summaryrefslogtreecommitdiff
diff options
context:
space:
mode:
-rw-r--r--build/Android.common_build.mk3
-rw-r--r--build/Android.gtest.mk9
-rw-r--r--build/art.go2
-rw-r--r--cmdline/cmdline_types.h2
-rw-r--r--compiler/common_compiler_test.h2
-rw-r--r--compiler/compiled_method.h21
-rw-r--r--compiler/driver/compiler_driver.cc134
-rw-r--r--compiler/driver/compiler_driver.h12
-rw-r--r--compiler/driver/compiler_driver_test.cc2
-rw-r--r--compiler/image_writer.cc2
-rw-r--r--compiler/linker/arm64/relative_patcher_arm64.cc1
-rw-r--r--compiler/oat_test.cc2
-rw-r--r--compiler/oat_writer.cc42
-rw-r--r--compiler/oat_writer.h6
-rw-r--r--compiler/optimizing/bounds_check_elimination.cc19
-rw-r--r--compiler/optimizing/bounds_check_elimination_test.cc8
-rw-r--r--compiler/optimizing/builder.h6
-rw-r--r--compiler/optimizing/code_generator.cc55
-rw-r--r--compiler/optimizing/code_generator.h17
-rw-r--r--compiler/optimizing/code_generator_arm.cc173
-rw-r--r--compiler/optimizing/code_generator_arm.h10
-rw-r--r--compiler/optimizing/code_generator_arm64.cc193
-rw-r--r--compiler/optimizing/code_generator_arm64.h16
-rw-r--r--compiler/optimizing/code_generator_arm_vixl.cc162
-rw-r--r--compiler/optimizing/code_generator_arm_vixl.h10
-rw-r--r--compiler/optimizing/code_generator_mips.cc170
-rw-r--r--compiler/optimizing/code_generator_mips.h8
-rw-r--r--compiler/optimizing/code_generator_mips64.cc153
-rw-r--r--compiler/optimizing/code_generator_mips64.h8
-rw-r--r--compiler/optimizing/code_generator_x86.cc182
-rw-r--r--compiler/optimizing/code_generator_x86.h13
-rw-r--r--compiler/optimizing/code_generator_x86_64.cc166
-rw-r--r--compiler/optimizing/code_generator_x86_64.h13
-rw-r--r--compiler/optimizing/dex_cache_array_fixups_arm.cc20
-rw-r--r--compiler/optimizing/dex_cache_array_fixups_mips.cc20
-rw-r--r--compiler/optimizing/graph_visualizer.cc5
-rw-r--r--compiler/optimizing/induction_var_range.cc17
-rw-r--r--compiler/optimizing/induction_var_range.h4
-rw-r--r--compiler/optimizing/induction_var_range_test.cc9
-rw-r--r--compiler/optimizing/inliner.cc41
-rw-r--r--compiler/optimizing/inliner.h2
-rw-r--r--compiler/optimizing/instruction_builder.cc227
-rw-r--r--compiler/optimizing/instruction_builder.h24
-rw-r--r--compiler/optimizing/instruction_simplifier.cc4
-rw-r--r--compiler/optimizing/intrinsics.cc2
-rw-r--r--compiler/optimizing/load_store_elimination.cc6
-rw-r--r--compiler/optimizing/loop_optimization.cc166
-rw-r--r--compiler/optimizing/loop_optimization.h8
-rw-r--r--compiler/optimizing/nodes.cc67
-rw-r--r--compiler/optimizing/nodes.h256
-rw-r--r--compiler/optimizing/nodes_test.cc8
-rw-r--r--compiler/optimizing/pc_relative_fixups_mips.cc3
-rw-r--r--compiler/optimizing/pc_relative_fixups_x86.cc2
-rw-r--r--compiler/optimizing/prepare_for_register_allocation.cc14
-rw-r--r--compiler/optimizing/reference_type_propagation.cc35
-rw-r--r--compiler/optimizing/sharpening.cc96
-rw-r--r--compiler/optimizing/sharpening.h2
-rw-r--r--compiler/optimizing/stack_map_stream.cc68
-rw-r--r--compiler/optimizing/stack_map_stream.h8
-rw-r--r--compiler/optimizing/stack_map_test.cc53
-rw-r--r--compiler/utils/assembler_thumb_test_expected.cc.inc2
-rw-r--r--compiler/utils/x86/assembler_x86.cc145
-rw-r--r--compiler/utils/x86/assembler_x86.h23
-rw-r--r--compiler/utils/x86/assembler_x86_test.cc92
-rw-r--r--compiler/utils/x86_64/assembler_x86_64.cc162
-rw-r--r--compiler/utils/x86_64/assembler_x86_64.h22
-rw-r--r--compiler/utils/x86_64/assembler_x86_64_test.cc72
-rw-r--r--compiler/verifier_deps_test.cc12
-rw-r--r--dex2oat/dex2oat.cc4
-rw-r--r--dex2oat/dex2oat_test.cc2
-rw-r--r--dexlayout/dex_visualize.cc2
-rw-r--r--dexlayout/dexlayout.cc2
-rw-r--r--dexlayout/dexlayout_main.cc2
-rw-r--r--patchoat/patchoat.cc2
-rw-r--r--profman/profile_assistant.h2
-rw-r--r--profman/profile_assistant_test.cc2
-rw-r--r--profman/profman.cc2
-rw-r--r--runtime/Android.bp4
-rw-r--r--runtime/arch/arm/quick_entrypoints_arm.S101
-rw-r--r--runtime/arch/arm64/quick_entrypoints_arm64.S164
-rw-r--r--runtime/arch/mips/entrypoints_init_mips.cc9
-rw-r--r--runtime/arch/mips/quick_entrypoints_mips.S80
-rw-r--r--runtime/arch/mips64/instruction_set_features_mips64.cc2
-rw-r--r--runtime/arch/mips64/instruction_set_features_mips64_test.cc2
-rw-r--r--runtime/arch/mips64/quick_entrypoints_mips64.S82
-rw-r--r--runtime/arch/quick_alloc_entrypoints.S69
-rw-r--r--runtime/arch/stub_test.cc160
-rw-r--r--runtime/arch/x86/quick_entrypoints_x86.S116
-rw-r--r--runtime/arch/x86_64/quick_entrypoints_x86_64.S200
-rw-r--r--runtime/art_method-inl.h71
-rw-r--r--runtime/art_method.cc5
-rw-r--r--runtime/art_method.h43
-rw-r--r--runtime/asm_support.h6
-rw-r--r--runtime/base/mutex.cc6
-rw-r--r--runtime/base/mutex.h6
-rw-r--r--runtime/class_linker-inl.h30
-rw-r--r--runtime/class_linker.cc106
-rw-r--r--runtime/class_linker.h46
-rw-r--r--runtime/class_linker_test.cc9
-rw-r--r--runtime/common_runtime_test.cc8
-rw-r--r--runtime/common_throws.cc8
-rw-r--r--runtime/debugger.cc23
-rw-r--r--runtime/debugger.h39
-rw-r--r--runtime/dex2oat_environment_test.h2
-rw-r--r--runtime/dex_file.cc10
-rw-r--r--runtime/dex_file.h3
-rw-r--r--runtime/dex_file_annotations.cc6
-rw-r--r--runtime/dex_file_verifier.cc210
-rw-r--r--runtime/dex_file_verifier.h15
-rw-r--r--runtime/dex_file_verifier_test.cc221
-rw-r--r--runtime/dex_instruction.cc46
-rw-r--r--runtime/entrypoints/entrypoint_utils-inl.h109
-rw-r--r--runtime/entrypoints/entrypoint_utils.cc129
-rw-r--r--runtime/entrypoints/entrypoint_utils.h29
-rw-r--r--runtime/entrypoints/quick/quick_alloc_entrypoints.cc80
-rw-r--r--runtime/entrypoints/quick/quick_default_externs.h5
-rw-r--r--runtime/entrypoints/quick/quick_default_init_entrypoints.h4
-rw-r--r--runtime/entrypoints/quick/quick_dexcache_entrypoints.cc72
-rw-r--r--runtime/entrypoints/quick/quick_entrypoints_list.h10
-rw-r--r--runtime/entrypoints/quick/quick_trampoline_entrypoints.cc120
-rw-r--r--runtime/entrypoints_order_test.cc35
-rw-r--r--runtime/gc/collector/concurrent_copying.cc2
-rw-r--r--runtime/gc/space/large_object_space.cc10
-rw-r--r--runtime/generated/asm_support_gen.h12
-rw-r--r--runtime/image.cc2
-rw-r--r--runtime/interpreter/interpreter_common.cc8
-rw-r--r--runtime/interpreter/interpreter_switch_impl.cc4
-rw-r--r--runtime/jit/jit.cc2
-rw-r--r--runtime/jit/jit.h2
-rw-r--r--runtime/jit/profile_compilation_info.cc (renamed from runtime/jit/offline_profiling_info.cc)2
-rw-r--r--runtime/jit/profile_compilation_info.h (renamed from runtime/jit/offline_profiling_info.h)7
-rw-r--r--runtime/jit/profile_compilation_info_test.cc2
-rw-r--r--runtime/jit/profile_saver.h2
-rw-r--r--runtime/jni_env_ext.cc47
-rw-r--r--runtime/jni_env_ext.h21
-rw-r--r--runtime/jni_internal_test.cc35
-rw-r--r--runtime/memory_region.h4
-rw-r--r--runtime/mirror/class_ext.cc5
-rw-r--r--runtime/mirror/class_ext.h8
-rw-r--r--runtime/mirror/dex_cache_test.cc1
-rw-r--r--runtime/mirror/emulated_stack_frame.cc1
-rw-r--r--runtime/mirror/emulated_stack_frame.h5
-rw-r--r--runtime/mirror/object_test.cc17
-rw-r--r--runtime/native/java_lang_Class.cc4
-rw-r--r--runtime/oat.cc4
-rw-r--r--runtime/oat.h4
-rw-r--r--runtime/oat_file.cc6
-rw-r--r--runtime/oat_file_assistant.cc8
-rw-r--r--runtime/oat_file_assistant_test.cc20
-rw-r--r--runtime/openjdkjvmti/Android.bp6
-rw-r--r--runtime/openjdkjvmti/OpenjdkJvmTi.cc275
-rw-r--r--runtime/openjdkjvmti/art_jvmti.h6
-rw-r--r--runtime/openjdkjvmti/events-inl.h222
-rw-r--r--runtime/openjdkjvmti/events.cc101
-rw-r--r--runtime/openjdkjvmti/events.h121
-rw-r--r--runtime/openjdkjvmti/jvmti.h2
-rw-r--r--runtime/openjdkjvmti/object_tagging.cc4
-rw-r--r--runtime/openjdkjvmti/ti_class.cc120
-rw-r--r--runtime/openjdkjvmti/ti_class.h10
-rw-r--r--runtime/openjdkjvmti/ti_class_definition.cc55
-rw-r--r--runtime/openjdkjvmti/ti_class_definition.h77
-rw-r--r--runtime/openjdkjvmti/ti_jni.cc91
-rw-r--r--runtime/openjdkjvmti/ti_jni.h58
-rw-r--r--runtime/openjdkjvmti/ti_phase.cc129
-rw-r--r--runtime/openjdkjvmti/ti_phase.h65
-rw-r--r--runtime/openjdkjvmti/ti_redefine.cc643
-rw-r--r--runtime/openjdkjvmti/ti_redefine.h244
-rw-r--r--runtime/openjdkjvmti/ti_search.cc122
-rw-r--r--runtime/openjdkjvmti/ti_search.h48
-rw-r--r--runtime/openjdkjvmti/ti_stack.cc368
-rw-r--r--runtime/openjdkjvmti/ti_stack.h14
-rw-r--r--runtime/openjdkjvmti/ti_thread.cc165
-rw-r--r--runtime/openjdkjvmti/ti_thread.h11
-rw-r--r--runtime/openjdkjvmti/ti_threadgroup.cc285
-rw-r--r--runtime/openjdkjvmti/ti_threadgroup.h60
-rw-r--r--runtime/openjdkjvmti/ti_timers.cc93
-rw-r--r--runtime/openjdkjvmti/ti_timers.h51
-rw-r--r--runtime/openjdkjvmti/transform.cc150
-rw-r--r--runtime/openjdkjvmti/transform.h35
-rw-r--r--runtime/parsed_options.cc2
-rw-r--r--runtime/reflection.cc48
-rw-r--r--runtime/runtime.cc50
-rw-r--r--runtime/runtime.h9
-rw-r--r--runtime/runtime_callbacks.cc104
-rw-r--r--runtime/runtime_callbacks.h115
-rw-r--r--runtime/runtime_callbacks_test.cc410
-rw-r--r--runtime/runtime_options.def2
-rw-r--r--runtime/stack_map.cc21
-rw-r--r--runtime/stack_map.h53
-rw-r--r--runtime/thread.cc106
-rw-r--r--runtime/thread.h40
-rw-r--r--runtime/vdex_file.h2
-rw-r--r--runtime/verifier/method_verifier.cc21
-rw-r--r--runtime/verifier/verifier_deps.cc39
-rw-r--r--runtime/well_known_classes.cc2
-rw-r--r--runtime/well_known_classes.h1
-rw-r--r--test/080-oom-throw/expected.txt1
-rw-r--r--test/080-oom-throw/src/Main.java43
-rw-r--r--test/129-ThreadGetId/src/Main.java33
-rw-r--r--test/494-checker-instanceof-tests/src/Main.java6
-rw-r--r--test/496-checker-inlining-class-loader/src/Main.java19
-rw-r--r--test/552-checker-sharpening/src/Main.java30
-rw-r--r--test/559-checker-irreducible-loop/smali/IrreducibleLoop.smali6
-rw-r--r--test/559-checker-irreducible-loop/src/Main.java3
-rw-r--r--test/559-checker-rtp-ifnotnull/src/Main.java7
-rw-r--r--test/572-checker-array-get-regression/src/Main.java8
-rw-r--r--test/595-profile-saving/profile-saving.cc2
-rw-r--r--test/627-checker-unroll/expected.txt1
-rw-r--r--test/627-checker-unroll/info.txt1
-rw-r--r--test/627-checker-unroll/src/Main.java119
-rw-r--r--test/633-checker-rtp-getclass/expected.txt3
-rw-r--r--test/633-checker-rtp-getclass/info.txt3
-rw-r--r--test/633-checker-rtp-getclass/src/Main.java76
-rw-r--r--test/634-vdex-duplicate/expected.txt1
-rw-r--r--test/634-vdex-duplicate/info.txt0
-rw-r--r--test/634-vdex-duplicate/run17
-rw-r--r--test/634-vdex-duplicate/src/Main.java21
-rw-r--r--test/634-vdex-duplicate/src/sun/misc/Unsafe.java20
-rw-r--r--test/901-hello-ti-agent/basics.cc83
-rw-r--r--test/901-hello-ti-agent/expected.txt10
-rw-r--r--test/901-hello-ti-agent/src/Main.java25
-rw-r--r--test/911-get-stack-trace/expected.txt1023
-rw-r--r--test/911-get-stack-trace/src/AllTraces.java80
-rw-r--r--test/911-get-stack-trace/src/ControlData.java31
-rw-r--r--test/911-get-stack-trace/src/Frames.java133
-rw-r--r--test/911-get-stack-trace/src/Main.java259
-rw-r--r--test/911-get-stack-trace/src/OtherThread.java82
-rw-r--r--test/911-get-stack-trace/src/PrintThread.java70
-rw-r--r--test/911-get-stack-trace/src/Recurse.java58
-rw-r--r--test/911-get-stack-trace/src/SameThread.java33
-rw-r--r--test/911-get-stack-trace/src/ThreadListTraces.java71
-rw-r--r--test/911-get-stack-trace/stack_trace.cc111
-rw-r--r--test/912-classes/classes.cc37
-rw-r--r--test/912-classes/expected.txt18
-rwxr-xr-xtest/912-classes/run7
-rw-r--r--test/912-classes/src-ex/A.java18
-rw-r--r--test/912-classes/src/B.java18
-rw-r--r--test/912-classes/src/Main.java126
-rw-r--r--test/916-obsolete-jit/src/Main.java35
-rw-r--r--test/921-hello-failure/expected.txt16
-rw-r--r--test/921-hello-failure/src/CommonClassDefinition.java27
-rw-r--r--test/921-hello-failure/src/Main.java35
-rw-r--r--test/921-hello-failure/src/MultiRedef.java100
-rw-r--r--test/921-hello-failure/src/MultiRetrans.java108
-rw-r--r--test/924-threads/expected.txt3
-rw-r--r--test/924-threads/src/Main.java82
-rw-r--r--test/924-threads/threads.cc37
-rwxr-xr-xtest/925-threadgroups/build (renamed from test/956-methodhandles/run)5
-rw-r--r--test/925-threadgroups/expected.txt16
-rw-r--r--test/925-threadgroups/info.txt1
-rwxr-xr-xtest/925-threadgroups/run19
-rw-r--r--test/925-threadgroups/src/Main.java113
-rw-r--r--test/925-threadgroups/threadgroups.cc127
-rwxr-xr-xtest/926-multi-obsolescence/build (renamed from test/957-methodhandle-transforms/run)5
-rw-r--r--test/926-multi-obsolescence/expected.txt15
-rw-r--r--test/926-multi-obsolescence/info.txt2
-rwxr-xr-xtest/926-multi-obsolescence/run19
-rw-r--r--test/926-multi-obsolescence/src/CommonClassDefinition.java27
-rw-r--r--test/926-multi-obsolescence/src/Main.java128
-rw-r--r--test/926-multi-obsolescence/src/Transform.java30
-rw-r--r--test/926-multi-obsolescence/src/Transform2.java23
-rwxr-xr-xtest/927-timers/build (renamed from test/954-invoke-polymorphic-verifier/run)5
-rw-r--r--test/927-timers/expected.txt3
-rw-r--r--test/927-timers/info.txt1
-rwxr-xr-xtest/927-timers/run19
-rw-r--r--test/927-timers/src/Main.java62
-rw-r--r--test/927-timers/timers.cc84
-rwxr-xr-xtest/928-jni-table/build (renamed from test/955-methodhandles-smali/run)5
-rw-r--r--test/928-jni-table/expected.txt1
-rw-r--r--test/928-jni-table/info.txt1
-rw-r--r--test/928-jni-table/jni_table.cc89
-rwxr-xr-xtest/928-jni-table/run19
-rw-r--r--test/928-jni-table/src/Main.java27
-rwxr-xr-xtest/929-search/build17
-rw-r--r--test/929-search/expected.txt1
-rw-r--r--test/929-search/info.txt1
-rwxr-xr-xtest/929-search/run23
-rw-r--r--test/929-search/search.cc53
-rw-r--r--test/929-search/src-ex/A.java18
-rw-r--r--test/929-search/src/B.java18
-rw-r--r--test/929-search/src/Main.java54
-rwxr-xr-xtest/930-hello-retransform/build17
-rw-r--r--test/930-hello-retransform/expected.txt2
-rw-r--r--test/930-hello-retransform/info.txt1
-rwxr-xr-xtest/930-hello-retransform/run19
-rw-r--r--test/930-hello-retransform/src/Main.java70
-rw-r--r--test/930-hello-retransform/src/Transform.java28
-rw-r--r--test/931-agent-thread/agent_thread.cc132
-rwxr-xr-xtest/931-agent-thread/build17
-rw-r--r--test/931-agent-thread/expected.txt1
-rw-r--r--test/931-agent-thread/info.txt1
-rwxr-xr-xtest/931-agent-thread/run23
-rw-r--r--test/931-agent-thread/src/Main.java29
-rwxr-xr-xtest/932-transform-saves/build17
-rw-r--r--test/932-transform-saves/expected.txt3
-rw-r--r--test/932-transform-saves/info.txt1
-rwxr-xr-xtest/932-transform-saves/run19
-rw-r--r--test/932-transform-saves/src/Main.java116
-rw-r--r--test/932-transform-saves/src/Transform.java28
-rwxr-xr-xtest/953-invoke-polymorphic-compiler/build25
-rw-r--r--test/953-invoke-polymorphic-compiler/expected.txt25
-rw-r--r--test/953-invoke-polymorphic-compiler/info.txt3
-rw-r--r--test/953-invoke-polymorphic-compiler/src/Main.java374
-rw-r--r--test/956-methodhandles/src/Main.java20
-rw-r--r--test/957-methodhandle-transforms/src/Main.java136
-rwxr-xr-xtest/958-methodhandle-emulated-stackframe/run20
-rw-r--r--test/959-invoke-polymorphic-accessors/run20
-rw-r--r--test/Android.bp5
-rw-r--r--test/Android.run-test.mk22
-rw-r--r--test/XandY/Y.java6
-rw-r--r--test/common/runtime_state.cc17
-rwxr-xr-xtest/etc/run-test-jar54
-rwxr-xr-xtest/run-test9
-rw-r--r--test/ti-agent/common_helper.cc263
-rw-r--r--test/ti-agent/common_helper.h4
-rw-r--r--test/ti-agent/common_load.cc5
-rw-r--r--test/valgrind-suppressions.txt47
-rw-r--r--tools/cpp-define-generator/offset_dexcache.def1
-rw-r--r--tools/dexfuzz/src/dexfuzz/Options.java9
-rw-r--r--tools/dexfuzz/src/dexfuzz/fuzzers/Fuzzer.java4
320 files changed, 12460 insertions, 4061 deletions
diff --git a/build/Android.common_build.mk b/build/Android.common_build.mk
index 4c82506516..f5a95fa0cf 100644
--- a/build/Android.common_build.mk
+++ b/build/Android.common_build.mk
@@ -46,6 +46,9 @@ ifeq ($(ART_BUILD_HOST_DEBUG),false)
$(info Disabling ART_BUILD_HOST_DEBUG)
endif
+# Enable the read barrier by default.
+ART_USE_READ_BARRIER ?= true
+
ART_CPP_EXTENSION := .cc
ifndef LIBART_IMG_HOST_BASE_ADDRESS
diff --git a/build/Android.gtest.mk b/build/Android.gtest.mk
index 5bdfbc74eb..d8b780ac35 100644
--- a/build/Android.gtest.mk
+++ b/build/Android.gtest.mk
@@ -107,6 +107,7 @@ ART_GTEST_proxy_test_DEX_DEPS := Interfaces
ART_GTEST_reflection_test_DEX_DEPS := Main NonStaticLeafMethods StaticLeafMethods
ART_GTEST_profile_assistant_test_DEX_DEPS := ProfileTestMultiDex
ART_GTEST_profile_compilation_info_test_DEX_DEPS := ProfileTestMultiDex
+ART_GTEST_runtime_callbacks_test_DEX_DEPS := XandY
ART_GTEST_stub_test_DEX_DEPS := AllFields
ART_GTEST_transaction_test_DEX_DEPS := Transaction
ART_GTEST_type_lookup_table_test_DEX_DEPS := Lookup
@@ -120,14 +121,14 @@ ART_GTEST_elf_writer_test_TARGET_DEPS := $(TARGET_CORE_IMAGE_optimizing_no-pic_6
ART_GTEST_dex2oat_environment_tests_HOST_DEPS := \
$(HOST_CORE_IMAGE_optimizing_pic_64) \
$(HOST_CORE_IMAGE_optimizing_pic_32) \
- $(HOST_CORE_IMAGE_optimizing_no-pic_64) \
- $(HOST_CORE_IMAGE_optimizing_no-pic_32) \
+ $(HOST_CORE_IMAGE_interpreter_pic_64) \
+ $(HOST_CORE_IMAGE_interpreter_pic_32) \
$(HOST_OUT_EXECUTABLES)/patchoatd
ART_GTEST_dex2oat_environment_tests_TARGET_DEPS := \
$(TARGET_CORE_IMAGE_optimizing_pic_64) \
$(TARGET_CORE_IMAGE_optimizing_pic_32) \
- $(TARGET_CORE_IMAGE_optimizing_no-pic_64) \
- $(TARGET_CORE_IMAGE_optimizing_no-pic_32) \
+ $(TARGET_CORE_IMAGE_interpreter_pic_64) \
+ $(TARGET_CORE_IMAGE_interpreter_pic_32) \
$(TARGET_OUT_EXECUTABLES)/patchoatd
ART_GTEST_oat_file_assistant_test_HOST_DEPS := \
diff --git a/build/art.go b/build/art.go
index e6e0544e4d..84269c3f23 100644
--- a/build/art.go
+++ b/build/art.go
@@ -58,7 +58,7 @@ func globalFlags(ctx android.BaseContext) ([]string, []string) {
asflags = append(asflags, "-DART_HEAP_POISONING=1")
}
- if envTrue(ctx, "ART_USE_READ_BARRIER") || ctx.AConfig().ArtUseReadBarrier() {
+ if !envFalse(ctx, "ART_USE_READ_BARRIER") || ctx.AConfig().ArtUseReadBarrier() {
// Used to change the read barrier type. Valid values are BAKER, BROOKS, TABLELOOKUP.
// The default is BAKER.
barrierType := envDefault(ctx, "ART_READ_BARRIER_TYPE", "BAKER")
diff --git a/cmdline/cmdline_types.h b/cmdline/cmdline_types.h
index e41d9bde59..28c009edf0 100644
--- a/cmdline/cmdline_types.h
+++ b/cmdline/cmdline_types.h
@@ -770,8 +770,6 @@ struct CmdlineType<ExperimentalFlags> : CmdlineTypeParser<ExperimentalFlags> {
existing = existing | ExperimentalFlags::kAgents;
} else if (option == "runtime-plugins") {
existing = existing | ExperimentalFlags::kRuntimePlugins;
- } else if (option == "method-handles") {
- existing = existing | ExperimentalFlags::kMethodHandles;
} else {
return Result::Failure(std::string("Unknown option '") + option + "'");
}
diff --git a/compiler/common_compiler_test.h b/compiler/common_compiler_test.h
index f4838c1119..0d45a50053 100644
--- a/compiler/common_compiler_test.h
+++ b/compiler/common_compiler_test.h
@@ -23,7 +23,7 @@
#include "common_runtime_test.h"
#include "compiler.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
#include "oat_file.h"
namespace art {
diff --git a/compiler/compiled_method.h b/compiler/compiled_method.h
index bbf9eee0e5..e2a0942724 100644
--- a/compiler/compiled_method.h
+++ b/compiler/compiled_method.h
@@ -176,6 +176,7 @@ class LinkerPatch {
kCallRelative, // NOTE: Actual patching is instruction_set-dependent.
kType,
kTypeRelative, // NOTE: Actual patching is instruction_set-dependent.
+ kTypeBssEntry, // NOTE: Actual patching is instruction_set-dependent.
kString,
kStringRelative, // NOTE: Actual patching is instruction_set-dependent.
kStringBssEntry, // NOTE: Actual patching is instruction_set-dependent.
@@ -228,6 +229,16 @@ class LinkerPatch {
return patch;
}
+ static LinkerPatch TypeBssEntryPatch(size_t literal_offset,
+ const DexFile* target_dex_file,
+ uint32_t pc_insn_offset,
+ uint32_t target_type_idx) {
+ LinkerPatch patch(literal_offset, Type::kTypeBssEntry, target_dex_file);
+ patch.type_idx_ = target_type_idx;
+ patch.pc_insn_offset_ = pc_insn_offset;
+ return patch;
+ }
+
static LinkerPatch StringPatch(size_t literal_offset,
const DexFile* target_dex_file,
uint32_t target_string_idx) {
@@ -282,6 +293,7 @@ class LinkerPatch {
switch (GetType()) {
case Type::kCallRelative:
case Type::kTypeRelative:
+ case Type::kTypeBssEntry:
case Type::kStringRelative:
case Type::kStringBssEntry:
case Type::kDexCacheArray:
@@ -299,12 +311,16 @@ class LinkerPatch {
}
const DexFile* TargetTypeDexFile() const {
- DCHECK(patch_type_ == Type::kType || patch_type_ == Type::kTypeRelative);
+ DCHECK(patch_type_ == Type::kType ||
+ patch_type_ == Type::kTypeRelative ||
+ patch_type_ == Type::kTypeBssEntry);
return target_dex_file_;
}
dex::TypeIndex TargetTypeIndex() const {
- DCHECK(patch_type_ == Type::kType || patch_type_ == Type::kTypeRelative);
+ DCHECK(patch_type_ == Type::kType ||
+ patch_type_ == Type::kTypeRelative ||
+ patch_type_ == Type::kTypeBssEntry);
return dex::TypeIndex(type_idx_);
}
@@ -334,6 +350,7 @@ class LinkerPatch {
uint32_t PcInsnOffset() const {
DCHECK(patch_type_ == Type::kTypeRelative ||
+ patch_type_ == Type::kTypeBssEntry ||
patch_type_ == Type::kStringRelative ||
patch_type_ == Type::kStringBssEntry ||
patch_type_ == Type::kDexCacheArray);
diff --git a/compiler/driver/compiler_driver.cc b/compiler/driver/compiler_driver.cc
index 29502666ad..faf8b41be1 100644
--- a/compiler/driver/compiler_driver.cc
+++ b/compiler/driver/compiler_driver.cc
@@ -1060,13 +1060,13 @@ class ResolveCatchBlockExceptionsClassVisitor : public ClassVisitor {
virtual bool operator()(ObjPtr<mirror::Class> c) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_) {
const auto pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
for (auto& m : c->GetMethods(pointer_size)) {
- ResolveExceptionsForMethod(&m, pointer_size);
+ ResolveExceptionsForMethod(&m);
}
return true;
}
private:
- void ResolveExceptionsForMethod(ArtMethod* method_handle, PointerSize pointer_size)
+ void ResolveExceptionsForMethod(ArtMethod* method_handle)
REQUIRES_SHARED(Locks::mutator_lock_) {
const DexFile::CodeItem* code_item = method_handle->GetCodeItem();
if (code_item == nullptr) {
@@ -1088,8 +1088,7 @@ class ResolveCatchBlockExceptionsClassVisitor : public ClassVisitor {
dex::TypeIndex encoded_catch_handler_handlers_type_idx =
dex::TypeIndex(DecodeUnsignedLeb128(&encoded_catch_handler_list));
// Add to set of types to resolve if not already in the dex cache resolved types
- if (!method_handle->IsResolvedTypeIdx(encoded_catch_handler_handlers_type_idx,
- pointer_size)) {
+ if (!method_handle->IsResolvedTypeIdx(encoded_catch_handler_handlers_type_idx)) {
exceptions_to_resolve_.emplace(encoded_catch_handler_handlers_type_idx,
method_handle->GetDexFile());
}
@@ -1950,66 +1949,82 @@ static void PopulateVerifiedMethods(const DexFile& dex_file,
DCHECK(!it.HasNext());
}
-void CompilerDriver::Verify(jobject jclass_loader,
- const std::vector<const DexFile*>& dex_files,
- TimingLogger* timings) {
+bool CompilerDriver::FastVerify(jobject jclass_loader,
+ const std::vector<const DexFile*>& dex_files,
+ TimingLogger* timings) {
verifier::VerifierDeps* verifier_deps =
Runtime::Current()->GetCompilerCallbacks()->GetVerifierDeps();
// If there is an existing `VerifierDeps`, try to use it for fast verification.
- if (verifier_deps != nullptr) {
- TimingLogger::ScopedTiming t("Fast Verify", timings);
- ScopedObjectAccess soa(Thread::Current());
- StackHandleScope<2> hs(soa.Self());
- Handle<mirror::ClassLoader> class_loader(
- hs.NewHandle(soa.Decode<mirror::ClassLoader>(jclass_loader)));
- MutableHandle<mirror::Class> cls(hs.NewHandle<mirror::Class>(nullptr));
- ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
- if (verifier_deps->ValidateDependencies(class_loader, soa.Self())) {
- // We successfully validated the dependencies, now update class status
- // of verified classes. Note that the dependencies also record which classes
- // could not be fully verified; we could try again, but that would hurt verification
- // time. So instead we assume these classes still need to be verified at
- // runtime.
- for (const DexFile* dex_file : dex_files) {
- // Fetch the list of unverified classes and turn it into a set for faster
- // lookups.
- const std::vector<dex::TypeIndex>& unverified_classes =
- verifier_deps->GetUnverifiedClasses(*dex_file);
- std::set<dex::TypeIndex> set(unverified_classes.begin(), unverified_classes.end());
- for (uint32_t i = 0; i < dex_file->NumClassDefs(); ++i) {
- const DexFile::ClassDef& class_def = dex_file->GetClassDef(i);
- if (set.find(class_def.class_idx_) == set.end()) {
- if (!GetCompilerOptions().IsAnyMethodCompilationEnabled()) {
- // Just update the compiled_classes_ map. The compiler doesn't need to resolve
- // the type.
- compiled_classes_.Overwrite(
- ClassReference(dex_file, i), new CompiledClass(mirror::Class::kStatusVerified));
- } else {
- // Resolve the type, so later compilation stages know they don't need to verify
- // the class.
- const char* descriptor = dex_file->GetClassDescriptor(class_def);
- cls.Assign(class_linker->FindClass(soa.Self(), descriptor, class_loader));
- if (cls.Get() != nullptr) {
- ObjectLock<mirror::Class> lock(soa.Self(), cls);
- mirror::Class::SetStatus(cls, mirror::Class::kStatusVerified, soa.Self());
- } else {
- DCHECK(soa.Self()->IsExceptionPending());
- soa.Self()->ClearException();
- }
- // Create `VerifiedMethod`s for each methods, the compiler expects one for
- // quickening or compiling.
- // Note that this means:
- // - We're only going to compile methods that did verify.
- // - Quickening will not do checkcast ellision.
- // TODO(ngeoffray): Reconsider this once we refactor compiler filters.
- PopulateVerifiedMethods(*dex_file, i, verification_results_);
+ if (verifier_deps == nullptr) {
+ return false;
+ }
+ TimingLogger::ScopedTiming t("Fast Verify", timings);
+ ScopedObjectAccess soa(Thread::Current());
+ StackHandleScope<2> hs(soa.Self());
+ Handle<mirror::ClassLoader> class_loader(
+ hs.NewHandle(soa.Decode<mirror::ClassLoader>(jclass_loader)));
+ MutableHandle<mirror::Class> cls(hs.NewHandle<mirror::Class>(nullptr));
+ ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
+ if (!verifier_deps->ValidateDependencies(class_loader, soa.Self())) {
+ return false;
+ }
+
+ // We successfully validated the dependencies, now update class status
+ // of verified classes. Note that the dependencies also record which classes
+ // could not be fully verified; we could try again, but that would hurt verification
+ // time. So instead we assume these classes still need to be verified at
+ // runtime.
+ for (const DexFile* dex_file : dex_files) {
+ // Fetch the list of unverified classes and turn it into a set for faster
+ // lookups.
+ const std::vector<dex::TypeIndex>& unverified_classes =
+ verifier_deps->GetUnverifiedClasses(*dex_file);
+ std::set<dex::TypeIndex> set(unverified_classes.begin(), unverified_classes.end());
+ for (uint32_t i = 0; i < dex_file->NumClassDefs(); ++i) {
+ const DexFile::ClassDef& class_def = dex_file->GetClassDef(i);
+ if (set.find(class_def.class_idx_) == set.end()) {
+ if (!GetCompilerOptions().IsAnyMethodCompilationEnabled()) {
+ // Just update the compiled_classes_ map. The compiler doesn't need to resolve
+ // the type.
+ compiled_classes_.Overwrite(
+ ClassReference(dex_file, i), new CompiledClass(mirror::Class::kStatusVerified));
+ } else {
+ // Resolve the type, so later compilation stages know they don't need to verify
+ // the class.
+ const char* descriptor = dex_file->GetClassDescriptor(class_def);
+ cls.Assign(class_linker->FindClass(soa.Self(), descriptor, class_loader));
+ if (cls.Get() != nullptr) {
+ // Check that the class is resolved with the current dex file. We might get
+ // a boot image class, or a class in a different dex file for multidex, and
+ // we should not update the status in that case.
+ if (&cls->GetDexFile() == dex_file) {
+ ObjectLock<mirror::Class> lock(soa.Self(), cls);
+ mirror::Class::SetStatus(cls, mirror::Class::kStatusVerified, soa.Self());
}
+ } else {
+ DCHECK(soa.Self()->IsExceptionPending());
+ soa.Self()->ClearException();
}
+ // Create `VerifiedMethod`s for each methods, the compiler expects one for
+ // quickening or compiling.
+ // Note that this means:
+ // - We're only going to compile methods that did verify.
+ // - Quickening will not do checkcast ellision.
+ // TODO(ngeoffray): Reconsider this once we refactor compiler filters.
+ PopulateVerifiedMethods(*dex_file, i, verification_results_);
}
}
- return;
}
}
+ return true;
+}
+
+void CompilerDriver::Verify(jobject jclass_loader,
+ const std::vector<const DexFile*>& dex_files,
+ TimingLogger* timings) {
+ if (FastVerify(jclass_loader, dex_files, timings)) {
+ return;
+ }
// If there is no existing `verifier_deps` (because of non-existing vdex), or
// the existing `verifier_deps` is not valid anymore, create a new one for
@@ -2017,7 +2032,7 @@ void CompilerDriver::Verify(jobject jclass_loader,
// Then dex2oat can update the vdex file with these new dependencies.
if (!GetCompilerOptions().IsBootImage()) {
// Create the main VerifierDeps, and set it to this thread.
- verifier_deps = new verifier::VerifierDeps(dex_files);
+ verifier::VerifierDeps* verifier_deps = new verifier::VerifierDeps(dex_files);
Runtime::Current()->GetCompilerCallbacks()->SetVerifierDeps(verifier_deps);
Thread::Current()->SetVerifierDeps(verifier_deps);
// Create per-thread VerifierDeps to avoid contention on the main one.
@@ -2026,6 +2041,7 @@ void CompilerDriver::Verify(jobject jclass_loader,
worker->GetThread()->SetVerifierDeps(new verifier::VerifierDeps(dex_files));
}
}
+
// Note: verification should not be pulling in classes anymore when compiling the boot image,
// as all should have been resolved before. As such, doing this in parallel should still
// be deterministic.
@@ -2041,6 +2057,7 @@ void CompilerDriver::Verify(jobject jclass_loader,
if (!GetCompilerOptions().IsBootImage()) {
// Merge all VerifierDeps into the main one.
+ verifier::VerifierDeps* verifier_deps = Thread::Current()->GetVerifierDeps();
for (ThreadPoolWorker* worker : parallel_thread_pool_->GetWorkers()) {
verifier::VerifierDeps* thread_deps = worker->GetThread()->GetVerifierDeps();
worker->GetThread()->SetVerifierDeps(nullptr);
@@ -2061,7 +2078,10 @@ class VerifyClassVisitor : public CompilationVisitor {
ScopedObjectAccess soa(Thread::Current());
const DexFile& dex_file = *manager_->GetDexFile();
if (!manager_->GetCompiler()->ShouldVerifyClassBasedOnProfile(dex_file, class_def_index)) {
- // Skip verification since the class is not in the profile.
+ // Skip verification since the class is not in the profile, and let the VerifierDeps know
+ // that the class will need to be verified at runtime.
+ verifier::VerifierDeps::MaybeRecordVerificationStatus(
+ dex_file, dex::TypeIndex(class_def_index), verifier::MethodVerifier::kSoftFailure);
return;
}
const DexFile::ClassDef& class_def = dex_file.GetClassDef(class_def_index);
diff --git a/compiler/driver/compiler_driver.h b/compiler/driver/compiler_driver.h
index 2e3b7c8eb5..503fe3adfc 100644
--- a/compiler/driver/compiler_driver.h
+++ b/compiler/driver/compiler_driver.h
@@ -33,7 +33,7 @@
#include "dex_file.h"
#include "dex_file_types.h"
#include "driver/compiled_method_storage.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
#include "invoke_type.h"
#include "method_reference.h"
#include "mirror/class.h" // For mirror::Class::Status.
@@ -433,12 +433,18 @@ class CompilerDriver {
TimingLogger* timings)
REQUIRES(!Locks::mutator_lock_);
+ // Do fast verification through VerifierDeps if possible. Return whether
+ // verification was successful.
// NO_THREAD_SAFETY_ANALYSIS as the method accesses a guarded value in a
// single-threaded way.
