+ "A/9uQAEAAlQiAAYAcBAEAAAAGwEGAAAAbiAGABAADABuIAUAMAAMABsBAAAAAG4gBgAQAAwAbhAH" +
+ "AAAADAByIAgABAAOADgD4f/YAAP/bkABAAJUKNoAAAAAAAAAAAEAAAAAAAAAAQAAAMABAAABAAAA" +
+ "AAAAAAEAAAAFAAAAAwAAAAAABwAEAAAAAQAAAAMADiAtIHRyYW5zZm9ybWVkAAIoSQACKVYAATwA" +
+ "Bjxpbml0PgACPjsAB0dvb2RieWUABUhlbGxvAAFJAAFMAAJMSQACTEwAC0xUcmFuc2Zvcm07AB1M" +
+ "ZGFsdmlrL2Fubm90YXRpb24vU2lnbmF0dXJlOwASTGphdmEvbGFuZy9PYmplY3Q7ABRMamF2YS9s" +
+ "YW5nL1J1bm5hYmxlOwASTGphdmEvbGFuZy9TdHJpbmc7ABlMamF2YS9sYW5nL1N0cmluZ0J1aWxk" +
+ "ZXI7ABxMamF2YS91dGlsL2Z1bmN0aW9uL0NvbnN1bWVyAB1MamF2YS91dGlsL2Z1bmN0aW9uL0Nv" +
+ "bnN1bWVyOwAOVHJhbnNmb3JtLmphdmEAAVYABFZJTEwAAlZMAAZhY2NlcHQABmFwcGVuZAASZW1p" +
+ "dHRlcjogamFjay00LjI0AANydW4ABXNheUhpAAh0b1N0cmluZwAFdmFsdWUAAgAHDgAEAwAAAAcO" +
+ "AR4PPDxdAR4PGS0AAgIBHhwHFwEXEhcDFxAXBRcPFwIAAAEBAICABMgDAQHgAwAAAA8AAAAAAAAA" +
+ "AQAAAAAAAAABAAAAHwAAAHAAAAACAAAACQAAAOwAAAADAAAABgAAABABAAAFAAAACQAAAFgBAAAG" +
+ "AAAAAQAAAKABAAADEAAAAQAAAMABAAABIAAAAgAAAMgBAAAGIAAAAQAAAJACAAABEAAABAAAAKgC" +
+ "AAACIAAAHwAAAMoCAAADIAAAAgAAAC8EAAAEIAAAAQAAAEcEAAAAIAAAAQAAAFsEAAAAEAAAAQAA" +
+ "AGwEAAA=");
+
+ // A class that we can use to keep track of the output of this test.
+ private static class TestWatcher implements Consumer<String> {
+ private StringBuilder sb;
+ public TestWatcher() {
+ sb = new StringBuilder();
+ }
+
+ @Override
+ public void accept(String s) {
+ sb.append(s);
+ sb.append('\n');
+ }
+
+ public String getOutput() {
+ return sb.toString();
+ }
+
+ public void clear() {
+ sb = new StringBuilder();
+ }
+ }
+
+ public static void main(String[] args) {
+ doTest(new Transform());
+ }
+
+ private static boolean retry = false;
+
+ public static void doTest(Transform t) {
+ final TestWatcher reporter = new TestWatcher();
+ Method say_hi_method;
+ // Figure out if we can even JIT at all.
+ final boolean has_jit = hasJit();
+ try {
+ say_hi_method = Transform.class.getDeclaredMethod(
+ "sayHi", int.class, Consumer.class, Runnable.class);
+ } catch (Exception e) {
+ System.out.println("Unable to find methods!");
+ e.printStackTrace();
+ return;
+ }
+ // Makes sure the stack is the way we want it for the test and does the redefinition. It will
+ // set the retry boolean to true if we need to go around again due to jit code being GCd.
+ Runnable do_redefinition = () -> {
+ if (has_jit && Main.isInterpretedFunction(say_hi_method, true)) {
+ // Try again. We are not running the right jitted methods/cannot redefine them now.
+ retry = true;
+ } else {
+ // Actually do the redefinition. The stack looks good.
+ retry = false;
+ reporter.accept("transforming calling function");
+ doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+ }
+ };
+ do {
+ // Run ensureJitCompiled here since it might get GCd
+ ensureJitCompiled(Transform.class, "sayHi");
+ // Clear output.
+ reporter.clear();
+ t.sayHi(2, reporter, () -> { reporter.accept("Not doing anything here"); });
+ t.sayHi(2, reporter, do_redefinition);
+ t.sayHi(2, reporter, () -> { reporter.accept("Not doing anything here"); });
+ } while(retry);
+ System.out.println(reporter.getOutput());
+ }
+
+ private static native boolean hasJit();
+
+ private static native boolean isInterpretedFunction(Method m, boolean require_deoptimizable);
+
+ private static native void ensureJitCompiled(Class c, String name);
+
+ // Transforms the class
+ private static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+}
diff --git a/test/941-recurive-obsolete-jit/src/Transform.java b/test/941-recurive-obsolete-jit/src/Transform.java
new file mode 100644
index 0000000000..e6a913a391
--- /dev/null
+++ b/test/941-recurive-obsolete-jit/src/Transform.java
@@ -0,0 +1,29 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.function.Consumer;
+class Transform {
+ public void sayHi(int recur, Consumer<String> c, Runnable r) {
+ c.accept("hello" + recur);
+ if (recur == 1) {
+ r.run();
+ sayHi(recur - 1, c, r);
+ } else if (recur != 0) {
+ sayHi(recur - 1, c, r);
+ }
+ c.accept("goodbye" + recur);
+ }
+}
diff --git a/test/942-private-recursive/build b/test/942-private-recursive/build
new file mode 100755
index 0000000000..898e2e54a2
--- /dev/null
+++ b/test/942-private-recursive/build
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-build "$@" --experimental agents
diff --git a/test/942-private-recursive/expected.txt b/test/942-private-recursive/expected.txt
new file mode 100644
index 0000000000..18ffc25d8a
--- /dev/null
+++ b/test/942-private-recursive/expected.txt
@@ -0,0 +1,21 @@
+hello2
+hello1
+Not doing anything here
+hello0
+goodbye0
+goodbye1
+goodbye2
+hello2
+hello1
+transforming calling function
+Hello0 - transformed
+Goodbye0 - transformed
+goodbye1
+goodbye2
+Hello2 - transformed
+Hello1 - transformed
+Not doing anything here
+Hello0 - transformed
+Goodbye0 - transformed
+Goodbye1 - transformed
+Goodbye2 - transformed
diff --git a/test/942-private-recursive/info.txt b/test/942-private-recursive/info.txt
new file mode 100644
index 0000000000..c8b892cedd
--- /dev/null
+++ b/test/942-private-recursive/info.txt
@@ -0,0 +1 @@
+Tests basic obsolete method support
diff --git a/test/942-private-recursive/run b/test/942-private-recursive/run
new file mode 100755
index 0000000000..c6e62ae6cd
--- /dev/null
+++ b/test/942-private-recursive/run
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-run "$@" --jvmti
diff --git a/test/942-private-recursive/src/Main.java b/test/942-private-recursive/src/Main.java
new file mode 100644
index 0000000000..8cbab7bac3
--- /dev/null
+++ b/test/942-private-recursive/src/Main.java
@@ -0,0 +1,94 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+
+public class Main {
+
+ // class Transform {
+ // public void sayHi(int recur, Runnable r) {
+ // privateSayHi(recur, r);
+ // }
+ // private void privateSayHi(int recur, Runnable r) {
+ // System.out.println("Hello" + recur + " - transformed");
+ // if (recur == 1) {
+ // r.run();
+ // privateSayHi(recur - 1, r);
+ // } else if (recur != 0) {
+ // privateSayHi(recur - 1, r);
+ // }
+ // System.out.println("Goodbye" + recur + " - transformed");
+ // }
+ // }
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAOAoADwAaCgAOABsJABwAHQcAHgoABAAaCAAfCgAEACAKAAQAIQgAIgoABAAjCgAk" +
+ "ACULACYAJwgAKAcAKQcAKgEABjxpbml0PgEAAygpVgEABENvZGUBAA9MaW5lTnVtYmVyVGFibGUB" +
+ "AAVzYXlIaQEAGChJTGphdmEvbGFuZy9SdW5uYWJsZTspVgEADHByaXZhdGVTYXlIaQEADVN0YWNr" +
+ "TWFwVGFibGUBAApTb3VyY2VGaWxlAQAOVHJhbnNmb3JtLmphdmEMABAAEQwAFgAVBwArDAAsAC0B" +
+ "ABdqYXZhL2xhbmcvU3RyaW5nQnVpbGRlcgEABUhlbGxvDAAuAC8MAC4AMAEADiAtIHRyYW5zZm9y" +
+ "bWVkDAAxADIHADMMADQANQcANgwANwARAQAHR29vZGJ5ZQEACVRyYW5zZm9ybQEAEGphdmEvbGFu" +
+ "Zy9PYmplY3QBABBqYXZhL2xhbmcvU3lzdGVtAQADb3V0AQAVTGphdmEvaW8vUHJpbnRTdHJlYW07" +
+ "AQAGYXBwZW5kAQAtKExqYXZhL2xhbmcvU3RyaW5nOylMamF2YS9sYW5nL1N0cmluZ0J1aWxkZXI7" +
+ "AQAcKEkpTGphdmEvbGFuZy9TdHJpbmdCdWlsZGVyOwEACHRvU3RyaW5nAQAUKClMamF2YS9sYW5n" +
+ "L1N0cmluZzsBABNqYXZhL2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0" +
+ "cmluZzspVgEAEmphdmEvbGFuZy9SdW5uYWJsZQEAA3J1bgAgAA4ADwAAAAAAAwAAABAAEQABABIA" +
+ "AAAdAAEAAQAAAAUqtwABsQAAAAEAEwAAAAYAAQAAAAEAAQAUABUAAQASAAAAIwADAAMAAAAHKhss" +
+ "twACsQAAAAEAEwAAAAoAAgAAAAMABgAEAAIAFgAVAAEAEgAAAJ0AAwADAAAAX7IAA7sABFm3AAUS" +
+ "BrYABxu2AAgSCbYAB7YACrYACxsEoAAULLkADAEAKhsEZCy3AAKnAA8bmQALKhsEZCy3AAKyAAO7" +
+ "AARZtwAFEg22AAcbtgAIEgm2AAe2AAq2AAuxAAAAAgATAAAAIgAIAAAABgAeAAcAIwAIACkACQA0" +
+ "AAoAOAALAEAADQBeAA4AFwAAAAQAAjQLAAEAGAAAAAIAGQ==");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQBQqwVIiZvIuS8j1HDurKbXZEV62Mnug5PEBAAAcAAAAHhWNBIAAAAAAAAAACQEAAAb" +
+ "AAAAcAAAAAkAAADcAAAABgAAAAABAAABAAAASAEAAAoAAABQAQAAAQAAAKABAAAEAwAAwAEAAMAC" +
+ "AADQAgAA2AIAAOECAADoAgAA6wIAAO4CAADyAgAA9gIAAAMDAAAaAwAALgMAAEQDAABYAwAAcwMA" +
+ "AIcDAACXAwAAmgMAAJ8DAACjAwAAqwMAAL8DAADEAwAAzQMAANsDAADgAwAA5wMAAAQAAAAIAAAA" +
+ "CQAAAAoAAAALAAAADAAAAA0AAAAOAAAAEAAAAAUAAAAFAAAAAAAAAAYAAAAGAAAAqAIAAAcAAAAG" +
+ "AAAAsAIAABAAAAAIAAAAAAAAABEAAAAIAAAAuAIAABIAAAAIAAAAsAIAAAcAAgAVAAAAAQADAAEA" +
+ "AAABAAQAFwAAAAEABAAZAAAAAgAFABYAAAADAAMAAQAAAAQAAwAYAAAABgADAAEAAAAGAAEAEwAA" +
+ "AAYAAgATAAAABgAAABoAAAABAAAAAAAAAAMAAAAAAAAADwAAAAAAAAAQBAAAAAAAAAEAAQABAAAA" +
+ "8QMAAAQAAABwEAQAAAAOAAYAAwADAAAA9gMAAFQAAABiAAAAIgEGAHAQBgABABsCAwAAAG4gCAAh" +