+ bool FastVerify(jobject class_loader,
+ const std::vector<const DexFile*>& dex_files,
+ TimingLogger* timings)
+ NO_THREAD_SAFETY_ANALYSIS;
+
void Verify(jobject class_loader,
const std::vector<const DexFile*>& dex_files,
- TimingLogger* timings)
- NO_THREAD_SAFETY_ANALYSIS;
+ TimingLogger* timings);
void VerifyDexFile(jobject class_loader,
const DexFile& dex_file,
diff --git a/compiler/driver/compiler_driver_test.cc b/compiler/driver/compiler_driver_test.cc
index 12684c09c0..1e4ca16844 100644
--- a/compiler/driver/compiler_driver_test.cc
+++ b/compiler/driver/compiler_driver_test.cc
@@ -32,7 +32,7 @@
#include "mirror/object_array-inl.h"
#include "mirror/object-inl.h"
#include "handle_scope-inl.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
#include "scoped_thread_state_change-inl.h"
namespace art {
diff --git a/compiler/image_writer.cc b/compiler/image_writer.cc
index 9c38445276..4109345f80 100644
--- a/compiler/image_writer.cc
+++ b/compiler/image_writer.cc
@@ -2346,8 +2346,6 @@ void ImageWriter::CopyAndFixupMethod(ArtMethod* orig,
copy->SetDeclaringClass(GetImageAddress(orig->GetDeclaringClassUnchecked()));
ArtMethod** orig_resolved_methods = orig->GetDexCacheResolvedMethods(target_ptr_size_);
copy->SetDexCacheResolvedMethods(NativeLocationInImage(orig_resolved_methods), target_ptr_size_);
- GcRoot<mirror::Class>* orig_resolved_types = orig->GetDexCacheResolvedTypes(target_ptr_size_);
- copy->SetDexCacheResolvedTypes(NativeLocationInImage(orig_resolved_types), target_ptr_size_);
// OatWriter replaces the code_ with an offset value. Here we re-adjust to a pointer relative to
// oat_begin_
diff --git a/compiler/linker/arm64/relative_patcher_arm64.cc b/compiler/linker/arm64/relative_patcher_arm64.cc
index 4a9de7f3d1..79e1785e91 100644
--- a/compiler/linker/arm64/relative_patcher_arm64.cc
+++ b/compiler/linker/arm64/relative_patcher_arm64.cc
@@ -224,6 +224,7 @@ void Arm64RelativePatcher::PatchPcRelativeReference(std::vector<uint8_t>* code,
} else {
// LDR/STR 32-bit or 64-bit with imm12 == 0 (unset).
DCHECK(patch.GetType() == LinkerPatch::Type::kDexCacheArray ||
+ patch.GetType() == LinkerPatch::Type::kTypeBssEntry ||
patch.GetType() == LinkerPatch::Type::kStringBssEntry) << patch.GetType();
DCHECK_EQ(insn & 0xbfbffc00, 0xb9000000) << std::hex << insn;
}
diff --git a/compiler/oat_test.cc b/compiler/oat_test.cc
index 4180e0e6c9..34b33a13a3 100644
--- a/compiler/oat_test.cc
+++ b/compiler/oat_test.cc
@@ -487,7 +487,7 @@ TEST_F(OatTest, OatHeaderSizeCheck) {
EXPECT_EQ(72U, sizeof(OatHeader));
EXPECT_EQ(4U, sizeof(OatMethodOffsets));
EXPECT_EQ(20U, sizeof(OatQuickMethodHeader));
- EXPECT_EQ(163 * static_cast<size_t>(GetInstructionSetPointerSize(kRuntimeISA)),
+ EXPECT_EQ(157 * static_cast<size_t>(GetInstructionSetPointerSize(kRuntimeISA)),
sizeof(QuickEntryPoints));
}
diff --git a/compiler/oat_writer.cc b/compiler/oat_writer.cc
index a9da09c82c..de5af97b9a 100644
--- a/compiler/oat_writer.cc
+++ b/compiler/oat_writer.cc
@@ -296,6 +296,7 @@ OatWriter::OatWriter(bool compiling_boot_image, TimingLogger* timings, ProfileCo
bss_start_(0u),
bss_size_(0u),
bss_roots_offset_(0u),
+ bss_type_entries_(),
bss_string_entries_(),
oat_data_offset_(0u),
oat_header_(nullptr),
@@ -585,7 +586,7 @@ void OatWriter::PrepareLayout(linker::MultiOatRelativePatcher* relative_patcher)
}
oat_size_ = offset;
- if (!HasBootImage()) {
+ {
TimingLogger::ScopedTiming split("InitBssLayout", timings_);
InitBssLayout(instruction_set);
}
@@ -847,6 +848,10 @@ class OatWriter::InitCodeMethodVisitor : public OatDexMethodVisitor {
if (!patch.IsPcRelative()) {
writer_->absolute_patch_locations_.push_back(base_loc + patch.LiteralOffset());
}
+ if (patch.GetType() == LinkerPatch::Type::kTypeBssEntry) {
+ TypeReference ref(patch.TargetTypeDexFile(), patch.TargetTypeIndex());
+ writer_->bss_type_entries_.Overwrite(ref, /* placeholder */ 0u);
+ }
if (patch.GetType() == LinkerPatch::Type::kStringBssEntry) {
StringReference ref(patch.TargetStringDexFile(), patch.TargetStringIndex());
writer_->bss_string_entries_.Overwrite(ref, /* placeholder */ 0u);
@@ -1185,6 +1190,15 @@ class OatWriter::WriteCodeMethodVisitor : public OatDexMethodVisitor {
target_offset);
break;
}
+ case LinkerPatch::Type::kTypeBssEntry: {
+ TypeReference ref(patch.TargetTypeDexFile(), patch.TargetTypeIndex());
+ uint32_t target_offset = writer_->bss_type_entries_.Get(ref);
+ writer_->relative_patcher_->PatchPcRelativeReference(&patched_code_,
+ patch,
+ offset_ + literal_offset,
+ target_offset);
+ break;
+ }
case LinkerPatch::Type::kCall: {
uint32_t target_offset = GetTargetOffset(patch);
PatchCodeAddress(&patched_code_, literal_offset, target_offset);
@@ -1619,20 +1633,34 @@ size_t OatWriter::InitOatCodeDexFiles(size_t offset) {
}
void OatWriter::InitBssLayout(InstructionSet instruction_set) {
- DCHECK(!HasBootImage());
+ if (HasBootImage()) {
+ DCHECK(bss_string_entries_.empty());
+ if (bss_type_entries_.empty()) {
+ // Nothing to put to the .bss section.
+ return;
+ }
+ }
// Allocate space for app dex cache arrays in the .bss section.
bss_start_ = RoundUp(oat_size_, kPageSize);
- PointerSize pointer_size = GetInstructionSetPointerSize(instruction_set);
bss_size_ = 0u;
- for (const DexFile* dex_file : *dex_files_) {
- dex_cache_arrays_offsets_.Put(dex_file, bss_start_ + bss_size_);
- DexCacheArraysLayout layout(pointer_size, dex_file);
- bss_size_ += layout.Size();
+ if (!HasBootImage()) {
+ PointerSize pointer_size = GetInstructionSetPointerSize(instruction_set);
+ for (const DexFile* dex_file : *dex_files_) {
+ dex_cache_arrays_offsets_.Put(dex_file, bss_start_ + bss_size_);
+ DexCacheArraysLayout layout(pointer_size, dex_file);
+ bss_size_ += layout.Size();
+ }
}
bss_roots_offset_ = bss_size_;
+ // Prepare offsets for .bss Class entries.
+ for (auto& entry : bss_type_entries_) {
+ DCHECK_EQ(entry.second, 0u);
+ entry.second = bss_start_ + bss_size_;
+ bss_size_ += sizeof(GcRoot<mirror::Class>);
+ }
// Prepare offsets for .bss String entries.
for (auto& entry : bss_string_entries_) {
DCHECK_EQ(entry.second, 0u);
diff --git a/compiler/oat_writer.h b/compiler/oat_writer.h
index 8d087f4f91..db84166ad3 100644
--- a/compiler/oat_writer.h
+++ b/compiler/oat_writer.h
@@ -31,6 +31,7 @@
#include "os.h"
#include "safe_map.h"
#include "string_reference.h"
+#include "utils/type_reference.h"
namespace art {
@@ -372,6 +373,11 @@ class OatWriter {
// The offset of the GC roots in .bss section.
size_t bss_roots_offset_;
+ // Map for allocating Class entries in .bss. Indexed by TypeReference for the source
+ // type in the dex file with the "type value comparator" for deduplication. The value
+ // is the target offset for patching, starting at `bss_start_ + bss_roots_offset_`.
+ SafeMap<TypeReference, size_t, TypeReferenceValueComparator> bss_type_entries_;
+
// Map for allocating String entries in .bss. Indexed by StringReference for the source
// string in the dex file with the "string value comparator" for deduplication. The value
// is the target offset for patching, starting at `bss_start_ + bss_roots_offset_`.
diff --git a/compiler/optimizing/bounds_check_elimination.cc b/compiler/optimizing/bounds_check_elimination.cc
index 7dc094b25f..2ee4db923a 100644
--- a/compiler/optimizing/bounds_check_elimination.cc
+++ b/compiler/optimizing/bounds_check_elimination.cc
@@ -153,21 +153,6 @@ class ValueBound : public ValueObject {
return instruction_ == bound.instruction_ && constant_ == bound.constant_;
}
- /*
- * Hunt "under the hood" of array lengths (leading to array references),
- * null checks (also leading to array references), and new arrays
- * (leading to the actual length). This makes it more likely related
- * instructions become actually comparable.
- */
- static HInstruction* HuntForDeclaration(HInstruction* instruction) {
- while (instruction->IsArrayLength() ||
- instruction->IsNullCheck() ||
- instruction->IsNewArray()) {
- instruction = instruction->InputAt(0);
- }
- return instruction;
- }
-
static bool Equal(HInstruction* instruction1, HInstruction* instruction2) {
if (instruction1 == instruction2) {
return true;
@@ -1136,7 +1121,7 @@ class BCEVisitor : public HGraphVisitor {
}
void VisitNewArray(HNewArray* new_array) OVERRIDE {
- HInstruction* len = new_array->InputAt(0);
+ HInstruction* len = new_array->GetLength();
if (!len->IsIntConstant()) {
HInstruction *left;
int32_t right_const;
@@ -1324,7 +1309,7 @@ class BCEVisitor : public HGraphVisitor {
InductionVarRange::Value v2;
bool needs_finite_test = false;
HInstruction* index = context->InputAt(0);
- HInstruction* hint = ValueBound::HuntForDeclaration(context->InputAt(1));
+ HInstruction* hint = HuntForDeclaration(context->InputAt(1));
if (induction_range_.GetInductionRange(context, index, hint, &v1, &v2, &needs_finite_test)) {
if (v1.is_known && (v1.a_constant == 0 || v1.a_constant == 1) &&
v2.is_known && (v2.a_constant == 0 || v2.a_constant == 1)) {
diff --git a/compiler/optimizing/bounds_check_elimination_test.cc b/compiler/optimizing/bounds_check_elimination_test.cc
index dfa150406d..5d58207511 100644
--- a/compiler/optimizing/bounds_check_elimination_test.cc
+++ b/compiler/optimizing/bounds_check_elimination_test.cc
@@ -596,13 +596,11 @@ static HInstruction* BuildSSAGraph3(HGraph* graph,
HBasicBlock* block = new (allocator) HBasicBlock(graph);
graph->AddBlock(block);
entry->AddSuccessor(block);
+ // We pass a bogus constant for the class to avoid mocking one.
HInstruction* new_array = new (allocator) HNewArray(
constant_10,
- graph->GetCurrentMethod(),
- 0,
- dex::TypeIndex(static_cast<uint16_t>(Primitive::kPrimInt)),
- graph->GetDexFile(),
- kQuickAllocArray);
+ constant_10,
+ 0);
block->AddInstruction(new_array);
block->AddInstruction(new (allocator) HGoto());
diff --git a/compiler/optimizing/builder.h b/compiler/optimizing/builder.h
index f896f1199e..8cf4089eba 100644
--- a/compiler/optimizing/builder.h
+++ b/compiler/optimizing/builder.h
@@ -63,7 +63,8 @@ class HGraphBuilder : public ValueObject {
driver,
interpreter_metadata,
compiler_stats,
- dex_cache) {}
+ dex_cache,
+ handles) {}
// Only for unit testing.
HGraphBuilder(HGraph* graph,
@@ -90,7 +91,8 @@ class HGraphBuilder : public ValueObject {
/* compiler_driver */ nullptr,
/* interpreter_metadata */ nullptr,
/* compiler_stats */ nullptr,
- null_dex_cache_) {}
+ null_dex_cache_,
+ handles) {}
GraphAnalysisResult BuildGraph();
diff --git a/compiler/optimizing/code_generator.cc b/compiler/optimizing/code_generator.cc
index f00648f570..70c2738010 100644
--- a/compiler/optimizing/code_generator.cc
+++ b/compiler/optimizing/code_generator.cc
@@ -367,6 +367,12 @@ void CodeGenerator::GenerateInvokeUnresolvedRuntimeCall(HInvokeUnresolved* invok
InvokeRuntime(entrypoint, invoke, invoke->GetDexPc(), nullptr);
}
+void CodeGenerator::GenerateInvokePolymorphicCall(HInvokePolymorphic* invoke) {
+ MoveConstant(invoke->GetLocations()->GetTemp(0), static_cast<int32_t>(invoke->GetType()));
+ QuickEntrypointEnum entrypoint = kQuickInvokePolymorphic;
+ InvokeRuntime(entrypoint, invoke, invoke->GetDexPc(), nullptr);
+}
+
void CodeGenerator::CreateUnresolvedFieldLocationSummary(
HInstruction* field_access,
Primitive::Type field_type,
@@ -491,31 +497,34 @@ void CodeGenerator::GenerateUnresolvedFieldAccess(
}
}
-// TODO: Remove argument `code_generator_supports_read_barrier` when
-// all code generators have read barrier support.
-void CodeGenerator::CreateLoadClassLocationSummary(HLoadClass* cls,
- Location runtime_type_index_location,
- Location runtime_return_location,
- bool code_generator_supports_read_barrier) {
- ArenaAllocator* allocator = cls->GetBlock()->GetGraph()->GetArena();
- LocationSummary::CallKind call_kind = cls->NeedsAccessCheck()
- ? LocationSummary::kCallOnMainOnly
- : (((code_generator_supports_read_barrier && kEmitCompilerReadBarrier) ||
- cls->CanCallRuntime())
- ? LocationSummary::kCallOnSlowPath
- : LocationSummary::kNoCall);
- LocationSummary* locations = new (allocator) LocationSummary(cls, call_kind);
+void CodeGenerator::CreateLoadClassRuntimeCallLocationSummary(HLoadClass* cls,
+ Location runtime_type_index_location,
+ Location runtime_return_location) {
+ DCHECK_EQ(cls->GetLoadKind(), HLoadClass::LoadKind::kDexCacheViaMethod);
+ DCHECK_EQ(cls->InputCount(), 1u);
+ LocationSummary* locations = new (cls->GetBlock()->GetGraph()->GetArena()) LocationSummary(
+ cls, LocationSummary::kCallOnMainOnly);
+ locations->SetInAt(0, Location::NoLocation());
+ locations->AddTemp(runtime_type_index_location);
+ locations->SetOut(runtime_return_location);
+}
+
+void CodeGenerator::GenerateLoadClassRuntimeCall(HLoadClass* cls) {
+ DCHECK_EQ(cls->GetLoadKind(), HLoadClass::LoadKind::kDexCacheViaMethod);
+ LocationSummary* locations = cls->GetLocations();
+ MoveConstant(locations->GetTemp(0), cls->GetTypeIndex().index_);
if (cls->NeedsAccessCheck()) {
- locations->SetInAt(0, Location::NoLocation());
- locations->AddTemp(runtime_type_index_location);
- locations->SetOut(runtime_return_location);
+ CheckEntrypointTypes<kQuickInitializeTypeAndVerifyAccess, void*, uint32_t>();
+ InvokeRuntime(kQuickInitializeTypeAndVerifyAccess, cls, cls->GetDexPc());
+ } else if (cls->MustGenerateClinitCheck()) {
+ CheckEntrypointTypes<kQuickInitializeStaticStorage, void*, uint32_t>();
+ InvokeRuntime(kQuickInitializeStaticStorage, cls, cls->GetDexPc());
} else {
- locations->SetInAt(0, Location::RequiresRegister());
- locations->SetOut(Location::RequiresRegister());
+ CheckEntrypointTypes<kQuickInitializeType, void*, uint32_t>();
+ InvokeRuntime(kQuickInitializeType, cls, cls->GetDexPc());
}
}
-
void CodeGenerator::BlockIfInRegister(Location location, bool is_out) const {
// The DCHECKS below check that a register is not specified twice in
// the summary. The out location can overlap with an input, so we need
@@ -927,10 +936,10 @@ void CodeGenerator::EmitEnvironment(HEnvironment* environment, SlowPathCode* slo
if (environment->GetParent() != nullptr) {
// We emit the parent environment first.
EmitEnvironment(environment->GetParent(), slow_path);
- stack_map_stream_.BeginInlineInfoEntry(environment->GetMethodIdx(),
+ stack_map_stream_.BeginInlineInfoEntry(environment->GetMethod(),
environment->GetDexPc(),
- environment->GetInvokeType(),
- environment->Size());
+ environment->Size(),
+ &graph_->GetDexFile());
}
// Walk over the environment, and record the location of dex registers.
diff --git a/compiler/optimizing/code_generator.h b/compiler/optimizing/code_generator.h
index 6366b9838f..38d532e1e9 100644
--- a/compiler/optimizing/code_generator.h
+++ b/compiler/optimizing/code_generator.h
@@ -426,12 +426,12 @@ class CodeGenerator : public DeletableArenaObject<kArenaAllocCodeGenerator> {
}
- // Perfoms checks pertaining to an InvokeRuntime call.
+ // Performs checks pertaining to an InvokeRuntime call.
void ValidateInvokeRuntime(QuickEntrypointEnum entrypoint,
HInstruction* instruction,
SlowPathCode* slow_path);
- // Perfoms checks pertaining to an InvokeRuntimeWithoutRecordingPcInfo call.
+ // Performs checks pertaining to an InvokeRuntimeWithoutRecordingPcInfo call.
static void ValidateInvokeRuntimeWithoutRecordingPcInfo(HInstruction* instruction,
SlowPathCode* slow_path);
@@ -495,6 +495,8 @@ class CodeGenerator : public DeletableArenaObject<kArenaAllocCodeGenerator> {
void GenerateInvokeUnresolvedRuntimeCall(HInvokeUnresolved* invoke);
+ void GenerateInvokePolymorphicCall(HInvokePolymorphic* invoke);
+
void CreateUnresolvedFieldLocationSummary(
HInstruction* field_access,
Primitive::Type field_type,
@@ -507,11 +509,10 @@ class CodeGenerator : public DeletableArenaObject<kArenaAllocCodeGenerator> {
uint32_t dex_pc,
const FieldAccessCallingConvention& calling_convention);
- // TODO: This overlaps a bit with MoveFromReturnRegister. Refactor for a better design.
- static void CreateLoadClassLocationSummary(HLoadClass* cls,
- Location runtime_type_index_location,
- Location runtime_return_location,
- bool code_generator_supports_read_barrier = false);
+ static void CreateLoadClassRuntimeCallLocationSummary(HLoadClass* cls,
+ Location runtime_type_index_location,
+ Location runtime_return_location);
+ void GenerateLoadClassRuntimeCall(HLoadClass* cls);
static void CreateSystemArrayCopyLocationSummary(HInvoke* invoke);
@@ -521,7 +522,7 @@ class CodeGenerator : public DeletableArenaObject<kArenaAllocCodeGenerator> {
virtual void InvokeRuntime(QuickEntrypointEnum entrypoint,
HInstruction* instruction,
uint32_t dex_pc,
- SlowPathCode* slow_path) = 0;
+ SlowPathCode* slow_path = nullptr) = 0;
// Check if the desired_string_load_kind is supported. If it is, return it,
// otherwise return a fall-back kind that should be used instead.
diff --git a/compiler/optimizing/code_generator_arm.cc b/compiler/optimizing/code_generator_arm.cc
index 541a1c5b8f..9c9c604dca 100644
--- a/compiler/optimizing/code_generator_arm.cc
+++ b/compiler/optimizing/code_generator_arm.cc
@@ -371,22 +371,23 @@ class LoadClassSlowPathARM : public SlowPathCodeARM {
HInstruction* at,
uint32_t dex_pc,
bool do_clinit)
- : SlowPathCodeARM(at), cls_(cls), at_(at), dex_pc_(dex_pc), do_clinit_(do_clinit) {
+ : SlowPathCodeARM(at), cls_(cls), dex_pc_(dex_pc), do_clinit_(do_clinit) {
DCHECK(at->IsLoadClass() || at->IsClinitCheck());
}
void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
- LocationSummary* locations = at_->GetLocations();
+ LocationSummary* locations = instruction_->GetLocations();
CodeGeneratorARM* arm_codegen = down_cast<CodeGeneratorARM*>(codegen);
__ Bind(GetEntryLabel());
SaveLiveRegisters(codegen, locations);
InvokeRuntimeCallingConvention calling_convention;
- __ LoadImmediate(calling_convention.GetRegisterAt(0), cls_->GetTypeIndex().index_);
+ dex::TypeIndex type_index = cls_->GetTypeIndex();
+ __ LoadImmediate(calling_convention.GetRegisterAt(0), type_index.index_);
QuickEntrypointEnum entrypoint = do_clinit_ ? kQuickInitializeStaticStorage
: kQuickInitializeType;
- arm_codegen->InvokeRuntime(entrypoint, at_, dex_pc_, this);
+ arm_codegen->InvokeRuntime(entrypoint, instruction_, dex_pc_, this);
if (do_clinit_) {
CheckEntrypointTypes<kQuickInitializeStaticStorage, void*, uint32_t>();
} else {
@@ -400,6 +401,23 @@ class LoadClassSlowPathARM : public SlowPathCodeARM {
arm_codegen->Move32(locations->Out(), Location::RegisterLocation(R0));
}
RestoreLiveRegisters(codegen, locations);
+ // For HLoadClass/kBssEntry, store the resolved Class to the BSS entry.
+ DCHECK_EQ(instruction_->IsLoadClass(), cls_ == instruction_);
+ if (cls_ == instruction_ && cls_->GetLoadKind() == HLoadClass::LoadKind::kBssEntry) {
+ DCHECK(out.IsValid());
+ // TODO: Change art_quick_initialize_type/art_quick_initialize_static_storage to
+ // kSaveEverything and use a temporary for the .bss entry address in the fast path,
+ // so that we can avoid another calculation here.
+ CodeGeneratorARM::PcRelativePatchInfo* labels =
+ arm_codegen->NewTypeBssEntryPatch(cls_->GetDexFile(), type_index);
+ __ BindTrackedLabel(&labels->movw_label);
+ __ movw(IP, /* placeholder */ 0u);
+ __ BindTrackedLabel(&labels->movt_label);
+ __ movt(IP, /* placeholder */ 0u);
+ __ BindTrackedLabel(&labels->add_pc_label);
+ __ add(IP, IP, ShifterOperand(PC));
+ __ str(locations->Out().AsRegister<Register>(), Address(IP));
+ }
__ b(GetExitLabel());
}
@@ -409,10 +427,6 @@ class LoadClassSlowPathARM : public SlowPathCodeARM {
// The class this slow path will load.
HLoadClass* const cls_;
- // The instruction where this slow path is happening.
- // (Might be the load class or an initialization check).
- HInstruction* const at_;
-
// The dex PC of `at_`.
const uint32_t dex_pc_;
@@ -430,7 +444,7 @@ class LoadStringSlowPathARM : public SlowPathCodeARM {
LocationSummary* locations = instruction_->GetLocations();
DCHECK(!locations->GetLiveRegisters()->ContainsCoreRegister(locations->Out().reg()));
HLoadString* load = instruction_->AsLoadString();
- const uint32_t string_index = load->GetStringIndex().index_;
+ const dex::StringIndex string_index = load->GetStringIndex();
Register out = locations->Out().AsRegister<Register>();
Register temp = locations->GetTemp(0).AsRegister<Register>();
constexpr bool call_saves_everything_except_r0 = (!kUseReadBarrier || kUseBakerReadBarrier);
@@ -449,7 +463,7 @@ class LoadStringSlowPathARM : public SlowPathCodeARM {
__ mov(entry_address, ShifterOperand(temp));
}
- __ LoadImmediate(calling_convention.GetRegisterAt(0), string_index);
+ __ LoadImmediate(calling_convention.GetRegisterAt(0), string_index.index_);
arm_codegen->InvokeRuntime(kQuickResolveString, instruction_, instruction_->GetDexPc(), this);
CheckEntrypointTypes<kQuickResolveString, void*, uint32_t>();
@@ -1208,6 +1222,7 @@ CodeGeneratorARM::CodeGeneratorARM(HGraph* graph,
boot_image_type_patches_(TypeReferenceValueComparator(),
graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
pc_relative_type_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ type_bss_entry_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
boot_image_address_patches_(std::less<uint32_t>(),
graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
jit_string_patches_(StringReferenceValueComparator(),
@@ -2370,6 +2385,14 @@ void InstructionCodeGeneratorARM::VisitInvokeInterface(HInvokeInterface* invoke)
codegen_->RecordPcInfo(invoke, invoke->GetDexPc());
}
+void LocationsBuilderARM::VisitInvokePolymorphic(HInvokePolymorphic* invoke) {
+ HandleInvoke(invoke);
+}
+
+void InstructionCodeGeneratorARM::VisitInvokePolymorphic(HInvokePolymorphic* invoke) {
+ codegen_->GenerateInvokePolymorphicCall(invoke);
+}
+
void LocationsBuilderARM::VisitNeg(HNeg* neg) {
LocationSummary* locations =
new (GetGraph()->GetArena()) LocationSummary(neg, LocationSummary::kNoCall);
@@ -3961,19 +3984,16 @@ void LocationsBuilderARM::VisitNewArray(HNewArray* instruction) {
LocationSummary* locations =
new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kCallOnMainOnly);
InvokeRuntimeCallingConvention calling_convention;
- locations->AddTemp(Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
locations->SetOut(Location::RegisterLocation(R0));
- locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
- locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(2)));
+ locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
+ locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
}
void InstructionCodeGeneratorARM::VisitNewArray(HNewArray* instruction) {
- InvokeRuntimeCallingConvention calling_convention;
- __ LoadImmediate(calling_convention.GetRegisterAt(0), instruction->GetTypeIndex().index_);
// Note: if heap poisoning is enabled, the entry point takes cares
// of poisoning the reference.
- codegen_->InvokeRuntime(instruction->GetEntrypoint(), instruction, instruction->GetDexPc());
- CheckEntrypointTypes<kQuickAllocArrayWithAccessCheck, void*, uint32_t, int32_t, ArtMethod*>();
+ codegen_->InvokeRuntime(kQuickAllocArrayResolved, instruction, instruction->GetDexPc());
+ CheckEntrypointTypes<kQuickAllocArrayResolved, void*, mirror::Class*, int32_t>();
}
void LocationsBuilderARM::VisitParameterValue(HParameterValue* instruction) {
@@ -5708,17 +5728,11 @@ HLoadClass::LoadKind CodeGeneratorARM::GetSupportedLoadClassKind(
break;
case HLoadClass::LoadKind::kBootImageAddress:
break;
- case HLoadClass::LoadKind::kJitTableAddress:
- break;
- case HLoadClass::LoadKind::kDexCachePcRelative:
+ case HLoadClass::LoadKind::kBssEntry:
DCHECK(!Runtime::Current()->UseJitCompilation());
- // We disable pc-relative load when there is an irreducible loop, as the optimization
- // is incompatible with it.
- // TODO: Create as many ArmDexCacheArraysBase instructions as needed for methods
- // with irreducible loops.
- if (GetGraph()->HasIrreducibleLoops()) {
- return HLoadClass::LoadKind::kDexCacheViaMethod;
- }
+ break;
+ case HLoadClass::LoadKind::kJitTableAddress:
+ DCHECK(Runtime::Current()->UseJitCompilation());
break;
case HLoadClass::LoadKind::kDexCacheViaMethod:
break;
@@ -5727,15 +5741,16 @@ HLoadClass::LoadKind CodeGeneratorARM::GetSupportedLoadClassKind(
}
void LocationsBuilderARM::VisitLoadClass(HLoadClass* cls) {
- if (cls->NeedsAccessCheck()) {
+ HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+ if (load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
InvokeRuntimeCallingConvention calling_convention;
- CodeGenerator::CreateLoadClassLocationSummary(
+ CodeGenerator::CreateLoadClassRuntimeCallLocationSummary(
cls,
Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
- Location::RegisterLocation(R0),
- /* code_generator_supports_read_barrier */ true);
+ Location::RegisterLocation(R0));
return;
}
+ DCHECK(!cls->NeedsAccessCheck());
const bool requires_read_barrier = kEmitCompilerReadBarrier && !cls->IsInBootImage();
LocationSummary::CallKind call_kind = (cls->NeedsEnvironment() || requires_read_barrier)
@@ -5746,24 +5761,23 @@ void LocationsBuilderARM::VisitLoadClass(HLoadClass* cls) {
locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
- HLoadClass::LoadKind load_kind = cls->GetLoadKind();
- if (load_kind == HLoadClass::LoadKind::kReferrersClass ||
- load_kind == HLoadClass::LoadKind::kDexCacheViaMethod ||
- load_kind == HLoadClass::LoadKind::kDexCachePcRelative) {
+ if (load_kind == HLoadClass::LoadKind::kReferrersClass) {
locations->SetInAt(0, Location::RequiresRegister());
}
locations->SetOut(Location::RequiresRegister());
}
-void InstructionCodeGeneratorARM::VisitLoadClass(HLoadClass* cls) {
- LocationSummary* locations = cls->GetLocations();
- if (cls->NeedsAccessCheck()) {
- codegen_->MoveConstant(locations->GetTemp(0), cls->GetTypeIndex().index_);
- codegen_->InvokeRuntime(kQuickInitializeTypeAndVerifyAccess, cls, cls->GetDexPc());
- CheckEntrypointTypes<kQuickInitializeTypeAndVerifyAccess, void*, uint32_t>();
+// NO_THREAD_SAFETY_ANALYSIS as we manipulate handles whose internal object we know does not
+// move.
+void InstructionCodeGeneratorARM::VisitLoadClass(HLoadClass* cls) NO_THREAD_SAFETY_ANALYSIS {
+ HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+ if (load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
+ codegen_->GenerateLoadClassRuntimeCall(cls);
return;
}
+ DCHECK(!cls->NeedsAccessCheck());
+ LocationSummary* locations = cls->GetLocations();
Location out_loc = locations->Out();
Register out = out_loc.AsRegister<Register>();
@@ -5771,7 +5785,7 @@ void InstructionCodeGeneratorARM::VisitLoadClass(HLoadClass* cls) {
? kWithoutReadBarrier
: kCompilerReadBarrierOption;
bool generate_null_check = false;
- switch (cls->GetLoadKind()) {
+ switch (load_kind) {
case HLoadClass::LoadKind::kReferrersClass: {
DCHECK(!cls->CanCallRuntime());
DCHECK(!cls->MustGenerateClinitCheck());
@@ -5785,12 +5799,14 @@ void InstructionCodeGeneratorARM::VisitLoadClass(HLoadClass* cls) {
break;
}
case HLoadClass::LoadKind::kBootImageLinkTimeAddress: {
+ DCHECK(codegen_->GetCompilerOptions().IsBootImage());
DCHECK_EQ(read_barrier_option, kWithoutReadBarrier);
__ LoadLiteral(out, codegen_->DeduplicateBootImageTypeLiteral(cls->GetDexFile(),
cls->GetTypeIndex()));
break;
}
case HLoadClass::LoadKind::kBootImageLinkTimePcRelative: {
+ DCHECK(codegen_->GetCompilerOptions().IsBootImage());
DCHECK_EQ(read_barrier_option, kWithoutReadBarrier);
CodeGeneratorARM::PcRelativePatchInfo* labels =
codegen_->NewPcRelativeTypePatch(cls->GetDexFile(), cls->GetTypeIndex());
@@ -5804,41 +5820,36 @@ void InstructionCodeGeneratorARM::VisitLoadClass(HLoadClass* cls) {
}
case HLoadClass::LoadKind::kBootImageAddress: {
DCHECK_EQ(read_barrier_option, kWithoutReadBarrier);
- DCHECK_NE(cls->GetAddress(), 0u);
- uint32_t address = dchecked_integral_cast<uint32_t>(cls->GetAddress());
+ uint32_t address = dchecked_integral_cast<uint32_t>(
+ reinterpret_cast<uintptr_t>(cls->GetClass().Get()));
+ DCHECK_NE(address, 0u);
__ LoadLiteral(out, codegen_->DeduplicateBootImageAddressLiteral(address));
break;
}
+ case HLoadClass::LoadKind::kBssEntry: {
+ CodeGeneratorARM::PcRelativePatchInfo* labels =
+ codegen_->NewTypeBssEntryPatch(cls->GetDexFile(), cls->GetTypeIndex());
+ __ BindTrackedLabel(&labels->movw_label);
+ __ movw(out, /* placeholder */ 0u);
+ __ BindTrackedLabel(&labels->movt_label);
+ __ movt(out, /* placeholder */ 0u);
+ __ BindTrackedLabel(&labels->add_pc_label);
+ __ add(out, out, ShifterOperand(PC));
+ GenerateGcRootFieldLoad(cls, out_loc, out, 0, kCompilerReadBarrierOption);
+ generate_null_check = true;
+ break;
+ }
case HLoadClass::LoadKind::kJitTableAddress: {
__ LoadLiteral(out, codegen_->DeduplicateJitClassLiteral(cls->GetDexFile(),
cls->GetTypeIndex(),
- cls->GetAddress()));
+ cls->GetClass()));
// /* GcRoot<mirror::Class> */ out = *out
GenerateGcRootFieldLoad(cls, out_loc, out, /* offset */ 0, kCompilerReadBarrierOption);
break;
}
- case HLoadClass::LoadKind::kDexCachePcRelative: {
- Register base_reg = locations->InAt(0).AsRegister<Register>();
- HArmDexCacheArraysBase* base = cls->InputAt(0)->AsArmDexCacheArraysBase();
- int32_t offset = cls->GetDexCacheElementOffset() - base->GetElementOffset();
- // /* GcRoot<mirror::Class> */ out = *(dex_cache_arrays_base + offset)
- GenerateGcRootFieldLoad(cls, out_loc, base_reg, offset, read_barrier_option);
- generate_null_check = !cls->IsInDexCache();
- break;
- }
- case HLoadClass::LoadKind::kDexCacheViaMethod: {
- // /* GcRoot<mirror::Class>[] */ out =
- // current_method.ptr_sized_fields_->dex_cache_resolved_types_
- Register current_method = locations->InAt(0).AsRegister<Register>();
- __ LoadFromOffset(kLoadWord,
- out,
- current_method,
- ArtMethod::DexCacheResolvedTypesOffset(kArmPointerSize).Int32Value());
- // /* GcRoot<mirror::Class> */ out = out[type_index]
- size_t offset = CodeGenerator::GetCacheOffset(cls->GetTypeIndex().index_);
- GenerateGcRootFieldLoad(cls, out_loc, out, offset, read_barrier_option);
- generate_null_check = !cls->IsInDexCache();
- }
+ case HLoadClass::LoadKind::kDexCacheViaMethod:
+ LOG(FATAL) << "UNREACHABLE";
+ UNREACHABLE();
}
if (generate_null_check || cls->MustGenerateClinitCheck()) {
@@ -5946,6 +5957,7 @@ void InstructionCodeGeneratorARM::VisitLoadString(HLoadString* load) NO_THREAD_S
switch (load_kind) {
case HLoadString::LoadKind::kBootImageLinkTimeAddress: {
+ DCHECK(codegen_->GetCompilerOptions().IsBootImage());
__ LoadLiteral(out, codegen_->DeduplicateBootImageStringLiteral(load->GetDexFile(),
load->GetStringIndex()));
return; // No dex cache slow path.
@@ -5953,7 +5965,7 @@ void InstructionCodeGeneratorARM::VisitLoadString(HLoadString* load) NO_THREAD_S
case HLoadString::LoadKind::kBootImageLinkTimePcRelative: {
DCHECK(codegen_->GetCompilerOptions().IsBootImage());
CodeGeneratorARM::PcRelativePatchInfo* labels =
- codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex().index_);
+ codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex());
__ BindTrackedLabel(&labels->movw_label);
__ movw(out, /* placeholder */ 0u);
__ BindTrackedLabel(&labels->movt_label);
@@ -5973,7 +5985,7 @@ void InstructionCodeGeneratorARM::VisitLoadString(HLoadString* load) NO_THREAD_S
DCHECK(!codegen_->GetCompilerOptions().IsBootImage());
Register temp = locations->GetTemp(0).AsRegister<Register>();
CodeGeneratorARM::PcRelativePatchInfo* labels =
- codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex().index_);
+ codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex());
__ BindTrackedLabel(&labels->movw_label);
__ movw(temp, /* placeholder */ 0u);
__ BindTrackedLabel(&labels->movt_label);
@@ -7279,8 +7291,8 @@ void CodeGeneratorARM::GenerateVirtualCall(HInvokeVirtual* invoke, Location temp
}
CodeGeneratorARM::PcRelativePatchInfo* CodeGeneratorARM::NewPcRelativeStringPatch(
- const DexFile& dex_file, uint32_t string_index) {
- return NewPcRelativePatch(dex_file, string_index, &pc_relative_string_patches_);
+ const DexFile& dex_file, dex::StringIndex string_index) {
+ return NewPcRelativePatch(dex_file, string_index.index_, &pc_relative_string_patches_);
}
CodeGeneratorARM::PcRelativePatchInfo* CodeGeneratorARM::NewPcRelativeTypePatch(
@@ -7288,6 +7300,11 @@ CodeGeneratorARM::PcRelativePatchInfo* CodeGeneratorARM::NewPcRelativeTypePatch(
return NewPcRelativePatch(dex_file, type_index.index_, &pc_relative_type_patches_);
}
+CodeGeneratorARM::PcRelativePatchInfo* CodeGeneratorARM::NewTypeBssEntryPatch(
+ const DexFile& dex_file, dex::TypeIndex type_index) {
+ return NewPcRelativePatch(dex_file, type_index.index_, &type_bss_entry_patches_);
+}
+
CodeGeneratorARM::PcRelativePatchInfo* CodeGeneratorARM::NewPcRelativeDexCacheArrayPatch(
const DexFile& dex_file, uint32_t element_offset) {
return NewPcRelativePatch(dex_file, element_offset, &pc_relative_dex_cache_patches_);
@@ -7331,8 +7348,9 @@ Literal* CodeGeneratorARM::DeduplicateJitStringLiteral(const DexFile& dex_file,
Literal* CodeGeneratorARM::DeduplicateJitClassLiteral(const DexFile& dex_file,
dex::TypeIndex type_index,
- uint64_t address) {
- jit_class_roots_.Overwrite(TypeReference(&dex_file, type_index), address);
+ Handle<mirror::Class> handle) {
+ jit_class_roots_.Overwrite(TypeReference(&dex_file, type_index),
+ reinterpret_cast64<uint64_t>(handle.GetReference()));
return jit_class_patches_.GetOrCreate(
TypeReference(&dex_file, type_index),
[this]() { return __ NewLiteral<uint32_t>(/* placeholder */ 0u); });
@@ -7366,6 +7384,7 @@ void CodeGeneratorARM::EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_patche
/* MOVW+MOVT for each entry */ 2u * pc_relative_string_patches_.size() +
boot_image_type_patches_.size() +
/* MOVW+MOVT for each entry */ 2u * pc_relative_type_patches_.size() +
+ /* MOVW+MOVT for each entry */ 2u * type_bss_entry_patches_.size() +
boot_image_address_patches_.size();
linker_patches->reserve(size);
EmitPcRelativeLinkerPatches<LinkerPatch::DexCacheArrayPatch>(pc_relative_dex_cache_patches_,
@@ -7380,12 +7399,17 @@ void CodeGeneratorARM::EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_patche
target_string.string_index.index_));
}
if (!GetCompilerOptions().IsBootImage()) {
+ DCHECK(pc_relative_type_patches_.empty());
EmitPcRelativeLinkerPatches<LinkerPatch::StringBssEntryPatch>(pc_relative_string_patches_,
linker_patches);
} else {
+ EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(pc_relative_type_patches_,
+ linker_patches);
EmitPcRelativeLinkerPatches<LinkerPatch::RelativeStringPatch>(pc_relative_string_patches_,
linker_patches);
}
+ EmitPcRelativeLinkerPatches<LinkerPatch::TypeBssEntryPatch>(type_bss_entry_patches_,
+ linker_patches);
for (const auto& entry : boot_image_type_patches_) {
const TypeReference& target_type = entry.first;
Literal* literal = entry.second;
@@ -7395,8 +7419,6 @@ void CodeGeneratorARM::EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_patche
target_type.dex_file,
target_type.type_index.index_));
}
- EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(pc_relative_type_patches_,
- linker_patches);
for (const auto& entry : boot_image_address_patches_) {
DCHECK(GetCompilerOptions().GetIncludePatchInformation());
Literal* literal = entry.second;
@@ -7404,6 +7426,7 @@ void CodeGeneratorARM::EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_patche
uint32_t literal_offset = literal->GetLabel()->Position();
linker_patches->push_back(LinkerPatch::RecordPosition(literal_offset));
}
+ DCHECK_EQ(size, linker_patches->size());
}
Literal* CodeGeneratorARM::DeduplicateUint32Literal(uint32_t value, Uint32ToLiteralMap* map) {
diff --git a/compiler/optimizing/code_generator_arm.h b/compiler/optimizing/code_generator_arm.h
index d5968e0764..52d18575ff 100644
--- a/compiler/optimizing/code_generator_arm.h
+++ b/compiler/optimizing/code_generator_arm.h
@@ -481,8 +481,10 @@ class CodeGeneratorARM : public CodeGenerator {
Label add_pc_label;
};
- PcRelativePatchInfo* NewPcRelativeStringPatch(const DexFile& dex_file, uint32_t string_index);
+ PcRelativePatchInfo* NewPcRelativeStringPatch(const DexFile& dex_file,
+ dex::StringIndex string_index);
PcRelativePatchInfo* NewPcRelativeTypePatch(const DexFile& dex_file, dex::TypeIndex type_index);
+ PcRelativePatchInfo* NewTypeBssEntryPatch(const DexFile& dex_file, dex::TypeIndex type_index);
PcRelativePatchInfo* NewPcRelativeDexCacheArrayPatch(const DexFile& dex_file,
uint32_t element_offset);
Literal* DeduplicateBootImageStringLiteral(const DexFile& dex_file,
@@ -494,7 +496,7 @@ class CodeGeneratorARM : public CodeGenerator {
Handle<mirror::String> handle);
Literal* DeduplicateJitClassLiteral(const DexFile& dex_file,
dex::TypeIndex type_index,
- uint64_t address);
+ Handle<mirror::Class> handle);
void EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_patches) OVERRIDE;
@@ -635,8 +637,10 @@ class CodeGeneratorARM : public CodeGenerator {
ArenaDeque<PcRelativePatchInfo> pc_relative_string_patches_;
// Deduplication map for boot type literals for kBootImageLinkTimeAddress.