+ "AAwBbiAHAEEADAEbAgAAAABuIAgAIQAMAW4QCQABAAwBbiADABAAEhAzBCsAchAFAAUA2AAE/3Aw" +
+ "AQADBWIAAAAiAQYAcBAGAAEAGwICAAAAbiAIACEADAFuIAcAQQAMARsCAAAAAG4gCAAhAAwBbhAJ" +
+ "AAEADAFuIAMAEAAOADgE3//YAAT/cDABAAMFKNgDAAMAAwAAAAgEAAAEAAAAcDABABACDgABAAAA" +
+ "AAAAAAEAAAAFAAAAAgAAAAAABAAOIC0gdHJhbnNmb3JtZWQABjxpbml0PgAHR29vZGJ5ZQAFSGVs" +
+ "bG8AAUkAAUwAAkxJAAJMTAALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwASTGph" +
+ "dmEvbGFuZy9PYmplY3Q7ABRMamF2YS9sYW5nL1J1bm5hYmxlOwASTGphdmEvbGFuZy9TdHJpbmc7" +
+ "ABlMamF2YS9sYW5nL1N0cmluZ0J1aWxkZXI7ABJMamF2YS9sYW5nL1N5c3RlbTsADlRyYW5zZm9y" +
+ "bS5qYXZhAAFWAANWSUwAAlZMAAZhcHBlbmQAEmVtaXR0ZXI6IGphY2stNC4yNAADb3V0AAdwcmlu" +
+ "dGxuAAxwcml2YXRlU2F5SGkAA3J1bgAFc2F5SGkACHRvU3RyaW5nAAEABw4ABgIAAAcOASAPPDxd" +
+ "ASAPGS0AAwIAAAcOPAAAAAIBAICABMADAQLYAwIBkAUAAA0AAAAAAAAAAQAAAAAAAAABAAAAGwAA" +
+ "AHAAAAACAAAACQAAANwAAAADAAAABgAAAAABAAAEAAAAAQAAAEgBAAAFAAAACgAAAFABAAAGAAAA" +
+ "AQAAAKABAAABIAAAAwAAAMABAAABEAAAAwAAAKgCAAACIAAAGwAAAMACAAADIAAAAwAAAPEDAAAA" +
+ "IAAAAQAAABAEAAAAEAAAAQAAACQEAAA=");
+
+ public static void main(String[] args) {
+ doTest(new Transform());
+ }
+
+ public static void doTest(Transform t) {
+ t.sayHi(2, () -> { System.out.println("Not doing anything here"); });
+ t.sayHi(2, () -> {
+ System.out.println("transforming calling function");
+ doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+ });
+ t.sayHi(2, () -> { System.out.println("Not doing anything here"); });
+ }
+
+ // Transforms the class
+ private static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+}
diff --git a/test/942-private-recursive/src/Transform.java b/test/942-private-recursive/src/Transform.java
new file mode 100644
index 0000000000..dd5452cac8
--- /dev/null
+++ b/test/942-private-recursive/src/Transform.java
@@ -0,0 +1,32 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Transform {
+ public void sayHi(int recur, Runnable r) {
+ privateSayHi(recur, r);
+ }
+
+ private void privateSayHi(int recur, Runnable r) {
+ System.out.println("hello" + recur);
+ if (recur == 1) {
+ r.run();
+ privateSayHi(recur - 1, r);
+ } else if (recur != 0) {
+ privateSayHi(recur - 1, r);
+ }
+ System.out.println("goodbye" + recur);
+ }
+}
diff --git a/test/943-private-recursive-jit/build b/test/943-private-recursive-jit/build
new file mode 100755
index 0000000000..898e2e54a2
--- /dev/null
+++ b/test/943-private-recursive-jit/build
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-build "$@" --experimental agents
diff --git a/test/943-private-recursive-jit/expected.txt b/test/943-private-recursive-jit/expected.txt
new file mode 100644
index 0000000000..447f4a2245
--- /dev/null
+++ b/test/943-private-recursive-jit/expected.txt
@@ -0,0 +1,22 @@
+hello2
+hello1
+Not doing anything here
+hello0
+goodbye0
+goodbye1
+goodbye2
+hello2
+hello1
+transforming calling function
+hello0 - transformed
+goodbye0 - transformed
+goodbye1
+goodbye2
+hello2 - transformed
+hello1 - transformed
+Not doing anything here
+hello0 - transformed
+goodbye0 - transformed
+goodbye1 - transformed
+goodbye2 - transformed
+
diff --git a/test/943-private-recursive-jit/info.txt b/test/943-private-recursive-jit/info.txt
new file mode 100644
index 0000000000..c8b892cedd
--- /dev/null
+++ b/test/943-private-recursive-jit/info.txt
@@ -0,0 +1 @@
+Tests basic obsolete method support
diff --git a/test/943-private-recursive-jit/run b/test/943-private-recursive-jit/run
new file mode 100755
index 0000000000..c6e62ae6cd
--- /dev/null
+++ b/test/943-private-recursive-jit/run
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-run "$@" --jvmti
diff --git a/test/943-private-recursive-jit/src/Main.java b/test/943-private-recursive-jit/src/Main.java
new file mode 100644
index 0000000000..8fa534d997
--- /dev/null
+++ b/test/943-private-recursive-jit/src/Main.java
@@ -0,0 +1,171 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+import java.util.function.Consumer;
+import java.lang.reflect.Method;
+
+public class Main {
+ static final boolean ALWAYS_PRINT = false;
+
+ // import java.util.function.Consumer;
+ // class Transform {