TypeToLiteralMap boot_image_type_patches_;
- // PC-relative type patch info.
+ // PC-relative type patch info for kBootImageLinkTimePcRelative.
ArenaDeque<PcRelativePatchInfo> pc_relative_type_patches_;
+ // PC-relative type patch info for kBssEntry.
+ ArenaDeque<PcRelativePatchInfo> type_bss_entry_patches_;
// Deduplication map for patchable boot image addresses.
Uint32ToLiteralMap boot_image_address_patches_;
diff --git a/compiler/optimizing/code_generator_arm64.cc b/compiler/optimizing/code_generator_arm64.cc
index 9aaeadb44a..68d0b869e7 100644
--- a/compiler/optimizing/code_generator_arm64.cc
+++ b/compiler/optimizing/code_generator_arm64.cc
@@ -276,22 +276,23 @@ class LoadClassSlowPathARM64 : public SlowPathCodeARM64 {
HInstruction* at,
uint32_t dex_pc,
bool do_clinit)
- : SlowPathCodeARM64(at), cls_(cls), at_(at), dex_pc_(dex_pc), do_clinit_(do_clinit) {
+ : SlowPathCodeARM64(at), cls_(cls), dex_pc_(dex_pc), do_clinit_(do_clinit) {
DCHECK(at->IsLoadClass() || at->IsClinitCheck());
}
void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
- LocationSummary* locations = at_->GetLocations();
+ LocationSummary* locations = instruction_->GetLocations();
CodeGeneratorARM64* arm64_codegen = down_cast<CodeGeneratorARM64*>(codegen);
__ Bind(GetEntryLabel());
SaveLiveRegisters(codegen, locations);
InvokeRuntimeCallingConvention calling_convention;
- __ Mov(calling_convention.GetRegisterAt(0).W(), cls_->GetTypeIndex().index_);
+ dex::TypeIndex type_index = cls_->GetTypeIndex();
+ __ Mov(calling_convention.GetRegisterAt(0).W(), type_index.index_);
QuickEntrypointEnum entrypoint = do_clinit_ ? kQuickInitializeStaticStorage
: kQuickInitializeType;
- arm64_codegen->InvokeRuntime(entrypoint, at_, dex_pc_, this);
+ arm64_codegen->InvokeRuntime(entrypoint, instruction_, dex_pc_, this);
if (do_clinit_) {
CheckEntrypointTypes<kQuickInitializeStaticStorage, void*, uint32_t>();
} else {
@@ -302,11 +303,32 @@ class LoadClassSlowPathARM64 : public SlowPathCodeARM64 {
Location out = locations->Out();
if (out.IsValid()) {
DCHECK(out.IsRegister() && !locations->GetLiveRegisters()->ContainsCoreRegister(out.reg()));
- Primitive::Type type = at_->GetType();
+ Primitive::Type type = instruction_->GetType();
arm64_codegen->MoveLocation(out, calling_convention.GetReturnLocation(type), type);
}
-
RestoreLiveRegisters(codegen, locations);
+ // For HLoadClass/kBssEntry, store the resolved Class to the BSS entry.
+ DCHECK_EQ(instruction_->IsLoadClass(), cls_ == instruction_);
+ if (cls_ == instruction_ && cls_->GetLoadKind() == HLoadClass::LoadKind::kBssEntry) {
+ DCHECK(out.IsValid());
+ UseScratchRegisterScope temps(arm64_codegen->GetVIXLAssembler());
+ Register temp = temps.AcquireX();
+ const DexFile& dex_file = cls_->GetDexFile();
+ // TODO: Change art_quick_initialize_type/art_quick_initialize_static_storage to
+ // kSaveEverything and use a temporary for the ADRP in the fast path, so that we
+ // can avoid the ADRP here.
+ vixl::aarch64::Label* adrp_label =
+ arm64_codegen->NewBssEntryTypePatch(dex_file, type_index);
+ arm64_codegen->EmitAdrpPlaceholder(adrp_label, temp);
+ vixl::aarch64::Label* strp_label =
+ arm64_codegen->NewBssEntryTypePatch(dex_file, type_index, adrp_label);
+ {
+ SingleEmissionCheckScope guard(arm64_codegen->GetVIXLAssembler());
+ __ Bind(strp_label);
+ __ str(RegisterFrom(locations->Out(), Primitive::kPrimNot),
+ MemOperand(temp, /* offset placeholder */ 0));
+ }
+ }
__ B(GetExitLabel());
}
@@ -316,10 +338,6 @@ class LoadClassSlowPathARM64 : public SlowPathCodeARM64 {
// The class this slow path will load.
HLoadClass* const cls_;
- // The instruction where this slow path is happening.
- // (Might be the load class or an initialization check).
- HInstruction* const at_;
-
// The dex PC of `at_`.
const uint32_t dex_pc_;
@@ -349,8 +367,8 @@ class LoadStringSlowPathARM64 : public SlowPathCodeARM64 {
SaveLiveRegisters(codegen, locations);
InvokeRuntimeCallingConvention calling_convention;
- const uint32_t string_index = instruction_->AsLoadString()->GetStringIndex().index_;
- __ Mov(calling_convention.GetRegisterAt(0).W(), string_index);
+ const dex::StringIndex string_index = instruction_->AsLoadString()->GetStringIndex();
+ __ Mov(calling_convention.GetRegisterAt(0).W(), string_index.index_);
arm64_codegen->InvokeRuntime(kQuickResolveString, instruction_, instruction_->GetDexPc(), this);
CheckEntrypointTypes<kQuickResolveString, void*, uint32_t>();
Primitive::Type type = instruction_->GetType();
@@ -1154,6 +1172,7 @@ CodeGeneratorARM64::CodeGeneratorARM64(HGraph* graph,
boot_image_type_patches_(TypeReferenceValueComparator(),
graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
pc_relative_type_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ type_bss_entry_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
boot_image_address_patches_(std::less<uint32_t>(),
graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
jit_string_patches_(StringReferenceValueComparator(),
@@ -3994,7 +4013,7 @@ void CodeGeneratorARM64::GenerateStaticOrDirectCall(HInvokeStaticOrDirect* invok
break;
case HInvokeStaticOrDirect::MethodLoadKind::kDexCachePcRelative: {
// Add ADRP with its PC-relative DexCache access patch.
- const DexFile& dex_file = invoke->GetDexFile();
+ const DexFile& dex_file = invoke->GetDexFileForPcRelativeDexCache();
uint32_t element_offset = invoke->GetDexCacheArrayOffset();
vixl::aarch64::Label* adrp_label = NewPcRelativeDexCacheArrayPatch(dex_file, element_offset);
EmitAdrpPlaceholder(adrp_label, XRegisterFrom(temp));
@@ -4080,11 +4099,20 @@ void CodeGeneratorARM64::GenerateVirtualCall(HInvokeVirtual* invoke, Location te
__ Blr(lr);
}
+void LocationsBuilderARM64::VisitInvokePolymorphic(HInvokePolymorphic* invoke) {
+ HandleInvoke(invoke);
+}
+
+void InstructionCodeGeneratorARM64::VisitInvokePolymorphic(HInvokePolymorphic* invoke) {
+ codegen_->GenerateInvokePolymorphicCall(invoke);
+}
+
vixl::aarch64::Label* CodeGeneratorARM64::NewPcRelativeStringPatch(
const DexFile& dex_file,
- uint32_t string_index,
+ dex::StringIndex string_index,
vixl::aarch64::Label* adrp_label) {
- return NewPcRelativePatch(dex_file, string_index, adrp_label, &pc_relative_string_patches_);
+ return
+ NewPcRelativePatch(dex_file, string_index.index_, adrp_label, &pc_relative_string_patches_);
}
vixl::aarch64::Label* CodeGeneratorARM64::NewPcRelativeTypePatch(
@@ -4094,6 +4122,13 @@ vixl::aarch64::Label* CodeGeneratorARM64::NewPcRelativeTypePatch(
return NewPcRelativePatch(dex_file, type_index.index_, adrp_label, &pc_relative_type_patches_);
}
+vixl::aarch64::Label* CodeGeneratorARM64::NewBssEntryTypePatch(
+ const DexFile& dex_file,
+ dex::TypeIndex type_index,
+ vixl::aarch64::Label* adrp_label) {
+ return NewPcRelativePatch(dex_file, type_index.index_, adrp_label, &type_bss_entry_patches_);
+}
+
vixl::aarch64::Label* CodeGeneratorARM64::NewPcRelativeDexCacheArrayPatch(
const DexFile& dex_file,
uint32_t element_offset,
@@ -4146,8 +4181,9 @@ vixl::aarch64::Literal<uint32_t>* CodeGeneratorARM64::DeduplicateJitStringLitera
}
vixl::aarch64::Literal<uint32_t>* CodeGeneratorARM64::DeduplicateJitClassLiteral(
- const DexFile& dex_file, dex::TypeIndex type_index, uint64_t address) {
- jit_class_roots_.Overwrite(TypeReference(&dex_file, type_index), address);
+ const DexFile& dex_file, dex::TypeIndex type_index, Handle<mirror::Class> handle) {
+ jit_class_roots_.Overwrite(TypeReference(&dex_file, type_index),
+ reinterpret_cast64<uint64_t>(handle.GetReference()));
return jit_class_patches_.GetOrCreate(
TypeReference(&dex_file, type_index),
[this]() { return __ CreateLiteralDestroyedWithPool<uint32_t>(/* placeholder */ 0u); });
@@ -4200,6 +4236,7 @@ void CodeGeneratorARM64::EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_patc
pc_relative_string_patches_.size() +
boot_image_type_patches_.size() +
pc_relative_type_patches_.size() +
+ type_bss_entry_patches_.size() +
boot_image_address_patches_.size();
linker_patches->reserve(size);
for (const PcRelativePatchInfo& info : pc_relative_dex_cache_patches_) {
@@ -4216,12 +4253,17 @@ void CodeGeneratorARM64::EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_patc
target_string.string_index.index_));
}
if (!GetCompilerOptions().IsBootImage()) {
+ DCHECK(pc_relative_type_patches_.empty());
EmitPcRelativeLinkerPatches<LinkerPatch::StringBssEntryPatch>(pc_relative_string_patches_,
linker_patches);
} else {
+ EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(pc_relative_type_patches_,
+ linker_patches);
EmitPcRelativeLinkerPatches<LinkerPatch::RelativeStringPatch>(pc_relative_string_patches_,
linker_patches);
}
+ EmitPcRelativeLinkerPatches<LinkerPatch::TypeBssEntryPatch>(type_bss_entry_patches_,
+ linker_patches);
for (const auto& entry : boot_image_type_patches_) {
const TypeReference& target_type = entry.first;
vixl::aarch64::Literal<uint32_t>* literal = entry.second;
@@ -4229,13 +4271,12 @@ void CodeGeneratorARM64::EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_patc
target_type.dex_file,
target_type.type_index.index_));
}
- EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(pc_relative_type_patches_,
- linker_patches);
for (const auto& entry : boot_image_address_patches_) {
DCHECK(GetCompilerOptions().GetIncludePatchInformation());
vixl::aarch64::Literal<uint32_t>* literal = entry.second;
linker_patches->push_back(LinkerPatch::RecordPosition(literal->GetOffset()));
}
+ DCHECK_EQ(size, linker_patches->size());
}
vixl::aarch64::Literal<uint32_t>* CodeGeneratorARM64::DeduplicateUint32Literal(uint32_t value,
@@ -4298,12 +4339,12 @@ HLoadClass::LoadKind CodeGeneratorARM64::GetSupportedLoadClassKind(
break;
case HLoadClass::LoadKind::kBootImageAddress:
break;
+ case HLoadClass::LoadKind::kBssEntry:
+ DCHECK(!Runtime::Current()->UseJitCompilation());
+ break;
case HLoadClass::LoadKind::kJitTableAddress:
DCHECK(Runtime::Current()->UseJitCompilation());
break;
- case HLoadClass::LoadKind::kDexCachePcRelative:
- DCHECK(!Runtime::Current()->UseJitCompilation());
- break;
case HLoadClass::LoadKind::kDexCacheViaMethod:
break;
}
@@ -4311,15 +4352,16 @@ HLoadClass::LoadKind CodeGeneratorARM64::GetSupportedLoadClassKind(
}
void LocationsBuilderARM64::VisitLoadClass(HLoadClass* cls) {
- if (cls->NeedsAccessCheck()) {
+ HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+ if (load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
InvokeRuntimeCallingConvention calling_convention;
- CodeGenerator::CreateLoadClassLocationSummary(
+ CodeGenerator::CreateLoadClassRuntimeCallLocationSummary(
cls,
LocationFrom(calling_convention.GetRegisterAt(0)),
- LocationFrom(vixl::aarch64::x0),
- /* code_generator_supports_read_barrier */ true);
+ LocationFrom(vixl::aarch64::x0));
return;
}
+ DCHECK(!cls->NeedsAccessCheck());
const bool requires_read_barrier = kEmitCompilerReadBarrier && !cls->IsInBootImage();
LocationSummary::CallKind call_kind = (cls->NeedsEnvironment() || requires_read_barrier)
@@ -4330,21 +4372,21 @@ void LocationsBuilderARM64::VisitLoadClass(HLoadClass* cls) {
locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
- HLoadClass::LoadKind load_kind = cls->GetLoadKind();
- if (load_kind == HLoadClass::LoadKind::kReferrersClass ||
- load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
+ if (load_kind == HLoadClass::LoadKind::kReferrersClass) {
locations->SetInAt(0, Location::RequiresRegister());
}
locations->SetOut(Location::RequiresRegister());
}
-void InstructionCodeGeneratorARM64::VisitLoadClass(HLoadClass* cls) {
- if (cls->NeedsAccessCheck()) {
- codegen_->MoveConstant(cls->GetLocations()->GetTemp(0), cls->GetTypeIndex().index_);
- codegen_->InvokeRuntime(kQuickInitializeTypeAndVerifyAccess, cls, cls->GetDexPc());
- CheckEntrypointTypes<kQuickInitializeTypeAndVerifyAccess, void*, uint32_t>();
+// NO_THREAD_SAFETY_ANALYSIS as we manipulate handles whose internal object we know does not
+// move.
+void InstructionCodeGeneratorARM64::VisitLoadClass(HLoadClass* cls) NO_THREAD_SAFETY_ANALYSIS {
+ HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+ if (load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
+ codegen_->GenerateLoadClassRuntimeCall(cls);
return;
}
+ DCHECK(!cls->NeedsAccessCheck());
Location out_loc = cls->GetLocations()->Out();
Register out = OutputRegister(cls);
@@ -4353,7 +4395,7 @@ void InstructionCodeGeneratorARM64::VisitLoadClass(HLoadClass* cls) {
? kWithoutReadBarrier
: kCompilerReadBarrierOption;
bool generate_null_check = false;
- switch (cls->GetLoadKind()) {
+ switch (load_kind) {
case HLoadClass::LoadKind::kReferrersClass: {
DCHECK(!cls->CanCallRuntime());
DCHECK(!cls->MustGenerateClinitCheck());
@@ -4387,59 +4429,46 @@ void InstructionCodeGeneratorARM64::VisitLoadClass(HLoadClass* cls) {
}
case HLoadClass::LoadKind::kBootImageAddress: {
DCHECK_EQ(read_barrier_option, kWithoutReadBarrier);
- DCHECK(cls->GetAddress() != 0u && IsUint<32>(cls->GetAddress()));
- __ Ldr(out.W(), codegen_->DeduplicateBootImageAddressLiteral(cls->GetAddress()));
- break;
- }
- case HLoadClass::LoadKind::kJitTableAddress: {
- __ Ldr(out, codegen_->DeduplicateJitClassLiteral(cls->GetDexFile(),
- cls->GetTypeIndex(),
- cls->GetAddress()));
- GenerateGcRootFieldLoad(cls,
- out_loc,
- out.X(),
- /* offset */ 0,
- /* fixup_label */ nullptr,
- kCompilerReadBarrierOption);
+ uint32_t address = dchecked_integral_cast<uint32_t>(
+ reinterpret_cast<uintptr_t>(cls->GetClass().Get()));
+ DCHECK_NE(address, 0u);
+ __ Ldr(out.W(), codegen_->DeduplicateBootImageAddressLiteral(address));
break;
}
- case HLoadClass::LoadKind::kDexCachePcRelative: {
- // Add ADRP with its PC-relative DexCache access patch.
+ case HLoadClass::LoadKind::kBssEntry: {
+ // Add ADRP with its PC-relative Class .bss entry patch.
const DexFile& dex_file = cls->GetDexFile();
- uint32_t element_offset = cls->GetDexCacheElementOffset();
- vixl::aarch64::Label* adrp_label =
- codegen_->NewPcRelativeDexCacheArrayPatch(dex_file, element_offset);
+ dex::TypeIndex type_index = cls->GetTypeIndex();
+ vixl::aarch64::Label* adrp_label = codegen_->NewBssEntryTypePatch(dex_file, type_index);
codegen_->EmitAdrpPlaceholder(adrp_label, out.X());
- // Add LDR with its PC-relative DexCache access patch.
+ // Add LDR with its PC-relative Class patch.
vixl::aarch64::Label* ldr_label =
- codegen_->NewPcRelativeDexCacheArrayPatch(dex_file, element_offset, adrp_label);
+ codegen_->NewBssEntryTypePatch(dex_file, type_index, adrp_label);
// /* GcRoot<mirror::Class> */ out = *(base_address + offset) /* PC-relative */
GenerateGcRootFieldLoad(cls,
- out_loc,
+ cls->GetLocations()->Out(),
out.X(),
- /* offset placeholder */ 0,
+ /* placeholder */ 0u,
ldr_label,
- read_barrier_option);
- generate_null_check = !cls->IsInDexCache();
+ kCompilerReadBarrierOption);
+ generate_null_check = true;
break;
}
- case HLoadClass::LoadKind::kDexCacheViaMethod: {
- MemberOffset resolved_types_offset =
- ArtMethod::DexCacheResolvedTypesOffset(kArm64PointerSize);
- // /* GcRoot<mirror::Class>[] */ out =
- // current_method.ptr_sized_fields_->dex_cache_resolved_types_
- Register current_method = InputRegisterAt(cls, 0);
- __ Ldr(out.X(), MemOperand(current_method, resolved_types_offset.Int32Value()));
- // /* GcRoot<mirror::Class> */ out = out[type_index]
+ case HLoadClass::LoadKind::kJitTableAddress: {
+ __ Ldr(out, codegen_->DeduplicateJitClassLiteral(cls->GetDexFile(),
+ cls->GetTypeIndex(),
+ cls->GetClass()));
GenerateGcRootFieldLoad(cls,
out_loc,
out.X(),
- CodeGenerator::GetCacheOffset(cls->GetTypeIndex().index_),
+ /* offset */ 0,
/* fixup_label */ nullptr,
- read_barrier_option);
- generate_null_check = !cls->IsInDexCache();
+ kCompilerReadBarrierOption);
break;
}
+ case HLoadClass::LoadKind::kDexCacheViaMethod:
+ LOG(FATAL) << "UNREACHABLE";
+ UNREACHABLE();
}
if (generate_null_check || cls->MustGenerateClinitCheck()) {
@@ -4494,11 +4523,11 @@ HLoadString::LoadKind CodeGeneratorARM64::GetSupportedLoadStringKind(
case HLoadString::LoadKind::kBssEntry:
DCHECK(!Runtime::Current()->UseJitCompilation());
break;
- case HLoadString::LoadKind::kDexCacheViaMethod:
- break;
case HLoadString::LoadKind::kJitTableAddress:
DCHECK(Runtime::Current()->UseJitCompilation());
break;
+ case HLoadString::LoadKind::kDexCacheViaMethod:
+ break;
}
return desired_string_load_kind;
}
@@ -4542,7 +4571,7 @@ void InstructionCodeGeneratorARM64::VisitLoadString(HLoadString* load) NO_THREAD
case HLoadString::LoadKind::kBootImageLinkTimePcRelative: {
// Add ADRP with its PC-relative String patch.
const DexFile& dex_file = load->GetDexFile();
- uint32_t string_index = load->GetStringIndex().index_;
+ const dex::StringIndex string_index = load->GetStringIndex();
DCHECK(codegen_->GetCompilerOptions().IsBootImage());
vixl::aarch64::Label* adrp_label = codegen_->NewPcRelativeStringPatch(dex_file, string_index);
codegen_->EmitAdrpPlaceholder(adrp_label, out.X());
@@ -4562,7 +4591,7 @@ void InstructionCodeGeneratorARM64::VisitLoadString(HLoadString* load) NO_THREAD
case HLoadString::LoadKind::kBssEntry: {
// Add ADRP with its PC-relative String .bss entry patch.
const DexFile& dex_file = load->GetDexFile();
- uint32_t string_index = load->GetStringIndex().index_;
+ const dex::StringIndex string_index = load->GetStringIndex();
DCHECK(!codegen_->GetCompilerOptions().IsBootImage());
UseScratchRegisterScope temps(codegen_->GetVIXLAssembler());
Register temp = temps.AcquireX();
@@ -4718,22 +4747,16 @@ void LocationsBuilderARM64::VisitNewArray(HNewArray* instruction) {
LocationSummary* locations =
new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kCallOnMainOnly);
InvokeRuntimeCallingConvention calling_convention;
- locations->AddTemp(LocationFrom(calling_convention.GetRegisterAt(0)));
locations->SetOut(LocationFrom(x0));
- locations->SetInAt(0, LocationFrom(calling_convention.GetRegisterAt(1)));
- locations->SetInAt(1, LocationFrom(calling_convention.GetRegisterAt(2)));
+ locations->SetInAt(0, LocationFrom(calling_convention.GetRegisterAt(0)));
+ locations->SetInAt(1, LocationFrom(calling_convention.GetRegisterAt(1)));
}
void InstructionCodeGeneratorARM64::VisitNewArray(HNewArray* instruction) {
- LocationSummary* locations = instruction->GetLocations();
- InvokeRuntimeCallingConvention calling_convention;
- Register type_index = RegisterFrom(locations->GetTemp(0), Primitive::kPrimInt);
- DCHECK(type_index.Is(w0));
- __ Mov(type_index, instruction->GetTypeIndex().index_);
// Note: if heap poisoning is enabled, the entry point takes cares
// of poisoning the reference.
- codegen_->InvokeRuntime(instruction->GetEntrypoint(), instruction, instruction->GetDexPc());
- CheckEntrypointTypes<kQuickAllocArrayWithAccessCheck, void*, uint32_t, int32_t, ArtMethod*>();
+ codegen_->InvokeRuntime(kQuickAllocArrayResolved, instruction, instruction->GetDexPc());
+ CheckEntrypointTypes<kQuickAllocArrayResolved, void*, mirror::Class*, int32_t>();
}
void LocationsBuilderARM64::VisitNewInstance(HNewInstance* instruction) {
diff --git a/compiler/optimizing/code_generator_arm64.h b/compiler/optimizing/code_generator_arm64.h
index d6a5f9d1fa..a9dca92980 100644
--- a/compiler/optimizing/code_generator_arm64.h
+++ b/compiler/optimizing/code_generator_arm64.h
@@ -540,7 +540,7 @@ class CodeGeneratorARM64 : public CodeGenerator {
// ADRP (pass `adrp_label = null`) or the ADD (pass `adrp_label` pointing
// to the associated ADRP patch label).
vixl::aarch64::Label* NewPcRelativeStringPatch(const DexFile& dex_file,
- uint32_t string_index,
+ dex::StringIndex string_index,
vixl::aarch64::Label* adrp_label = nullptr);
// Add a new PC-relative type patch for an instruction and return the label
@@ -551,6 +551,14 @@ class CodeGeneratorARM64 : public CodeGenerator {
dex::TypeIndex type_index,
vixl::aarch64::Label* adrp_label = nullptr);
+ // Add a new .bss entry type patch for an instruction and return the label
+ // to be bound before the instruction. The instruction will be either the
+ // ADRP (pass `adrp_label = null`) or the ADD (pass `adrp_label` pointing
+ // to the associated ADRP patch label).
+ vixl::aarch64::Label* NewBssEntryTypePatch(const DexFile& dex_file,
+ dex::TypeIndex type_index,
+ vixl::aarch64::Label* adrp_label = nullptr);
+
// Add a new PC-relative dex cache array patch for an instruction and return
// the label to be bound before the instruction. The instruction will be
// either the ADRP (pass `adrp_label = null`) or the LDR (pass `adrp_label`
@@ -571,7 +579,7 @@ class CodeGeneratorARM64 : public CodeGenerator {
Handle<mirror::String> handle);
vixl::aarch64::Literal<uint32_t>* DeduplicateJitClassLiteral(const DexFile& dex_file,
dex::TypeIndex string_index,
- uint64_t address);
+ Handle<mirror::Class> handle);
void EmitAdrpPlaceholder(vixl::aarch64::Label* fixup_label, vixl::aarch64::Register reg);
void EmitAddPlaceholder(vixl::aarch64::Label* fixup_label,
@@ -744,8 +752,10 @@ class CodeGeneratorARM64 : public CodeGenerator {
ArenaDeque<PcRelativePatchInfo> pc_relative_string_patches_;
// Deduplication map for boot type literals for kBootImageLinkTimeAddress.
TypeToLiteralMap boot_image_type_patches_;
- // PC-relative type patch info.
+ // PC-relative type patch info for kBootImageLinkTimePcRelative.
ArenaDeque<PcRelativePatchInfo> pc_relative_type_patches_;
+ // PC-relative type patch info for kBssEntry.
+ ArenaDeque<PcRelativePatchInfo> type_bss_entry_patches_;
// Deduplication map for patchable boot image addresses.
Uint32ToLiteralMap boot_image_address_patches_;
diff --git a/compiler/optimizing/code_generator_arm_vixl.cc b/compiler/optimizing/code_generator_arm_vixl.cc
index c769decaa0..592ee5aba6 100644
--- a/compiler/optimizing/code_generator_arm_vixl.cc
+++ b/compiler/optimizing/code_generator_arm_vixl.cc
@@ -394,22 +394,23 @@ class BoundsCheckSlowPathARMVIXL : public SlowPathCodeARMVIXL {
class LoadClassSlowPathARMVIXL : public SlowPathCodeARMVIXL {
public:
LoadClassSlowPathARMVIXL(HLoadClass* cls, HInstruction* at, uint32_t dex_pc, bool do_clinit)
- : SlowPathCodeARMVIXL(at), cls_(cls), at_(at), dex_pc_(dex_pc), do_clinit_(do_clinit) {
+ : SlowPathCodeARMVIXL(at), cls_(cls), dex_pc_(dex_pc), do_clinit_(do_clinit) {
DCHECK(at->IsLoadClass() || at->IsClinitCheck());
}
void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
- LocationSummary* locations = at_->GetLocations();
+ LocationSummary* locations = instruction_->GetLocations();
CodeGeneratorARMVIXL* arm_codegen = down_cast<CodeGeneratorARMVIXL*>(codegen);
__ Bind(GetEntryLabel());
SaveLiveRegisters(codegen, locations);
InvokeRuntimeCallingConventionARMVIXL calling_convention;
- __ Mov(calling_convention.GetRegisterAt(0), cls_->GetTypeIndex().index_);
+ dex::TypeIndex type_index = cls_->GetTypeIndex();
+ __ Mov(calling_convention.GetRegisterAt(0), type_index.index_);
QuickEntrypointEnum entrypoint = do_clinit_ ? kQuickInitializeStaticStorage
: kQuickInitializeType;
- arm_codegen->InvokeRuntime(entrypoint, at_, dex_pc_, this);
+ arm_codegen->InvokeRuntime(entrypoint, instruction_, dex_pc_, this);
if (do_clinit_) {
CheckEntrypointTypes<kQuickInitializeStaticStorage, void*, uint32_t>();
} else {
@@ -423,6 +424,20 @@ class LoadClassSlowPathARMVIXL : public SlowPathCodeARMVIXL {
arm_codegen->Move32(locations->Out(), LocationFrom(r0));
}
RestoreLiveRegisters(codegen, locations);
+ // For HLoadClass/kBssEntry, store the resolved Class to the BSS entry.
+ DCHECK_EQ(instruction_->IsLoadClass(), cls_ == instruction_);
+ if (cls_ == instruction_ && cls_->GetLoadKind() == HLoadClass::LoadKind::kBssEntry) {
+ DCHECK(out.IsValid());
+ // TODO: Change art_quick_initialize_type/art_quick_initialize_static_storage to
+ // kSaveEverything and use a temporary for the .bss entry address in the fast path,
+ // so that we can avoid another calculation here.
+ UseScratchRegisterScope temps(down_cast<CodeGeneratorARMVIXL*>(codegen)->GetVIXLAssembler());
+ vixl32::Register temp = temps.Acquire();
+ CodeGeneratorARMVIXL::PcRelativePatchInfo* labels =
+ arm_codegen->NewTypeBssEntryPatch(cls_->GetDexFile(), type_index);
+ arm_codegen->EmitMovwMovtPlaceholder(labels, temp);
+ __ Str(OutputRegister(cls_), MemOperand(temp));
+ }
__ B(GetExitLabel());
}
@@ -432,10 +447,6 @@ class LoadClassSlowPathARMVIXL : public SlowPathCodeARMVIXL {
// The class this slow path will load.
HLoadClass* const cls_;
- // The instruction where this slow path is happening.
- // (Might be the load class or an initialization check).
- HInstruction* const at_;
-
// The dex PC of `at_`.
const uint32_t dex_pc_;
@@ -454,7 +465,7 @@ class LoadStringSlowPathARMVIXL : public SlowPathCodeARMVIXL {
LocationSummary* locations = instruction_->GetLocations();
DCHECK(!locations->GetLiveRegisters()->ContainsCoreRegister(locations->Out().reg()));
HLoadString* load = instruction_->AsLoadString();
- const uint32_t string_index = load->GetStringIndex().index_;
+ const dex::StringIndex string_index = load->GetStringIndex();
vixl32::Register out = OutputRegister(load);
vixl32::Register temp = RegisterFrom(locations->GetTemp(0));
constexpr bool call_saves_everything_except_r0 = (!kUseReadBarrier || kUseBakerReadBarrier);
@@ -473,7 +484,7 @@ class LoadStringSlowPathARMVIXL : public SlowPathCodeARMVIXL {
__ Mov(entry_address, temp);
}
- __ Mov(calling_convention.GetRegisterAt(0), string_index);
+ __ Mov(calling_convention.GetRegisterAt(0), string_index.index_);
arm_codegen->InvokeRuntime(kQuickResolveString, instruction_, instruction_->GetDexPc(), this);
CheckEntrypointTypes<kQuickResolveString, void*, uint32_t>();
@@ -1252,6 +1263,7 @@ CodeGeneratorARMVIXL::CodeGeneratorARMVIXL(HGraph* graph,
boot_image_type_patches_(TypeReferenceValueComparator(),
graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
pc_relative_type_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ type_bss_entry_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
boot_image_address_patches_(std::less<uint32_t>(),
graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
jit_string_patches_(StringReferenceValueComparator(),
@@ -2445,6 +2457,14 @@ void InstructionCodeGeneratorARMVIXL::VisitInvokeInterface(HInvokeInterface* inv
}
}
+void LocationsBuilderARMVIXL::VisitInvokePolymorphic(HInvokePolymorphic* invoke) {
+ HandleInvoke(invoke);
+}
+
+void InstructionCodeGeneratorARMVIXL::VisitInvokePolymorphic(HInvokePolymorphic* invoke) {
+ codegen_->GenerateInvokePolymorphicCall(invoke);
+}
+
void LocationsBuilderARMVIXL::VisitNeg(HNeg* neg) {
LocationSummary* locations =
new (GetGraph()->GetArena()) LocationSummary(neg, LocationSummary::kNoCall);
@@ -3977,19 +3997,16 @@ void LocationsBuilderARMVIXL::VisitNewArray(HNewArray* instruction) {
LocationSummary* locations =
new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kCallOnMainOnly);
InvokeRuntimeCallingConventionARMVIXL calling_convention;
- locations->AddTemp(LocationFrom(calling_convention.GetRegisterAt(0)));
locations->SetOut(LocationFrom(r0));
locations->SetInAt(0, LocationFrom(calling_convention.GetRegisterAt(1)));
locations->SetInAt(1, LocationFrom(calling_convention.GetRegisterAt(2)));
}
void InstructionCodeGeneratorARMVIXL::VisitNewArray(HNewArray* instruction) {
- InvokeRuntimeCallingConventionARMVIXL calling_convention;
- __ Mov(calling_convention.GetRegisterAt(0), instruction->GetTypeIndex().index_);
// Note: if heap poisoning is enabled, the entry point takes cares
// of poisoning the reference.
- codegen_->InvokeRuntime(instruction->GetEntrypoint(), instruction, instruction->GetDexPc());
- CheckEntrypointTypes<kQuickAllocArrayWithAccessCheck, void*, uint32_t, int32_t, ArtMethod*>();
+ codegen_->InvokeRuntime(kQuickAllocArrayResolved, instruction, instruction->GetDexPc());
+ CheckEntrypointTypes<kQuickAllocArrayResolved, void*, mirror::Class*, int32_t>();
}
void LocationsBuilderARMVIXL::VisitParameterValue(HParameterValue* instruction) {
@@ -5789,17 +5806,11 @@ HLoadClass::LoadKind CodeGeneratorARMVIXL::GetSupportedLoadClassKind(
break;
case HLoadClass::LoadKind::kBootImageAddress:
break;
- case HLoadClass::LoadKind::kJitTableAddress:
- break;
- case HLoadClass::LoadKind::kDexCachePcRelative:
+ case HLoadClass::LoadKind::kBssEntry:
DCHECK(!Runtime::Current()->UseJitCompilation());
- // We disable pc-relative load when there is an irreducible loop, as the optimization
- // is incompatible with it.
- // TODO: Create as many ArmDexCacheArraysBase instructions as needed for methods
- // with irreducible loops.
- if (GetGraph()->HasIrreducibleLoops()) {
- return HLoadClass::LoadKind::kDexCacheViaMethod;
- }
+ break;
+ case HLoadClass::LoadKind::kJitTableAddress:
+ DCHECK(Runtime::Current()->UseJitCompilation());
break;
case HLoadClass::LoadKind::kDexCacheViaMethod:
break;
@@ -5808,15 +5819,16 @@ HLoadClass::LoadKind CodeGeneratorARMVIXL::GetSupportedLoadClassKind(
}
void LocationsBuilderARMVIXL::VisitLoadClass(HLoadClass* cls) {
- if (cls->NeedsAccessCheck()) {
+ HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+ if (load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
InvokeRuntimeCallingConventionARMVIXL calling_convention;
- CodeGenerator::CreateLoadClassLocationSummary(
+ CodeGenerator::CreateLoadClassRuntimeCallLocationSummary(
cls,
LocationFrom(calling_convention.GetRegisterAt(0)),
- LocationFrom(r0),
- /* code_generator_supports_read_barrier */ true);
+ LocationFrom(r0));
return;
}
+ DCHECK(!cls->NeedsAccessCheck());
const bool requires_read_barrier = kEmitCompilerReadBarrier && !cls->IsInBootImage();
LocationSummary::CallKind call_kind = (cls->NeedsEnvironment() || requires_read_barrier)
@@ -5827,24 +5839,23 @@ void LocationsBuilderARMVIXL::VisitLoadClass(HLoadClass* cls) {
locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
- HLoadClass::LoadKind load_kind = cls->GetLoadKind();
- if (load_kind == HLoadClass::LoadKind::kReferrersClass ||
- load_kind == HLoadClass::LoadKind::kDexCacheViaMethod ||
- load_kind == HLoadClass::LoadKind::kDexCachePcRelative) {
+ if (load_kind == HLoadClass::LoadKind::kReferrersClass) {
locations->SetInAt(0, Location::RequiresRegister());
}
locations->SetOut(Location::RequiresRegister());
}
-void InstructionCodeGeneratorARMVIXL::VisitLoadClass(HLoadClass* cls) {
- LocationSummary* locations = cls->GetLocations();
- if (cls->NeedsAccessCheck()) {
- codegen_->MoveConstant(locations->GetTemp(0), cls->GetTypeIndex().index_);
- codegen_->InvokeRuntime(kQuickInitializeTypeAndVerifyAccess, cls, cls->GetDexPc());
- CheckEntrypointTypes<kQuickInitializeTypeAndVerifyAccess, void*, uint32_t>();
+// NO_THREAD_SAFETY_ANALYSIS as we manipulate handles whose internal object we know does not
+// move.
+void InstructionCodeGeneratorARMVIXL::VisitLoadClass(HLoadClass* cls) NO_THREAD_SAFETY_ANALYSIS {
+ HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+ if (load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
+ codegen_->GenerateLoadClassRuntimeCall(cls);
return;
}
+ DCHECK(!cls->NeedsAccessCheck());
+ LocationSummary* locations = cls->GetLocations();
Location out_loc = locations->Out();
vixl32::Register out = OutputRegister(cls);
@@ -5852,7 +5863,7 @@ void InstructionCodeGeneratorARMVIXL::VisitLoadClass(HLoadClass* cls) {
? kWithoutReadBarrier
: kCompilerReadBarrierOption;
bool generate_null_check = false;
- switch (cls->GetLoadKind()) {
+ switch (load_kind) {
case HLoadClass::LoadKind::kReferrersClass: {
DCHECK(!cls->CanCallRuntime());
DCHECK(!cls->MustGenerateClinitCheck());
@@ -5866,12 +5877,14 @@ void InstructionCodeGeneratorARMVIXL::VisitLoadClass(HLoadClass* cls) {
break;
}
case HLoadClass::LoadKind::kBootImageLinkTimeAddress: {
+ DCHECK(codegen_->GetCompilerOptions().IsBootImage());
DCHECK_EQ(read_barrier_option, kWithoutReadBarrier);
__ Ldr(out, codegen_->DeduplicateBootImageTypeLiteral(cls->GetDexFile(),
cls->GetTypeIndex()));
break;
}
case HLoadClass::LoadKind::kBootImageLinkTimePcRelative: {
+ DCHECK(codegen_->GetCompilerOptions().IsBootImage());
DCHECK_EQ(read_barrier_option, kWithoutReadBarrier);
CodeGeneratorARMVIXL::PcRelativePatchInfo* labels =
codegen_->NewPcRelativeTypePatch(cls->GetDexFile(), cls->GetTypeIndex());
@@ -5880,43 +5893,31 @@ void InstructionCodeGeneratorARMVIXL::VisitLoadClass(HLoadClass* cls) {
}
case HLoadClass::LoadKind::kBootImageAddress: {
DCHECK_EQ(read_barrier_option, kWithoutReadBarrier);
- DCHECK_NE(cls->GetAddress(), 0u);
- uint32_t address = dchecked_integral_cast<uint32_t>(cls->GetAddress());
+ uint32_t address = dchecked_integral_cast<uint32_t>(
+ reinterpret_cast<uintptr_t>(cls->GetClass().Get()));
+ DCHECK_NE(address, 0u);
__ Ldr(out, codegen_->DeduplicateBootImageAddressLiteral(address));
break;
}
+ case HLoadClass::LoadKind::kBssEntry: {
+ CodeGeneratorARMVIXL::PcRelativePatchInfo* labels =
+ codegen_->NewTypeBssEntryPatch(cls->GetDexFile(), cls->GetTypeIndex());
+ codegen_->EmitMovwMovtPlaceholder(labels, out);
+ GenerateGcRootFieldLoad(cls, out_loc, out, 0, kCompilerReadBarrierOption);
+ generate_null_check = true;
+ break;
+ }
case HLoadClass::LoadKind::kJitTableAddress: {
__ Ldr(out, codegen_->DeduplicateJitClassLiteral(cls->GetDexFile(),
cls->GetTypeIndex(),
- cls->GetAddress()));
+ cls->GetClass()));
// /* GcRoot<mirror::Class> */ out = *out
GenerateGcRootFieldLoad(cls, out_loc, out, /* offset */ 0, kCompilerReadBarrierOption);
break;
}
- case HLoadClass::LoadKind::kDexCachePcRelative: {
- vixl32::Register base_reg = InputRegisterAt(cls, 0);
- HArmDexCacheArraysBase* base = cls->InputAt(0)->AsArmDexCacheArraysBase();
- int32_t offset = cls->GetDexCacheElementOffset() - base->GetElementOffset();
- // /* GcRoot<mirror::Class> */ out = *(dex_cache_arrays_base + offset)
- GenerateGcRootFieldLoad(cls, out_loc, base_reg, offset, read_barrier_option);
- generate_null_check = !cls->IsInDexCache();
- break;
- }
- case HLoadClass::LoadKind::kDexCacheViaMethod: {
- // /* GcRoot<mirror::Class>[] */ out =
- // current_method.ptr_sized_fields_->dex_cache_resolved_types_
- vixl32::Register current_method = InputRegisterAt(cls, 0);
- const int32_t resolved_types_offset =
- ArtMethod::DexCacheResolvedTypesOffset(kArmPointerSize).Int32Value();
- GetAssembler()->LoadFromOffset(kLoadWord, out, current_method, resolved_types_offset);
- // /* GcRoot<mirror::Class> */ out = out[type_index]
- size_t offset = CodeGenerator::GetCacheOffset(cls->GetTypeIndex().index_);
- GenerateGcRootFieldLoad(cls, out_loc, out, offset, read_barrier_option);
- generate_null_check = !cls->IsInDexCache();
- break;
- }
- default:
- TODO_VIXL32(FATAL);
+ case HLoadClass::LoadKind::kDexCacheViaMethod:
+ LOG(FATAL) << "UNREACHABLE";
+ UNREACHABLE();
}
if (generate_null_check || cls->MustGenerateClinitCheck()) {
@@ -6038,7 +6039,7 @@ void InstructionCodeGeneratorARMVIXL::VisitLoadString(HLoadString* load) NO_THRE
case HLoadString::LoadKind::kBootImageLinkTimePcRelative: {
DCHECK(codegen_->GetCompilerOptions().IsBootImage());
CodeGeneratorARMVIXL::PcRelativePatchInfo* labels =
- codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex().index_);
+ codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex());
codegen_->EmitMovwMovtPlaceholder(labels, out);
return; // No dex cache slow path.