+ // public void sayHi(int recur, Consumer<String> reporter, Runnable r) {
+ // privateSayHi(recur, reporter, r);
+ // }
+ // private void privateSayHi(int recur, Consumer<String> reporter, Runnable r) {
+ // reporter.accpet("hello" + recur + " - transformed");
+ // if (recur == 1) {
+ // r.run();
+ // privateSayHi(recur - 1, reporter, r);
+ // } else if (recur != 0) {
+ // privateSayHi(recur - 1, reporter, r);
+ // }
+ // reporter.accept("goodbye" + recur + " - transformed");
+ // }
+ // }
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQANAoADgAbCgANABwHAB0KAAMAGwgAHgoAAwAfCgADACAIACEKAAMAIgsAIwAkCwAl" +
+ "ACYIACcHACgHACkBAAY8aW5pdD4BAAMoKVYBAARDb2RlAQAPTGluZU51bWJlclRhYmxlAQAFc2F5" +
+ "SGkBADUoSUxqYXZhL3V0aWwvZnVuY3Rpb24vQ29uc3VtZXI7TGphdmEvbGFuZy9SdW5uYWJsZTsp" +
+ "VgEACVNpZ25hdHVyZQEASShJTGphdmEvdXRpbC9mdW5jdGlvbi9Db25zdW1lcjxMamF2YS9sYW5n" +
+ "L1N0cmluZzs+O0xqYXZhL2xhbmcvUnVubmFibGU7KVYBAAxwcml2YXRlU2F5SGkBAA1TdGFja01h" +
+ "cFRhYmxlAQAKU291cmNlRmlsZQEADlRyYW5zZm9ybS5qYXZhDAAPABAMABcAFAEAF2phdmEvbGFu" +
+ "Zy9TdHJpbmdCdWlsZGVyAQAFaGVsbG8MACoAKwwAKgAsAQAOIC0gdHJhbnNmb3JtZWQMAC0ALgcA" +
+ "LwwAMAAxBwAyDAAzABABAAdnb29kYnllAQAJVHJhbnNmb3JtAQAQamF2YS9sYW5nL09iamVjdAEA" +
+ "BmFwcGVuZAEALShMamF2YS9sYW5nL1N0cmluZzspTGphdmEvbGFuZy9TdHJpbmdCdWlsZGVyOwEA" +
+ "HChJKUxqYXZhL2xhbmcvU3RyaW5nQnVpbGRlcjsBAAh0b1N0cmluZwEAFCgpTGphdmEvbGFuZy9T" +
+ "dHJpbmc7AQAbamF2YS91dGlsL2Z1bmN0aW9uL0NvbnN1bWVyAQAGYWNjZXB0AQAVKExqYXZhL2xh" +
+ "bmcvT2JqZWN0OylWAQASamF2YS9sYW5nL1J1bm5hYmxlAQADcnVuACAADQAOAAAAAAADAAAADwAQ" +
+ "AAEAEQAAAB0AAQABAAAABSq3AAGxAAAAAQASAAAABgABAAAAAgABABMAFAACABEAAAAkAAQABAAA" +
+ "AAgqGywttwACsQAAAAEAEgAAAAoAAgAAAAQABwAFABUAAAACABYAAgAXABQAAgARAAAAnwAEAAQA" +
+ "AABhLLsAA1m3AAQSBbYABhu2AAcSCLYABrYACbkACgIAGwSgABUtuQALAQAqGwRkLC23AAKnABAb" +
+ "mQAMKhsEZCwttwACLLsAA1m3AAQSDLYABhu2AAcSCLYABrYACbkACgIAsQAAAAIAEgAAACIACAAA" +
+ "AAcAHgAIACMACQApAAoANQALADkADABCAA4AYAAPABgAAAAEAAI1DAAVAAAAAgAWAAEAGQAAAAIA" +
+ "Gg==");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQCevtlr8B0kh/duuDYqXkGz/w9lMmtCCuRoBQAAcAAAAHhWNBIAAAAAAAAAALAEAAAg" +
+ "AAAAcAAAAAkAAADwAAAABgAAABQBAAAAAAAAAAAAAAoAAABcAQAAAQAAAKwBAACcAwAAzAEAAPYC" +
+ "AAAGAwAACgMAAA4DAAARAwAAGQMAAB0DAAAgAwAAIwMAACcDAAArAwAAOAMAAFcDAABrAwAAgQMA" +
+ "AJUDAACwAwAAzgMAAO0DAAD9AwAAAAQAAAYEAAAKBAAAEgQAABoEAAAuBAAANwQAAD4EAABMBAAA" +
+ "UQQAAFgEAABiBAAABgAAAAoAAAALAAAADAAAAA0AAAAOAAAADwAAABEAAAATAAAABwAAAAUAAAAA" +
+ "AAAACAAAAAYAAADUAgAACQAAAAYAAADcAgAAEwAAAAgAAAAAAAAAFAAAAAgAAADkAgAAFQAAAAgA" +
+ "AADwAgAAAQADAAQAAAABAAQAGwAAAAEABAAdAAAAAwADAAQAAAAEAAMAHAAAAAYAAwAEAAAABgAB" +
+ "ABcAAAAGAAIAFwAAAAYAAAAeAAAABwAFABYAAAABAAAAAAAAAAMAAAAAAAAAEgAAALQCAACeBAAA" +
+ "AAAAAAEAAACKBAAAAQABAAEAAABpBAAABAAAAHAQAwAAAA4ABgAEAAQAAABuBAAAUAAAACIABgBw" +
+ "EAUAAAAbARoAAABuIAcAEAAMAG4gBgAwAAwAGwEAAAAAbiAHABAADABuEAgAAAAMAHIgCQAEABIQ" +
+ "MwMpAHIQBAAFANgAA/9wQAEAAlQiAAYAcBAFAAAAGwEZAAAAbiAHABAADABuIAYAMAAMABsBAAAA" +
+ "AG4gBwAQAAwAbhAIAAAADAByIAkABAAOADgD4f/YAAP/cEABAAJUKNoEAAQABAAAAIEEAAAEAAAA" +
+ "cEABABAyDgAAAAAAAAAAAAIAAAAAAAAAAQAAAMwBAAACAAAAzAEAAAEAAAAAAAAAAQAAAAUAAAAD" +
+ "AAAAAAAHAAQAAAABAAAAAwAOIC0gdHJhbnNmb3JtZWQAAihJAAIpVgABPAAGPGluaXQ+AAI+OwAB" +
+ "SQABTAACTEkAAkxMAAtMVHJhbnNmb3JtOwAdTGRhbHZpay9hbm5vdGF0aW9uL1NpZ25hdHVyZTsA" +
+ "EkxqYXZhL2xhbmcvT2JqZWN0OwAUTGphdmEvbGFuZy9SdW5uYWJsZTsAEkxqYXZhL2xhbmcvU3Ry" +
+ "aW5nOwAZTGphdmEvbGFuZy9TdHJpbmdCdWlsZGVyOwAcTGphdmEvdXRpbC9mdW5jdGlvbi9Db25z" +
+ "dW1lcgAdTGphdmEvdXRpbC9mdW5jdGlvbi9Db25zdW1lcjsADlRyYW5zZm9ybS5qYXZhAAFWAARW" +
+ "SUxMAAJWTAAGYWNjZXB0AAZhcHBlbmQAEmVtaXR0ZXI6IGphY2stNC4yNAAHZ29vZGJ5ZQAFaGVs" +
+ "bG8ADHByaXZhdGVTYXlIaQADcnVuAAVzYXlIaQAIdG9TdHJpbmcABXZhbHVlAAIABw4ABwMAAAAH" +
+ "DgEeDzw8XQEeDxktAAQDAAAABw48AAICAR8cBxcBFxAXAxcOFwUXDRcCAAACAQCAgATUAwEC7AMC" +
+ "AZwFDwAAAAAAAAABAAAAAAAAAAEAAAAgAAAAcAAAAAIAAAAJAAAA8AAAAAMAAAAGAAAAFAEAAAUA" +
+ "AAAKAAAAXAEAAAYAAAABAAAArAEAAAMQAAABAAAAzAEAAAEgAAADAAAA1AEAAAYgAAABAAAAtAIA" +
+ "AAEQAAAEAAAA1AIAAAIgAAAgAAAA9gIAAAMgAAADAAAAaQQAAAQgAAABAAAAigQAAAAgAAABAAAA" +
+ "ngQAAAAQAAABAAAAsAQAAA==");
+
+ // A class that we can use to keep track of the output of this test.
+ private static class TestWatcher implements Consumer<String> {
+ private StringBuilder sb;
+ public TestWatcher() {
+ sb = new StringBuilder();
+ }
+
+ @Override
+ public void accept(String s) {
+ if (Main.ALWAYS_PRINT) {
+ System.out.println(s);
+ }
+ sb.append(s);
+ sb.append('\n');
+ }
+
+ public String getOutput() {
+ return sb.toString();
+ }
+
+ public void clear() {
+ sb = new StringBuilder();
+ }
+ }
+
+ public static void main(String[] args) {
+ doTest(new Transform());
+ }
+
+ private static boolean retry = false;
+
+ public static void doTest(Transform t) {
+ final TestWatcher reporter = new TestWatcher();
+ Method say_hi_method;
+ Method private_say_hi_method;
+ // Figure out if we can even JIT at all.
+ final boolean has_jit = hasJit();
+ try {
+ say_hi_method = Transform.class.getDeclaredMethod(
+ "sayHi", int.class, Consumer.class, Runnable.class);
+ private_say_hi_method = Transform.class.getDeclaredMethod(
+ "privateSayHi", int.class, Consumer.class, Runnable.class);
+ } catch (Exception e) {
+ System.out.println("Unable to find methods!");
+ e.printStackTrace();
+ return;
+ }
+ // Makes sure the stack is the way we want it for the test and does the redefinition. It will
+ // set the retry boolean to true if we need to go around again due to jit code being GCd.
+ Runnable do_redefinition = () -> {
+ if (has_jit &&
+ (Main.isInterpretedFunction(say_hi_method, true) ||
+ Main.isInterpretedFunction(private_say_hi_method, true))) {
+ // Try again. We are not running the right jitted methods/cannot redefine them now.
+ retry = true;
+ } else {
+ // Actually do the redefinition. The stack looks good.
+ retry = false;
+ reporter.accept("transforming calling function");
+ doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+ }
+ };
+ do {
+ // Run ensureJitCompiled here since it might get GCd
+ ensureJitCompiled(Transform.class, "sayHi");
+ ensureJitCompiled(Transform.class, "privateSayHi");
+ // Clear output.
+ reporter.clear();
+ t.sayHi(2, reporter, () -> { reporter.accept("Not doing anything here"); });
+ t.sayHi(2, reporter, do_redefinition);
+ t.sayHi(2, reporter, () -> { reporter.accept("Not doing anything here"); });
+ } while(retry);
+ System.out.println(reporter.getOutput());
+ }
+
+ private static native boolean hasJit();
+
+ private static native boolean isInterpretedFunction(Method m, boolean require_deoptimizable);
+
+ private static native void ensureJitCompiled(Class c, String name);
+
+ // Transforms the class
+ private static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+}
diff --git a/test/943-private-recursive-jit/src/Transform.java b/test/943-private-recursive-jit/src/Transform.java
new file mode 100644
index 0000000000..9ec3e42544
--- /dev/null
+++ b/test/943-private-recursive-jit/src/Transform.java
@@ -0,0 +1,33 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.function.Consumer;
+class Transform {
+ public void sayHi(int recur, Consumer<String> reporter, Runnable r) {
+ privateSayHi(recur, reporter, r);
+ }
+
+ private void privateSayHi(int recur, Consumer<String> reporter, Runnable r) {
+ reporter.accept("hello" + recur);
+ if (recur == 1) {
+ r.run();
+ privateSayHi(recur - 1, reporter, r);
+ } else if (recur != 0) {
+ privateSayHi(recur - 1, reporter, r);
+ }
+ reporter.accept("goodbye" + recur);
+ }
+}
diff --git a/test/944-transform-classloaders/build b/test/944-transform-classloaders/build
new file mode 100755
index 0000000000..898e2e54a2
--- /dev/null
+++ b/test/944-transform-classloaders/build
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-build "$@" --experimental agents
diff --git a/test/944-transform-classloaders/classloader.cc b/test/944-transform-classloaders/classloader.cc
new file mode 100644
index 0000000000..5fbd8e11c9
--- /dev/null
+++ b/test/944-transform-classloaders/classloader.cc
@@ -0,0 +1,44 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "base/macros.h"
+#include "jni.h"
+#include "mirror/class-inl.h"
+#include "openjdkjvmti/jvmti.h"
+#include "ScopedLocalRef.h"
+
+#include "ti-agent/common_helper.h"
+#include "ti-agent/common_load.h"
+
+namespace art {
+namespace Test944TransformClassloaders {
+
+
+extern "C" JNIEXPORT jlong JNICALL Java_Main_getDexFilePointer(JNIEnv* env, jclass, jclass klass) {
+ if (Runtime::Current() == nullptr) {
+ env->ThrowNew(env->FindClass("java/lang/Exception"),
+ "We do not seem to be running in ART! Unable to get dex file.");
+ return 0;
+ }
+ ScopedObjectAccess soa(env);
+ // This sequence of casts must be the same as those done in
+ // runtime/native/dalvik_system_DexFile.cc in order to ensure that we get the same results.
+ return static_cast<jlong>(reinterpret_cast<uintptr_t>(
+ &soa.Decode<mirror::Class>(klass)->GetDexFile()));
+}
+
+} // namespace Test944TransformClassloaders
+} // namespace art
diff --git a/test/944-transform-classloaders/expected.txt b/test/944-transform-classloaders/expected.txt
new file mode 100644
index 0000000000..79522479dd
--- /dev/null
+++ b/test/944-transform-classloaders/expected.txt
@@ -0,0 +1,5 @@
+hello
+hello2
+Goodbye
+Goodbye2
+Passed
diff --git a/test/944-transform-classloaders/info.txt b/test/944-transform-classloaders/info.txt
new file mode 100644
index 0000000000..9155564d62
--- /dev/null
+++ b/test/944-transform-classloaders/info.txt
@@ -0,0 +1,7 @@
+Tests that redefined dex files are stored in the appropriate classloader.