}
@@ -6053,7 +6054,7 @@ void InstructionCodeGeneratorARMVIXL::VisitLoadString(HLoadString* load) NO_THRE
DCHECK(!codegen_->GetCompilerOptions().IsBootImage());
vixl32::Register temp = RegisterFrom(locations->GetTemp(0));
CodeGeneratorARMVIXL::PcRelativePatchInfo* labels =
- codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex().index_);
+ codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex());
codegen_->EmitMovwMovtPlaceholder(labels, temp);
GenerateGcRootFieldLoad(load, out_loc, temp, /* offset */ 0, kCompilerReadBarrierOption);
LoadStringSlowPathARMVIXL* slow_path =
@@ -7397,8 +7398,8 @@ void CodeGeneratorARMVIXL::GenerateVirtualCall(HInvokeVirtual* invoke, Location
}
CodeGeneratorARMVIXL::PcRelativePatchInfo* CodeGeneratorARMVIXL::NewPcRelativeStringPatch(
- const DexFile& dex_file, uint32_t string_index) {
- return NewPcRelativePatch(dex_file, string_index, &pc_relative_string_patches_);
+ const DexFile& dex_file, dex::StringIndex string_index) {
+ return NewPcRelativePatch(dex_file, string_index.index_, &pc_relative_string_patches_);
}
CodeGeneratorARMVIXL::PcRelativePatchInfo* CodeGeneratorARMVIXL::NewPcRelativeTypePatch(
@@ -7406,6 +7407,11 @@ CodeGeneratorARMVIXL::PcRelativePatchInfo* CodeGeneratorARMVIXL::NewPcRelativeTy
return NewPcRelativePatch(dex_file, type_index.index_, &pc_relative_type_patches_);
}
+CodeGeneratorARMVIXL::PcRelativePatchInfo* CodeGeneratorARMVIXL::NewTypeBssEntryPatch(
+ const DexFile& dex_file, dex::TypeIndex type_index) {
+ return NewPcRelativePatch(dex_file, type_index.index_, &type_bss_entry_patches_);
+}
+
CodeGeneratorARMVIXL::PcRelativePatchInfo* CodeGeneratorARMVIXL::NewPcRelativeDexCacheArrayPatch(
const DexFile& dex_file, uint32_t element_offset) {
return NewPcRelativePatch(dex_file, element_offset, &pc_relative_dex_cache_patches_);
@@ -7462,8 +7468,9 @@ VIXLUInt32Literal* CodeGeneratorARMVIXL::DeduplicateJitStringLiteral(
VIXLUInt32Literal* CodeGeneratorARMVIXL::DeduplicateJitClassLiteral(const DexFile& dex_file,
dex::TypeIndex type_index,
- uint64_t address) {
- jit_class_roots_.Overwrite(TypeReference(&dex_file, type_index), address);
+ Handle<mirror::Class> handle) {
+ jit_class_roots_.Overwrite(TypeReference(&dex_file, type_index),
+ reinterpret_cast64<uint64_t>(handle.GetReference()));
return jit_class_patches_.GetOrCreate(
TypeReference(&dex_file, type_index),
[this]() {
@@ -7499,6 +7506,7 @@ void CodeGeneratorARMVIXL::EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_pa
/* MOVW+MOVT for each entry */ 2u * pc_relative_string_patches_.size() +
boot_image_type_patches_.size() +
/* MOVW+MOVT for each entry */ 2u * pc_relative_type_patches_.size() +
+ /* MOVW+MOVT for each entry */ 2u * type_bss_entry_patches_.size() +
boot_image_address_patches_.size();
linker_patches->reserve(size);
EmitPcRelativeLinkerPatches<LinkerPatch::DexCacheArrayPatch>(pc_relative_dex_cache_patches_,
@@ -7513,12 +7521,17 @@ void CodeGeneratorARMVIXL::EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_pa
target_string.string_index.index_));
}
if (!GetCompilerOptions().IsBootImage()) {
+ DCHECK(pc_relative_type_patches_.empty());
EmitPcRelativeLinkerPatches<LinkerPatch::StringBssEntryPatch>(pc_relative_string_patches_,
linker_patches);
} else {
+ EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(pc_relative_type_patches_,
+ linker_patches);
EmitPcRelativeLinkerPatches<LinkerPatch::RelativeStringPatch>(pc_relative_string_patches_,
linker_patches);
}
+ EmitPcRelativeLinkerPatches<LinkerPatch::TypeBssEntryPatch>(type_bss_entry_patches_,
+ linker_patches);
for (const auto& entry : boot_image_type_patches_) {
const TypeReference& target_type = entry.first;
VIXLUInt32Literal* literal = entry.second;
@@ -7528,8 +7541,6 @@ void CodeGeneratorARMVIXL::EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_pa
target_type.dex_file,
target_type.type_index.index_));
}
- EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(pc_relative_type_patches_,
- linker_patches);
for (const auto& entry : boot_image_address_patches_) {
DCHECK(GetCompilerOptions().GetIncludePatchInformation());
VIXLUInt32Literal* literal = entry.second;
@@ -7537,6 +7548,7 @@ void CodeGeneratorARMVIXL::EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_pa
uint32_t literal_offset = literal->GetLocation();
linker_patches->push_back(LinkerPatch::RecordPosition(literal_offset));
}
+ DCHECK_EQ(size, linker_patches->size());
}
VIXLUInt32Literal* CodeGeneratorARMVIXL::DeduplicateUint32Literal(
diff --git a/compiler/optimizing/code_generator_arm_vixl.h b/compiler/optimizing/code_generator_arm_vixl.h
index 200a463c75..be653535ea 100644
--- a/compiler/optimizing/code_generator_arm_vixl.h
+++ b/compiler/optimizing/code_generator_arm_vixl.h
@@ -562,8 +562,10 @@ class CodeGeneratorARMVIXL : public CodeGenerator {
vixl::aarch32::Label add_pc_label;
};
- PcRelativePatchInfo* NewPcRelativeStringPatch(const DexFile& dex_file, uint32_t string_index);
+ PcRelativePatchInfo* NewPcRelativeStringPatch(const DexFile& dex_file,
+ dex::StringIndex string_index);
PcRelativePatchInfo* NewPcRelativeTypePatch(const DexFile& dex_file, dex::TypeIndex type_index);
+ PcRelativePatchInfo* NewTypeBssEntryPatch(const DexFile& dex_file, dex::TypeIndex type_index);
PcRelativePatchInfo* NewPcRelativeDexCacheArrayPatch(const DexFile& dex_file,
uint32_t element_offset);
VIXLUInt32Literal* DeduplicateBootImageStringLiteral(const DexFile& dex_file,
@@ -577,7 +579,7 @@ class CodeGeneratorARMVIXL : public CodeGenerator {
Handle<mirror::String> handle);
VIXLUInt32Literal* DeduplicateJitClassLiteral(const DexFile& dex_file,
dex::TypeIndex type_index,
- uint64_t address);
+ Handle<mirror::Class> handle);
void EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_patches) OVERRIDE;
@@ -731,8 +733,10 @@ class CodeGeneratorARMVIXL : public CodeGenerator {
ArenaDeque<PcRelativePatchInfo> pc_relative_string_patches_;
// Deduplication map for boot type literals for kBootImageLinkTimeAddress.
TypeToLiteralMap boot_image_type_patches_;
- // PC-relative type patch info.
+ // PC-relative type patch info for kBootImageLinkTimePcRelative.
ArenaDeque<PcRelativePatchInfo> pc_relative_type_patches_;
+ // PC-relative type patch info for kBssEntry.
+ ArenaDeque<PcRelativePatchInfo> type_bss_entry_patches_;
// Deduplication map for patchable boot image addresses.
Uint32ToLiteralMap boot_image_address_patches_;
diff --git a/compiler/optimizing/code_generator_mips.cc b/compiler/optimizing/code_generator_mips.cc
index bc62854e5d..a0383826d3 100644
--- a/compiler/optimizing/code_generator_mips.cc
+++ b/compiler/optimizing/code_generator_mips.cc
@@ -213,23 +213,24 @@ class LoadClassSlowPathMIPS : public SlowPathCodeMIPS {
HInstruction* at,
uint32_t dex_pc,
bool do_clinit)
- : SlowPathCodeMIPS(at), cls_(cls), at_(at), dex_pc_(dex_pc), do_clinit_(do_clinit) {
+ : SlowPathCodeMIPS(at), cls_(cls), dex_pc_(dex_pc), do_clinit_(do_clinit) {
DCHECK(at->IsLoadClass() || at->IsClinitCheck());
}
void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
- LocationSummary* locations = at_->GetLocations();
+ LocationSummary* locations = instruction_->GetLocations();
CodeGeneratorMIPS* mips_codegen = down_cast<CodeGeneratorMIPS*>(codegen);
__ Bind(GetEntryLabel());
SaveLiveRegisters(codegen, locations);
InvokeRuntimeCallingConvention calling_convention;
- __ LoadConst32(calling_convention.GetRegisterAt(0), cls_->GetTypeIndex().index_);
+ dex::TypeIndex type_index = cls_->GetTypeIndex();
+ __ LoadConst32(calling_convention.GetRegisterAt(0), type_index.index_);
QuickEntrypointEnum entrypoint = do_clinit_ ? kQuickInitializeStaticStorage
: kQuickInitializeType;
- mips_codegen->InvokeRuntime(entrypoint, at_, dex_pc_, this);
+ mips_codegen->InvokeRuntime(entrypoint, instruction_, dex_pc_, this);
if (do_clinit_) {
CheckEntrypointTypes<kQuickInitializeStaticStorage, void*, uint32_t>();
} else {
@@ -240,11 +241,26 @@ class LoadClassSlowPathMIPS : public SlowPathCodeMIPS {
Location out = locations->Out();
if (out.IsValid()) {
DCHECK(out.IsRegister() && !locations->GetLiveRegisters()->ContainsCoreRegister(out.reg()));
- Primitive::Type type = at_->GetType();
+ Primitive::Type type = instruction_->GetType();
mips_codegen->MoveLocation(out, calling_convention.GetReturnLocation(type), type);
}
RestoreLiveRegisters(codegen, locations);
+ // For HLoadClass/kBssEntry, store the resolved Class to the BSS entry.
+ DCHECK_EQ(instruction_->IsLoadClass(), cls_ == instruction_);
+ if (cls_ == instruction_ && cls_->GetLoadKind() == HLoadClass::LoadKind::kBssEntry) {
+ DCHECK(out.IsValid());
+ // TODO: Change art_quick_initialize_type/art_quick_initialize_static_storage to
+ // kSaveEverything and use a temporary for the .bss entry address in the fast path,
+ // so that we can avoid another calculation here.
+ bool isR6 = mips_codegen->GetInstructionSetFeatures().IsR6();
+ Register base = isR6 ? ZERO : locations->InAt(0).AsRegister<Register>();
+ DCHECK_NE(out.AsRegister<Register>(), AT);
+ CodeGeneratorMIPS::PcRelativePatchInfo* info =
+ mips_codegen->NewTypeBssEntryPatch(cls_->GetDexFile(), type_index);
+ mips_codegen->EmitPcRelativeAddressPlaceholder(info, TMP, base);
+ __ StoreToOffset(kStoreWord, out.AsRegister<Register>(), TMP, 0);
+ }
__ B(GetExitLabel());
}
@@ -254,10 +270,6 @@ class LoadClassSlowPathMIPS : public SlowPathCodeMIPS {
// The class this slow path will load.
HLoadClass* const cls_;
- // The instruction where this slow path is happening.
- // (Might be the load class or an initialization check).
- HInstruction* const at_;
-
// The dex PC of `at_`.
const uint32_t dex_pc_;
@@ -281,8 +293,8 @@ class LoadStringSlowPathMIPS : public SlowPathCodeMIPS {
InvokeRuntimeCallingConvention calling_convention;
HLoadString* load = instruction_->AsLoadString();
- const uint32_t string_index = load->GetStringIndex().index_;
- __ LoadConst32(calling_convention.GetRegisterAt(0), string_index);
+ const dex::StringIndex string_index = load->GetStringIndex();
+ __ LoadConst32(calling_convention.GetRegisterAt(0), string_index.index_);
mips_codegen->InvokeRuntime(kQuickResolveString, instruction_, instruction_->GetDexPc(), this);
CheckEntrypointTypes<kQuickResolveString, void*, uint32_t>();
Primitive::Type type = instruction_->GetType();
@@ -465,6 +477,7 @@ CodeGeneratorMIPS::CodeGeneratorMIPS(HGraph* graph,
boot_image_type_patches_(TypeReferenceValueComparator(),
graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
pc_relative_type_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ type_bss_entry_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
boot_image_address_patches_(std::less<uint32_t>(),
graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
clobbered_ra_(false) {
@@ -1007,6 +1020,7 @@ void CodeGeneratorMIPS::EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_patch
pc_relative_dex_cache_patches_.size() +
pc_relative_string_patches_.size() +
pc_relative_type_patches_.size() +
+ type_bss_entry_patches_.size() +
boot_image_string_patches_.size() +
boot_image_type_patches_.size() +
boot_image_address_patches_.size();
@@ -1014,13 +1028,16 @@ void CodeGeneratorMIPS::EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_patch
EmitPcRelativeLinkerPatches<LinkerPatch::DexCacheArrayPatch>(pc_relative_dex_cache_patches_,
linker_patches);
if (!GetCompilerOptions().IsBootImage()) {
+ DCHECK(pc_relative_type_patches_.empty());
EmitPcRelativeLinkerPatches<LinkerPatch::StringBssEntryPatch>(pc_relative_string_patches_,
linker_patches);
} else {
+ EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(pc_relative_type_patches_,
+ linker_patches);
EmitPcRelativeLinkerPatches<LinkerPatch::RelativeStringPatch>(pc_relative_string_patches_,
linker_patches);
}
- EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(pc_relative_type_patches_,
+ EmitPcRelativeLinkerPatches<LinkerPatch::TypeBssEntryPatch>(type_bss_entry_patches_,
linker_patches);
for (const auto& entry : boot_image_string_patches_) {
const StringReference& target_string = entry.first;
@@ -1047,11 +1064,12 @@ void CodeGeneratorMIPS::EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_patch
uint32_t literal_offset = __ GetLabelLocation(literal->GetLabel());
linker_patches->push_back(LinkerPatch::RecordPosition(literal_offset));
}
+ DCHECK_EQ(size, linker_patches->size());
}
CodeGeneratorMIPS::PcRelativePatchInfo* CodeGeneratorMIPS::NewPcRelativeStringPatch(
- const DexFile& dex_file, uint32_t string_index) {
- return NewPcRelativePatch(dex_file, string_index, &pc_relative_string_patches_);
+ const DexFile& dex_file, dex::StringIndex string_index) {
+ return NewPcRelativePatch(dex_file, string_index.index_, &pc_relative_string_patches_);
}
CodeGeneratorMIPS::PcRelativePatchInfo* CodeGeneratorMIPS::NewPcRelativeTypePatch(
@@ -1059,6 +1077,11 @@ CodeGeneratorMIPS::PcRelativePatchInfo* CodeGeneratorMIPS::NewPcRelativeTypePatc
return NewPcRelativePatch(dex_file, type_index.index_, &pc_relative_type_patches_);
}
+CodeGeneratorMIPS::PcRelativePatchInfo* CodeGeneratorMIPS::NewTypeBssEntryPatch(
+ const DexFile& dex_file, dex::TypeIndex type_index) {
+ return NewPcRelativePatch(dex_file, type_index.index_, &type_bss_entry_patches_);
+}
+
CodeGeneratorMIPS::PcRelativePatchInfo* CodeGeneratorMIPS::NewPcRelativeDexCacheArrayPatch(
const DexFile& dex_file, uint32_t element_offset) {
return NewPcRelativePatch(dex_file, element_offset, &pc_relative_dex_cache_patches_);
@@ -5154,6 +5177,14 @@ void LocationsBuilderMIPS::VisitInvokeStaticOrDirect(HInvokeStaticOrDirect* invo
}
}
+void LocationsBuilderMIPS::VisitInvokePolymorphic(HInvokePolymorphic* invoke) {
+ HandleInvoke(invoke);
+}
+
+void InstructionCodeGeneratorMIPS::VisitInvokePolymorphic(HInvokePolymorphic* invoke) {
+ codegen_->GenerateInvokePolymorphicCall(invoke);
+}
+
static bool TryGenerateIntrinsicCode(HInvoke* invoke, CodeGeneratorMIPS* codegen) {
if (invoke->GetLocations()->Intrinsified()) {
IntrinsicCodeGeneratorMIPS intrinsic(codegen);
@@ -5186,14 +5217,14 @@ HLoadString::LoadKind CodeGeneratorMIPS::GetSupportedLoadStringKind(
case HLoadString::LoadKind::kBssEntry:
DCHECK(!Runtime::Current()->UseJitCompilation());
break;
- case HLoadString::LoadKind::kDexCacheViaMethod:
- fallback_load = false;
- break;
case HLoadString::LoadKind::kJitTableAddress:
DCHECK(Runtime::Current()->UseJitCompilation());
// TODO: implement.
fallback_load = true;
break;
+ case HLoadString::LoadKind::kDexCacheViaMethod:
+ fallback_load = false;
+ break;
}
if (fallback_load) {
desired_string_load_kind = HLoadString::LoadKind::kDexCacheViaMethod;
@@ -5222,15 +5253,13 @@ HLoadClass::LoadKind CodeGeneratorMIPS::GetSupportedLoadClassKind(
break;
case HLoadClass::LoadKind::kBootImageAddress:
break;
+ case HLoadClass::LoadKind::kBssEntry:
+ DCHECK(!Runtime::Current()->UseJitCompilation());
+ break;
case HLoadClass::LoadKind::kJitTableAddress:
DCHECK(Runtime::Current()->UseJitCompilation());
fallback_load = true;
break;
- case HLoadClass::LoadKind::kDexCachePcRelative:
- DCHECK(!Runtime::Current()->UseJitCompilation());
- // TODO: Create as many MipsDexCacheArraysBase instructions as needed for methods
- // with irreducible loops.
- break;
case HLoadClass::LoadKind::kDexCacheViaMethod:
fallback_load = false;
break;
@@ -5427,34 +5456,32 @@ void InstructionCodeGeneratorMIPS::VisitInvokeVirtual(HInvokeVirtual* invoke) {
}
void LocationsBuilderMIPS::VisitLoadClass(HLoadClass* cls) {
- if (cls->NeedsAccessCheck()) {
+ HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+ if (load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
InvokeRuntimeCallingConvention calling_convention;
- CodeGenerator::CreateLoadClassLocationSummary(
+ CodeGenerator::CreateLoadClassRuntimeCallLocationSummary(
cls,
Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
- Location::RegisterLocation(V0),
- /* code_generator_supports_read_barrier */ false); // TODO: revisit this bool.
+ Location::RegisterLocation(V0));
return;
}
+ DCHECK(!cls->NeedsAccessCheck());
LocationSummary::CallKind call_kind = (cls->NeedsEnvironment() || kEmitCompilerReadBarrier)
? LocationSummary::kCallOnSlowPath
: LocationSummary::kNoCall;
LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(cls, call_kind);
- HLoadClass::LoadKind load_kind = cls->GetLoadKind();
switch (load_kind) {
// We need an extra register for PC-relative literals on R2.
case HLoadClass::LoadKind::kBootImageLinkTimeAddress:
- case HLoadClass::LoadKind::kBootImageAddress:
case HLoadClass::LoadKind::kBootImageLinkTimePcRelative:
+ case HLoadClass::LoadKind::kBootImageAddress:
+ case HLoadClass::LoadKind::kBssEntry:
if (codegen_->GetInstructionSetFeatures().IsR6()) {
break;
}
FALLTHROUGH_INTENDED;
- // We need an extra register for PC-relative dex cache accesses.
- case HLoadClass::LoadKind::kDexCachePcRelative:
case HLoadClass::LoadKind::kReferrersClass:
- case HLoadClass::LoadKind::kDexCacheViaMethod:
locations->SetInAt(0, Location::RequiresRegister());
break;
default:
@@ -5463,16 +5490,17 @@ void LocationsBuilderMIPS::VisitLoadClass(HLoadClass* cls) {
locations->SetOut(Location::RequiresRegister());
}
-void InstructionCodeGeneratorMIPS::VisitLoadClass(HLoadClass* cls) {
- LocationSummary* locations = cls->GetLocations();
- if (cls->NeedsAccessCheck()) {
- codegen_->MoveConstant(locations->GetTemp(0), cls->GetTypeIndex().index_);
- codegen_->InvokeRuntime(kQuickInitializeTypeAndVerifyAccess, cls, cls->GetDexPc());
- CheckEntrypointTypes<kQuickInitializeTypeAndVerifyAccess, void*, uint32_t>();
+// NO_THREAD_SAFETY_ANALYSIS as we manipulate handles whose internal object we know does not
+// move.
+void InstructionCodeGeneratorMIPS::VisitLoadClass(HLoadClass* cls) NO_THREAD_SAFETY_ANALYSIS {
+ HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+ if (load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
+ codegen_->GenerateLoadClassRuntimeCall(cls);
return;
}
+ DCHECK(!cls->NeedsAccessCheck());
- HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+ LocationSummary* locations = cls->GetLocations();
Location out_loc = locations->Out();
Register out = out_loc.AsRegister<Register>();
Register base_or_current_method_reg;
@@ -5480,12 +5508,11 @@ void InstructionCodeGeneratorMIPS::VisitLoadClass(HLoadClass* cls) {
switch (load_kind) {
// We need an extra register for PC-relative literals on R2.
case HLoadClass::LoadKind::kBootImageLinkTimeAddress:
- case HLoadClass::LoadKind::kBootImageAddress:
case HLoadClass::LoadKind::kBootImageLinkTimePcRelative:
+ case HLoadClass::LoadKind::kBootImageAddress:
+ case HLoadClass::LoadKind::kBssEntry:
base_or_current_method_reg = isR6 ? ZERO : locations->InAt(0).AsRegister<Register>();
break;
- // We need an extra register for PC-relative dex cache accesses.
- case HLoadClass::LoadKind::kDexCachePcRelative:
case HLoadClass::LoadKind::kReferrersClass:
case HLoadClass::LoadKind::kDexCacheViaMethod:
base_or_current_method_reg = locations->InAt(0).AsRegister<Register>();
@@ -5508,14 +5535,14 @@ void InstructionCodeGeneratorMIPS::VisitLoadClass(HLoadClass* cls) {
break;
}
case HLoadClass::LoadKind::kBootImageLinkTimeAddress:
- DCHECK(!kEmitCompilerReadBarrier);
+ DCHECK(codegen_->GetCompilerOptions().IsBootImage());
__ LoadLiteral(out,
base_or_current_method_reg,
codegen_->DeduplicateBootImageTypeLiteral(cls->GetDexFile(),
cls->GetTypeIndex()));
break;
case HLoadClass::LoadKind::kBootImageLinkTimePcRelative: {
- DCHECK(!kEmitCompilerReadBarrier);
+ DCHECK(codegen_->GetCompilerOptions().IsBootImage());
CodeGeneratorMIPS::PcRelativePatchInfo* info =
codegen_->NewPcRelativeTypePatch(cls->GetDexFile(), cls->GetTypeIndex());
codegen_->EmitPcRelativeAddressPlaceholder(info, out, base_or_current_method_reg);
@@ -5523,38 +5550,29 @@ void InstructionCodeGeneratorMIPS::VisitLoadClass(HLoadClass* cls) {
}
case HLoadClass::LoadKind::kBootImageAddress: {
DCHECK(!kEmitCompilerReadBarrier);
- DCHECK_NE(cls->GetAddress(), 0u);
- uint32_t address = dchecked_integral_cast<uint32_t>(cls->GetAddress());
+ uint32_t address = dchecked_integral_cast<uint32_t>(
+ reinterpret_cast<uintptr_t>(cls->GetClass().Get()));
+ DCHECK_NE(address, 0u);
__ LoadLiteral(out,
base_or_current_method_reg,
codegen_->DeduplicateBootImageAddressLiteral(address));
break;
}
- case HLoadClass::LoadKind::kJitTableAddress: {
- LOG(FATAL) << "Unimplemented";
+ case HLoadClass::LoadKind::kBssEntry: {
+ CodeGeneratorMIPS::PcRelativePatchInfo* info =
+ codegen_->NewTypeBssEntryPatch(cls->GetDexFile(), cls->GetTypeIndex());
+ codegen_->EmitPcRelativeAddressPlaceholder(info, out, base_or_current_method_reg);
+ __ LoadFromOffset(kLoadWord, out, out, 0);
+ generate_null_check = true;
break;
}
- case HLoadClass::LoadKind::kDexCachePcRelative: {
- HMipsDexCacheArraysBase* base = cls->InputAt(0)->AsMipsDexCacheArraysBase();
- int32_t offset =
- cls->GetDexCacheElementOffset() - base->GetElementOffset() - kDexCacheArrayLwOffset;
- // /* GcRoot<mirror::Class> */ out = *(dex_cache_arrays_base + offset)
- GenerateGcRootFieldLoad(cls, out_loc, base_or_current_method_reg, offset);
- generate_null_check = !cls->IsInDexCache();
+ case HLoadClass::LoadKind::kJitTableAddress: {
+ LOG(FATAL) << "Unimplemented";
break;
}
- case HLoadClass::LoadKind::kDexCacheViaMethod: {
- // /* GcRoot<mirror::Class>[] */ out =
- // current_method.ptr_sized_fields_->dex_cache_resolved_types_
- __ LoadFromOffset(kLoadWord,
- out,
- base_or_current_method_reg,
- ArtMethod::DexCacheResolvedTypesOffset(kArmPointerSize).Int32Value());
- // /* GcRoot<mirror::Class> */ out = out[type_index]
- size_t offset = CodeGenerator::GetCacheOffset(cls->GetTypeIndex().index_);
- GenerateGcRootFieldLoad(cls, out_loc, out, offset);
- generate_null_check = !cls->IsInDexCache();
- }
+ case HLoadClass::LoadKind::kDexCacheViaMethod:
+ LOG(FATAL) << "UNREACHABLE";
+ UNREACHABLE();
}
if (generate_null_check || cls->MustGenerateClinitCheck()) {
@@ -5649,6 +5667,7 @@ void InstructionCodeGeneratorMIPS::VisitLoadString(HLoadString* load) NO_THREAD_
switch (load_kind) {
case HLoadString::LoadKind::kBootImageLinkTimeAddress:
+ DCHECK(codegen_->GetCompilerOptions().IsBootImage());
__ LoadLiteral(out,
base_or_current_method_reg,
codegen_->DeduplicateBootImageStringLiteral(load->GetDexFile(),
@@ -5657,7 +5676,7 @@ void InstructionCodeGeneratorMIPS::VisitLoadString(HLoadString* load) NO_THREAD_
case HLoadString::LoadKind::kBootImageLinkTimePcRelative: {
DCHECK(codegen_->GetCompilerOptions().IsBootImage());
CodeGeneratorMIPS::PcRelativePatchInfo* info =
- codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex().index_);
+ codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex());
codegen_->EmitPcRelativeAddressPlaceholder(info, out, base_or_current_method_reg);
return; // No dex cache slow path.
}
@@ -5673,7 +5692,7 @@ void InstructionCodeGeneratorMIPS::VisitLoadString(HLoadString* load) NO_THREAD_
case HLoadString::LoadKind::kBssEntry: {
DCHECK(!codegen_->GetCompilerOptions().IsBootImage());
CodeGeneratorMIPS::PcRelativePatchInfo* info =
- codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex().index_);
+ codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex());
codegen_->EmitPcRelativeAddressPlaceholder(info, out, base_or_current_method_reg);
__ LoadFromOffset(kLoadWord, out, out, 0);
SlowPathCodeMIPS* slow_path = new (GetGraph()->GetArena()) LoadStringSlowPathMIPS(load);
@@ -5878,21 +5897,14 @@ void LocationsBuilderMIPS::VisitNewArray(HNewArray* instruction) {
LocationSummary* locations =
new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kCallOnMainOnly);
InvokeRuntimeCallingConvention calling_convention;
- locations->AddTemp(Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
- locations->AddTemp(Location::RegisterLocation(calling_convention.GetRegisterAt(2)));
locations->SetOut(calling_convention.GetReturnLocation(Primitive::kPrimNot));
- locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
+ locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
+ locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
}
void InstructionCodeGeneratorMIPS::VisitNewArray(HNewArray* instruction) {
- InvokeRuntimeCallingConvention calling_convention;
- Register current_method_register = calling_convention.GetRegisterAt(2);
- __ Lw(current_method_register, SP, kCurrentMethodStackOffset);
- // Move an uint16_t value to a register.
- __ LoadConst32(calling_convention.GetRegisterAt(0), instruction->GetTypeIndex().index_);
- codegen_->InvokeRuntime(instruction->GetEntrypoint(), instruction, instruction->GetDexPc());
- CheckEntrypointTypes<kQuickAllocArrayWithAccessCheck,
- void*, uint32_t, int32_t, ArtMethod*>();
+ codegen_->InvokeRuntime(kQuickAllocArrayResolved, instruction, instruction->GetDexPc());
+ CheckEntrypointTypes<kQuickAllocArrayResolved, void*, mirror::Class*, int32_t>();
}
void LocationsBuilderMIPS::VisitNewInstance(HNewInstance* instruction) {
diff --git a/compiler/optimizing/code_generator_mips.h b/compiler/optimizing/code_generator_mips.h
index 7b0812cb7b..c8fd325999 100644
--- a/compiler/optimizing/code_generator_mips.h
+++ b/compiler/optimizing/code_generator_mips.h
@@ -452,8 +452,10 @@ class CodeGeneratorMIPS : public CodeGenerator {
MipsLabel pc_rel_label;
};
- PcRelativePatchInfo* NewPcRelativeStringPatch(const DexFile& dex_file, uint32_t string_index);
+ PcRelativePatchInfo* NewPcRelativeStringPatch(const DexFile& dex_file,
+ dex::StringIndex string_index);
PcRelativePatchInfo* NewPcRelativeTypePatch(const DexFile& dex_file, dex::TypeIndex type_index);
+ PcRelativePatchInfo* NewTypeBssEntryPatch(const DexFile& dex_file, dex::TypeIndex type_index);
PcRelativePatchInfo* NewPcRelativeDexCacheArrayPatch(const DexFile& dex_file,
uint32_t element_offset);
Literal* DeduplicateBootImageStringLiteral(const DexFile& dex_file,
@@ -504,8 +506,10 @@ class CodeGeneratorMIPS : public CodeGenerator {
ArenaDeque<PcRelativePatchInfo> pc_relative_string_patches_;
// Deduplication map for boot type literals for kBootImageLinkTimeAddress.
BootTypeToLiteralMap boot_image_type_patches_;
- // PC-relative type patch info.
+ // PC-relative type patch info for kBootImageLinkTimePcRelative.
ArenaDeque<PcRelativePatchInfo> pc_relative_type_patches_;
+ // PC-relative type patch info for kBssEntry.
+ ArenaDeque<PcRelativePatchInfo> type_bss_entry_patches_;
// Deduplication map for patchable boot image addresses.
Uint32ToLiteralMap boot_image_address_patches_;
diff --git a/compiler/optimizing/code_generator_mips64.cc b/compiler/optimizing/code_generator_mips64.cc
index 1b9c6da460..446dea659e 100644
--- a/compiler/optimizing/code_generator_mips64.cc
+++ b/compiler/optimizing/code_generator_mips64.cc
@@ -167,22 +167,23 @@ class LoadClassSlowPathMIPS64 : public SlowPathCodeMIPS64 {
HInstruction* at,
uint32_t dex_pc,
bool do_clinit)
- : SlowPathCodeMIPS64(at), cls_(cls), at_(at), dex_pc_(dex_pc), do_clinit_(do_clinit) {
+ : SlowPathCodeMIPS64(at), cls_(cls), dex_pc_(dex_pc), do_clinit_(do_clinit) {
DCHECK(at->IsLoadClass() || at->IsClinitCheck());
}
void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
- LocationSummary* locations = at_->GetLocations();
+ LocationSummary* locations = instruction_->GetLocations();
CodeGeneratorMIPS64* mips64_codegen = down_cast<CodeGeneratorMIPS64*>(codegen);
__ Bind(GetEntryLabel());
SaveLiveRegisters(codegen, locations);
InvokeRuntimeCallingConvention calling_convention;
- __ LoadConst32(calling_convention.GetRegisterAt(0), cls_->GetTypeIndex().index_);
+ dex::TypeIndex type_index = cls_->GetTypeIndex();
+ __ LoadConst32(calling_convention.GetRegisterAt(0), type_index.index_);
QuickEntrypointEnum entrypoint = do_clinit_ ? kQuickInitializeStaticStorage
: kQuickInitializeType;
- mips64_codegen->InvokeRuntime(entrypoint, at_, dex_pc_, this);
+ mips64_codegen->InvokeRuntime(entrypoint, instruction_, dex_pc_, this);
if (do_clinit_) {
CheckEntrypointTypes<kQuickInitializeStaticStorage, void*, uint32_t>();
} else {
@@ -193,11 +194,24 @@ class LoadClassSlowPathMIPS64 : public SlowPathCodeMIPS64 {
Location out = locations->Out();
if (out.IsValid()) {
DCHECK(out.IsRegister() && !locations->GetLiveRegisters()->ContainsCoreRegister(out.reg()));
- Primitive::Type type = at_->GetType();
+ Primitive::Type type = instruction_->GetType();
mips64_codegen->MoveLocation(out, calling_convention.GetReturnLocation(type), type);
}
RestoreLiveRegisters(codegen, locations);
+ // For HLoadClass/kBssEntry, store the resolved Class to the BSS entry.
+ DCHECK_EQ(instruction_->IsLoadClass(), cls_ == instruction_);
+ if (cls_ == instruction_ && cls_->GetLoadKind() == HLoadClass::LoadKind::kBssEntry) {
+ DCHECK(out.IsValid());
+ // TODO: Change art_quick_initialize_type/art_quick_initialize_static_storage to
+ // kSaveEverything and use a temporary for the .bss entry address in the fast path,
+ // so that we can avoid another calculation here.
+ DCHECK_NE(out.AsRegister<GpuRegister>(), AT);
+ CodeGeneratorMIPS64::PcRelativePatchInfo* info =
+ mips64_codegen->NewTypeBssEntryPatch(cls_->GetDexFile(), type_index);
+ mips64_codegen->EmitPcRelativeAddressPlaceholderHigh(info, AT);
+ __ Sw(out.AsRegister<GpuRegister>(), AT, /* placeholder */ 0x5678);
+ }
__ Bc(GetExitLabel());
}
@@ -207,10 +221,6 @@ class LoadClassSlowPathMIPS64 : public SlowPathCodeMIPS64 {
// The class this slow path will load.
HLoadClass* const cls_;
- // The instruction where this slow path is happening.
- // (Might be the load class or an initialization check).
- HInstruction* const at_;
-
// The dex PC of `at_`.
const uint32_t dex_pc_;
@@ -234,8 +244,8 @@ class LoadStringSlowPathMIPS64 : public SlowPathCodeMIPS64 {
InvokeRuntimeCallingConvention calling_convention;
HLoadString* load = instruction_->AsLoadString();
- const uint32_t string_index = instruction_->AsLoadString()->GetStringIndex().index_;
- __ LoadConst32(calling_convention.GetRegisterAt(0), string_index);
+ const dex::StringIndex string_index = instruction_->AsLoadString()->GetStringIndex();
+ __ LoadConst32(calling_convention.GetRegisterAt(0), string_index.index_);
mips64_codegen->InvokeRuntime(kQuickResolveString,
instruction_,
instruction_->GetDexPc(),
@@ -422,6 +432,7 @@ CodeGeneratorMIPS64::CodeGeneratorMIPS64(HGraph* graph,
boot_image_type_patches_(TypeReferenceValueComparator(),
graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
pc_relative_type_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ type_bss_entry_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
boot_image_address_patches_(std::less<uint32_t>(),
graph->GetArena()->Adapter(kArenaAllocCodeGenerator)) {
// Save RA (containing the return address) to mimic Quick.
@@ -922,6 +933,7 @@ void CodeGeneratorMIPS64::EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_pat
pc_relative_dex_cache_patches_.size() +
pc_relative_string_patches_.size() +
pc_relative_type_patches_.size() +
+ type_bss_entry_patches_.size() +
boot_image_string_patches_.size() +
boot_image_type_patches_.size() +
boot_image_address_patches_.size();
@@ -929,13 +941,16 @@ void CodeGeneratorMIPS64::EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_pat
EmitPcRelativeLinkerPatches<LinkerPatch::DexCacheArrayPatch>(pc_relative_dex_cache_patches_,
linker_patches);
if (!GetCompilerOptions().IsBootImage()) {
+ DCHECK(pc_relative_type_patches_.empty());
EmitPcRelativeLinkerPatches<LinkerPatch::StringBssEntryPatch>(pc_relative_string_patches_,
linker_patches);
} else {
+ EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(pc_relative_type_patches_,
+ linker_patches);
EmitPcRelativeLinkerPatches<LinkerPatch::RelativeStringPatch>(pc_relative_string_patches_,
linker_patches);
}
- EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(pc_relative_type_patches_,
+ EmitPcRelativeLinkerPatches<LinkerPatch::TypeBssEntryPatch>(type_bss_entry_patches_,
linker_patches);
for (const auto& entry : boot_image_string_patches_) {
const StringReference& target_string = entry.first;
@@ -962,11 +977,12 @@ void CodeGeneratorMIPS64::EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_pat
uint32_t literal_offset = __ GetLabelLocation(literal->GetLabel());
linker_patches->push_back(LinkerPatch::RecordPosition(literal_offset));
}
+ DCHECK_EQ(size, linker_patches->size());
}
CodeGeneratorMIPS64::PcRelativePatchInfo* CodeGeneratorMIPS64::NewPcRelativeStringPatch(
- const DexFile& dex_file, uint32_t string_index) {
- return NewPcRelativePatch(dex_file, string_index, &pc_relative_string_patches_);
+ const DexFile& dex_file, dex::StringIndex string_index) {
+ return NewPcRelativePatch(dex_file, string_index.index_, &pc_relative_string_patches_);
}
CodeGeneratorMIPS64::PcRelativePatchInfo* CodeGeneratorMIPS64::NewPcRelativeTypePatch(
@@ -974,6 +990,11 @@ CodeGeneratorMIPS64::PcRelativePatchInfo* CodeGeneratorMIPS64::NewPcRelativeType
return NewPcRelativePatch(dex_file, type_index.index_, &pc_relative_type_patches_);
}
+CodeGeneratorMIPS64::PcRelativePatchInfo* CodeGeneratorMIPS64::NewTypeBssEntryPatch(
+ const DexFile& dex_file, dex::TypeIndex type_index) {
+ return NewPcRelativePatch(dex_file, type_index.index_, &type_bss_entry_patches_);
+}
+
CodeGeneratorMIPS64::PcRelativePatchInfo* CodeGeneratorMIPS64::NewPcRelativeDexCacheArrayPatch(
const DexFile& dex_file, uint32_t element_offset) {
return NewPcRelativePatch(dex_file, element_offset, &pc_relative_dex_cache_patches_);
@@ -3095,7 +3116,7 @@ void InstructionCodeGeneratorMIPS64::GenerateGcRootFieldLoad(
Location root,
GpuRegister obj,
uint32_t offset) {
- // When handling HLoadClass::LoadKind::kDexCachePcRelative, the caller calls
+ // When handling PC-relative loads, the caller calls
// EmitPcRelativeAddressPlaceholderHigh() and then GenerateGcRootFieldLoad().