+
+This test cannot run on the RI.
+
+We use reflection with setAccessible(true) to examine the private internals of
+classloaders. Changes to the internal operation or definition of
+dalvik.system.BaseDexClassLoader might cause this test to fail.
diff --git a/test/944-transform-classloaders/run b/test/944-transform-classloaders/run
new file mode 100755
index 0000000000..c6e62ae6cd
--- /dev/null
+++ b/test/944-transform-classloaders/run
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-run "$@" --jvmti
diff --git a/test/944-transform-classloaders/src/CommonClassDefinition.java b/test/944-transform-classloaders/src/CommonClassDefinition.java
new file mode 100644
index 0000000000..62602a02e9
--- /dev/null
+++ b/test/944-transform-classloaders/src/CommonClassDefinition.java
@@ -0,0 +1,27 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+}
diff --git a/test/944-transform-classloaders/src/Main.java b/test/944-transform-classloaders/src/Main.java
new file mode 100644
index 0000000000..4911e00a70
--- /dev/null
+++ b/test/944-transform-classloaders/src/Main.java
@@ -0,0 +1,265 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Arrays;
+import java.util.ArrayList;
+import java.util.Base64;
+import java.lang.reflect.*;
+public class Main {
+
+ /**
+ * base64 encoded class/dex file for
+ * class Transform {
+ * public void sayHi() {
+ * System.out.println("Goodbye");
+ * }
+ * }
+ */
+ private static CommonClassDefinition TRANSFORM_DEFINITION = new CommonClassDefinition(
+ Transform.class,
+ Base64.getDecoder().decode(
+ "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+ "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
+ "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
+ "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
+ "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" +
+ "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
+ "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0="),
+ Base64.getDecoder().decode(
+ "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+ "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+ "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
+ "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+ "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
+ "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
+ "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
+ "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
+ "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
+ "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
+ "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+ "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+ "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA="));
+
+ /**
+ * base64 encoded class/dex file for
+ * class Transform2 {
+ * public void sayHi() {
+ * System.out.println("Goodbye2");
+ * }
+ * }
+ */
+ private static CommonClassDefinition TRANSFORM2_DEFINITION = new CommonClassDefinition(
+ Transform2.class,
+ Base64.getDecoder().decode(
+ "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+ "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA9UcmFuc2Zvcm0yLmphdmEM" +
+ "AAcACAcAFgwAFwAYAQAIR29vZGJ5ZTIHABkMABoAGwEAClRyYW5zZm9ybTIBABBqYXZhL2xhbmcv" +
+ "T2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEA" +
+ "E2phdmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAA" +
+ "BQAGAAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAAQABAAsA" +
+ "CAABAAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAADAAgABAABAAwAAAACAA0="),
+ Base64.getDecoder().decode(
+ "ZGV4CjAzNQABX6vL8OT7aGLjbzFBEfCM9Aaz+zzGzVnQAgAAcAAAAHhWNBIAAAAAAAAAADACAAAO" +
+ "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACwAQAAIAEAAGIB" +
+ "AABqAQAAdAEAAIIBAACZAQAArQEAAMEBAADVAQAA5gEAAOkBAADtAQAAAQIAAAYCAAAPAgAAAgAA" +
+ "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+ "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAACECAAAA" +
+ "AAAAAQABAAEAAAAWAgAABAAAAHAQAwAAAA4AAwABAAIAAAAbAgAACQAAAGIAAAAbAQEAAABuIAIA" +
+ "EAAOAAAAAQAAAAMABjxpbml0PgAIR29vZGJ5ZTIADExUcmFuc2Zvcm0yOwAVTGphdmEvaW8vUHJp" +
+ "bnRTdHJlYW07ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwASTGphdmEv" +
+ "bGFuZy9TeXN0ZW07AA9UcmFuc2Zvcm0yLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTQuMjQA" +
+ "A291dAAHcHJpbnRsbgAFc2F5SGkAAQAHDgADAAcOhwAAAAEBAICABKACAQG4AgANAAAAAAAAAAEA" +
+ "AAAAAAAAAQAAAA4AAABwAAAAAgAAAAYAAACoAAAAAwAAAAIAAADAAAAABAAAAAEAAADYAAAABQAA" +
+ "AAQAAADgAAAABgAAAAEAAAAAAQAAASAAAAIAAAAgAQAAARAAAAEAAABcAQAAAiAAAA4AAABiAQAA" +
+ "AyAAAAIAAAAWAgAAACAAAAEAAAAhAgAAABAAAAEAAAAwAgAA"));
+
+ public static void main(String[] args) throws Exception {
+ doTest();
+ System.out.println("Passed");
+ }
+
+ private static void checkIsInstance(Class<?> klass, Object o) throws Exception {
+ if (!klass.isInstance(o)) {
+ throw new Exception(klass + " is not the class of " + o);
+ }
+ }
+
+ private static boolean arrayContains(long[] arr, long value) {
+ if (arr == null) {
+ return false;
+ }
+ for (int i = 0; i < arr.length; i++) {
+ if (arr[i] == value) {
+ return true;
+ }
+ }
+ return false;
+ }
+
+ /**
+ * Checks that we can find the dex-file for the given class in its classloader.
+ *
+ * Throws if it fails.
+ */
+ private static void checkDexFileInClassLoader(Class<?> klass) throws Exception {
+ // If all the android BCP classes were availible when compiling this test and access checks
+ // weren't a thing this function would be written as follows:
+ //
+ // long dexFilePtr = getDexFilePointer(klass);
+ // dalvik.system.BaseDexClassLoader loader =
+ // (dalvik.system.BaseDexClassLoader)klass.getClassLoader();
+ // dalvik.system.DexPathList pathListValue = loader.pathList;
+ // dalvik.system.DexPathList.Element[] elementArrayValue = pathListValue.dexElements;
+ // int array_length = elementArrayValue.length;
+ // for (int i = 0; i < array_length; i++) {
+ // dalvik.system.DexPathList.Element curElement = elementArrayValue[i];
+ // dalvik.system.DexFile curDexFile = curElement.dexFile;
+ // if (curDexFile == null) {
+ // continue;
+ // }
+ // long[] curCookie = (long[])curDexFile.mCookie;
+ // long[] curInternalCookie = (long[])curDexFile.mInternalCookie;
+ // if (arrayContains(curCookie, dexFilePtr) || arrayContains(curInternalCookie, dexFilePtr)) {
+ // return;
+ // }
+ // }
+ // throw new Exception(
+ // "Unable to find dex file pointer " + dexFilePtr + " in class loader for " + klass);
+
+ // Get all the fields and classes we need by reflection.
+ Class<?> baseDexClassLoaderClass = Class.forName("dalvik.system.BaseDexClassLoader");
+ Field pathListField = baseDexClassLoaderClass.getDeclaredField("pathList");
+
+ Class<?> dexPathListClass = Class.forName("dalvik.system.DexPathList");
+ Field elementArrayField = dexPathListClass.getDeclaredField("dexElements");
+
+ Class<?> dexPathListElementClass = Class.forName("dalvik.system.DexPathList$Element");
+ Field dexFileField = dexPathListElementClass.getDeclaredField("dexFile");
+
+ Class<?> dexFileClass = Class.forName("dalvik.system.DexFile");
+ Field dexFileCookieField = dexFileClass.getDeclaredField("mCookie");
+ Field dexFileInternalCookieField = dexFileClass.getDeclaredField("mInternalCookie");
+
+ // Make all the fields accessible
+ AccessibleObject.setAccessible(new AccessibleObject[] { pathListField,
+ elementArrayField,
+ dexFileField,
+ dexFileCookieField,
+ dexFileInternalCookieField }, true);
+
+ long dexFilePtr = getDexFilePointer(klass);
+
+ ClassLoader loader = klass.getClassLoader();
+ checkIsInstance(baseDexClassLoaderClass, loader);
+ // DexPathList pathListValue = ((BaseDexClassLoader) loader).pathList;
+ Object pathListValue = pathListField.get(loader);
+
+ checkIsInstance(dexPathListClass, pathListValue);
+
+ // DexPathList.Element[] elementArrayValue = pathListValue.dexElements;
+ Object elementArrayValue = elementArrayField.get(pathListValue);
+ if (!elementArrayValue.getClass().isArray() ||
+ elementArrayValue.getClass().getComponentType() != dexPathListElementClass) {
+ throw new Exception("elementArrayValue is not an " + dexPathListElementClass + " array!");
+ }
+ // int array_length = elementArrayValue.length;
+ int array_length = Array.getLength(elementArrayValue);
+ for (int i = 0; i < array_length; i++) {
+ // DexPathList.Element curElement = elementArrayValue[i];
+ Object curElement = Array.get(elementArrayValue, i);
+ checkIsInstance(dexPathListElementClass, curElement);
+
+ // DexFile curDexFile = curElement.dexFile;
+ Object curDexFile = dexFileField.get(curElement);
+ if (curDexFile == null) {
+ continue;
+ }
+ checkIsInstance(dexFileClass, curDexFile);
+
+ // long[] curCookie = (long[])curDexFile.mCookie;
+ long[] curCookie = (long[])dexFileCookieField.get(curDexFile);
+ // long[] curInternalCookie = (long[])curDexFile.mInternalCookie;
+ long[] curInternalCookie = (long[])dexFileInternalCookieField.get(curDexFile);
+
+ if (arrayContains(curCookie, dexFilePtr) || arrayContains(curInternalCookie, dexFilePtr)) {
+ return;
+ }
+ }
+ throw new Exception(
+ "Unable to find dex file pointer " + dexFilePtr + " in class loader for " + klass);
+ }
+
+ private static void doTest() throws Exception {
+ Transform t = new Transform();
+ Transform2 t2 = new Transform2();
+
+ long initial_t1_dex = getDexFilePointer(Transform.class);
+ long initial_t2_dex = getDexFilePointer(Transform2.class);
+ if (initial_t2_dex != initial_t1_dex) {
+ throw new Exception("The classes " + Transform.class + " and " + Transform2.class + " " +
+ "have different initial dex files!");
+ }
+ checkDexFileInClassLoader(Transform.class);
+ checkDexFileInClassLoader(Transform2.class);
+
+ // Make sure they are loaded
+ t.sayHi();
+ t2.sayHi();
+ // Redefine both of the classes.
+ doMultiClassRedefinition(TRANSFORM_DEFINITION, TRANSFORM2_DEFINITION);
+ // Make sure we actually transformed them!
+ t.sayHi();
+ t2.sayHi();
+
+ long final_t1_dex = getDexFilePointer(Transform.class);
+ long final_t2_dex = getDexFilePointer(Transform2.class);
+ if (final_t2_dex == final_t1_dex) {
+ throw new Exception("The classes " + Transform.class + " and " + Transform2.class + " " +
+ "have the same initial dex files!");
+ } else if (final_t1_dex == initial_t1_dex) {
+ throw new Exception("The class " + Transform.class + " did not get a new dex file!");
+ } else if (final_t2_dex == initial_t2_dex) {
+ throw new Exception("The class " + Transform2.class + " did not get a new dex file!");
+ }
+ // Check to make sure the new dex files are in the class loader.
+ checkDexFileInClassLoader(Transform.class);
+ checkDexFileInClassLoader(Transform2.class);
+ }
+
+ private static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ // Gets the 'long' (really a native pointer) that is stored in the ClassLoader representing the
+ // DexFile a class is loaded from. This is converted from the DexFile* in the same way it is done
+ // in runtime/native/dalvik_system_DexFile.cc
+ private static native long getDexFilePointer(Class<?> target);
+ // Transforms the classes
+ private static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+}
diff --git a/test/944-transform-classloaders/src/Transform.java b/test/944-transform-classloaders/src/Transform.java
new file mode 100644
index 0000000000..8e8af355da
--- /dev/null
+++ b/test/944-transform-classloaders/src/Transform.java
@@ -0,0 +1,28 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Transform {
+ public void sayHi() {
+ // Use lower 'h' to make sure the string will have a different string id
+ // than the transformation (the transformation code is the same except
+ // the actual printed String, which was making the test inacurately passing
+ // in JIT mode when loading the string from the dex cache, as the string ids
+ // of the two different strings were the same).
+ // We know the string ids will be different because lexicographically:
+ // "Goodbye" < "LTransform;" < "hello".