// The relative patcher expects the two methods to emit the following patchable
// sequence of instructions in this case:
@@ -3256,6 +3277,14 @@ void LocationsBuilderMIPS64::VisitInvokeStaticOrDirect(HInvokeStaticOrDirect* in
HandleInvoke(invoke);
}
+void LocationsBuilderMIPS64::VisitInvokePolymorphic(HInvokePolymorphic* invoke) {
+ HandleInvoke(invoke);
+}
+
+void InstructionCodeGeneratorMIPS64::VisitInvokePolymorphic(HInvokePolymorphic* invoke) {
+ codegen_->GenerateInvokePolymorphicCall(invoke);
+}
+
static bool TryGenerateIntrinsicCode(HInvoke* invoke, CodeGeneratorMIPS64* codegen) {
if (invoke->GetLocations()->Intrinsified()) {
IntrinsicCodeGeneratorMIPS64 intrinsic(codegen);
@@ -3314,14 +3343,14 @@ HLoadClass::LoadKind CodeGeneratorMIPS64::GetSupportedLoadClassKind(
break;
case HLoadClass::LoadKind::kBootImageAddress:
break;
+ case HLoadClass::LoadKind::kBssEntry:
+ DCHECK(!Runtime::Current()->UseJitCompilation());
+ break;
case HLoadClass::LoadKind::kJitTableAddress:
DCHECK(Runtime::Current()->UseJitCompilation());
// TODO: implement.
fallback_load = true;
break;
- case HLoadClass::LoadKind::kDexCachePcRelative:
- DCHECK(!Runtime::Current()->UseJitCompilation());
- break;
case HLoadClass::LoadKind::kDexCacheViaMethod:
break;
}
@@ -3366,7 +3395,7 @@ void CodeGeneratorMIPS64::GenerateStaticOrDirectCall(HInvokeStaticOrDirect* invo
case HInvokeStaticOrDirect::MethodLoadKind::kDexCachePcRelative: {
uint32_t offset = invoke->GetDexCacheArrayOffset();
CodeGeneratorMIPS64::PcRelativePatchInfo* info =
- NewPcRelativeDexCacheArrayPatch(invoke->GetDexFile(), offset);
+ NewPcRelativeDexCacheArrayPatch(invoke->GetDexFileForPcRelativeDexCache(), offset);
EmitPcRelativeAddressPlaceholderHigh(info, AT);
__ Ld(temp.AsRegister<GpuRegister>(), AT, /* placeholder */ 0x5678);
break;
@@ -3474,38 +3503,38 @@ void InstructionCodeGeneratorMIPS64::VisitInvokeVirtual(HInvokeVirtual* invoke)
}
void LocationsBuilderMIPS64::VisitLoadClass(HLoadClass* cls) {
- if (cls->NeedsAccessCheck()) {
+ HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+ if (load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
InvokeRuntimeCallingConvention calling_convention;
- CodeGenerator::CreateLoadClassLocationSummary(
+ CodeGenerator::CreateLoadClassRuntimeCallLocationSummary(
cls,
Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
- calling_convention.GetReturnLocation(Primitive::kPrimNot),
- /* code_generator_supports_read_barrier */ false);
+ calling_convention.GetReturnLocation(Primitive::kPrimNot));
return;
}
+ DCHECK(!cls->NeedsAccessCheck());
LocationSummary::CallKind call_kind = (cls->NeedsEnvironment() || kEmitCompilerReadBarrier)
? LocationSummary::kCallOnSlowPath
: LocationSummary::kNoCall;
LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(cls, call_kind);
- HLoadClass::LoadKind load_kind = cls->GetLoadKind();
- if (load_kind == HLoadClass::LoadKind::kReferrersClass ||
- load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
+ if (load_kind == HLoadClass::LoadKind::kReferrersClass) {
locations->SetInAt(0, Location::RequiresRegister());
}
locations->SetOut(Location::RequiresRegister());
}
-void InstructionCodeGeneratorMIPS64::VisitLoadClass(HLoadClass* cls) {
- LocationSummary* locations = cls->GetLocations();
- if (cls->NeedsAccessCheck()) {
- codegen_->MoveConstant(locations->GetTemp(0), cls->GetTypeIndex().index_);
- codegen_->InvokeRuntime(kQuickInitializeTypeAndVerifyAccess, cls, cls->GetDexPc());
- CheckEntrypointTypes<kQuickInitializeTypeAndVerifyAccess, void*, uint32_t>();
+// NO_THREAD_SAFETY_ANALYSIS as we manipulate handles whose internal object we know does not
+// move.
+void InstructionCodeGeneratorMIPS64::VisitLoadClass(HLoadClass* cls) NO_THREAD_SAFETY_ANALYSIS {
+ HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+ if (load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
+ codegen_->GenerateLoadClassRuntimeCall(cls);
return;
}
+ DCHECK(!cls->NeedsAccessCheck());
- HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+ LocationSummary* locations = cls->GetLocations();
Location out_loc = locations->Out();
GpuRegister out = out_loc.AsRegister<GpuRegister>();
GpuRegister current_method_reg = ZERO;
@@ -3526,14 +3555,14 @@ void InstructionCodeGeneratorMIPS64::VisitLoadClass(HLoadClass* cls) {
ArtMethod::DeclaringClassOffset().Int32Value());
break;
case HLoadClass::LoadKind::kBootImageLinkTimeAddress:
- DCHECK(!kEmitCompilerReadBarrier);
+ DCHECK(codegen_->GetCompilerOptions().IsBootImage());
__ LoadLiteral(out,
kLoadUnsignedWord,
codegen_->DeduplicateBootImageTypeLiteral(cls->GetDexFile(),
cls->GetTypeIndex()));
break;
case HLoadClass::LoadKind::kBootImageLinkTimePcRelative: {
- DCHECK(!kEmitCompilerReadBarrier);
+ DCHECK(codegen_->GetCompilerOptions().IsBootImage());
CodeGeneratorMIPS64::PcRelativePatchInfo* info =
codegen_->NewPcRelativeTypePatch(cls->GetDexFile(), cls->GetTypeIndex());
codegen_->EmitPcRelativeAddressPlaceholderHigh(info, AT);
@@ -3542,39 +3571,29 @@ void InstructionCodeGeneratorMIPS64::VisitLoadClass(HLoadClass* cls) {
}
case HLoadClass::LoadKind::kBootImageAddress: {
DCHECK(!kEmitCompilerReadBarrier);
- DCHECK_NE(cls->GetAddress(), 0u);
- uint32_t address = dchecked_integral_cast<uint32_t>(cls->GetAddress());
+ uint32_t address = dchecked_integral_cast<uint32_t>(
+ reinterpret_cast<uintptr_t>(cls->GetClass().Get()));
+ DCHECK_NE(address, 0u);
__ LoadLiteral(out,
kLoadUnsignedWord,
codegen_->DeduplicateBootImageAddressLiteral(address));
break;
}
- case HLoadClass::LoadKind::kJitTableAddress: {
- LOG(FATAL) << "Unimplemented";
- break;
- }
- case HLoadClass::LoadKind::kDexCachePcRelative: {
- uint32_t element_offset = cls->GetDexCacheElementOffset();
+ case HLoadClass::LoadKind::kBssEntry: {
CodeGeneratorMIPS64::PcRelativePatchInfo* info =
- codegen_->NewPcRelativeDexCacheArrayPatch(cls->GetDexFile(), element_offset);
+ codegen_->NewTypeBssEntryPatch(cls->GetDexFile(), cls->GetTypeIndex());
codegen_->EmitPcRelativeAddressPlaceholderHigh(info, AT);
- // /* GcRoot<mirror::Class> */ out = *address /* PC-relative */
- GenerateGcRootFieldLoad(cls, out_loc, AT, /* placeholder */ 0x5678);
- generate_null_check = !cls->IsInDexCache();
+ __ Lwu(out, AT, /* placeholder */ 0x5678);
+ generate_null_check = true;
break;
}
- case HLoadClass::LoadKind::kDexCacheViaMethod: {
- // /* GcRoot<mirror::Class>[] */ out =
- // current_method.ptr_sized_fields_->dex_cache_resolved_types_
- __ LoadFromOffset(kLoadDoubleword,
- out,
- current_method_reg,
- ArtMethod::DexCacheResolvedTypesOffset(kMips64PointerSize).Int32Value());
- // /* GcRoot<mirror::Class> */ out = out[type_index]
- size_t offset = CodeGenerator::GetCacheOffset(cls->GetTypeIndex().index_);
- GenerateGcRootFieldLoad(cls, out_loc, out, offset);
- generate_null_check = !cls->IsInDexCache();
+ case HLoadClass::LoadKind::kJitTableAddress: {
+ LOG(FATAL) << "Unimplemented";
+ break;
}
+ case HLoadClass::LoadKind::kDexCacheViaMethod:
+ LOG(FATAL) << "UNREACHABLE";
+ UNREACHABLE();
}
if (generate_null_check || cls->MustGenerateClinitCheck()) {
@@ -3638,6 +3657,7 @@ void InstructionCodeGeneratorMIPS64::VisitLoadString(HLoadString* load) NO_THREA
switch (load_kind) {
case HLoadString::LoadKind::kBootImageLinkTimeAddress:
+ DCHECK(codegen_->GetCompilerOptions().IsBootImage());
__ LoadLiteral(out,
kLoadUnsignedWord,
codegen_->DeduplicateBootImageStringLiteral(load->GetDexFile(),
@@ -3646,7 +3666,7 @@ void InstructionCodeGeneratorMIPS64::VisitLoadString(HLoadString* load) NO_THREA
case HLoadString::LoadKind::kBootImageLinkTimePcRelative: {
DCHECK(codegen_->GetCompilerOptions().IsBootImage());
CodeGeneratorMIPS64::PcRelativePatchInfo* info =
- codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex().index_);
+ codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex());
codegen_->EmitPcRelativeAddressPlaceholderHigh(info, AT);
__ Daddiu(out, AT, /* placeholder */ 0x5678);
return; // No dex cache slow path.
@@ -3663,7 +3683,7 @@ void InstructionCodeGeneratorMIPS64::VisitLoadString(HLoadString* load) NO_THREA
case HLoadString::LoadKind::kBssEntry: {
DCHECK(!codegen_->GetCompilerOptions().IsBootImage());
CodeGeneratorMIPS64::PcRelativePatchInfo* info =
- codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex().index_);
+ codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex());
codegen_->EmitPcRelativeAddressPlaceholderHigh(info, AT);
__ Lwu(out, AT, /* placeholder */ 0x5678);
SlowPathCodeMIPS64* slow_path = new (GetGraph()->GetArena()) LoadStringSlowPathMIPS64(load);
@@ -3821,19 +3841,14 @@ void LocationsBuilderMIPS64::VisitNewArray(HNewArray* instruction) {
LocationSummary* locations =
new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kCallOnMainOnly);
InvokeRuntimeCallingConvention calling_convention;
- locations->AddTemp(Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
locations->SetOut(calling_convention.GetReturnLocation(Primitive::kPrimNot));
- locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
- locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(2)));
+ locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
+ locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
}
void InstructionCodeGeneratorMIPS64::VisitNewArray(HNewArray* instruction) {
- LocationSummary* locations = instruction->GetLocations();
- // Move an uint16_t value to a register.
- __ LoadConst32(locations->GetTemp(0).AsRegister<GpuRegister>(),
- instruction->GetTypeIndex().index_);
- codegen_->InvokeRuntime(instruction->GetEntrypoint(), instruction, instruction->GetDexPc());
- CheckEntrypointTypes<kQuickAllocArrayWithAccessCheck, void*, uint32_t, int32_t, ArtMethod*>();
+ codegen_->InvokeRuntime(kQuickAllocArrayResolved, instruction, instruction->GetDexPc());
+ CheckEntrypointTypes<kQuickAllocArrayResolved, void*, mirror::Class*, int32_t>();
}
void LocationsBuilderMIPS64::VisitNewInstance(HNewInstance* instruction) {
diff --git a/compiler/optimizing/code_generator_mips64.h b/compiler/optimizing/code_generator_mips64.h
index 8ac919f47e..52b780c106 100644
--- a/compiler/optimizing/code_generator_mips64.h
+++ b/compiler/optimizing/code_generator_mips64.h
@@ -411,8 +411,10 @@ class CodeGeneratorMIPS64 : public CodeGenerator {
Mips64Label pc_rel_label;
};
- PcRelativePatchInfo* NewPcRelativeStringPatch(const DexFile& dex_file, uint32_t string_index);
+ PcRelativePatchInfo* NewPcRelativeStringPatch(const DexFile& dex_file,
+ dex::StringIndex string_index);
PcRelativePatchInfo* NewPcRelativeTypePatch(const DexFile& dex_file, dex::TypeIndex type_index);
+ PcRelativePatchInfo* NewTypeBssEntryPatch(const DexFile& dex_file, dex::TypeIndex type_index);
PcRelativePatchInfo* NewPcRelativeDexCacheArrayPatch(const DexFile& dex_file,
uint32_t element_offset);
PcRelativePatchInfo* NewPcRelativeCallPatch(const DexFile& dex_file,
@@ -469,8 +471,10 @@ class CodeGeneratorMIPS64 : public CodeGenerator {
ArenaDeque<PcRelativePatchInfo> pc_relative_string_patches_;
// Deduplication map for boot type literals for kBootImageLinkTimeAddress.
BootTypeToLiteralMap boot_image_type_patches_;
- // PC-relative type patch info.
+ // PC-relative type patch info for kBootImageLinkTimePcRelative.
ArenaDeque<PcRelativePatchInfo> pc_relative_type_patches_;
+ // PC-relative type patch info for kBssEntry.
+ ArenaDeque<PcRelativePatchInfo> type_bss_entry_patches_;
// Deduplication map for patchable boot image addresses.
Uint32ToLiteralMap boot_image_address_patches_;
diff --git a/compiler/optimizing/code_generator_x86.cc b/compiler/optimizing/code_generator_x86.cc
index a9b717db4f..853c91fac8 100644
--- a/compiler/optimizing/code_generator_x86.cc
+++ b/compiler/optimizing/code_generator_x86.cc
@@ -225,8 +225,8 @@ class LoadStringSlowPathX86 : public SlowPathCode {
SaveLiveRegisters(codegen, locations);
InvokeRuntimeCallingConvention calling_convention;
- const uint32_t string_index = instruction_->AsLoadString()->GetStringIndex().index_;
- __ movl(calling_convention.GetRegisterAt(0), Immediate(string_index));
+ const dex::StringIndex string_index = instruction_->AsLoadString()->GetStringIndex();
+ __ movl(calling_convention.GetRegisterAt(0), Immediate(string_index.index_));
x86_codegen->InvokeRuntime(kQuickResolveString, instruction_, instruction_->GetDexPc(), this);
CheckEntrypointTypes<kQuickResolveString, void*, uint32_t>();
x86_codegen->Move32(locations->Out(), Location::RegisterLocation(EAX));
@@ -254,21 +254,24 @@ class LoadClassSlowPathX86 : public SlowPathCode {
HInstruction* at,
uint32_t dex_pc,
bool do_clinit)
- : SlowPathCode(at), cls_(cls), at_(at), dex_pc_(dex_pc), do_clinit_(do_clinit) {
+ : SlowPathCode(at), cls_(cls), dex_pc_(dex_pc), do_clinit_(do_clinit) {
DCHECK(at->IsLoadClass() || at->IsClinitCheck());
}
void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
- LocationSummary* locations = at_->GetLocations();
+ LocationSummary* locations = instruction_->GetLocations();
CodeGeneratorX86* x86_codegen = down_cast<CodeGeneratorX86*>(codegen);
__ Bind(GetEntryLabel());
SaveLiveRegisters(codegen, locations);
InvokeRuntimeCallingConvention calling_convention;
- __ movl(calling_convention.GetRegisterAt(0), Immediate(cls_->GetTypeIndex().index_));
+ dex::TypeIndex type_index = cls_->GetTypeIndex();
+ __ movl(calling_convention.GetRegisterAt(0), Immediate(type_index.index_));
x86_codegen->InvokeRuntime(do_clinit_ ? kQuickInitializeStaticStorage
: kQuickInitializeType,
- at_, dex_pc_, this);
+ instruction_,
+ dex_pc_,
+ this);
if (do_clinit_) {
CheckEntrypointTypes<kQuickInitializeStaticStorage, void*, uint32_t>();
} else {
@@ -281,8 +284,17 @@ class LoadClassSlowPathX86 : public SlowPathCode {
DCHECK(out.IsRegister() && !locations->GetLiveRegisters()->ContainsCoreRegister(out.reg()));
x86_codegen->Move32(out, Location::RegisterLocation(EAX));
}
-
RestoreLiveRegisters(codegen, locations);
+ // For HLoadClass/kBssEntry, store the resolved Class to the BSS entry.
+ DCHECK_EQ(instruction_->IsLoadClass(), cls_ == instruction_);
+ if (cls_ == instruction_ && cls_->GetLoadKind() == HLoadClass::LoadKind::kBssEntry) {
+ DCHECK(out.IsValid());
+ Register method_address = locations->InAt(0).AsRegister<Register>();
+ __ movl(Address(method_address, CodeGeneratorX86::kDummy32BitOffset),
+ locations->Out().AsRegister<Register>());
+ Label* fixup_label = x86_codegen->NewTypeBssEntryPatch(cls_);
+ __ Bind(fixup_label);
+ }
__ jmp(GetExitLabel());
}
@@ -292,10 +304,6 @@ class LoadClassSlowPathX86 : public SlowPathCode {
// The class this slow path will load.
HLoadClass* const cls_;
- // The instruction where this slow path is happening.
- // (Might be the load class or an initialization check).
- HInstruction* const at_;
-
// The dex PC of `at_`.
const uint32_t dex_pc_;
@@ -1009,7 +1017,8 @@ CodeGeneratorX86::CodeGeneratorX86(HGraph* graph,
pc_relative_dex_cache_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
simple_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
string_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
- type_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ boot_image_type_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ type_bss_entry_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
jit_string_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
jit_class_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
constant_area_start_(-1),
@@ -2244,6 +2253,14 @@ void InstructionCodeGeneratorX86::VisitInvokeInterface(HInvokeInterface* invoke)
codegen_->RecordPcInfo(invoke, invoke->GetDexPc());
}
+void LocationsBuilderX86::VisitInvokePolymorphic(HInvokePolymorphic* invoke) {
+ HandleInvoke(invoke);
+}
+
+void InstructionCodeGeneratorX86::VisitInvokePolymorphic(HInvokePolymorphic* invoke) {
+ codegen_->GenerateInvokePolymorphicCall(invoke);
+}
+
void LocationsBuilderX86::VisitNeg(HNeg* neg) {
LocationSummary* locations =
new (GetGraph()->GetArena()) LocationSummary(neg, LocationSummary::kNoCall);
@@ -4175,18 +4192,15 @@ void LocationsBuilderX86::VisitNewArray(HNewArray* instruction) {
new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kCallOnMainOnly);
locations->SetOut(Location::RegisterLocation(EAX));
InvokeRuntimeCallingConvention calling_convention;
- locations->AddTemp(Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
- locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
- locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(2)));
+ locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
+ locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
}
void InstructionCodeGeneratorX86::VisitNewArray(HNewArray* instruction) {
- InvokeRuntimeCallingConvention calling_convention;
- __ movl(calling_convention.GetRegisterAt(0), Immediate(instruction->GetTypeIndex().index_));
// Note: if heap poisoning is enabled, the entry point takes cares
// of poisoning the reference.
- codegen_->InvokeRuntime(instruction->GetEntrypoint(), instruction, instruction->GetDexPc());
- CheckEntrypointTypes<kQuickAllocArrayWithAccessCheck, void*, uint32_t, int32_t, ArtMethod*>();
+ codegen_->InvokeRuntime(kQuickAllocArrayResolved, instruction, instruction->GetDexPc());
+ CheckEntrypointTypes<kQuickAllocArrayResolved, void*, mirror::Class*, int32_t>();
DCHECK(!codegen_->IsLeafMethod());
}
@@ -4504,7 +4518,7 @@ Location CodeGeneratorX86::GenerateCalleeMethodStaticOrDirectCall(HInvokeStaticO
__ movl(temp.AsRegister<Register>(), Address(base_reg, kDummy32BitOffset));
// Bind a new fixup label at the end of the "movl" insn.
uint32_t offset = invoke->GetDexCacheArrayOffset();
- __ Bind(NewPcRelativeDexCacheArrayPatch(invoke->GetDexFile(), offset));
+ __ Bind(NewPcRelativeDexCacheArrayPatch(invoke->GetDexFileForPcRelativeDexCache(), offset));
break;
}
case HInvokeStaticOrDirect::MethodLoadKind::kDexCacheViaMethod: {
@@ -4593,9 +4607,15 @@ void CodeGeneratorX86::RecordBootStringPatch(HLoadString* load_string) {
__ Bind(&string_patches_.back().label);
}
-void CodeGeneratorX86::RecordTypePatch(HLoadClass* load_class) {
- type_patches_.emplace_back(load_class->GetDexFile(), load_class->GetTypeIndex().index_);
- __ Bind(&type_patches_.back().label);
+void CodeGeneratorX86::RecordBootTypePatch(HLoadClass* load_class) {
+ boot_image_type_patches_.emplace_back(load_class->GetDexFile(),
+ load_class->GetTypeIndex().index_);
+ __ Bind(&boot_image_type_patches_.back().label);
+}
+
+Label* CodeGeneratorX86::NewTypeBssEntryPatch(HLoadClass* load_class) {
+ type_bss_entry_patches_.emplace_back(load_class->GetDexFile(), load_class->GetTypeIndex().index_);
+ return &type_bss_entry_patches_.back().label;
}
Label* CodeGeneratorX86::NewStringBssEntryPatch(HLoadString* load_string) {
@@ -4632,7 +4652,8 @@ void CodeGeneratorX86::EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_patche
pc_relative_dex_cache_patches_.size() +
simple_patches_.size() +
string_patches_.size() +
- type_patches_.size();
+ boot_image_type_patches_.size() +
+ type_bss_entry_patches_.size();
linker_patches->reserve(size);
EmitPcRelativeLinkerPatches<LinkerPatch::DexCacheArrayPatch>(pc_relative_dex_cache_patches_,
linker_patches);
@@ -4641,24 +4662,26 @@ void CodeGeneratorX86::EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_patche
linker_patches->push_back(LinkerPatch::RecordPosition(literal_offset));
}
if (!GetCompilerOptions().IsBootImage()) {
+ DCHECK(boot_image_type_patches_.empty());
EmitPcRelativeLinkerPatches<LinkerPatch::StringBssEntryPatch>(string_patches_, linker_patches);
} else if (GetCompilerOptions().GetCompilePic()) {
+ EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(boot_image_type_patches_,
+ linker_patches);
EmitPcRelativeLinkerPatches<LinkerPatch::RelativeStringPatch>(string_patches_, linker_patches);
} else {
+ for (const PatchInfo<Label>& info : boot_image_type_patches_) {
+ uint32_t literal_offset = info.label.Position() - kLabelPositionToLiteralOffsetAdjustment;
+ linker_patches->push_back(LinkerPatch::TypePatch(literal_offset, &info.dex_file, info.index));
+ }
for (const PatchInfo<Label>& info : string_patches_) {
uint32_t literal_offset = info.label.Position() - kLabelPositionToLiteralOffsetAdjustment;
linker_patches->push_back(
LinkerPatch::StringPatch(literal_offset, &info.dex_file, info.index));
}
}
- if (GetCompilerOptions().GetCompilePic()) {
- EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(type_patches_, linker_patches);
- } else {
- for (const PatchInfo<Label>& info : type_patches_) {
- uint32_t literal_offset = info.label.Position() - kLabelPositionToLiteralOffsetAdjustment;
- linker_patches->push_back(LinkerPatch::TypePatch(literal_offset, &info.dex_file, info.index));
- }
- }
+ EmitPcRelativeLinkerPatches<LinkerPatch::TypeBssEntryPatch>(type_bss_entry_patches_,
+ linker_patches);
+ DCHECK_EQ(size, linker_patches->size());
}
void CodeGeneratorX86::MarkGCCard(Register temp,
@@ -5977,7 +6000,7 @@ HLoadClass::LoadKind CodeGeneratorX86::GetSupportedLoadClassKind(
case HLoadClass::LoadKind::kBootImageLinkTimePcRelative:
DCHECK(GetCompilerOptions().GetCompilePic());
FALLTHROUGH_INTENDED;
- case HLoadClass::LoadKind::kDexCachePcRelative:
+ case HLoadClass::LoadKind::kBssEntry:
DCHECK(!Runtime::Current()->UseJitCompilation()); // Note: boot image is also non-JIT.
// We disable pc-relative load when there is an irreducible loop, as the optimization
// is incompatible with it.
@@ -5999,15 +6022,16 @@ HLoadClass::LoadKind CodeGeneratorX86::GetSupportedLoadClassKind(
}
void LocationsBuilderX86::VisitLoadClass(HLoadClass* cls) {
- if (cls->NeedsAccessCheck()) {
+ HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+ if (load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
InvokeRuntimeCallingConvention calling_convention;
- CodeGenerator::CreateLoadClassLocationSummary(
+ CodeGenerator::CreateLoadClassRuntimeCallLocationSummary(
cls,
Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
- Location::RegisterLocation(EAX),
- /* code_generator_supports_read_barrier */ true);
+ Location::RegisterLocation(EAX));
return;
}
+ DCHECK(!cls->NeedsAccessCheck());
const bool requires_read_barrier = kEmitCompilerReadBarrier && !cls->IsInBootImage();
LocationSummary::CallKind call_kind = (cls->NeedsEnvironment() || requires_read_barrier)
@@ -6018,11 +6042,9 @@ void LocationsBuilderX86::VisitLoadClass(HLoadClass* cls) {
locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
- HLoadClass::LoadKind load_kind = cls->GetLoadKind();
if (load_kind == HLoadClass::LoadKind::kReferrersClass ||
- load_kind == HLoadClass::LoadKind::kDexCacheViaMethod ||
load_kind == HLoadClass::LoadKind::kBootImageLinkTimePcRelative ||
- load_kind == HLoadClass::LoadKind::kDexCachePcRelative) {
+ load_kind == HLoadClass::LoadKind::kBssEntry) {
locations->SetInAt(0, Location::RequiresRegister());
}
locations->SetOut(Location::RequiresRegister());
@@ -6030,23 +6052,26 @@ void LocationsBuilderX86::VisitLoadClass(HLoadClass* cls) {
Label* CodeGeneratorX86::NewJitRootClassPatch(const DexFile& dex_file,
dex::TypeIndex dex_index,
- uint64_t address) {
- jit_class_roots_.Overwrite(TypeReference(&dex_file, dex_index), address);
+ Handle<mirror::Class> handle) {
+ jit_class_roots_.Overwrite(TypeReference(&dex_file, dex_index),
+ reinterpret_cast64<uint64_t>(handle.GetReference()));
// Add a patch entry and return the label.
jit_class_patches_.emplace_back(dex_file, dex_index.index_);
PatchInfo<Label>* info = &jit_class_patches_.back();
return &info->label;
}
-void InstructionCodeGeneratorX86::VisitLoadClass(HLoadClass* cls) {
- LocationSummary* locations = cls->GetLocations();
- if (cls->NeedsAccessCheck()) {
- codegen_->MoveConstant(locations->GetTemp(0), cls->GetTypeIndex().index_);
- codegen_->InvokeRuntime(kQuickInitializeTypeAndVerifyAccess, cls, cls->GetDexPc());
- CheckEntrypointTypes<kQuickInitializeTypeAndVerifyAccess, void*, uint32_t>();
+// NO_THREAD_SAFETY_ANALYSIS as we manipulate handles whose internal object we know does not
+// move.
+void InstructionCodeGeneratorX86::VisitLoadClass(HLoadClass* cls) NO_THREAD_SAFETY_ANALYSIS {
+ HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+ if (load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
+ codegen_->GenerateLoadClassRuntimeCall(cls);
return;
}
+ DCHECK(!cls->NeedsAccessCheck());
+ LocationSummary* locations = cls->GetLocations();
Location out_loc = locations->Out();
Register out = out_loc.AsRegister<Register>();
@@ -6054,7 +6079,7 @@ void InstructionCodeGeneratorX86::VisitLoadClass(HLoadClass* cls) {
const ReadBarrierOption read_barrier_option = cls->IsInBootImage()
? kWithoutReadBarrier
: kCompilerReadBarrierOption;
- switch (cls->GetLoadKind()) {
+ switch (load_kind) {
case HLoadClass::LoadKind::kReferrersClass: {
DCHECK(!cls->CanCallRuntime());
DCHECK(!cls->MustGenerateClinitCheck());
@@ -6069,63 +6094,48 @@ void InstructionCodeGeneratorX86::VisitLoadClass(HLoadClass* cls) {
break;
}
case HLoadClass::LoadKind::kBootImageLinkTimeAddress: {
+ DCHECK(codegen_->GetCompilerOptions().IsBootImage());
DCHECK_EQ(read_barrier_option, kWithoutReadBarrier);
__ movl(out, Immediate(/* placeholder */ 0));
- codegen_->RecordTypePatch(cls);
+ codegen_->RecordBootTypePatch(cls);
break;
}
case HLoadClass::LoadKind::kBootImageLinkTimePcRelative: {
+ DCHECK(codegen_->GetCompilerOptions().IsBootImage());
DCHECK_EQ(read_barrier_option, kWithoutReadBarrier);
Register method_address = locations->InAt(0).AsRegister<Register>();
__ leal(out, Address(method_address, CodeGeneratorX86::kDummy32BitOffset));
- codegen_->RecordTypePatch(cls);
+ codegen_->RecordBootTypePatch(cls);
break;
}
case HLoadClass::LoadKind::kBootImageAddress: {
DCHECK_EQ(read_barrier_option, kWithoutReadBarrier);
- DCHECK_NE(cls->GetAddress(), 0u);
- uint32_t address = dchecked_integral_cast<uint32_t>(cls->GetAddress());
+ uint32_t address = dchecked_integral_cast<uint32_t>(
+ reinterpret_cast<uintptr_t>(cls->GetClass().Get()));
+ DCHECK_NE(address, 0u);
__ movl(out, Immediate(address));
codegen_->RecordSimplePatch();
break;
}
+ case HLoadClass::LoadKind::kBssEntry: {
+ Register method_address = locations->InAt(0).AsRegister<Register>();
+ Address address(method_address, CodeGeneratorX86::kDummy32BitOffset);
+ Label* fixup_label = codegen_->NewTypeBssEntryPatch(cls);
+ GenerateGcRootFieldLoad(cls, out_loc, address, fixup_label, read_barrier_option);
+ generate_null_check = true;
+ break;
+ }
case HLoadClass::LoadKind::kJitTableAddress: {
Address address = Address::Absolute(CodeGeneratorX86::kDummy32BitOffset);
Label* fixup_label = codegen_->NewJitRootClassPatch(
- cls->GetDexFile(), cls->GetTypeIndex(), cls->GetAddress());
+ cls->GetDexFile(), cls->GetTypeIndex(), cls->GetClass());
// /* GcRoot<mirror::Class> */ out = *address
GenerateGcRootFieldLoad(cls, out_loc, address, fixup_label, kCompilerReadBarrierOption);
break;
}
- case HLoadClass::LoadKind::kDexCachePcRelative: {
- Register base_reg = locations->InAt(0).AsRegister<Register>();
- uint32_t offset = cls->GetDexCacheElementOffset();
- Label* fixup_label = codegen_->NewPcRelativeDexCacheArrayPatch(cls->GetDexFile(), offset);
- // /* GcRoot<mirror::Class> */ out = *(base + offset) /* PC-relative */
- GenerateGcRootFieldLoad(cls,
- out_loc,
- Address(base_reg, CodeGeneratorX86::kDummy32BitOffset),
- fixup_label,
- read_barrier_option);
- generate_null_check = !cls->IsInDexCache();
- break;
- }
- case HLoadClass::LoadKind::kDexCacheViaMethod: {
- // /* GcRoot<mirror::Class>[] */ out =
- // current_method.ptr_sized_fields_->dex_cache_resolved_types_
- Register current_method = locations->InAt(0).AsRegister<Register>();
- __ movl(out, Address(current_method,
- ArtMethod::DexCacheResolvedTypesOffset(kX86PointerSize).Int32Value()));
- // /* GcRoot<mirror::Class> */ out = out[type_index]
- GenerateGcRootFieldLoad(cls,
- out_loc,
- Address(out,
- CodeGenerator::GetCacheOffset(cls->GetTypeIndex().index_)),
- /* fixup_label */ nullptr,
- read_barrier_option);
- generate_null_check = !cls->IsInDexCache();
- break;
- }
+ case HLoadClass::LoadKind::kDexCacheViaMethod:
+ LOG(FATAL) << "UNREACHABLE";
+ UNREACHABLE();
}
if (generate_null_check || cls->MustGenerateClinitCheck()) {
@@ -6195,11 +6205,11 @@ HLoadString::LoadKind CodeGeneratorX86::GetSupportedLoadStringKind(
break;
case HLoadString::LoadKind::kBootImageAddress:
break;
- case HLoadString::LoadKind::kDexCacheViaMethod:
- break;
case HLoadString::LoadKind::kJitTableAddress:
DCHECK(Runtime::Current()->UseJitCompilation());
break;
+ case HLoadString::LoadKind::kDexCacheViaMethod:
+ break;
}
return desired_string_load_kind;
}
@@ -6250,11 +6260,13 @@ void InstructionCodeGeneratorX86::VisitLoadString(HLoadString* load) NO_THREAD_S
switch (load->GetLoadKind()) {
case HLoadString::LoadKind::kBootImageLinkTimeAddress: {
+ DCHECK(codegen_->GetCompilerOptions().IsBootImage());
__ movl(out, Immediate(/* placeholder */ 0));
codegen_->RecordBootStringPatch(load);
return; // No dex cache slow path.
}
case HLoadString::LoadKind::kBootImageLinkTimePcRelative: {
+ DCHECK(codegen_->GetCompilerOptions().IsBootImage());
Register method_address = locations->InAt(0).AsRegister<Register>();
__ leal(out, Address(method_address, CodeGeneratorX86::kDummy32BitOffset));
codegen_->RecordBootStringPatch(load);
diff --git a/compiler/optimizing/code_generator_x86.h b/compiler/optimizing/code_generator_x86.h
index dd1628c867..9eb97658da 100644
--- a/compiler/optimizing/code_generator_x86.h
+++ b/compiler/optimizing/code_generator_x86.h
@@ -412,13 +412,16 @@ class CodeGeneratorX86 : public CodeGenerator {
void RecordSimplePatch();
void RecordBootStringPatch(HLoadString* load_string);
- void RecordTypePatch(HLoadClass* load_class);
+ void RecordBootTypePatch(HLoadClass* load_class);
+ Label* NewTypeBssEntryPatch(HLoadClass* load_class);
Label* NewStringBssEntryPatch(HLoadString* load_string);
Label* NewPcRelativeDexCacheArrayPatch(const DexFile& dex_file, uint32_t element_offset);
Label* NewJitRootStringPatch(const DexFile& dex_file,
dex::StringIndex dex_index,
Handle<mirror::String> handle);
- Label* NewJitRootClassPatch(const DexFile& dex_file, dex::TypeIndex dex_index, uint64_t address);
+ Label* NewJitRootClassPatch(const DexFile& dex_file,
+ dex::TypeIndex dex_index,
+ Handle<mirror::Class> handle);
void MoveFromReturnRegister(Location trg, Primitive::Type type) OVERRIDE;
@@ -621,8 +624,10 @@ class CodeGeneratorX86 : public CodeGenerator {
ArenaDeque<Label> simple_patches_;
// String patch locations; type depends on configuration (app .bss or boot image PIC/non-PIC).
ArenaDeque<PatchInfo<Label>> string_patches_;
- // Type patch locations.
- ArenaDeque<PatchInfo<Label>> type_patches_;
+ // Type patch locations for boot image; type depends on configuration (boot image PIC/non-PIC).
+ ArenaDeque<PatchInfo<Label>> boot_image_type_patches_;
+ // Type patch locations for kBssEntry.
+ ArenaDeque<PatchInfo<Label>> type_bss_entry_patches_;
// Patches for string root accesses in JIT compiled code.
ArenaDeque<PatchInfo<Label>> jit_string_patches_;
diff --git a/compiler/optimizing/code_generator_x86_64.cc b/compiler/optimizing/code_generator_x86_64.cc
index 261473505f..74c71cce1f 100644
--- a/compiler/optimizing/code_generator_x86_64.cc
+++ b/compiler/optimizing/code_generator_x86_64.cc
@@ -234,12 +234,12 @@ class LoadClassSlowPathX86_64 : public SlowPathCode {
HInstruction* at,
uint32_t dex_pc,
bool do_clinit)
- : SlowPathCode(at), cls_(cls), at_(at), dex_pc_(dex_pc), do_clinit_(do_clinit) {
+ : SlowPathCode(at), cls_(cls), dex_pc_(dex_pc), do_clinit_(do_clinit) {
DCHECK(at->IsLoadClass() || at->IsClinitCheck());
}
void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
- LocationSummary* locations = at_->GetLocations();
+ LocationSummary* locations = instruction_->GetLocations();
CodeGeneratorX86_64* x86_64_codegen = down_cast<CodeGeneratorX86_64*>(codegen);
__ Bind(GetEntryLabel());
@@ -249,7 +249,7 @@ class LoadClassSlowPathX86_64 : public SlowPathCode {
__ movl(CpuRegister(calling_convention.GetRegisterAt(0)),
Immediate(cls_->GetTypeIndex().index_));
x86_64_codegen->InvokeRuntime(do_clinit_ ? kQuickInitializeStaticStorage : kQuickInitializeType,
- at_,
+ instruction_,
dex_pc_,
this);
if (do_clinit_) {
@@ -266,6 +266,15 @@ class LoadClassSlowPathX86_64 : public SlowPathCode {
}
RestoreLiveRegisters(codegen, locations);
+ // For HLoadClass/kBssEntry, store the resolved Class to the BSS entry.
+ DCHECK_EQ(instruction_->IsLoadClass(), cls_ == instruction_);
+ if (cls_ == instruction_ && cls_->GetLoadKind() == HLoadClass::LoadKind::kBssEntry) {
+ DCHECK(out.IsValid());
+ __ movl(Address::Absolute(CodeGeneratorX86_64::kDummy32BitOffset, /* no_rip */ false),
+ locations->Out().AsRegister<CpuRegister>());
+ Label* fixup_label = x86_64_codegen->NewTypeBssEntryPatch(cls_);
+ __ Bind(fixup_label);
+ }
__ jmp(GetExitLabel());
}
@@ -275,10 +284,6 @@ class LoadClassSlowPathX86_64 : public SlowPathCode {
// The class this slow path will load.
HLoadClass* const cls_;
- // The instruction where this slow path is happening.
- // (Might be the load class or an initialization check).
- HInstruction* const at_;
-
// The dex PC of `at_`.
const uint32_t dex_pc_;
@@ -300,9 +305,9 @@ class LoadStringSlowPathX86_64 : public SlowPathCode {
__ Bind(GetEntryLabel());
SaveLiveRegisters(codegen, locations);
- const uint32_t string_index = instruction_->AsLoadString()->GetStringIndex().index_;
+ const dex::StringIndex string_index = instruction_->AsLoadString()->GetStringIndex();
// Custom calling convention: RAX serves as both input and output.
- __ movl(CpuRegister(RAX), Immediate(string_index));
+ __ movl(CpuRegister(RAX), Immediate(string_index.index_));
x86_64_codegen->InvokeRuntime(kQuickResolveString,
instruction_,
instruction_->GetDexPc(),
@@ -986,7 +991,7 @@ Location CodeGeneratorX86_64::GenerateCalleeMethodStaticOrDirectCall(HInvokeStat
Address::Absolute(kDummy32BitOffset, /* no_rip */ false));
// Bind a new fixup label at the end of the "movl" insn.
uint32_t offset = invoke->GetDexCacheArrayOffset();
- __ Bind(NewPcRelativeDexCacheArrayPatch(invoke->GetDexFile(), offset));
+ __ Bind(NewPcRelativeDexCacheArrayPatch(invoke->GetDexFileForPcRelativeDexCache(), offset));
break;
}
case HInvokeStaticOrDirect::MethodLoadKind::kDexCacheViaMethod: {
@@ -1079,9 +1084,15 @@ void CodeGeneratorX86_64::RecordBootStringPatch(HLoadString* load_string) {
__ Bind(&string_patches_.back().label);
}
-void CodeGeneratorX86_64::RecordTypePatch(HLoadClass* load_class) {
- type_patches_.emplace_back(load_class->GetDexFile(), load_class->GetTypeIndex().index_);
- __ Bind(&type_patches_.back().label);
+void CodeGeneratorX86_64::RecordBootTypePatch(HLoadClass* load_class) {
+ boot_image_type_patches_.emplace_back(load_class->GetDexFile(),
+ load_class->GetTypeIndex().index_);
+ __ Bind(&boot_image_type_patches_.back().label);
+}
+
+Label* CodeGeneratorX86_64::NewTypeBssEntryPatch(HLoadClass* load_class) {
+ type_bss_entry_patches_.emplace_back(load_class->GetDexFile(), load_class->GetTypeIndex().index_);
+ return &type_bss_entry_patches_.back().label;
}
Label* CodeGeneratorX86_64::NewStringBssEntryPatch(HLoadString* load_string) {
@@ -1118,7 +1129,8 @@ void CodeGeneratorX86_64::EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_pat
pc_relative_dex_cache_patches_.size() +
simple_patches_.size() +
string_patches_.size() +
- type_patches_.size();
+ boot_image_type_patches_.size() +
+ type_bss_entry_patches_.size();
linker_patches->reserve(size);
EmitPcRelativeLinkerPatches<LinkerPatch::DexCacheArrayPatch>(pc_relative_dex_cache_patches_,
linker_patches);
@@ -1127,13 +1139,17 @@ void CodeGeneratorX86_64::EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_pat
linker_patches->push_back(LinkerPatch::RecordPosition(literal_offset));
}
if (!GetCompilerOptions().IsBootImage()) {
+ DCHECK(boot_image_type_patches_.empty());
EmitPcRelativeLinkerPatches<LinkerPatch::StringBssEntryPatch>(string_patches_, linker_patches);
} else {
- // These are always PC-relative, see GetSupportedLoadStringKind().
+ // These are always PC-relative, see GetSupportedLoadClassKind()/GetSupportedLoadStringKind().
+ EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(boot_image_type_patches_,
+ linker_patches);
EmitPcRelativeLinkerPatches<LinkerPatch::RelativeStringPatch>(string_patches_, linker_patches);
}
- // These are always PC-relative, see GetSupportedLoadClassKind().
- EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(type_patches_, linker_patches);
+ EmitPcRelativeLinkerPatches<LinkerPatch::TypeBssEntryPatch>(type_bss_entry_patches_,
+ linker_patches);
+ DCHECK_EQ(size, linker_patches->size());
}
void CodeGeneratorX86_64::DumpCoreRegister(std::ostream& stream, int reg) const {
@@ -1214,7 +1230,8 @@ CodeGeneratorX86_64::CodeGeneratorX86_64(HGraph* graph,
pc_relative_dex_cache_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
simple_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
string_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
- type_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ boot_image_type_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ type_bss_entry_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
fixups_to_jump_tables_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
jit_string_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
jit_class_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)) {
@@ -2423,6 +2440,14 @@ void InstructionCodeGeneratorX86_64::VisitInvokeInterface(HInvokeInterface* invo
codegen_->RecordPcInfo(invoke, invoke->GetDexPc());
}
+void LocationsBuilderX86_64::VisitInvokePolymorphic(HInvokePolymorphic* invoke) {
+ HandleInvoke(invoke);
+}
+
+void InstructionCodeGeneratorX86_64::VisitInvokePolymorphic(HInvokePolymorphic* invoke) {
+ codegen_->GenerateInvokePolymorphicCall(invoke);
+}
+
void LocationsBuilderX86_64::VisitNeg(HNeg* neg) {
LocationSummary* locations =
new (GetGraph()->GetArena()) LocationSummary(neg, LocationSummary::kNoCall);
@@ -4063,21 +4088,16 @@ void LocationsBuilderX86_64::VisitNewArray(HNewArray* instruction) {
LocationSummary* locations =
new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kCallOnMainOnly);
InvokeRuntimeCallingConvention calling_convention;
- locations->AddTemp(Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
locations->SetOut(Location::RegisterLocation(RAX));
- locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
- locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(2)));
+ locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
+ locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
}
void InstructionCodeGeneratorX86_64::VisitNewArray(HNewArray* instruction) {
- InvokeRuntimeCallingConvention calling_convention;
- codegen_->Load64BitValue(CpuRegister(calling_convention.GetRegisterAt(0)),
- instruction->GetTypeIndex().index_);
// Note: if heap poisoning is enabled, the entry point takes cares
// of poisoning the reference.
- codegen_->InvokeRuntime(instruction->GetEntrypoint(), instruction, instruction->GetDexPc());
- CheckEntrypointTypes<kQuickAllocArrayWithAccessCheck, void*, uint32_t, int32_t, ArtMethod*>();
-
+ codegen_->InvokeRuntime(kQuickAllocArrayResolved, instruction, instruction->GetDexPc());
+ CheckEntrypointTypes<kQuickAllocArrayResolved, void*, mirror::Class*, int32_t>();
DCHECK(!codegen_->IsLeafMethod());
}
@@ -5416,11 +5436,12 @@ HLoadClass::LoadKind CodeGeneratorX86_64::GetSupportedLoadClassKind(
break;
case HLoadClass::LoadKind::kBootImageAddress:
break;
- case HLoadClass::LoadKind::kJitTableAddress:
- break;
- case HLoadClass::LoadKind::kDexCachePcRelative:
+ case HLoadClass::LoadKind::kBssEntry:
DCHECK(!Runtime::Current()->UseJitCompilation());
break;
+ case HLoadClass::LoadKind::kJitTableAddress:
+ DCHECK(Runtime::Current()->UseJitCompilation());
+ break;
case HLoadClass::LoadKind::kDexCacheViaMethod:
break;
}
@@ -5428,15 +5449,16 @@ HLoadClass::LoadKind CodeGeneratorX86_64::GetSupportedLoadClassKind(
}
void LocationsBuilderX86_64::VisitLoadClass(HLoadClass* cls) {
- if (cls->NeedsAccessCheck()) {
+ HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+ if (load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
InvokeRuntimeCallingConvention calling_convention;
- CodeGenerator::CreateLoadClassLocationSummary(
+ CodeGenerator::CreateLoadClassRuntimeCallLocationSummary(
cls,
Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
- Location::RegisterLocation(RAX),
- /* code_generator_supports_read_barrier */ true);
+ Location::RegisterLocation(RAX));
return;
}
+ DCHECK(!cls->NeedsAccessCheck());
const bool requires_read_barrier = kEmitCompilerReadBarrier && !cls->IsInBootImage();
LocationSummary::CallKind call_kind = (cls->NeedsEnvironment() || requires_read_barrier)
@@ -5447,9 +5469,7 @@ void LocationsBuilderX86_64::VisitLoadClass(HLoadClass* cls) {
locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
- HLoadClass::LoadKind load_kind = cls->GetLoadKind();
- if (load_kind == HLoadClass::LoadKind::kReferrersClass ||
- load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
+ if (load_kind == HLoadClass::LoadKind::kReferrersClass) {
locations->SetInAt(0, Location::RequiresRegister());
}
locations->SetOut(Location::RequiresRegister());
@@ -5457,23 +5477,26 @@ void LocationsBuilderX86_64::VisitLoadClass(HLoadClass* cls) {
Label* CodeGeneratorX86_64::NewJitRootClassPatch(const DexFile& dex_file,
dex::TypeIndex dex_index,
- uint64_t address) {
- jit_class_roots_.Overwrite(TypeReference(&dex_file, dex_index), address);
+ Handle<mirror::Class> handle) {
+ jit_class_roots_.Overwrite(
+ TypeReference(&dex_file, dex_index), reinterpret_cast64<uint64_t>(handle.GetReference()));
// Add a patch entry and return the label.
jit_class_patches_.emplace_back(dex_file, dex_index.index_);
PatchInfo<Label>* info = &jit_class_patches_.back();
return &info->label;
}
-void InstructionCodeGeneratorX86_64::VisitLoadClass(HLoadClass* cls) {
- LocationSummary* locations = cls->GetLocations();
- if (cls->NeedsAccessCheck()) {
- codegen_->MoveConstant(locations->GetTemp(0), cls->GetTypeIndex().index_);
- codegen_->InvokeRuntime(kQuickInitializeTypeAndVerifyAccess, cls, cls->GetDexPc());
- CheckEntrypointTypes<kQuickInitializeTypeAndVerifyAccess, void*, uint32_t>();
+// NO_THREAD_SAFETY_ANALYSIS as we manipulate handles whose internal object we know does not
+// move.
+void InstructionCodeGeneratorX86_64::VisitLoadClass(HLoadClass* cls) NO_THREAD_SAFETY_ANALYSIS {
+ HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+ if (load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
+ codegen_->GenerateLoadClassRuntimeCall(cls);
return;
}
+ DCHECK(!cls->NeedsAccessCheck());
+ LocationSummary* locations = cls->GetLocations();
Location out_loc = locations->Out();
CpuRegister out = out_loc.AsRegister<CpuRegister>();
@@ -5481,7 +5504,7 @@ void InstructionCodeGeneratorX86_64::VisitLoadClass(HLoadClass* cls) {
? kWithoutReadBarrier
: kCompilerReadBarrierOption;
bool generate_null_check = false;
- switch (cls->GetLoadKind()) {
+ switch (load_kind) {
case HLoadClass::LoadKind::kReferrersClass: {
DCHECK(!cls->CanCallRuntime());
DCHECK(!cls->MustGenerateClinitCheck());
@@ -5496,52 +5519,36 @@ void InstructionCodeGeneratorX86_64::VisitLoadClass(HLoadClass* cls) {
break;
}
case HLoadClass::LoadKind::kBootImageLinkTimePcRelative:
+ DCHECK(codegen_->GetCompilerOptions().IsBootImage());
DCHECK_EQ(read_barrier_option, kWithoutReadBarrier);
__ leal(out, Address::Absolute(CodeGeneratorX86_64::kDummy32BitOffset, /* no_rip */ false));
- codegen_->RecordTypePatch(cls);
+ codegen_->RecordBootTypePatch(cls);
break;
case HLoadClass::LoadKind::kBootImageAddress: {
DCHECK_EQ(read_barrier_option, kWithoutReadBarrier);
- DCHECK_NE(cls->GetAddress(), 0u);
- uint32_t address = dchecked_integral_cast<uint32_t>(cls->GetAddress());
+ uint32_t address = dchecked_integral_cast<uint32_t>(
+ reinterpret_cast<uintptr_t>(cls->GetClass().Get()));
+ DCHECK_NE(address, 0u);
__ movl(out, Immediate(address)); // Zero-extended.
codegen_->RecordSimplePatch();
break;
}
- case HLoadClass::LoadKind::kJitTableAddress: {
- Address address = Address::Absolute(CodeGeneratorX86_64::kDummy32BitOffset,
- /* no_rip */ true);
- Label* fixup_label =
- codegen_->NewJitRootClassPatch(cls->GetDexFile(), cls->GetTypeIndex(), cls->GetAddress());
- // /* GcRoot<mirror::Class> */ out = *address
- GenerateGcRootFieldLoad(cls, out_loc, address, fixup_label, kCompilerReadBarrierOption);
- break;
- }
- case HLoadClass::LoadKind::kDexCachePcRelative: {
- uint32_t offset = cls->GetDexCacheElementOffset();
- Label* fixup_label = codegen_->NewPcRelativeDexCacheArrayPatch(cls->GetDexFile(), offset);
+ case HLoadClass::LoadKind::kBssEntry: {
Address address = Address::Absolute(CodeGeneratorX86_64::kDummy32BitOffset,
/* no_rip */ false);
+ Label* fixup_label = codegen_->NewTypeBssEntryPatch(cls);
// /* GcRoot<mirror::Class> */ out = *address /* PC-relative */
GenerateGcRootFieldLoad(cls, out_loc, address, fixup_label, read_barrier_option);
- generate_null_check = !cls->IsInDexCache();
+ generate_null_check = true;
break;
}
- case HLoadClass::LoadKind::kDexCacheViaMethod: {
- // /* GcRoot<mirror::Class>[] */ out =
- // current_method.ptr_sized_fields_->dex_cache_resolved_types_
- CpuRegister current_method = locations->InAt(0).AsRegister<CpuRegister>();
- __ movq(out,
- Address(current_method,
- ArtMethod::DexCacheResolvedTypesOffset(kX86_64PointerSize).Int32Value()));
- // /* GcRoot<mirror::Class> */ out = out[type_index]
- GenerateGcRootFieldLoad(
- cls,
- out_loc,
- Address(out, CodeGenerator::GetCacheOffset(cls->GetTypeIndex().index_)),
- /* fixup_label */ nullptr,
- read_barrier_option);
- generate_null_check = !cls->IsInDexCache();
+ case HLoadClass::LoadKind::kJitTableAddress: {
+ Address address = Address::Absolute(CodeGeneratorX86_64::kDummy32BitOffset,
+ /* no_rip */ true);
+ Label* fixup_label =
+ codegen_->NewJitRootClassPatch(cls->GetDexFile(), cls->GetTypeIndex(), cls->GetClass());
+ // /* GcRoot<mirror::Class> */ out = *address
+ GenerateGcRootFieldLoad(cls, out_loc, address, fixup_label, kCompilerReadBarrierOption);
break;
}
default:
@@ -5599,11 +5606,11 @@ HLoadString::LoadKind CodeGeneratorX86_64::GetSupportedLoadStringKind(
case HLoadString::LoadKind::kBssEntry:
DCHECK(!Runtime::Current()->UseJitCompilation());
break;
- case HLoadString::LoadKind::kDexCacheViaMethod:
- break;
case HLoadString::LoadKind::kJitTableAddress:
DCHECK(Runtime::Current()->UseJitCompilation());
break;
+ case HLoadString::LoadKind::kDexCacheViaMethod:
+ break;
}
return desired_string_load_kind;
}
@@ -5649,6 +5656,7 @@ void InstructionCodeGeneratorX86_64::VisitLoadString(HLoadString* load) NO_THREA
switch (load->GetLoadKind()) {
case HLoadString::LoadKind::kBootImageLinkTimePcRelative: {
+ DCHECK(codegen_->GetCompilerOptions().IsBootImage());
__ leal(out, Address::Absolute(CodeGeneratorX86_64::kDummy32BitOffset, /* no_rip */ false));
codegen_->RecordBootStringPatch(load);
return; // No dex cache slow path.
diff --git a/compiler/optimizing/code_generator_x86_64.h b/compiler/optimizing/code_generator_x86_64.h
index 32d006c5f3..3438b8159f 100644
--- a/compiler/optimizing/code_generator_x86_64.h
+++ b/compiler/optimizing/code_generator_x86_64.h
@@ -409,13 +409,16 @@ class CodeGeneratorX86_64 : public CodeGenerator {
void RecordSimplePatch();
void RecordBootStringPatch(HLoadString* load_string);
- void RecordTypePatch(HLoadClass* load_class);
+ void RecordBootTypePatch(HLoadClass* load_class);
+ Label* NewTypeBssEntryPatch(HLoadClass* load_class);
Label* NewStringBssEntryPatch(HLoadString* load_string);
Label* NewPcRelativeDexCacheArrayPatch(const DexFile& dex_file, uint32_t element_offset);
Label* NewJitRootStringPatch(const DexFile& dex_file,
dex::StringIndex dex_index,
Handle<mirror::String> handle);
- Label* NewJitRootClassPatch(const DexFile& dex_file, dex::TypeIndex dex_index, uint64_t address);
+ Label* NewJitRootClassPatch(const DexFile& dex_file,
+ dex::TypeIndex dex_index,
+ Handle<mirror::Class> handle);
void MoveFromReturnRegister(Location trg, Primitive::Type type) OVERRIDE;
@@ -604,8 +607,10 @@ class CodeGeneratorX86_64 : public CodeGenerator {
ArenaDeque<Label> simple_patches_;
// String patch locations; type depends on configuration (app .bss or boot image PIC).
ArenaDeque<PatchInfo<Label>> string_patches_;
- // Type patch locations.
- ArenaDeque<PatchInfo<Label>> type_patches_;
+ // Type patch locations for boot image (always PIC).
+ ArenaDeque<PatchInfo<Label>> boot_image_type_patches_;
+ // Type patch locations for kBssEntry.
+ ArenaDeque<PatchInfo<Label>> type_bss_entry_patches_;
// Fixups for jump tables need to be handled specially.
ArenaVector<JumpTableRIPFixup*> fixups_to_jump_tables_;
diff --git a/compiler/optimizing/dex_cache_array_fixups_arm.cc b/compiler/optimizing/dex_cache_array_fixups_arm.cc
index 10a36c6ff4..9ddcd563ca 100644
--- a/compiler/optimizing/dex_cache_array_fixups_arm.cc
+++ b/compiler/optimizing/dex_cache_array_fixups_arm.cc
@@ -59,29 +59,15 @@ class DexCacheArrayFixupsVisitor : public HGraphVisitor {
}
private:
- void VisitLoadClass(HLoadClass* load_class) OVERRIDE {
- // If this is a load with PC-relative access to the dex cache types array,
- // we need to add the dex cache arrays base as the special input.
- if (load_class->GetLoadKind() == HLoadClass::LoadKind::kDexCachePcRelative) {
- // Initialize base for target dex file if needed.
- const DexFile& dex_file = load_class->GetDexFile();
- HArmDexCacheArraysBase* base = GetOrCreateDexCacheArrayBase(dex_file);
- // Update the element offset in base.
- DexCacheArraysLayout layout(kArmPointerSize, &dex_file);
- base->UpdateElementOffset(layout.TypeOffset(load_class->GetTypeIndex()));
- // Add the special argument base to the load.
- load_class->AddSpecialInput(base);
- }
- }
-
void VisitInvokeStaticOrDirect(HInvokeStaticOrDirect* invoke) OVERRIDE {
// If this is an invoke with PC-relative access to the dex cache methods array,
// we need to add the dex cache arrays base as the special input.
if (invoke->HasPcRelativeDexCache() &&
!IsCallFreeIntrinsic<IntrinsicLocationsBuilderARMType>(invoke, codegen_)) {
- HArmDexCacheArraysBase* base = GetOrCreateDexCacheArrayBase(invoke->GetDexFile());
+ HArmDexCacheArraysBase* base =
+ GetOrCreateDexCacheArrayBase(invoke->GetDexFileForPcRelativeDexCache());
// Update the element offset in base.
- DexCacheArraysLayout layout(kArmPointerSize, &invoke->GetDexFile());
+ DexCacheArraysLayout layout(kArmPointerSize, &invoke->GetDexFileForPcRelativeDexCache());
base->UpdateElementOffset(layout.MethodOffset(invoke->GetDexMethodIndex()));
// Add the special argument base to the method.
DCHECK(!invoke->HasCurrentMethodInput());
diff --git a/compiler/optimizing/dex_cache_array_fixups_mips.cc b/compiler/optimizing/dex_cache_array_fixups_mips.cc
index 31fff26dd5..04a4294c48 100644
--- a/compiler/optimizing/dex_cache_array_fixups_mips.cc
+++ b/compiler/optimizing/dex_cache_array_fixups_mips.cc
@@ -53,30 +53,16 @@ class DexCacheArrayFixupsVisitor : public HGraphVisitor {
}
private:
- void VisitLoadClass(HLoadClass* load_class) OVERRIDE {
- // If this is a load with PC-relative access to the dex cache types array,
- // we need to add the dex cache arrays base as the special input.
- if (load_class->GetLoadKind() == HLoadClass::LoadKind::kDexCachePcRelative) {
- // Initialize base for target dex file if needed.
- const DexFile& dex_file = load_class->GetDexFile();
- HMipsDexCacheArraysBase* base = GetOrCreateDexCacheArrayBase(dex_file);
- // Update the element offset in base.
- DexCacheArraysLayout layout(kMipsPointerSize, &dex_file);
- base->UpdateElementOffset(layout.TypeOffset(load_class->GetTypeIndex()));
- // Add the special argument base to the load.
- load_class->AddSpecialInput(base);
- }
- }
-
void VisitInvokeStaticOrDirect(HInvokeStaticOrDirect* invoke) OVERRIDE {
// If this is an invoke with PC-relative access to the dex cache methods array,
// we need to add the dex cache arrays base as the special input.
if (invoke->HasPcRelativeDexCache() &&
!IsCallFreeIntrinsic<IntrinsicLocationsBuilderMIPS>(invoke, codegen_)) {
// Initialize base for target method dex file if needed.
- HMipsDexCacheArraysBase* base = GetOrCreateDexCacheArrayBase(invoke->GetDexFile());
+ HMipsDexCacheArraysBase* base =
+ GetOrCreateDexCacheArrayBase(invoke->GetDexFileForPcRelativeDexCache());
// Update the element offset in base.
- DexCacheArraysLayout layout(kMipsPointerSize, &invoke->GetDexFile());
+ DexCacheArraysLayout layout(kMipsPointerSize, &invoke->GetDexFileForPcRelativeDexCache());
base->UpdateElementOffset(layout.MethodOffset(invoke->GetDexMethodIndex()));
// Add the special argument base to the method.
DCHECK(!invoke->HasCurrentMethodInput());
diff --git a/compiler/optimizing/graph_visualizer.cc b/compiler/optimizing/graph_visualizer.cc
index 09dcefa02c..f6fba883bd 100644
--- a/compiler/optimizing/graph_visualizer.cc
+++ b/compiler/optimizing/graph_visualizer.cc
@@ -464,6 +464,11 @@ class HGraphVisualizerPrinter : public HGraphDelegateVisitor {
StartAttributeStream("intrinsic") << invoke->GetIntrinsic();
}
+ void VisitInvokePolymorphic(HInvokePolymorphic* invoke) OVERRIDE {
+ VisitInvoke(invoke);
+ StartAttributeStream("invoke_type") << "InvokePolymorphic";
+ }
+
void VisitInstanceFieldGet(HInstanceFieldGet* iget) OVERRIDE {
StartAttributeStream("field_name") <<
iget->GetFieldInfo().GetDexFile().PrettyField(iget->GetFieldInfo().GetFieldIndex(),
diff --git a/compiler/optimizing/induction_var_range.cc b/compiler/optimizing/induction_var_range.cc
index d5c4c2fa69..3973985338 100644
--- a/compiler/optimizing/induction_var_range.cc
+++ b/compiler/optimizing/induction_var_range.cc
@@ -114,12 +114,7 @@ static bool IsMaxAtHint(
}
} else {
*suitable = instruction;
- while (instruction->IsArrayLength() ||
- instruction->IsNullCheck() ||
- instruction->IsNewArray()) {
- instruction = instruction->InputAt(0);
- }
- return instruction == hint;
+ return HuntForDeclaration(instruction) == hint;
}
return false;
}
@@ -368,10 +363,14 @@ void InductionVarRange::Replace(HInstruction* instruction,
}
}
-bool InductionVarRange::IsFinite(HLoopInformation* loop) const {
+bool InductionVarRange::IsFinite(HLoopInformation* loop, /*out*/ int64_t* tc) const {
HInductionVarAnalysis::InductionInfo *trip =
induction_analysis_->LookupInfo(loop, GetLoopControl(loop));
- return trip != nullptr && !IsUnsafeTripCount(trip);
+ if (trip != nullptr && !IsUnsafeTripCount(trip)) {
+ IsConstant(trip->op_a, kExact, tc);
+ return true;
+ }
+ return false;
}
//
@@ -625,7 +624,7 @@ InductionVarRange::Value InductionVarRange::GetFetch(HInstruction* instruction,
if (chase_hint_ == nullptr) {
return is_min ? Value(0) : Value(std::numeric_limits<int32_t>::max());
} else if (instruction->InputAt(0)->IsNewArray()) {
- return GetFetch(instruction->InputAt(0)->InputAt(0), trip, in_body, is_min);
+ return GetFetch(instruction->InputAt(0)->AsNewArray()->GetLength(), trip, in_body, is_min);
}
} else if (instruction->IsTypeConversion()) {
// Since analysis is 32-bit (or narrower), chase beyond widening along the path.
diff --git a/compiler/optimizing/induction_var_range.h b/compiler/optimizing/induction_var_range.h
index ba14847d82..6c424b78b9 100644
--- a/compiler/optimizing/induction_var_range.h
+++ b/compiler/optimizing/induction_var_range.h
@@ -150,9 +150,9 @@ class InductionVarRange {
}
/**
- * Checks if header logic of a loop terminates.
+ * Checks if header logic of a loop terminates. Sets trip-count tc if known.
*/
- bool IsFinite(HLoopInformation* loop) const;
+ bool IsFinite(HLoopInformation* loop, /*out*/ int64_t* tc) const;
private:
/*
diff --git a/compiler/optimizing/induction_var_range_test.cc b/compiler/optimizing/induction_var_range_test.cc
index aa3e1aab4f..d81817fb09 100644
--- a/compiler/optimizing/induction_var_range_test.cc
+++ b/compiler/optimizing/induction_var_range_test.cc
@@ -697,13 +697,8 @@ TEST_F(InductionVarRangeTest, MaxValue) {
}
TEST_F(InductionVarRangeTest, ArrayLengthAndHints) {
- HInstruction* new_array = new (&allocator_)
- HNewArray(x_,
- graph_->GetCurrentMethod(),
- 0,
- dex::TypeIndex(Primitive::kPrimInt),
- graph_->GetDexFile(),
- kQuickAllocArray);
+ // We pass a bogus constant for the class to avoid mocking one.
+ HInstruction* new_array = new (&allocator_) HNewArray(x_, x_, 0);
entry_block_->AddInstruction(new_array);
HInstruction* array_length = new (&allocator_) HArrayLength(new_array, 0);
entry_block_->AddInstruction(array_length);
diff --git a/compiler/optimizing/inliner.cc b/compiler/optimizing/inliner.cc
index c970e5cbba..5d40f75618 100644
--- a/compiler/optimizing/inliner.cc
+++ b/compiler/optimizing/inliner.cc
@@ -308,8 +308,10 @@ ArtMethod* HInliner::TryCHADevirtualization(ArtMethod* resolved_method) {
}
bool HInliner::TryInline(HInvoke* invoke_instruction) {
- if (invoke_instruction->IsInvokeUnresolved()) {
- return false; // Don't bother to move further if we know the method is unresolved.
+ if (invoke_instruction->IsInvokeUnresolved() ||
+ invoke_instruction->IsInvokePolymorphic()) {
+ return false; // Don't bother to move further if we know the method is unresolved or an
+ // invoke-polymorphic.
}
ScopedObjectAccess soa(Thread::Current());
@@ -472,10 +474,10 @@ bool HInliner::TryInlineMonomorphicCall(HInvoke* invoke_instruction,
HInstruction* receiver = invoke_instruction->InputAt(0);
HInstruction* cursor = invoke_instruction->GetPrevious();
HBasicBlock* bb_cursor = invoke_instruction->GetBlock();
- Handle<mirror::Class> handle = handles_->NewHandle(GetMonomorphicType(classes));
+ Handle<mirror::Class> monomorphic_type = handles_->NewHandle(GetMonomorphicType(classes));
if (!TryInlineAndReplace(invoke_instruction,
resolved_method,
- ReferenceTypeInfo::Create(handle, /* is_exact */ true),
+ ReferenceTypeInfo::Create(monomorphic_type, /* is_exact */ true),
/* do_rtp */ false,
/* cha_devirtualize */ false)) {
return false;
@@ -486,7 +488,7 @@ bool HInliner::TryInlineMonomorphicCall(HInvoke* invoke_instruction,
cursor,
bb_cursor,
class_index,
- GetMonomorphicType(classes),
+ monomorphic_type,
invoke_instruction,
/* with_deoptimization */ true);
@@ -531,11 +533,9 @@ HInstruction* HInliner::AddTypeGuard(HInstruction* receiver,
HInstruction* cursor,
HBasicBlock* bb_cursor,
dex::TypeIndex class_index,
- mirror::Class* klass,
+ Handle<mirror::Class> klass,
HInstruction* invoke_instruction,
bool with_deoptimization) {
- ScopedAssertNoThreadSuspension sants("Adding compiler type guard");
-
ClassLinker* class_linker = caller_compilation_unit_.GetClassLinker();
HInstanceFieldGet* receiver_class = BuildGetReceiverClass(
class_linker, receiver, invoke_instruction->GetDexPc());
@@ -546,19 +546,20 @@ HInstruction* HInliner::AddTypeGuard(HInstruction* receiver,
}
const DexFile& caller_dex_file = *caller_compilation_unit_.GetDexFile();
- bool is_referrer = (klass == outermost_graph_->GetArtMethod()->GetDeclaringClass());
+ bool is_referrer = (klass.Get() == outermost_graph_->GetArtMethod()->GetDeclaringClass());
// Note that we will just compare the classes, so we don't need Java semantics access checks.
// Note that the type index and the dex file are relative to the method this type guard is
// inlined into.
HLoadClass* load_class = new (graph_->GetArena()) HLoadClass(graph_->GetCurrentMethod(),
class_index,
caller_dex_file,
+ klass,
is_referrer,
invoke_instruction->GetDexPc(),
/* needs_access_check */ false);
bb_cursor->InsertInstructionAfter(load_class, receiver_class);
// Sharpen after adding the instruction, as the sharpening may remove inputs.
- HSharpening::SharpenClass(load_class, klass, handles_, codegen_, compiler_driver_);
+ HSharpening::SharpenClass(load_class, codegen_, compiler_driver_);
// TODO: Extend reference type propagation to understand the guard.
HNotEqual* compare = new (graph_->GetArena()) HNotEqual(load_class, receiver_class);
@@ -635,7 +636,7 @@ bool HInliner::TryInlinePolymorphicCall(HInvoke* invoke_instruction,
cursor,
bb_cursor,
class_index,
- handle.Get(),
+ handle,
invoke_instruction,
deoptimize);
if (deoptimize) {
@@ -1428,15 +1429,6 @@ bool HInliner::TryBuildAndInlineHelper(HInvoke* invoke_instruction,
return false;
}
- if (current->IsNewArray() &&
- (current->AsNewArray()->GetEntrypoint() == kQuickAllocArrayWithAccessCheck)) {
- VLOG(compiler) << "Method " << callee_dex_file.PrettyMethod(method_index)
- << " could not be inlined because it is using an entrypoint"
- << " with access checks";
- // Allocation entrypoint does not handle inlined frames.
- return false;
- }
-
if (current->IsUnresolvedStaticFieldGet() ||
current->IsUnresolvedInstanceFieldGet() ||
current->IsUnresolvedStaticFieldSet() ||
@@ -1537,8 +1529,6 @@ bool HInliner::ArgumentTypesMoreSpecific(HInvoke* invoke_instruction, ArtMethod*
}
}
- PointerSize pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
-
// Iterate over the list of parameter types and test whether any of the
// actual inputs has a more specific reference type than the type declared in
// the signature.
@@ -1550,9 +1540,9 @@ bool HInliner::ArgumentTypesMoreSpecific(HInvoke* invoke_instruction, ArtMethod*
++param_idx, ++input_idx) {
HInstruction* input = invoke_instruction->InputAt(input_idx);
if (input->GetType() == Primitive::kPrimNot) {
- mirror::Class* param_cls = resolved_method->GetDexCacheResolvedType(
+ mirror::Class* param_cls = resolved_method->GetClassFromTypeIndex(
param_list->GetTypeItem(param_idx).type_idx_,
- pointer_size);
+ /* resolve */ false);
if (IsReferenceTypeRefinement(GetClassRTI(param_cls),
/* declared_can_be_null */ true,
input)) {
@@ -1601,8 +1591,7 @@ void HInliner::FixUpReturnReferenceType(ArtMethod* resolved_method,
// TODO: we could be more precise by merging the phi inputs but that requires
// some functionality from the reference type propagation.
DCHECK(return_replacement->IsPhi());
- PointerSize pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
- mirror::Class* cls = resolved_method->GetReturnType(false /* resolve */, pointer_size);
+ mirror::Class* cls = resolved_method->GetReturnType(false /* resolve */);
return_replacement->SetReferenceTypeInfo(GetClassRTI(cls));
}
}
diff --git a/compiler/optimizing/inliner.h b/compiler/optimizing/inliner.h
index 4c0b990f26..11aacab802 100644
--- a/compiler/optimizing/inliner.h
+++ b/compiler/optimizing/inliner.h
@@ -170,7 +170,7 @@ class HInliner : public HOptimization {
HInstruction* cursor,
HBasicBlock* bb_cursor,
dex::TypeIndex class_index,
- mirror::Class* klass,
+ Handle<mirror::Class> klass,
HInstruction* invoke_instruction,
bool with_deoptimization)
REQUIRES_SHARED(Locks::mutator_lock_);
diff --git a/compiler/optimizing/instruction_builder.cc b/compiler/optimizing/instruction_builder.cc
index 009d549547..ef8d74dce0 100644
--- a/compiler/optimizing/instruction_builder.cc
+++ b/compiler/optimizing/instruction_builder.cc
@@ -1,3 +1,4 @@
+
/*
* Copyright (C) 2016 The Android Open Source Project
*
@@ -207,10 +208,8 @@ void HInstructionBuilder::InitializeInstruction(HInstruction* instruction) {
HEnvironment* environment = new (arena_) HEnvironment(
arena_,
current_locals_->size(),
- graph_->GetDexFile(),
- graph_->GetMethodIdx(),
+ graph_->GetArtMethod(),
instruction->GetDexPc(),
- graph_->GetInvokeType(),
instruction);
environment->CopyFrom(*current_locals_);
instruction->SetRawEnvironment(environment);
@@ -906,50 +905,69 @@ bool HInstructionBuilder::BuildInvoke(const Instruction& instruction,
false /* is_unresolved */);
}
+bool HInstructionBuilder::BuildInvokePolymorphic(const Instruction& instruction ATTRIBUTE_UNUSED,
+ uint32_t dex_pc,
+ uint32_t method_idx,
+ uint32_t proto_idx,
+ uint32_t number_of_vreg_arguments,
+ bool is_range,
+ uint32_t* args,
+ uint32_t register_index) {
+ const char* descriptor = dex_file_->GetShorty(proto_idx);
+ DCHECK_EQ(1 + ArtMethod::NumArgRegisters(descriptor), number_of_vreg_arguments);
+ Primitive::Type return_type = Primitive::GetType(descriptor[0]);
+ size_t number_of_arguments = strlen(descriptor);
+ HInvoke* invoke = new (arena_) HInvokePolymorphic(arena_,
+ number_of_arguments,
+ return_type,
+ dex_pc,
+ method_idx);
+ return HandleInvoke(invoke,
+ number_of_vreg_arguments,
+ args,
+ register_index,
+ is_range,
+ descriptor,
+ nullptr /* clinit_check */,
+ false /* is_unresolved */);
+}
+
bool HInstructionBuilder::BuildNewInstance(dex::TypeIndex type_index, uint32_t dex_pc) {
ScopedObjectAccess soa(Thread::Current());
- StackHandleScope<1> hs(soa.Self());
Handle<mirror::DexCache> dex_cache = dex_compilation_unit_->GetDexCache();
- Handle<mirror::Class> resolved_class(hs.NewHandle(dex_cache->GetResolvedType(type_index)));
- const DexFile& outer_dex_file = *outer_compilation_unit_->GetDexFile();
Handle<mirror::DexCache> outer_dex_cache = outer_compilation_unit_->GetDexCache();
- bool finalizable;
- bool needs_access_check = NeedsAccessCheck(type_index, dex_cache, &finalizable);
-
- // Only the access check entrypoint handles the finalizable class case. If we
- // need access checks, then we haven't resolved the method and the class may
- // again be finalizable.
- QuickEntrypointEnum entrypoint = (finalizable || needs_access_check)
- ? kQuickAllocObjectWithChecks
- : kQuickAllocObjectInitialized;
-
if (outer_dex_cache.Get() != dex_cache.Get()) {
// We currently do not support inlining allocations across dex files.
return false;
}
- HLoadClass* load_class = new (arena_) HLoadClass(
- graph_->GetCurrentMethod(),
- type_index,
- outer_dex_file,
- IsOutermostCompilingClass(type_index),
- dex_pc,
- needs_access_check);
+ HLoadClass* load_class = BuildLoadClass(type_index, dex_pc, /* check_access */ true);
- AppendInstruction(load_class);
HInstruction* cls = load_class;
- if (!IsInitialized(resolved_class)) {
+ Handle<mirror::Class> klass = load_class->GetClass();
+
+ if (!IsInitialized(klass)) {
cls = new (arena_) HClinitCheck(load_class, dex_pc);
AppendInstruction(cls);
}
+ // Only the access check entrypoint handles the finalizable class case. If we
+ // need access checks, then we haven't resolved the method and the class may
+ // again be finalizable.
+ QuickEntrypointEnum entrypoint = kQuickAllocObjectInitialized;
+ if (load_class->NeedsAccessCheck() || klass->IsFinalizable() || !klass->IsInstantiable()) {
+ entrypoint = kQuickAllocObjectWithChecks;
+ }
+
+ // Consider classes we haven't resolved as potentially finalizable.