+ System.out.println("hello");
+ }
+}
diff --git a/test/944-transform-classloaders/src/Transform2.java b/test/944-transform-classloaders/src/Transform2.java
new file mode 100644
index 0000000000..eb22842184
--- /dev/null
+++ b/test/944-transform-classloaders/src/Transform2.java
@@ -0,0 +1,21 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Transform2 {
+ public void sayHi() {
+ System.out.println("hello2");
+ }
+}
diff --git a/test/Android.bp b/test/Android.bp
index 1070645040..d3244a683a 100644
--- a/test/Android.bp
+++ b/test/Android.bp
@@ -273,6 +273,7 @@ art_cc_defaults {
"931-agent-thread/agent_thread.cc",
"933-misc-events/misc_events.cc",
"936-search-onload/search_onload.cc",
+ "944-transform-classloaders/classloader.cc",
],
shared_libs: [
"libbase",
diff --git a/test/Android.run-test.mk b/test/Android.run-test.mk
index 1b4f19509f..742353da46 100644
--- a/test/Android.run-test.mk
+++ b/test/Android.run-test.mk
@@ -439,13 +439,14 @@ TEST_ART_BROKEN_FALLBACK_RUN_TESTS := \
629-vdex-speed
# This test fails without an image.
-# 018, 961, 964 often time out. b/34369284
+# 018, 961, 964, 968 often time out. b/34369284
TEST_ART_BROKEN_NO_IMAGE_RUN_TESTS := \
137-cfi \
138-duplicate-classes-check \
018-stack-overflow \
961-default-iface-resolution-gen \
- 964-default-iface-init
+ 964-default-iface-init \
+ 968-default-partial-compile-gen \
ifneq (,$(filter no-dex2oat,$(PREBUILD_TYPES)))
ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,$(TARGET_TYPES),$(RUN_TYPES),no-dex2oat, \
diff --git a/test/Nested/Nested.java b/test/Nested/Nested.java
index 78b273bec0..f493989268 100644
--- a/test/Nested/Nested.java
+++ b/test/Nested/Nested.java
@@ -17,4 +17,6 @@
class Nested {
class Inner {
}
+ Object x = new Object() {
+ };
}
diff --git a/test/etc/run-test-jar b/test/etc/run-test-jar
index 751aa95f50..186a1513ee 100755
--- a/test/etc/run-test-jar
+++ b/test/etc/run-test-jar
@@ -364,6 +364,8 @@ fi
if [ "$HAVE_IMAGE" = "n" ]; then
+ # Add 5 minutes to give some time to generate the boot image.
+ TIME_OUT_VALUE=$((${TIME_OUT_VALUE} + 300))
DALVIKVM_BOOT_OPT="-Ximage:/system/non-existant/core.art"
else
DALVIKVM_BOOT_OPT="-Ximage:${BOOT_IMAGE}"
diff --git a/test/ti-agent/common_helper.cc b/test/ti-agent/common_helper.cc
index ed82bb04cf..ea6359e5e0 100644
--- a/test/ti-agent/common_helper.cc
+++ b/test/ti-agent/common_helper.cc
@@ -210,6 +210,7 @@ struct CommonTransformationResult {
// Map from class name to transformation result.
std::map<std::string, std::deque<CommonTransformationResult>> gTransformations;
+bool gPopTransformations = true;
extern "C" JNIEXPORT void JNICALL Java_Main_addCommonTransformationResult(JNIEnv* env,
jclass,
@@ -266,7 +267,32 @@ void JNICALL CommonClassFileLoadHookRetransformable(jvmtiEnv* jvmti_env,
memcpy(new_data, desired_array.data(), desired_array.size());
*new_class_data = new_data;
*new_class_data_len = desired_array.size();
+ if (gPopTransformations) {
+ gTransformations[name_str].pop_front();
+ }
+ }
+}
+
+extern "C" JNIEXPORT void Java_Main_setPopRetransformations(JNIEnv*,
+ jclass,
+ jboolean enable) {
+ gPopTransformations = enable;
+}
+
+extern "C" JNIEXPORT void Java_Main_popTransformationFor(JNIEnv* env,
+ jclass,
+ jstring class_name) {
+ const char* name_chrs = env->GetStringUTFChars(class_name, nullptr);
+ std::string name_str(name_chrs);
+ env->ReleaseStringUTFChars(class_name, name_chrs);
+ if (gTransformations.find(name_str) != gTransformations.end() &&
+ gTransformations[name_str].size() > 0) {
gTransformations[name_str].pop_front();
+ } else {
+ std::stringstream err;
+ err << "No transformations found for class " << name_str;
+ std::string message = err.str();
+ env->ThrowNew(env->FindClass("java/lang/Exception"), message.c_str());
}
}
diff --git a/test/ti-agent/common_load.cc b/test/ti-agent/common_load.cc
index 621d45a1bc..c5a93568c6 100644
--- a/test/ti-agent/common_load.cc
+++ b/test/ti-agent/common_load.cc
@@ -115,6 +115,13 @@ static AgentLib agents[] = {
{ "935-non-retransformable", common_transform::OnLoad, nullptr },
{ "936-search-onload", Test936SearchOnload::OnLoad, nullptr },
{ "937-hello-retransform-package", common_retransform::OnLoad, nullptr },
+ { "938-load-transform-bcp", common_retransform::OnLoad, nullptr },
+ { "939-hello-transformation-bcp", common_redefine::OnLoad, nullptr },
+ { "940-recursive-obsolete", common_redefine::OnLoad, nullptr },
+ { "941-recursive-obsolete-jit", common_redefine::OnLoad, nullptr },
+ { "942-private-recursive", common_redefine::OnLoad, nullptr },
+ { "943-private-recursive-jit", common_redefine::OnLoad, nullptr },
+ { "944-transform-classloaders", common_redefine::OnLoad, nullptr },
};
static AgentLib* FindAgent(char* name) {
diff --git a/tools/buildbot-build.sh b/tools/buildbot-build.sh
index 2d26b4858d..963efa49a5 100755
--- a/tools/buildbot-build.sh
+++ b/tools/buildbot-build.sh
@@ -52,6 +52,9 @@ while true; do
shift
elif [[ "$1" == "" ]]; then
break
+ else
+ echo "Unknown options $@"
+ exit 1
fi
done
diff --git a/tools/cpp-define-generator/constant_jit.def b/tools/cpp-define-generator/constant_jit.def
index 5fa5194d00..82cdbb20f1 100644
--- a/tools/cpp-define-generator/constant_jit.def
+++ b/tools/cpp-define-generator/constant_jit.def
@@ -25,5 +25,6 @@
DEFINE_JIT_CONSTANT(CHECK_OSR, int16_t, art::jit::kJitCheckForOSR)
DEFINE_JIT_CONSTANT(HOTNESS_DISABLE, int16_t, art::jit::kJitHotnessDisabled)
+DEFINE_JIT_CONSTANT(CHECK_OSR_THRESHOLD, int16_t, art::jit::Jit::kJitRecheckOSRThreshold)
#undef DEFINE_JIT_CONSTANT