+ bool finalizable = (klass.Get() == nullptr) || klass->IsFinalizable();
+
AppendInstruction(new (arena_) HNewInstance(
cls,
dex_pc,
type_index,
*dex_compilation_unit_->GetDexFile(),
- needs_access_check,
finalizable,
entrypoint));
return true;
@@ -990,7 +1008,6 @@ HClinitCheck* HInstructionBuilder::ProcessClinitCheckForInvoke(
ArtMethod* resolved_method,
uint32_t method_idx,
HInvokeStaticOrDirect::ClinitCheckRequirement* clinit_check_requirement) {
- const DexFile& outer_dex_file = *outer_compilation_unit_->GetDexFile();
Thread* self = Thread::Current();
StackHandleScope<2> hs(self);
Handle<mirror::DexCache> dex_cache = dex_compilation_unit_->GetDexCache();
@@ -1018,15 +1035,9 @@ HClinitCheck* HInstructionBuilder::ProcessClinitCheckForInvoke(
*clinit_check_requirement = HInvokeStaticOrDirect::ClinitCheckRequirement::kNone;
} else if (storage_index.IsValid()) {
*clinit_check_requirement = HInvokeStaticOrDirect::ClinitCheckRequirement::kExplicit;
- HLoadClass* load_class = new (arena_) HLoadClass(
- graph_->GetCurrentMethod(),
- storage_index,
- outer_dex_file,
- is_outer_class,
- dex_pc,
- /*needs_access_check*/ false);
- AppendInstruction(load_class);
- clinit_check = new (arena_) HClinitCheck(load_class, dex_pc);
+ HLoadClass* cls = BuildLoadClass(
+ storage_index, dex_pc, /* check_access */ false, /* outer */ true);
+ clinit_check = new (arena_) HClinitCheck(cls, dex_pc);
AppendInstruction(clinit_check);
}
return clinit_check;
@@ -1348,7 +1359,6 @@ bool HInstructionBuilder::BuildStaticFieldAccess(const Instruction& instruction,
}
Primitive::Type field_type = resolved_field->GetTypeAsPrimitiveType();
- const DexFile& outer_dex_file = *outer_compilation_unit_->GetDexFile();
Handle<mirror::DexCache> outer_dex_cache = outer_compilation_unit_->GetDexCache();
Handle<mirror::Class> outer_class(hs.NewHandle(GetOutermostCompilingClass()));
@@ -1376,16 +1386,10 @@ bool HInstructionBuilder::BuildStaticFieldAccess(const Instruction& instruction,
}
}
- HLoadClass* constant = new (arena_) HLoadClass(graph_->GetCurrentMethod(),
- storage_index,
- outer_dex_file,
- is_outer_class,
- dex_pc,
- /*needs_access_check*/ false);
- AppendInstruction(constant);
+ HLoadClass* constant = BuildLoadClass(
+ storage_index, dex_pc, /* check_access */ false, /* outer */ true);
HInstruction* cls = constant;
-
Handle<mirror::Class> klass(hs.NewHandle(resolved_field->GetDeclaringClass()));
if (!IsInitialized(klass)) {
cls = new (arena_) HClinitCheck(constant, dex_pc);
@@ -1494,16 +1498,8 @@ void HInstructionBuilder::BuildFilledNewArray(uint32_t dex_pc,
uint32_t* args,
uint32_t register_index) {
HInstruction* length = graph_->GetIntConstant(number_of_vreg_arguments, dex_pc);
- bool finalizable;
- QuickEntrypointEnum entrypoint = NeedsAccessCheck(type_index, &finalizable)
- ? kQuickAllocArrayWithAccessCheck
- : kQuickAllocArray;
- HInstruction* object = new (arena_) HNewArray(length,
- graph_->GetCurrentMethod(),
- dex_pc,
- type_index,
- *dex_compilation_unit_->GetDexFile(),
- entrypoint);
+ HLoadClass* cls = BuildLoadClass(type_index, dex_pc, /* check_access */ true);
+ HInstruction* object = new (arena_) HNewArray(cls, length, dex_pc);
AppendInstruction(object);
const char* descriptor = dex_file_->StringByTypeIdx(type_index);
@@ -1632,33 +1628,57 @@ static TypeCheckKind ComputeTypeCheckKind(Handle<mirror::Class> cls)
}
}
-void HInstructionBuilder::BuildTypeCheck(const Instruction& instruction,
- uint8_t destination,
- uint8_t reference,
- dex::TypeIndex type_index,
- uint32_t dex_pc) {
+HLoadClass* HInstructionBuilder::BuildLoadClass(dex::TypeIndex type_index,
+ uint32_t dex_pc,
+ bool check_access,
+ bool outer) {
ScopedObjectAccess soa(Thread::Current());
+ const DexCompilationUnit* compilation_unit =
+ outer ? outer_compilation_unit_ : dex_compilation_unit_;
+ const DexFile& dex_file = *compilation_unit->GetDexFile();
StackHandleScope<1> hs(soa.Self());
- const DexFile& dex_file = *dex_compilation_unit_->GetDexFile();
- Handle<mirror::DexCache> dex_cache = dex_compilation_unit_->GetDexCache();
- Handle<mirror::Class> resolved_class(hs.NewHandle(dex_cache->GetResolvedType(type_index)));
-
- bool can_access = compiler_driver_->CanAccessTypeWithoutChecks(
- dex_compilation_unit_->GetDexMethodIndex(),
- dex_cache,
- type_index);
+ Handle<mirror::ClassLoader> class_loader(hs.NewHandle(
+ soa.Decode<mirror::ClassLoader>(dex_compilation_unit_->GetClassLoader())));
+ Handle<mirror::Class> klass = handles_->NewHandle(compiler_driver_->ResolveClass(
+ soa, compilation_unit->GetDexCache(), class_loader, type_index, compilation_unit));
+
+ bool is_accessible = false;
+ if (!check_access) {
+ is_accessible = true;
+ } else if (klass.Get() != nullptr) {
+ if (klass->IsPublic()) {
+ is_accessible = true;
+ } else {
+ mirror::Class* compiling_class = GetCompilingClass();
+ if (compiling_class != nullptr && compiling_class->CanAccess(klass.Get())) {
+ is_accessible = true;
+ }
+ }
+ }
- HInstruction* object = LoadLocal(reference, Primitive::kPrimNot);
- HLoadClass* cls = new (arena_) HLoadClass(
+ HLoadClass* load_class = new (arena_) HLoadClass(
graph_->GetCurrentMethod(),
type_index,
dex_file,
- IsOutermostCompilingClass(type_index),
+ klass,
+ klass.Get() != nullptr && (klass.Get() == GetOutermostCompilingClass()),
dex_pc,
- !can_access);
- AppendInstruction(cls);
+ !is_accessible);
+
+ AppendInstruction(load_class);
+ return load_class;
+}
+
+void HInstructionBuilder::BuildTypeCheck(const Instruction& instruction,
+ uint8_t destination,
+ uint8_t reference,
+ dex::TypeIndex type_index,
+ uint32_t dex_pc) {
+ HInstruction* object = LoadLocal(reference, Primitive::kPrimNot);
+ HLoadClass* cls = BuildLoadClass(type_index, dex_pc, /* check_access */ true);
- TypeCheckKind check_kind = ComputeTypeCheckKind(resolved_class);
+ ScopedObjectAccess soa(Thread::Current());
+ TypeCheckKind check_kind = ComputeTypeCheckKind(cls->GetClass());
if (instruction.Opcode() == Instruction::INSTANCE_OF) {
AppendInstruction(new (arena_) HInstanceOf(object, cls, check_kind, dex_pc));
UpdateLocal(destination, current_block_->GetLastInstruction());
@@ -1915,6 +1935,37 @@ bool HInstructionBuilder::ProcessDexInstruction(const Instruction& instruction,
break;
}
+ case Instruction::INVOKE_POLYMORPHIC: {
+ uint16_t method_idx = instruction.VRegB_45cc();
+ uint16_t proto_idx = instruction.VRegH_45cc();
+ uint32_t number_of_vreg_arguments = instruction.VRegA_45cc();
+ uint32_t args[5];
+ instruction.GetVarArgs(args);
+ return BuildInvokePolymorphic(instruction,
+ dex_pc,
+ method_idx,
+ proto_idx,
+ number_of_vreg_arguments,
+ false,
+ args,
+ -1);
+ }
+
+ case Instruction::INVOKE_POLYMORPHIC_RANGE: {
+ uint16_t method_idx = instruction.VRegB_4rcc();
+ uint16_t proto_idx = instruction.VRegH_4rcc();
+ uint32_t number_of_vreg_arguments = instruction.VRegA_4rcc();
+ uint32_t register_index = instruction.VRegC_4rcc();
+ return BuildInvokePolymorphic(instruction,
+ dex_pc,
+ method_idx,
+ proto_idx,
+ number_of_vreg_arguments,
+ true,
+ nullptr,
+ register_index);
+ }
+
case Instruction::NEG_INT: {
Unop_12x<HNeg>(instruction, Primitive::kPrimInt, dex_pc);
break;
@@ -2448,16 +2499,8 @@ bool HInstructionBuilder::ProcessDexInstruction(const Instruction& instruction,
case Instruction::NEW_ARRAY: {
dex::TypeIndex type_index(instruction.VRegC_22c());
HInstruction* length = LoadLocal(instruction.VRegB_22c(), Primitive::kPrimInt);
- bool finalizable;
- QuickEntrypointEnum entrypoint = NeedsAccessCheck(type_index, &finalizable)
- ? kQuickAllocArrayWithAccessCheck
- : kQuickAllocArray;
- AppendInstruction(new (arena_) HNewArray(length,
- graph_->GetCurrentMethod(),
- dex_pc,
- type_index,
- *dex_compilation_unit_->GetDexFile(),
- entrypoint));
+ HLoadClass* cls = BuildLoadClass(type_index, dex_pc, /* check_access */ true);
+ AppendInstruction(new (arena_) HNewArray(cls, length, dex_pc));
UpdateLocal(instruction.VRegA_22c(), current_block_->GetLastInstruction());
break;
}
@@ -2631,21 +2674,7 @@ bool HInstructionBuilder::ProcessDexInstruction(const Instruction& instruction,
case Instruction::CONST_CLASS: {
dex::TypeIndex type_index(instruction.VRegB_21c());
- // `CanAccessTypeWithoutChecks` will tell whether the method being
- // built is trying to access its own class, so that the generated
- // code can optimize for this case. However, the optimization does not
- // work for inlining, so we use `IsOutermostCompilingClass` instead.
- ScopedObjectAccess soa(Thread::Current());
- Handle<mirror::DexCache> dex_cache = dex_compilation_unit_->GetDexCache();
- bool can_access = compiler_driver_->CanAccessTypeWithoutChecks(
- dex_compilation_unit_->GetDexMethodIndex(), dex_cache, type_index);
- AppendInstruction(new (arena_) HLoadClass(
- graph_->GetCurrentMethod(),
- type_index,
- *dex_file_,
- IsOutermostCompilingClass(type_index),
- dex_pc,
- !can_access));
+ BuildLoadClass(type_index, dex_pc, /* check_access */ true);
UpdateLocal(instruction.VRegA_21c(), current_block_->GetLastInstruction());
break;
}
diff --git a/compiler/optimizing/instruction_builder.h b/compiler/optimizing/instruction_builder.h
index f29e522040..5efe95094c 100644
--- a/compiler/optimizing/instruction_builder.h
+++ b/compiler/optimizing/instruction_builder.h
@@ -46,9 +46,11 @@ class HInstructionBuilder : public ValueObject {
CompilerDriver* driver,
const uint8_t* interpreter_metadata,
OptimizingCompilerStats* compiler_stats,
- Handle<mirror::DexCache> dex_cache)
+ Handle<mirror::DexCache> dex_cache,
+ VariableSizedHandleScope* handles)
: arena_(graph->GetArena()),
graph_(graph),
+ handles_(handles),
dex_file_(dex_file),
code_item_(code_item),
return_type_(return_type),
@@ -175,6 +177,17 @@ class HInstructionBuilder : public ValueObject {
uint32_t* args,
uint32_t register_index);
+ // Builds an invocation node for invoke-polymorphic and returns whether the
+ // instruction is supported.
+ bool BuildInvokePolymorphic(const Instruction& instruction,
+ uint32_t dex_pc,
+ uint32_t method_idx,
+ uint32_t proto_idx,
+ uint32_t number_of_vreg_arguments,
+ bool is_range,
+ uint32_t* args,
+ uint32_t register_index);
+
// Builds a new array node and the instructions that fill it.
void BuildFilledNewArray(uint32_t dex_pc,
dex::TypeIndex type_index,
@@ -212,6 +225,14 @@ class HInstructionBuilder : public ValueObject {
// Builds an instruction sequence for a switch statement.
void BuildSwitch(const Instruction& instruction, uint32_t dex_pc);
+ // Builds a `HLoadClass` loading the given `type_index`. If `outer` is true,
+ // this method will use the outer class's dex file to lookup the type at
+ // `type_index`.
+ HLoadClass* BuildLoadClass(dex::TypeIndex type_index,
+ uint32_t dex_pc,
+ bool check_access,
+ bool outer = false);
+
// Returns the outer-most compiling method's class.
mirror::Class* GetOutermostCompilingClass() const;
@@ -271,6 +292,7 @@ class HInstructionBuilder : public ValueObject {
ArenaAllocator* const arena_;
HGraph* const graph_;
+ VariableSizedHandleScope* handles_;
// The dex file where the method being compiled is, and the bytecode data.
const DexFile* const dex_file_;
diff --git a/compiler/optimizing/instruction_simplifier.cc b/compiler/optimizing/instruction_simplifier.cc
index 911bfb9cc6..35f59cb4a4 100644
--- a/compiler/optimizing/instruction_simplifier.cc
+++ b/compiler/optimizing/instruction_simplifier.cc
@@ -777,7 +777,7 @@ void InstructionSimplifierVisitor::VisitArrayLength(HArrayLength* instruction) {
// If the array is a NewArray with constant size, replace the array length
// with the constant instruction. This helps the bounds check elimination phase.
if (input->IsNewArray()) {
- input = input->InputAt(0);
+ input = input->AsNewArray()->GetLength();
if (input->IsIntConstant()) {
instruction->ReplaceWith(input);
}
@@ -1774,7 +1774,7 @@ static bool IsArrayLengthOf(HInstruction* potential_length, HInstruction* potent
}
if (potential_array->IsNewArray()) {
- return potential_array->InputAt(0) == potential_length;
+ return potential_array->AsNewArray()->GetLength() == potential_length;
}
return false;
diff --git a/compiler/optimizing/intrinsics.cc b/compiler/optimizing/intrinsics.cc
index fc6ff7b197..17d683f357 100644
--- a/compiler/optimizing/intrinsics.cc
+++ b/compiler/optimizing/intrinsics.cc
@@ -145,7 +145,7 @@ void IntrinsicsRecognizer::Run() {
if (!CheckInvokeType(intrinsic, invoke)) {
LOG(WARNING) << "Found an intrinsic with unexpected invoke type: "
<< intrinsic << " for "
- << invoke->GetDexFile().PrettyMethod(invoke->GetDexMethodIndex())
+ << art_method->PrettyMethod()
<< invoke->DebugName();
} else {
invoke->SetIntrinsic(intrinsic,
diff --git a/compiler/optimizing/load_store_elimination.cc b/compiler/optimizing/load_store_elimination.cc
index 2856c3ea11..2d3c00fb97 100644
--- a/compiler/optimizing/load_store_elimination.cc
+++ b/compiler/optimizing/load_store_elimination.cc
@@ -943,6 +943,10 @@ class LSEVisitor : public HGraphVisitor {
HandleInvoke(invoke);
}
+ void VisitInvokePolymorphic(HInvokePolymorphic* invoke) OVERRIDE {
+ HandleInvoke(invoke);
+ }
+
void VisitClinitCheck(HClinitCheck* clinit) OVERRIDE {
HandleInvoke(clinit);
}
@@ -975,7 +979,7 @@ class LSEVisitor : public HGraphVisitor {
}
if (ref_info->IsSingletonAndRemovable() &&
!new_instance->IsFinalizable() &&
- !new_instance->NeedsAccessCheck()) {
+ !new_instance->NeedsChecks()) {
singleton_new_instances_.push_back(new_instance);
}
ArenaVector<HInstruction*>& heap_values =
diff --git a/compiler/optimizing/loop_optimization.cc b/compiler/optimizing/loop_optimization.cc
index 9d73e29602..95838380cc 100644
--- a/compiler/optimizing/loop_optimization.cc
+++ b/compiler/optimizing/loop_optimization.cc
@@ -161,26 +161,27 @@ void HLoopOptimization::RemoveLoop(LoopNode* node) {
void HLoopOptimization::TraverseLoopsInnerToOuter(LoopNode* node) {
for ( ; node != nullptr; node = node->next) {
+ // Visit inner loops first.
int current_induction_simplification_count = induction_simplication_count_;
if (node->inner != nullptr) {
TraverseLoopsInnerToOuter(node->inner);
}
- // Visit loop after its inner loops have been visited. If the induction of any inner
- // loop has been simplified, recompute the induction information of this loop first.
+ // Recompute induction information of this loop if the induction
+ // of any inner loop has been simplified.
if (current_induction_simplification_count != induction_simplication_count_) {
induction_range_.ReVisit(node->loop_info);
}
- // Repeat simplifications until no more changes occur. Note that since
- // each simplification consists of eliminating code (without introducing
- // new code), this process is always finite.
+ // Repeat simplifications in the body of this loop until no more changes occur.
+ // Note that since each simplification consists of eliminating code (without
+ // introducing new code), this process is always finite.
do {
simplified_ = false;
- SimplifyBlocks(node);
SimplifyInduction(node);
+ SimplifyBlocks(node);
} while (simplified_);
- // Remove inner loops when empty.
+ // Simplify inner loop.
if (node->inner == nullptr) {
- RemoveIfEmptyInnerLoop(node);
+ SimplifyInnerLoop(node);
}
}
}
@@ -198,7 +199,7 @@ void HLoopOptimization::SimplifyInduction(LoopNode* node) {
iset_->clear();
int32_t use_count = 0;
if (IsPhiInduction(phi) &&
- IsOnlyUsedAfterLoop(node->loop_info, phi, &use_count) &&
+ IsOnlyUsedAfterLoop(node->loop_info, phi, /*collect_loop_uses*/ false, &use_count) &&
// No uses, or no early-exit with proper replacement.
(use_count == 0 ||
(!IsEarlyExit(node->loop_info) && TryReplaceWithLastValue(phi, preheader)))) {
@@ -206,7 +207,6 @@ void HLoopOptimization::SimplifyInduction(LoopNode* node) {
RemoveFromCycle(i);
}
simplified_ = true;
- induction_simplication_count_++;
}
}
}
@@ -216,24 +216,14 @@ void HLoopOptimization::SimplifyBlocks(LoopNode* node) {
for (HBlocksInLoopIterator it(*node->loop_info); !it.Done(); it.Advance()) {
HBasicBlock* block = it.Current();
// Remove dead instructions from the loop-body.
- for (HBackwardInstructionIterator i(block->GetInstructions()); !i.Done(); i.Advance()) {
- HInstruction* instruction = i.Current();
- if (instruction->IsDeadAndRemovable()) {
- simplified_ = true;
- block->RemoveInstruction(instruction);
- }
- }
+ RemoveDeadInstructions(block->GetPhis());
+ RemoveDeadInstructions(block->GetInstructions());
// Remove trivial control flow blocks from the loop-body.
- HBasicBlock* succ = nullptr;
- if (IsGotoBlock(block, &succ) && succ->GetPredecessors().size() == 1) {
- // Trivial goto block can be removed.
- HBasicBlock* pred = block->GetSinglePredecessor();
+ if (block->GetPredecessors().size() == 1 &&
+ block->GetSuccessors().size() == 1 &&
+ block->GetSingleSuccessor()->GetPredecessors().size() == 1) {
simplified_ = true;
- pred->ReplaceSuccessor(block, succ);
- block->RemoveDominatedBlock(succ);
- block->DisconnectAndDelete();
- pred->AddDominatedBlock(succ);
- succ->SetDominator(pred);
+ block->MergeWith(block->GetSingleSuccessor());
} else if (block->GetSuccessors().size() == 2) {
// Trivial if block can be bypassed to either branch.
HBasicBlock* succ0 = block->GetSuccessors()[0];
@@ -258,55 +248,66 @@ void HLoopOptimization::SimplifyBlocks(LoopNode* node) {
}
}
-void HLoopOptimization::RemoveIfEmptyInnerLoop(LoopNode* node) {
+bool HLoopOptimization::SimplifyInnerLoop(LoopNode* node) {
HBasicBlock* header = node->loop_info->GetHeader();
HBasicBlock* preheader = node->loop_info->GetPreHeader();
// Ensure loop header logic is finite.
- if (!induction_range_.IsFinite(node->loop_info)) {
- return;
+ int64_t tc = 0;
+ if (!induction_range_.IsFinite(node->loop_info, &tc)) {
+ return false;
}
// Ensure there is only a single loop-body (besides the header).
HBasicBlock* body = nullptr;
for (HBlocksInLoopIterator it(*node->loop_info); !it.Done(); it.Advance()) {
if (it.Current() != header) {
if (body != nullptr) {
- return;
+ return false;
}
body = it.Current();
}
}
// Ensure there is only a single exit point.
if (header->GetSuccessors().size() != 2) {
- return;
+ return false;
}
HBasicBlock* exit = (header->GetSuccessors()[0] == body)
? header->GetSuccessors()[1]
: header->GetSuccessors()[0];
// Ensure exit can only be reached by exiting loop.
if (exit->GetPredecessors().size() != 1) {
- return;
+ return false;
}
- // Detect an empty loop: no side effects other than plain iteration. Replace
- // subsequent index uses, if any, with the last value and remove the loop.
+ // Detect either an empty loop (no side effects other than plain iteration) or
+ // a trivial loop (just iterating once). Replace subsequent index uses, if any,
+ // with the last value and remove the loop, possibly after unrolling its body.
+ HInstruction* phi = header->GetFirstPhi();
iset_->clear();
int32_t use_count = 0;
- if (IsEmptyHeader(header) &&
- IsEmptyBody(body) &&
- IsOnlyUsedAfterLoop(node->loop_info, header->GetFirstPhi(), &use_count) &&
- // No uses, or proper replacement.
- (use_count == 0 || TryReplaceWithLastValue(header->GetFirstPhi(), preheader))) {
- body->DisconnectAndDelete();
- exit->RemovePredecessor(header);
- header->RemoveSuccessor(exit);
- header->RemoveDominatedBlock(exit);
- header->DisconnectAndDelete();
- preheader->AddSuccessor(exit);
- preheader->AddInstruction(new (graph_->GetArena()) HGoto()); // global allocator
- preheader->AddDominatedBlock(exit);
- exit->SetDominator(preheader);
- // Update hierarchy.
- RemoveLoop(node);
+ if (IsEmptyHeader(header)) {
+ bool is_empty = IsEmptyBody(body);
+ if ((is_empty || tc == 1) &&
+ IsOnlyUsedAfterLoop(node->loop_info, phi, /*collect_loop_uses*/ true, &use_count) &&
+ // No uses, or proper replacement.
+ (use_count == 0 || TryReplaceWithLastValue(phi, preheader))) {
+ if (!is_empty) {
+ // Unroll the loop body, which sees initial value of the index.
+ phi->ReplaceWith(phi->InputAt(0));
+ preheader->MergeInstructionsWith(body);
+ }
+ body->DisconnectAndDelete();
+ exit->RemovePredecessor(header);
+ header->RemoveSuccessor(exit);
+ header->RemoveDominatedBlock(exit);
+ header->DisconnectAndDelete();
+ preheader->AddSuccessor(exit);
+ preheader->AddInstruction(new (graph_->GetArena()) HGoto()); // global allocator
+ preheader->AddDominatedBlock(exit);
+ exit->SetDominator(preheader);
+ RemoveLoop(node); // update hierarchy
+ return true;
+ }
}
+ return false;
}
bool HLoopOptimization::IsPhiInduction(HPhi* phi) {
@@ -374,12 +375,19 @@ bool HLoopOptimization::IsEmptyBody(HBasicBlock* block) {
bool HLoopOptimization::IsOnlyUsedAfterLoop(HLoopInformation* loop_info,
HInstruction* instruction,
+ bool collect_loop_uses,
/*out*/ int32_t* use_count) {
for (const HUseListNode<HInstruction*>& use : instruction->GetUses()) {
HInstruction* user = use.GetUser();
if (iset_->find(user) == iset_->end()) { // not excluded?
HLoopInformation* other_loop_info = user->GetBlock()->GetLoopInformation();
if (other_loop_info != nullptr && other_loop_info->IsIn(*loop_info)) {
+ // If collect_loop_uses is set, simply keep adding those uses to the set.
+ // Otherwise, reject uses inside the loop that were not already in the set.
+ if (collect_loop_uses) {
+ iset_->insert(user);
+ continue;
+ }
return false;
}
++*use_count;
@@ -388,40 +396,48 @@ bool HLoopOptimization::IsOnlyUsedAfterLoop(HLoopInformation* loop_info,
return true;
}
-void HLoopOptimization::ReplaceAllUses(HInstruction* instruction, HInstruction* replacement) {
- const HUseList<HInstruction*>& uses = instruction->GetUses();
- for (auto it = uses.begin(), end = uses.end(); it != end;) {
- HInstruction* user = it->GetUser();
- size_t index = it->GetIndex();
- ++it; // increment before replacing
- if (iset_->find(user) == iset_->end()) { // not excluded?
- user->ReplaceInput(replacement, index);
- induction_range_.Replace(user, instruction, replacement); // update induction
- }
- }
- const HUseList<HEnvironment*>& env_uses = instruction->GetEnvUses();
- for (auto it = env_uses.begin(), end = env_uses.end(); it != end;) {
- HEnvironment* user = it->GetUser();
- size_t index = it->GetIndex();
- ++it; // increment before replacing
- if (iset_->find(user->GetHolder()) == iset_->end()) { // not excluded?
- user->RemoveAsUserOfInput(index);
- user->SetRawEnvAt(index, replacement);
- replacement->AddEnvUseAt(user, index);
- }
- }
-}
-
bool HLoopOptimization::TryReplaceWithLastValue(HInstruction* instruction, HBasicBlock* block) {
// Try to replace outside uses with the last value. Environment uses can consume this
// value too, since any first true use is outside the loop (although this may imply
// that de-opting may look "ahead" a bit on the phi value). If there are only environment
// uses, the value is dropped altogether, since the computations have no effect.
if (induction_range_.CanGenerateLastValue(instruction)) {
- ReplaceAllUses(instruction, induction_range_.GenerateLastValue(instruction, graph_, block));
+ HInstruction* replacement = induction_range_.GenerateLastValue(instruction, graph_, block);
+ const HUseList<HInstruction*>& uses = instruction->GetUses();
+ for (auto it = uses.begin(), end = uses.end(); it != end;) {
+ HInstruction* user = it->GetUser();
+ size_t index = it->GetIndex();
+ ++it; // increment before replacing
+ if (iset_->find(user) == iset_->end()) { // not excluded?
+ user->ReplaceInput(replacement, index);
+ induction_range_.Replace(user, instruction, replacement); // update induction
+ }
+ }
+ const HUseList<HEnvironment*>& env_uses = instruction->GetEnvUses();
+ for (auto it = env_uses.begin(), end = env_uses.end(); it != end;) {
+ HEnvironment* user = it->GetUser();
+ size_t index = it->GetIndex();
+ ++it; // increment before replacing
+ if (iset_->find(user->GetHolder()) == iset_->end()) { // not excluded?
+ user->RemoveAsUserOfInput(index);
+ user->SetRawEnvAt(index, replacement);
+ replacement->AddEnvUseAt(user, index);
+ }
+ }
+ induction_simplication_count_++;
return true;
}
return false;
}
+void HLoopOptimization::RemoveDeadInstructions(const HInstructionList& list) {
+ for (HBackwardInstructionIterator i(list); !i.Done(); i.Advance()) {
+ HInstruction* instruction = i.Current();
+ if (instruction->IsDeadAndRemovable()) {
+ simplified_ = true;
+ instruction->GetBlock()->RemoveInstructionOrPhi(instruction);
+ }
+ }
+}
+
} // namespace art
diff --git a/compiler/optimizing/loop_optimization.h b/compiler/optimizing/loop_optimization.h
index 0f05b24c37..9ddab4150c 100644
--- a/compiler/optimizing/loop_optimization.h
+++ b/compiler/optimizing/loop_optimization.h
@@ -60,19 +60,21 @@ class HLoopOptimization : public HOptimization {
void TraverseLoopsInnerToOuter(LoopNode* node);
+ // Simplification.
void SimplifyInduction(LoopNode* node);
void SimplifyBlocks(LoopNode* node);
- void RemoveIfEmptyInnerLoop(LoopNode* node);
+ bool SimplifyInnerLoop(LoopNode* node);
+ // Helpers.
bool IsPhiInduction(HPhi* phi);
bool IsEmptyHeader(HBasicBlock* block);
bool IsEmptyBody(HBasicBlock* block);
-
bool IsOnlyUsedAfterLoop(HLoopInformation* loop_info,
HInstruction* instruction,
+ bool collect_loop_uses,
/*out*/ int32_t* use_count);
- void ReplaceAllUses(HInstruction* instruction, HInstruction* replacement);
bool TryReplaceWithLastValue(HInstruction* instruction, HBasicBlock* block);
+ void RemoveDeadInstructions(const HInstructionList& list);
// Range information based on prior induction variable analysis.
InductionVarRange induction_range_;
diff --git a/compiler/optimizing/nodes.cc b/compiler/optimizing/nodes.cc
index d45fa11534..d15145e673 100644
--- a/compiler/optimizing/nodes.cc
+++ b/compiler/optimizing/nodes.cc
@@ -1853,6 +1853,14 @@ void HBasicBlock::DisconnectAndDelete() {
SetGraph(nullptr);
}
+void HBasicBlock::MergeInstructionsWith(HBasicBlock* other) {
+ DCHECK(EndsWithControlFlowInstruction());
+ RemoveInstruction(GetLastInstruction());
+ instructions_.Add(other->GetInstructions());
+ other->instructions_.SetBlockOfInstructions(this);
+ other->instructions_.Clear();
+}
+
void HBasicBlock::MergeWith(HBasicBlock* other) {
DCHECK_EQ(GetGraph(), other->GetGraph());
DCHECK(ContainsElement(dominated_blocks_, other));
@@ -1861,11 +1869,7 @@ void HBasicBlock::MergeWith(HBasicBlock* other) {
DCHECK(other->GetPhis().IsEmpty());
// Move instructions from `other` to `this`.
- DCHECK(EndsWithControlFlowInstruction());
- RemoveInstruction(GetLastInstruction());
- instructions_.Add(other->GetInstructions());
- other->instructions_.SetBlockOfInstructions(this);
- other->instructions_.Clear();
+ MergeInstructionsWith(other);
// Remove `other` from the loops it is included in.
for (HLoopInformationOutwardIterator it(*other); !it.Done(); it.Advance()) {
@@ -2387,6 +2391,14 @@ bool HInvoke::NeedsEnvironment() const {
return !opt.GetDoesNotNeedEnvironment();
}
+const DexFile& HInvokeStaticOrDirect::GetDexFileForPcRelativeDexCache() const {
+ ArtMethod* caller = GetEnvironment()->GetMethod();
+ ScopedObjectAccess soa(Thread::Current());
+ // `caller` is null for a top-level graph representing a method whose declaring
+ // class was not resolved.
+ return caller == nullptr ? GetBlock()->GetGraph()->GetDexFile() : *caller->GetDexFile();
+}
+
bool HInvokeStaticOrDirect::NeedsDexCacheOfDeclaringClass() const {
if (GetMethodLoadKind() != MethodLoadKind::kDexCacheViaMethod) {
return false;
@@ -2430,17 +2442,6 @@ std::ostream& operator<<(std::ostream& os, HInvokeStaticOrDirect::ClinitCheckReq
}
}
-// Helper for InstructionDataEquals to fetch the mirror Class out
-// from a kJitTableAddress LoadClass kind.
-// NO_THREAD_SAFETY_ANALYSIS because even though we're accessing
-// mirrors, they are stored in a variable size handle scope which is always
-// visited during a pause. Also, the only caller of this helper
-// only uses the mirror for pointer comparison.
-static inline mirror::Class* AsMirrorInternal(uint64_t address)
- NO_THREAD_SAFETY_ANALYSIS {
- return reinterpret_cast<StackReference<mirror::Class>*>(address)->AsMirrorPtr();
-}
-
bool HLoadClass::InstructionDataEquals(const HInstruction* other) const {
const HLoadClass* other_load_class = other->AsLoadClass();
// TODO: To allow GVN for HLoadClass from different dex files, we should compare the type
@@ -2451,11 +2452,12 @@ bool HLoadClass::InstructionDataEquals(const HInstruction* other) const {
}
switch (GetLoadKind()) {
case LoadKind::kBootImageAddress:
- return GetAddress() == other_load_class->GetAddress();
- case LoadKind::kJitTableAddress:
- return AsMirrorInternal(GetAddress()) == AsMirrorInternal(other_load_class->GetAddress());
+ case LoadKind::kJitTableAddress: {
+ ScopedObjectAccess soa(Thread::Current());
+ return GetClass().Get() == other_load_class->GetClass().Get();
+ }
default:
- DCHECK(HasTypeReference(GetLoadKind()) || HasDexCacheReference(GetLoadKind()));
+ DCHECK(HasTypeReference(GetLoadKind()));
return IsSameDexFile(GetDexFile(), other_load_class->GetDexFile());
}
}
@@ -2486,10 +2488,10 @@ std::ostream& operator<<(std::ostream& os, HLoadClass::LoadKind rhs) {
return os << "BootImageLinkTimePcRelative";
case HLoadClass::LoadKind::kBootImageAddress:
return os << "BootImageAddress";
+ case HLoadClass::LoadKind::kBssEntry:
+ return os << "BssEntry";
case HLoadClass::LoadKind::kJitTableAddress:
return os << "JitTableAddress";
- case HLoadClass::LoadKind::kDexCachePcRelative:
- return os << "DexCachePcRelative";
case HLoadClass::LoadKind::kDexCacheViaMethod:
return os << "DexCacheViaMethod";
default:
@@ -2498,17 +2500,6 @@ std::ostream& operator<<(std::ostream& os, HLoadClass::LoadKind rhs) {
}
}
-// Helper for InstructionDataEquals to fetch the mirror String out
-// from a kJitTableAddress LoadString kind.
-// NO_THREAD_SAFETY_ANALYSIS because even though we're accessing
-// mirrors, they are stored in a variable size handle scope which is always
-// visited during a pause. Also, the only caller of this helper
-// only uses the mirror for pointer comparison.
-static inline mirror::String* AsMirrorInternal(Handle<mirror::String> handle)
- NO_THREAD_SAFETY_ANALYSIS {
- return handle.Get();
-}
-
bool HLoadString::InstructionDataEquals(const HInstruction* other) const {
const HLoadString* other_load_string = other->AsLoadString();
// TODO: To allow GVN for HLoadString from different dex files, we should compare the strings
@@ -2519,8 +2510,10 @@ bool HLoadString::InstructionDataEquals(const HInstruction* other) const {
}
switch (GetLoadKind()) {
case LoadKind::kBootImageAddress:
- case LoadKind::kJitTableAddress:
- return AsMirrorInternal(GetString()) == AsMirrorInternal(other_load_string->GetString());
+ case LoadKind::kJitTableAddress: {
+ ScopedObjectAccess soa(Thread::Current());
+ return GetString().Get() == other_load_string->GetString().Get();
+ }
default:
return IsSameDexFile(GetDexFile(), other_load_string->GetDexFile());
}
@@ -2551,10 +2544,10 @@ std::ostream& operator<<(std::ostream& os, HLoadString::LoadKind rhs) {
return os << "BootImageAddress";
case HLoadString::LoadKind::kBssEntry:
return os << "BssEntry";
- case HLoadString::LoadKind::kDexCacheViaMethod:
- return os << "DexCacheViaMethod";
case HLoadString::LoadKind::kJitTableAddress:
return os << "JitTableAddress";
+ case HLoadString::LoadKind::kDexCacheViaMethod:
+ return os << "DexCacheViaMethod";
default:
LOG(FATAL) << "Unknown HLoadString::LoadKind: " << static_cast<int>(rhs);
UNREACHABLE();
diff --git a/compiler/optimizing/nodes.h b/compiler/optimizing/nodes.h
index ea9a94c420..a2980dca20 100644
--- a/compiler/optimizing/nodes.h
+++ b/compiler/optimizing/nodes.h
@@ -1097,6 +1097,9 @@ class HBasicBlock : public ArenaObject<kArenaAllocBasicBlock> {
// with a control flow instruction).
void ReplaceWith(HBasicBlock* other);
+ // Merges the instructions of `other` at the end of `this`.
+ void MergeInstructionsWith(HBasicBlock* other);
+
// Merge `other` at the end of `this`. This method updates loops, reverse post
// order, links to predecessors, successors, dominators and deletes the block
// from the graph. The two blocks must be successive, i.e. `this` the only
@@ -1291,6 +1294,7 @@ class HLoopInformationOutwardIterator : public ValueObject {
M(InvokeInterface, Invoke) \
M(InvokeStaticOrDirect, Invoke) \
M(InvokeVirtual, Invoke) \
+ M(InvokePolymorphic, Invoke) \
M(LessThan, Condition) \
M(LessThanOrEqual, Condition) \
M(LoadClass, Instruction) \
@@ -1720,28 +1724,22 @@ class HEnvironment : public ArenaObject<kArenaAllocEnvironment> {
public:
HEnvironment(ArenaAllocator* arena,
size_t number_of_vregs,
- const DexFile& dex_file,
- uint32_t method_idx,
+ ArtMethod* method,
uint32_t dex_pc,
- InvokeType invoke_type,
HInstruction* holder)
: vregs_(number_of_vregs, arena->Adapter(kArenaAllocEnvironmentVRegs)),
locations_(number_of_vregs, arena->Adapter(kArenaAllocEnvironmentLocations)),
parent_(nullptr),
- dex_file_(dex_file),
- method_idx_(method_idx),
+ method_(method),
dex_pc_(dex_pc),
- invoke_type_(invoke_type),
holder_(holder) {
}
HEnvironment(ArenaAllocator* arena, const HEnvironment& to_copy, HInstruction* holder)
: HEnvironment(arena,
to_copy.Size(),
- to_copy.GetDexFile(),
- to_copy.GetMethodIdx(),
+ to_copy.GetMethod(),
to_copy.GetDexPc(),
- to_copy.GetInvokeType(),
holder) {}
void SetAndCopyParentChain(ArenaAllocator* allocator, HEnvironment* parent) {
@@ -1790,16 +1788,8 @@ class HEnvironment : public ArenaObject<kArenaAllocEnvironment> {
return dex_pc_;
}
- uint32_t GetMethodIdx() const {
- return method_idx_;
- }
-
- InvokeType GetInvokeType() const {
- return invoke_type_;
- }
-
- const DexFile& GetDexFile() const {
- return dex_file_;
+ ArtMethod* GetMethod() const {
+ return method_;
}
HInstruction* GetHolder() const {
@@ -1815,10 +1805,8 @@ class HEnvironment : public ArenaObject<kArenaAllocEnvironment> {
ArenaVector<HUserRecord<HEnvironment*>> vregs_;
ArenaVector<Location> locations_;
HEnvironment* parent_;
- const DexFile& dex_file_;
- const uint32_t method_idx_;
+ ArtMethod* method_;
const uint32_t dex_pc_;
- const InvokeType invoke_type_;
// The instruction that holds this environment.
HInstruction* const holder_;
@@ -3780,14 +3768,12 @@ class HNewInstance FINAL : public HExpression<1> {
uint32_t dex_pc,
dex::TypeIndex type_index,
const DexFile& dex_file,
- bool needs_access_check,
bool finalizable,
QuickEntrypointEnum entrypoint)
: HExpression(Primitive::kPrimNot, SideEffects::CanTriggerGC(), dex_pc),
type_index_(type_index),
dex_file_(dex_file),
entrypoint_(entrypoint) {
- SetPackedFlag<kFlagNeedsAccessCheck>(needs_access_check);
SetPackedFlag<kFlagFinalizable>(finalizable);
SetRawInputAt(0, cls);
}
@@ -3801,8 +3787,9 @@ class HNewInstance FINAL : public HExpression<1> {
// Can throw errors when out-of-memory or if it's not instantiable/accessible.
bool CanThrow() const OVERRIDE { return true; }
- // Needs to call into runtime to make sure it's instantiable/accessible.
- bool NeedsAccessCheck() const { return GetPackedFlag<kFlagNeedsAccessCheck>(); }
+ bool NeedsChecks() const {
+ return entrypoint_ == kQuickAllocObjectWithChecks;
+ }
bool IsFinalizable() const { return GetPackedFlag<kFlagFinalizable>(); }
@@ -3814,13 +3801,21 @@ class HNewInstance FINAL : public HExpression<1> {
entrypoint_ = entrypoint;
}
+ HLoadClass* GetLoadClass() const {
+ HInstruction* input = InputAt(0);
+ if (input->IsClinitCheck()) {
+ input = input->InputAt(0);
+ }
+ DCHECK(input->IsLoadClass());
+ return input->AsLoadClass();
+ }
+
bool IsStringAlloc() const;
DECLARE_INSTRUCTION(NewInstance);
private:
- static constexpr size_t kFlagNeedsAccessCheck = kNumberOfExpressionPackedBits;
- static constexpr size_t kFlagFinalizable = kFlagNeedsAccessCheck + 1;
+ static constexpr size_t kFlagFinalizable = kNumberOfExpressionPackedBits;
static constexpr size_t kNumberOfNewInstancePackedBits = kFlagFinalizable + 1;
static_assert(kNumberOfNewInstancePackedBits <= kMaxNumberOfPackedBits,
"Too many packed fields.");
@@ -3866,7 +3861,6 @@ class HInvoke : public HVariableInputSizeInstruction {
Primitive::Type GetType() const OVERRIDE { return GetPackedField<ReturnTypeField>(); }
uint32_t GetDexMethodIndex() const { return dex_method_index_; }
- const DexFile& GetDexFile() const { return GetEnvironment()->GetDexFile(); }
InvokeType GetInvokeType() const {
return GetPackedField<InvokeTypeField>();
@@ -3983,6 +3977,28 @@ class HInvokeUnresolved FINAL : public HInvoke {
DISALLOW_COPY_AND_ASSIGN(HInvokeUnresolved);
};
+class HInvokePolymorphic FINAL : public HInvoke {
+ public:
+ HInvokePolymorphic(ArenaAllocator* arena,
+ uint32_t number_of_arguments,
+ Primitive::Type return_type,
+ uint32_t dex_pc,
+ uint32_t dex_method_index)
+ : HInvoke(arena,
+ number_of_arguments,
+ 0u /* number_of_other_inputs */,
+ return_type,
+ dex_pc,
+ dex_method_index,
+ nullptr,
+ kVirtual) {}
+
+ DECLARE_INSTRUCTION(InvokePolymorphic);
+
+ private:
+ DISALLOW_COPY_AND_ASSIGN(HInvokePolymorphic);
+};
+
class HInvokeStaticOrDirect FINAL : public HInvoke {
public:
// Requirements of this method call regarding the class
@@ -4164,6 +4180,8 @@ class HInvokeStaticOrDirect FINAL : public HInvoke {
return dispatch_info_.method_load_data;
}
+ const DexFile& GetDexFileForPcRelativeDexCache() const;
+
ClinitCheckRequirement GetClinitCheckRequirement() const {
return GetPackedField<ClinitCheckRequirementField>();
}
@@ -4346,23 +4364,12 @@ class HNeg FINAL : public HUnaryOperation {
class HNewArray FINAL : public HExpression<2> {
public:
- HNewArray(HInstruction* length,
- HCurrentMethod* current_method,
- uint32_t dex_pc,
- dex::TypeIndex type_index,
- const DexFile& dex_file,
- QuickEntrypointEnum entrypoint)
- : HExpression(Primitive::kPrimNot, SideEffects::CanTriggerGC(), dex_pc),
- type_index_(type_index),
- dex_file_(dex_file),
- entrypoint_(entrypoint) {
- SetRawInputAt(0, length);
- SetRawInputAt(1, current_method);
+ HNewArray(HInstruction* cls, HInstruction* length, uint32_t dex_pc)
+ : HExpression(Primitive::kPrimNot, SideEffects::CanTriggerGC(), dex_pc) {
+ SetRawInputAt(0, cls);
+ SetRawInputAt(1, length);
}
- dex::TypeIndex GetTypeIndex() const { return type_index_; }
- const DexFile& GetDexFile() const { return dex_file_; }
-
// Calls runtime so needs an environment.
bool NeedsEnvironment() const OVERRIDE { return true; }
@@ -4371,15 +4378,18 @@ class HNewArray FINAL : public HExpression<2> {
bool CanBeNull() const OVERRIDE { return false; }
- QuickEntrypointEnum GetEntrypoint() const { return entrypoint_; }
+ HLoadClass* GetLoadClass() const {
+ DCHECK(InputAt(0)->IsLoadClass());
+ return InputAt(0)->AsLoadClass();
+ }
+
+ HInstruction* GetLength() const {
+ return InputAt(1);
+ }
DECLARE_INSTRUCTION(NewArray);
private:
- const dex::TypeIndex type_index_;
- const DexFile& dex_file_;
- const QuickEntrypointEnum entrypoint_;
-
DISALLOW_COPY_AND_ASSIGN(HNewArray);
};
@@ -5423,10 +5433,10 @@ class HBoundsCheck FINAL : public HExpression<2> {
HBoundsCheck(HInstruction* index,
HInstruction* length,
uint32_t dex_pc,
- uint32_t string_char_at_method_index = DexFile::kDexNoIndex)
- : HExpression(index->GetType(), SideEffects::CanTriggerGC(), dex_pc),
- string_char_at_method_index_(string_char_at_method_index) {
+ bool string_char_at = false)
+ : HExpression(index->GetType(), SideEffects::CanTriggerGC(), dex_pc) {
DCHECK_EQ(Primitive::kPrimInt, Primitive::PrimitiveKind(index->GetType()));
+ SetPackedFlag<kFlagIsStringCharAt>(string_char_at);
SetRawInputAt(0, index);
SetRawInputAt(1, length);
}
@@ -5440,22 +5450,14 @@ class HBoundsCheck FINAL : public HExpression<2> {
bool CanThrow() const OVERRIDE { return true; }
- bool IsStringCharAt() const { return GetStringCharAtMethodIndex() != DexFile::kDexNoIndex; }
- uint32_t GetStringCharAtMethodIndex() const { return string_char_at_method_index_; }
+ bool IsStringCharAt() const { return GetPackedFlag<kFlagIsStringCharAt>(); }
HInstruction* GetIndex() const { return InputAt(0); }
DECLARE_INSTRUCTION(BoundsCheck);
private:
- // We treat a String as an array, creating the HBoundsCheck from String.charAt()
- // intrinsic in the instruction simplifier. We want to include the String.charAt()
- // in the stack trace if we actually throw the StringIndexOutOfBoundsException,
- // so we need to create an HEnvironment which will be translated to an InlineInfo
- // indicating the extra stack frame. Since we add this HEnvironment quite late,
- // in the PrepareForRegisterAllocation pass, we need to remember the method index
- // from the invoke as we don't want to look again at the dex bytecode.
- uint32_t string_char_at_method_index_; // DexFile::kDexNoIndex if regular array.
+ static constexpr size_t kFlagIsStringCharAt = kNumberOfExpressionPackedBits;
DISALLOW_COPY_AND_ASSIGN(HBoundsCheck);
};
@@ -5523,14 +5525,13 @@ class HLoadClass FINAL : public HInstruction {
// GetIncludePatchInformation().
kBootImageAddress,
+ // Load from an entry in the .bss section using a PC-relative load.
+ // Used for classes outside boot image when .bss is accessible with a PC-relative load.
+ kBssEntry,
+
// Load from the root table associated with the JIT compiled method.
kJitTableAddress,
- // Load from resolved types array in the dex cache using a PC-relative load.
- // Used for classes outside boot image when we know that we can access
- // the dex cache arrays using a PC-relative load.
- kDexCachePcRelative,
-
// Load from resolved types array accessed through the class loaded from
// the compiled method's own ArtMethod*. This is the default access type when
// all other types are unavailable.
@@ -5542,6 +5543,7 @@ class HLoadClass FINAL : public HInstruction {
HLoadClass(HCurrentMethod* current_method,
dex::TypeIndex type_index,
const DexFile& dex_file,
+ Handle<mirror::Class> klass,
bool is_referrers_class,
uint32_t dex_pc,
bool needs_access_check)
@@ -5549,6 +5551,7 @@ class HLoadClass FINAL : public HInstruction {
special_input_(HUserRecord<HInstruction*>(current_method)),
type_index_(type_index),
dex_file_(dex_file),
+ klass_(klass),
loaded_class_rti_(ReferenceTypeInfo::CreateInvalid()) {
// Referrers class should not need access check. We never inline unverified
// methods so we can't possibly end up in this situation.
@@ -5557,14 +5560,11 @@ class HLoadClass FINAL : public HInstruction {
SetPackedField<LoadKindField>(
is_referrers_class ? LoadKind::kReferrersClass : LoadKind::kDexCacheViaMethod);
SetPackedFlag<kFlagNeedsAccessCheck>(needs_access_check);
- SetPackedFlag<kFlagIsInDexCache>(false);
SetPackedFlag<kFlagIsInBootImage>(false);
SetPackedFlag<kFlagGenerateClInitCheck>(false);
}
- void SetLoadKindWithAddress(LoadKind load_kind, uint64_t address) {
- DCHECK(HasAddress(load_kind));
- load_data_.address = address;
+ void SetLoadKind(LoadKind load_kind) {
SetLoadKindInternal(load_kind);
}
@@ -5577,15 +5577,6 @@ class HLoadClass FINAL : public HInstruction {
SetLoadKindInternal(load_kind);
}
- void SetLoadKindWithDexCacheReference(LoadKind load_kind,
- const DexFile& dex_file,
- uint32_t element_index) {
- DCHECK(HasDexCacheReference(load_kind));
- DCHECK(IsSameDexFile(dex_file_, dex_file));
- load_data_.dex_cache_element_index = element_index;
- SetLoadKindInternal(load_kind);
- }
-
LoadKind GetLoadKind() const {
return GetPackedField<LoadKindField>();
}
@@ -5610,13 +5601,21 @@ class HLoadClass FINAL : public HInstruction {
}
bool CanCallRuntime() const {
- return MustGenerateClinitCheck() ||
- (!IsReferrersClass() && !IsInDexCache()) ||
- NeedsAccessCheck();
+ return NeedsAccessCheck() ||
+ MustGenerateClinitCheck() ||
+ GetLoadKind() == LoadKind::kDexCacheViaMethod ||
+ GetLoadKind() == LoadKind::kBssEntry;
}
bool CanThrow() const OVERRIDE {
- return CanCallRuntime();
+ return NeedsAccessCheck() ||
+ MustGenerateClinitCheck() ||
+ // If the class is in the boot image, the lookup in the runtime call cannot throw.
+ // This keeps CanThrow() consistent between non-PIC (using kBootImageAddress) and
+ // PIC and subsequently avoids a DCE behavior dependency on the PIC option.
+ ((GetLoadKind() == LoadKind::kDexCacheViaMethod ||
+ GetLoadKind() == LoadKind::kBssEntry) &&
+ !IsInBootImage());
}
ReferenceTypeInfo GetLoadedClassRTI() {
@@ -5632,15 +5631,8 @@ class HLoadClass FINAL : public HInstruction {
dex::TypeIndex GetTypeIndex() const { return type_index_; }
const DexFile& GetDexFile() const { return dex_file_; }
- uint32_t GetDexCacheElementOffset() const;
-
- uint64_t GetAddress() const {
- DCHECK(HasAddress(GetLoadKind()));
- return load_data_.address;
- }
-
bool NeedsDexCacheOfDeclaringClass() const OVERRIDE {
- return !IsReferrersClass();
+ return GetLoadKind() == LoadKind::kDexCacheViaMethod;
}
static SideEffects SideEffectsForArchRuntimeCalls() {
@@ -5649,17 +5641,9 @@ class HLoadClass FINAL : public HInstruction {
bool IsReferrersClass() const { return GetLoadKind() == LoadKind::kReferrersClass; }
bool NeedsAccessCheck() const { return GetPackedFlag<kFlagNeedsAccessCheck>(); }
- bool IsInDexCache() const { return GetPackedFlag<kFlagIsInDexCache>(); }
bool IsInBootImage() const { return GetPackedFlag<kFlagIsInBootImage>(); }
bool MustGenerateClinitCheck() const { return GetPackedFlag<kFlagGenerateClInitCheck>(); }
- void MarkInDexCache() {
- SetPackedFlag<kFlagIsInDexCache>(true);
- DCHECK(!NeedsEnvironment());
- RemoveEnvironment();
- SetSideEffects(SideEffects::None());
- }
-
void MarkInBootImage() {
SetPackedFlag<kFlagIsInBootImage>(true);
}
@@ -5676,12 +5660,15 @@ class HLoadClass FINAL : public HInstruction {
return Primitive::kPrimNot;
}
+ Handle<mirror::Class> GetClass() const {
+ return klass_;
+ }
+
DECLARE_INSTRUCTION(LoadClass);
private:
static constexpr size_t kFlagNeedsAccessCheck = kNumberOfGenericPackedBits;
- static constexpr size_t kFlagIsInDexCache = kFlagNeedsAccessCheck + 1;
- static constexpr size_t kFlagIsInBootImage = kFlagIsInDexCache + 1;
+ static constexpr size_t kFlagIsInBootImage = kFlagNeedsAccessCheck + 1;
// Whether this instruction must generate the initialization check.
// Used for code generation.
static constexpr size_t kFlagGenerateClInitCheck = kFlagIsInBootImage + 1;
@@ -5693,35 +5680,24 @@ class HLoadClass FINAL : public HInstruction {
using LoadKindField = BitField<LoadKind, kFieldLoadKind, kFieldLoadKindSize>;
static bool HasTypeReference(LoadKind load_kind) {
- return load_kind == LoadKind::kBootImageLinkTimeAddress ||
+ return load_kind == LoadKind::kReferrersClass ||
+ load_kind == LoadKind::kBootImageLinkTimeAddress ||
load_kind == LoadKind::kBootImageLinkTimePcRelative ||
- load_kind == LoadKind::kDexCacheViaMethod ||
- load_kind == LoadKind::kReferrersClass;
- }
-
- static bool HasAddress(LoadKind load_kind) {
- return load_kind == LoadKind::kBootImageAddress ||
- load_kind == LoadKind::kJitTableAddress;
- }
-
- static bool HasDexCacheReference(LoadKind load_kind) {
- return load_kind == LoadKind::kDexCachePcRelative;
+ load_kind == LoadKind::kBssEntry ||
+ load_kind == LoadKind::kDexCacheViaMethod;
}
void SetLoadKindInternal(LoadKind load_kind);
// The special input is the HCurrentMethod for kDexCacheViaMethod or kReferrersClass.
// For other load kinds it's empty or possibly some architecture-specific instruction
- // for PC-relative loads, i.e. kDexCachePcRelative or kBootImageLinkTimePcRelative.
+ // for PC-relative loads, i.e. kBssEntry or kBootImageLinkTimePcRelative.
HUserRecord<HInstruction*> special_input_;
const dex::TypeIndex type_index_;
const DexFile& dex_file_;
- union {
- uint32_t dex_cache_element_index; // Only for dex cache reference.
- uint64_t address; // Up to 64-bit, needed for kJitTableAddress on 64-bit targets.
- } load_data_;
+ Handle<mirror::Class> klass_;
ReferenceTypeInfo loaded_class_rti_;
@@ -5730,19 +5706,13 @@ class HLoadClass FINAL : public HInstruction {
std::ostream& operator<<(std::ostream& os, HLoadClass::LoadKind rhs);
// Note: defined outside class to see operator<<(., HLoadClass::LoadKind).
-inline uint32_t HLoadClass::GetDexCacheElementOffset() const {
- DCHECK(HasDexCacheReference(GetLoadKind())) << GetLoadKind();
- return load_data_.dex_cache_element_index;
-}
-
-// Note: defined outside class to see operator<<(., HLoadClass::LoadKind).
inline void HLoadClass::AddSpecialInput(HInstruction* special_input) {
// The special input is used for PC-relative loads on some architectures,
// including literal pool loads, which are PC-relative too.
DCHECK(GetLoadKind() == LoadKind::kBootImageLinkTimePcRelative ||
- GetLoadKind() == LoadKind::kDexCachePcRelative ||
GetLoadKind() == LoadKind::kBootImageLinkTimeAddress ||
- GetLoadKind() == LoadKind::kBootImageAddress) << GetLoadKind();
+ GetLoadKind() == LoadKind::kBootImageAddress ||
+ GetLoadKind() == LoadKind::kBssEntry) << GetLoadKind();
DCHECK(special_input_.GetInstruction() == nullptr);
special_input_ = HUserRecord<HInstruction*>(special_input);
special_input->AddUseAt(this, 0);
@@ -5770,15 +5740,15 @@ class HLoadString FINAL : public HInstruction {
// Used for strings outside boot image when .bss is accessible with a PC-relative load.
kBssEntry,
+ // Load from the root table associated with the JIT compiled method.
+ kJitTableAddress,
+
// Load from resolved strings array accessed through the class loaded from
// the compiled method's own ArtMethod*. This is the default access type when
// all other types are unavailable.
kDexCacheViaMethod,
- // Load from the root table associated with the JIT compiled method.
- kJitTableAddress,
-
- kLast = kJitTableAddress,
+ kLast = kDexCacheViaMethod,
};
HLoadString(HCurrentMethod* current_method,
@@ -5870,7 +5840,7 @@ class HLoadString FINAL : public HInstruction {
// The special input is the HCurrentMethod for kDexCacheViaMethod.
// For other load kinds it's empty or possibly some architecture-specific instruction
- // for PC-relative loads, i.e. kDexCachePcRelative or kBootImageLinkTimePcRelative.
+ // for PC-relative loads, i.e. kBssEntry or kBootImageLinkTimePcRelative.
HUserRecord<HInstruction*> special_input_;
dex::StringIndex string_index_;
@@ -5922,7 +5892,10 @@ class HClinitCheck FINAL : public HExpression<1> {
bool CanThrow() const OVERRIDE { return true; }
- HLoadClass* GetLoadClass() const { return InputAt(0)->AsLoadClass(); }
+ HLoadClass* GetLoadClass() const {
+ DCHECK(InputAt(0)->IsLoadClass());
+ return InputAt(0)->AsLoadClass();
+ }
DECLARE_INSTRUCTION(ClinitCheck);
@@ -6788,6 +6761,23 @@ inline void MakeRoomFor(ArenaVector<HBasicBlock*>* blocks,
std::copy_backward(blocks->begin() + after + 1u, blocks->begin() + old_size, blocks->end());
}
+/*
+ * Hunt "under the hood" of array lengths (leading to array references),
+ * null checks (also leading to array references), and new arrays
+ * (leading to the actual length). This makes it more likely related
+ * instructions become actually comparable.
+ */
+inline HInstruction* HuntForDeclaration(HInstruction* instruction) {
+ while (instruction->IsArrayLength() ||
+ instruction->IsNullCheck() ||
+ instruction->IsNewArray()) {
+ instruction = instruction->IsNewArray()
+ ? instruction->AsNewArray()->GetLength()
+ : instruction->InputAt(0);
+ }
+ return instruction;
+}
+
} // namespace art
#endif // ART_COMPILER_OPTIMIZING_NODES_H_
diff --git a/compiler/optimizing/nodes_test.cc b/compiler/optimizing/nodes_test.cc
index 5d9a6528ca..7686ba851b 100644
--- a/compiler/optimizing/nodes_test.cc
+++ b/compiler/optimizing/nodes_test.cc
@@ -52,7 +52,7 @@ TEST(Node, RemoveInstruction) {
exit_block->AddInstruction(new (&allocator) HExit());
HEnvironment* environment = new (&allocator) HEnvironment(
- &allocator, 1, graph->GetDexFile(), graph->GetMethodIdx(), 0, kStatic, null_check);
+ &allocator, 1, graph->GetArtMethod(), 0, null_check);
null_check->SetRawEnvironment(environment);
environment->SetRawEnvAt(0, parameter);
parameter->AddEnvUseAt(null_check->GetEnvironment(), 0);
@@ -137,7 +137,7 @@ TEST(Node, ParentEnvironment) {
ASSERT_TRUE(parameter1->GetUses().HasExactlyOneElement());
HEnvironment* environment = new (&allocator) HEnvironment(
- &allocator, 1, graph->GetDexFile(), graph->GetMethodIdx(), 0, kStatic, with_environment);
+ &allocator, 1, graph->GetArtMethod(), 0, with_environment);
ArenaVector<HInstruction*> array(allocator.Adapter());
array.push_back(parameter1);
@@ -148,13 +148,13 @@ TEST(Node, ParentEnvironment) {
ASSERT_TRUE(parameter1->GetEnvUses().HasExactlyOneElement());
HEnvironment* parent1 = new (&allocator) HEnvironment(
- &allocator, 1, graph->GetDexFile(), graph->GetMethodIdx(), 0, kStatic, nullptr);
+ &allocator, 1, graph->GetArtMethod(), 0, nullptr);
parent1->CopyFrom(array);
ASSERT_EQ(parameter1->GetEnvUses().SizeSlow(), 2u);
HEnvironment* parent2 = new (&allocator) HEnvironment(
- &allocator, 1, graph->GetDexFile(), graph->GetMethodIdx(), 0, kStatic, nullptr);
+ &allocator, 1, graph->GetArtMethod(), 0, nullptr);
parent2->CopyFrom(array);
parent1->SetAndCopyParentChain(&allocator, parent2);
diff --git a/compiler/optimizing/pc_relative_fixups_mips.cc b/compiler/optimizing/pc_relative_fixups_mips.cc
index e321b9e3aa..a0fdde169d 100644
--- a/compiler/optimizing/pc_relative_fixups_mips.cc
+++ b/compiler/optimizing/pc_relative_fixups_mips.cc
@@ -62,8 +62,9 @@ class PCRelativeHandlerVisitor : public HGraphVisitor {
HLoadClass::LoadKind load_kind = load_class->GetLoadKind();
switch (load_kind) {
case HLoadClass::LoadKind::kBootImageLinkTimeAddress:
- case HLoadClass::LoadKind::kBootImageAddress:
case HLoadClass::LoadKind::kBootImageLinkTimePcRelative:
+ case HLoadClass::LoadKind::kBootImageAddress:
+ case HLoadClass::LoadKind::kBssEntry:
// Add a base register for PC-relative literals on R2.
InitializePCRelativeBasePointer();
load_class->AddSpecialInput(base_);
diff --git a/compiler/optimizing/pc_relative_fixups_x86.cc b/compiler/optimizing/pc_relative_fixups_x86.cc
index b1fdb1792d..2befc8ca4e 100644
--- a/compiler/optimizing/pc_relative_fixups_x86.cc
+++ b/compiler/optimizing/pc_relative_fixups_x86.cc
@@ -83,7 +83,7 @@ class PCRelativeHandlerVisitor : public HGraphVisitor {
void VisitLoadClass(HLoadClass* load_class) OVERRIDE {
HLoadClass::LoadKind load_kind = load_class->GetLoadKind();
if (load_kind == HLoadClass::LoadKind::kBootImageLinkTimePcRelative ||
- load_kind == HLoadClass::LoadKind::kDexCachePcRelative) {
+ load_kind == HLoadClass::LoadKind::kBssEntry) {
InitializePCRelativeBasePointer();
load_class->AddSpecialInput(base_);
}
diff --git a/compiler/optimizing/prepare_for_register_allocation.cc b/compiler/optimizing/prepare_for_register_allocation.cc
index db7c1fbb06..efbaf6c221 100644
--- a/compiler/optimizing/prepare_for_register_allocation.cc
+++ b/compiler/optimizing/prepare_for_register_allocation.cc
@@ -16,6 +16,9 @@
#include "prepare_for_register_allocation.h"
+#include "jni_internal.h"
+#include "well_known_classes.h"
+
namespace art {
void PrepareForRegisterAllocation::Run() {
@@ -42,16 +45,12 @@ void PrepareForRegisterAllocation::VisitBoundsCheck(HBoundsCheck* check) {
if (check->IsStringCharAt()) {
// Add a fake environment for String.charAt() inline info as we want
// the exception to appear as being thrown from there.
- const DexFile& dex_file = check->GetEnvironment()->GetDexFile();
- DCHECK_STREQ(dex_file.PrettyMethod(check->GetStringCharAtMethodIndex()).c_str(),
- "char java.lang.String.charAt(int)");
+ ArtMethod* char_at_method = jni::DecodeArtMethod(WellKnownClasses::java_lang_String_charAt);
ArenaAllocator* arena = GetGraph()->GetArena();
HEnvironment* environment = new (arena) HEnvironment(arena,
/* number_of_vregs */ 0u,
- dex_file,
- check->GetStringCharAtMethodIndex(),
+ char_at_method,
/* dex_pc */ DexFile::kDexNoIndex,
- kVirtual,
check);
check->InsertRawEnvironment(environment);
}
@@ -199,8 +198,7 @@ bool PrepareForRegisterAllocation::CanMoveClinitCheck(HInstruction* input,
return false;
}
if (user_environment->GetDexPc() != input_environment->GetDexPc() ||
- user_environment->GetMethodIdx() != input_environment->GetMethodIdx() ||
- !IsSameDexFile(user_environment->GetDexFile(), input_environment->GetDexFile())) {
+ user_environment->GetMethod() != input_environment->GetMethod()) {
return false;
}
user_environment = user_environment->GetParent();
diff --git a/compiler/optimizing/reference_type_propagation.cc b/compiler/optimizing/reference_type_propagation.cc
index f8a4469712..b02f2509ab 100644
--- a/compiler/optimizing/reference_type_propagation.cc
+++ b/compiler/optimizing/reference_type_propagation.cc
@@ -295,13 +295,13 @@ static void BoundTypeForClassCheck(HInstruction* check) {
}
if (check->IsIf()) {
- HBasicBlock* trueBlock = check->IsEqual()
+ HBasicBlock* trueBlock = compare->IsEqual()
? check->AsIf()->IfTrueSuccessor()
: check->AsIf()->IfFalseSuccessor();
BoundTypeIn(receiver, trueBlock, /* start_instruction */ nullptr, class_rti);
} else {
DCHECK(check->IsDeoptimize());
- if (check->IsEqual()) {
+ if (compare->IsEqual()) {
BoundTypeIn(receiver, check->GetBlock(), check, class_rti);
}
}
@@ -499,18 +499,19 @@ void ReferenceTypePropagation::RTPVisitor::SetClassAsTypeInfo(HInstruction* inst
if (instr->IsInvokeStaticOrDirect() && instr->AsInvokeStaticOrDirect()->IsStringInit()) {
// Calls to String.<init> are replaced with a StringFactory.
if (kIsDebugBuild) {
- HInvoke* invoke = instr->AsInvoke();
+ HInvokeStaticOrDirect* invoke = instr->AsInvokeStaticOrDirect();
ClassLinker* cl = Runtime::Current()->GetClassLinker();
Thread* self = Thread::Current();
StackHandleScope<2> hs(self);
+ const DexFile& dex_file = *invoke->GetTargetMethod().dex_file;
Handle<mirror::DexCache> dex_cache(
- hs.NewHandle(FindDexCacheWithHint(self, invoke->GetDexFile(), hint_dex_cache_)));
+ hs.NewHandle(FindDexCacheWithHint(self, dex_file, hint_dex_cache_)));
// Use a null loader. We should probably use the compiling method's class loader,
// but then we would need to pass it to RTPVisitor just for this debug check. Since
// the method is from the String class, the null loader is good enough.
Handle<mirror::ClassLoader> loader;
ArtMethod* method = cl->ResolveMethod<ClassLinker::kNoICCECheckForCache>(
- invoke->GetDexFile(), invoke->GetDexMethodIndex(), dex_cache, loader, nullptr, kDirect);
+ dex_file, invoke->GetDexMethodIndex(), dex_cache, loader, nullptr, kDirect);
DCHECK(method != nullptr);
mirror::Class* declaring_class = method->GetDeclaringClass();
DCHECK(declaring_class != nullptr);
@@ -547,11 +548,13 @@ void ReferenceTypePropagation::RTPVisitor::UpdateReferenceTypeInfo(HInstruction*
}
void ReferenceTypePropagation::RTPVisitor::VisitNewInstance(HNewInstance* instr) {
- UpdateReferenceTypeInfo(instr, instr->GetTypeIndex(), instr->GetDexFile(), /* is_exact */ true);
+ ScopedObjectAccess soa(Thread::Current());
+ SetClassAsTypeInfo(instr, instr->GetLoadClass()->GetClass().Get(), /* is_exact */ true);
}
void ReferenceTypePropagation::RTPVisitor::VisitNewArray(HNewArray* instr) {
- UpdateReferenceTypeInfo(instr, instr->GetTypeIndex(), instr->GetDexFile(), /* is_exact */ true);
+ ScopedObjectAccess soa(Thread::Current());
+ SetClassAsTypeInfo(instr, instr->GetLoadClass()->GetClass().Get(), /* is_exact */ true);
}
static mirror::Class* GetClassFromDexCache(Thread* self,
@@ -619,14 +622,10 @@ void ReferenceTypePropagation::RTPVisitor::VisitUnresolvedStaticFieldGet(
void ReferenceTypePropagation::RTPVisitor::VisitLoadClass(HLoadClass* instr) {
ScopedObjectAccess soa(Thread::Current());
- // Get type from dex cache assuming it was populated by the verifier.
- mirror::Class* resolved_class = GetClassFromDexCache(soa.Self(),
- instr->GetDexFile(),
- instr->GetTypeIndex(),
- hint_dex_cache_);
- if (IsAdmissible(resolved_class)) {
+ Handle<mirror::Class> resolved_class = instr->GetClass();
+ if (IsAdmissible(resolved_class.Get())) {
instr->SetLoadedClassRTI(ReferenceTypeInfo::Create(
- handle_cache_->NewHandle(resolved_class), /* is_exact */ true));
+ resolved_class, /* is_exact */ true));
}
instr->SetReferenceTypeInfo(
ReferenceTypeInfo::Create(handle_cache_->GetClassClassHandle(), /* is_exact */ true));
@@ -843,12 +842,8 @@ void ReferenceTypePropagation::RTPVisitor::VisitInvoke(HInvoke* instr) {
}
ScopedObjectAccess soa(Thread::Current());
- ClassLinker* cl = Runtime::Current()->GetClassLinker();
- mirror::DexCache* dex_cache =
- FindDexCacheWithHint(soa.Self(), instr->GetDexFile(), hint_dex_cache_);
- PointerSize pointer_size = cl->GetImagePointerSize();
- ArtMethod* method = dex_cache->GetResolvedMethod(instr->GetDexMethodIndex(), pointer_size);
- mirror::Class* klass = (method == nullptr) ? nullptr : method->GetReturnType(false, pointer_size);
+ ArtMethod* method = instr->GetResolvedMethod();
+ mirror::Class* klass = (method == nullptr) ? nullptr : method->GetReturnType(/* resolve */ false);
SetClassAsTypeInfo(instr, klass, /* is_exact */ false);
}
diff --git a/compiler/optimizing/sharpening.cc b/compiler/optimizing/sharpening.cc
index dc8ee23ba4..c5294107ae 100644
--- a/compiler/optimizing/sharpening.cc
+++ b/compiler/optimizing/sharpening.cc
@@ -133,72 +133,65 @@ void HSharpening::ProcessInvokeStaticOrDirect(HInvokeStaticOrDirect* invoke) {
void HSharpening::ProcessLoadClass(HLoadClass* load_class) {
ScopedObjectAccess soa(Thread::Current());
- StackHandleScope<1> hs(soa.Self());
- Runtime* runtime = Runtime::Current();
- ClassLinker* class_linker = runtime->GetClassLinker();
- const DexFile& dex_file = load_class->GetDexFile();
- dex::TypeIndex type_index = load_class->GetTypeIndex();
- Handle<mirror::DexCache> dex_cache = IsSameDexFile(dex_file, *compilation_unit_.GetDexFile())
- ? compilation_unit_.GetDexCache()
- : hs.NewHandle(class_linker->FindDexCache(soa.Self(), dex_file));
- mirror::Class* cls = dex_cache->GetResolvedType(type_index);
- SharpenClass(load_class, cls, handles_, codegen_, compiler_driver_);
+ SharpenClass(load_class, codegen_, compiler_driver_);
}
void HSharpening::SharpenClass(HLoadClass* load_class,
- mirror::Class* klass,
- VariableSizedHandleScope* handles,
CodeGenerator* codegen,
CompilerDriver* compiler_driver) {
- ScopedAssertNoThreadSuspension sants("Sharpening class in compiler");
+ Handle<mirror::Class> klass = load_class->GetClass();
DCHECK(load_class->GetLoadKind() == HLoadClass::LoadKind::kDexCacheViaMethod ||
load_class->GetLoadKind() == HLoadClass::LoadKind::kReferrersClass)
<< load_class->GetLoadKind();
- DCHECK(!load_class->IsInDexCache()) << "HLoadClass should not be optimized before sharpening.";
DCHECK(!load_class->IsInBootImage()) << "HLoadClass should not be optimized before sharpening.";
+ if (load_class->NeedsAccessCheck()) {
+ // We need to call the runtime anyway, so we simply get the class as that call's return value.
+ return;
+ }
+
+ if (load_class->GetLoadKind() == HLoadClass::LoadKind::kReferrersClass) {
+ // Loading from the ArtMethod* is the most efficient retrieval in code size.
+ // TODO: This may not actually be true for all architectures and
+ // locations of target classes. The additional register pressure
+ // for using the ArtMethod* should be considered.
+ return;
+ }
+
const DexFile& dex_file = load_class->GetDexFile();
dex::TypeIndex type_index = load_class->GetTypeIndex();
- bool is_in_dex_cache = false;
bool is_in_boot_image = false;
HLoadClass::LoadKind desired_load_kind = static_cast<HLoadClass::LoadKind>(-1);
- uint64_t address = 0u; // Class or dex cache element address.
Runtime* runtime = Runtime::Current();
if (codegen->GetCompilerOptions().IsBootImage()) {
// Compiling boot image. Check if the class is a boot image class.
DCHECK(!runtime->UseJitCompilation());
if (!compiler_driver->GetSupportBootImageFixup()) {
- // MIPS64 or compiler_driver_test. Do not sharpen.
+ // compiler_driver_test. Do not sharpen.
desired_load_kind = HLoadClass::LoadKind::kDexCacheViaMethod;
- } else if ((klass != nullptr) && compiler_driver->IsImageClass(
+ } else if ((klass.Get() != nullptr) && compiler_driver->IsImageClass(
dex_file.StringDataByIdx(dex_file.GetTypeId(type_index).descriptor_idx_))) {
is_in_boot_image = true;
- is_in_dex_cache = true;
desired_load_kind = codegen->GetCompilerOptions().GetCompilePic()
? HLoadClass::LoadKind::kBootImageLinkTimePcRelative
: HLoadClass::LoadKind::kBootImageLinkTimeAddress;
} else {
- // Not a boot image class. We must go through the dex cache.
+ // Not a boot image class.
DCHECK(ContainsElement(compiler_driver->GetDexFilesForOatFile(), &dex_file));
- desired_load_kind = HLoadClass::LoadKind::kDexCachePcRelative;
+ desired_load_kind = HLoadClass::LoadKind::kBssEntry;
}
} else {
- is_in_boot_image = (klass != nullptr) && runtime->GetHeap()->ObjectIsInBootImageSpace(klass);
+ is_in_boot_image = (klass.Get() != nullptr) &&
+ runtime->GetHeap()->ObjectIsInBootImageSpace(klass.Get());
if (runtime->UseJitCompilation()) {
// TODO: Make sure we don't set the "compile PIC" flag for JIT as that's bogus.
// DCHECK(!codegen_->GetCompilerOptions().GetCompilePic());
- is_in_dex_cache = (klass != nullptr);
if (is_in_boot_image) {
// TODO: Use direct pointers for all non-moving spaces, not just boot image. Bug: 29530787
desired_load_kind = HLoadClass::LoadKind::kBootImageAddress;
- address = reinterpret_cast64<uint64_t>(klass);
- } else if (is_in_dex_cache) {
+ } else if (klass.Get() != nullptr) {
desired_load_kind = HLoadClass::LoadKind::kJitTableAddress;
- // We store in the address field the location of the stack reference maintained
- // by the handle. We do this now so that the code generation does not need to figure
- // out which class loader to use.
- address = reinterpret_cast<uint64_t>(handles->NewHandle(klass).GetReference());
} else {
// Class not loaded yet. This happens when the dex code requesting
// this `HLoadClass` hasn't been executed in the interpreter.
@@ -209,15 +202,9 @@ void HSharpening::SharpenClass(HLoadClass* load_class,
} else if (is_in_boot_image && !codegen->GetCompilerOptions().GetCompilePic()) {
// AOT app compilation. Check if the class is in the boot image.
desired_load_kind = HLoadClass::LoadKind::kBootImageAddress;
- address = reinterpret_cast64<uint64_t>(klass);
} else {
// Not JIT and either the klass is not in boot image or we are compiling in PIC mode.
- // Use PC-relative load from the dex cache if the dex file belongs
- // to the oat file that we're currently compiling.
- desired_load_kind =
- ContainsElement(compiler_driver->GetDexFilesForOatFile(), &load_class->GetDexFile())
- ? HLoadClass::LoadKind::kDexCachePcRelative
- : HLoadClass::LoadKind::kDexCacheViaMethod;
+ desired_load_kind = HLoadClass::LoadKind::kBssEntry;
}
}
DCHECK_NE(desired_load_kind, static_cast<HLoadClass::LoadKind>(-1));
@@ -226,42 +213,18 @@ void HSharpening::SharpenClass(HLoadClass* load_class,
load_class->MarkInBootImage();
}
- if (load_class->NeedsAccessCheck()) {
- // We need to call the runtime anyway, so we simply get the class as that call's return value.
- return;
- }
-
- if (load_class->GetLoadKind() == HLoadClass::LoadKind::kReferrersClass) {
- // Loading from the ArtMethod* is the most efficient retrieval in code size.
- // TODO: This may not actually be true for all architectures and
- // locations of target classes. The additional register pressure
- // for using the ArtMethod* should be considered.
- return;
- }
-
- if (is_in_dex_cache) {
- load_class->MarkInDexCache();
- }
-
HLoadClass::LoadKind load_kind = codegen->GetSupportedLoadClassKind(desired_load_kind);
switch (load_kind) {
case HLoadClass::LoadKind::kBootImageLinkTimeAddress:
case HLoadClass::LoadKind::kBootImageLinkTimePcRelative:
+ case HLoadClass::LoadKind::kBssEntry:
case HLoadClass::LoadKind::kDexCacheViaMethod:
load_class->SetLoadKindWithTypeReference(load_kind, dex_file, type_index);
break;
case HLoadClass::LoadKind::kBootImageAddress:
case HLoadClass::LoadKind::kJitTableAddress:
- DCHECK_NE(address, 0u);
- load_class->SetLoadKindWithAddress(load_kind, address);
- break;
- case HLoadClass::LoadKind::kDexCachePcRelative: {
- PointerSize pointer_size = InstructionSetPointerSize(codegen->GetInstructionSet());
- DexCacheArraysLayout layout(pointer_size, &dex_file);
- size_t element_index = layout.TypeOffset(type_index);
- load_class->SetLoadKindWithDexCacheReference(load_kind, dex_file, element_index);
+ load_class->SetLoadKind(load_kind);
break;
- }
default:
LOG(FATAL) << "Unexpected load kind: " << load_kind;
UNREACHABLE();
@@ -274,7 +237,7 @@ void HSharpening::ProcessLoadString(HLoadString* load_string) {
const DexFile& dex_file = load_string->GetDexFile();
dex::StringIndex string_index = load_string->GetStringIndex();
- HLoadString::LoadKind desired_load_kind = HLoadString::LoadKind::kDexCacheViaMethod;
+ HLoadString::LoadKind desired_load_kind = static_cast<HLoadString::LoadKind>(-1);
{
Runtime* runtime = Runtime::Current();
ClassLinker* class_linker = runtime->GetClassLinker();
@@ -297,8 +260,8 @@ void HSharpening::ProcessLoadString(HLoadString* load_string) {
? HLoadString::LoadKind::kBootImageLinkTimePcRelative
: HLoadString::LoadKind::kBootImageLinkTimeAddress;
} else {
- // MIPS64 or compiler_driver_test. Do not sharpen.
- DCHECK_EQ(desired_load_kind, HLoadString::LoadKind::kDexCacheViaMethod);
+ // compiler_driver_test. Do not sharpen.
+ desired_load_kind = HLoadString::LoadKind::kDexCacheViaMethod;
}
} else if (runtime->UseJitCompilation()) {
// TODO: Make sure we don't set the "compile PIC" flag for JIT as that's bogus.
@@ -310,6 +273,8 @@ void HSharpening::ProcessLoadString(HLoadString* load_string) {
} else {
desired_load_kind = HLoadString::LoadKind::kJitTableAddress;
}
+ } else {
+ desired_load_kind = HLoadString::LoadKind::kDexCacheViaMethod;
}
} else {
// AOT app compilation. Try to lookup the string without allocating if not found.
@@ -326,6 +291,7 @@ void HSharpening::ProcessLoadString(HLoadString* load_string) {
load_string->SetString(handles_->NewHandle(string));
}
}
+ DCHECK_NE(desired_load_kind, static_cast<HLoadString::LoadKind>(-1));
HLoadString::LoadKind load_kind = codegen_->GetSupportedLoadStringKind(desired_load_kind);
load_string->SetLoadKind(load_kind);
diff --git a/compiler/optimizing/sharpening.h b/compiler/optimizing/sharpening.h
index ae5ccb33ab..ae3d83ef2c 100644
--- a/compiler/optimizing/sharpening.h
+++ b/compiler/optimizing/sharpening.h
@@ -49,8 +49,6 @@ class HSharpening : public HOptimization {
// Used internally but also by the inliner.
static void SharpenClass(HLoadClass* load_class,
- mirror::Class* klass,
- VariableSizedHandleScope* handles,
CodeGenerator* codegen,
CompilerDriver* compiler_driver)
REQUIRES_SHARED(Locks::mutator_lock_);
diff --git a/compiler/optimizing/stack_map_stream.cc b/compiler/optimizing/stack_map_stream.cc
index fc8af6462a..6087e36507 100644
--- a/compiler/optimizing/stack_map_stream.cc
+++ b/compiler/optimizing/stack_map_stream.cc
@@ -13,8 +13,13 @@
* See the License for the specific language governing permissions and
* limitations under the License.
*/
+
#include "stack_map_stream.h"
+#include "art_method.h"
+#include "runtime.h"
+#include "scoped_thread_state_change-inl.h"
+
namespace art {
void StackMapStream::BeginStackMapEntry(uint32_t dex_pc,
@@ -98,15 +103,27 @@ void StackMapStream::AddDexRegisterEntry(DexRegisterLocation::Kind kind, int32_t
current_dex_register_++;
}
-void StackMapStream::BeginInlineInfoEntry(uint32_t method_index,
+static bool EncodeArtMethodInInlineInfo(ArtMethod* method ATTRIBUTE_UNUSED) {
+ // Note: the runtime is null only for unit testing.
+ return Runtime::Current() == nullptr || !Runtime::Current()->IsAotCompiler();
+}
+
+void StackMapStream::BeginInlineInfoEntry(ArtMethod* method,
uint32_t dex_pc,
- InvokeType invoke_type,
- uint32_t num_dex_registers) {
+ uint32_t num_dex_registers,
+ const DexFile* outer_dex_file) {
DCHECK(!in_inline_frame_);
in_inline_frame_ = true;
- current_inline_info_.method_index = method_index;
+ if (EncodeArtMethodInInlineInfo(method)) {
+ current_inline_info_.method = method;
+ } else {
+ if (dex_pc != static_cast<uint32_t>(-1) && kIsDebugBuild) {
+ ScopedObjectAccess soa(Thread::Current());
+ DCHECK(IsSameDexFile(*outer_dex_file, *method->GetDexFile()));
+ }
+ current_inline_info_.method_index = method->GetDexMethodIndexUnchecked();
+ }
current_inline_info_.dex_pc = dex_pc;
- current_inline_info_.invoke_type = invoke_type;
current_inline_info_.num_dex_registers = num_dex_registers;
current_inline_info_.dex_register_locations_start_index = dex_register_locations_.size();
if (num_dex_registers != 0) {
@@ -229,25 +246,32 @@ size_t StackMapStream::ComputeDexRegisterMapsSize() const {
void StackMapStream::ComputeInlineInfoEncoding() {
uint32_t method_index_max = 0;
uint32_t dex_pc_max = DexFile::kDexNoIndex;
- uint32_t invoke_type_max = 0;
+ uint32_t extra_data_max = 0;
uint32_t inline_info_index = 0;
for (const StackMapEntry& entry : stack_maps_) {
for (size_t j = 0; j < entry.inlining_depth; ++j) {
InlineInfoEntry inline_entry = inline_infos_[inline_info_index++];
- method_index_max = std::max(method_index_max, inline_entry.method_index);
+ if (inline_entry.method == nullptr) {
+ method_index_max = std::max(method_index_max, inline_entry.method_index);
+ extra_data_max = std::max(extra_data_max, 1u);
+ } else {
+ method_index_max = std::max(
+ method_index_max, High32Bits(reinterpret_cast<uintptr_t>(inline_entry.method)));
+ extra_data_max = std::max(
+ extra_data_max, Low32Bits(reinterpret_cast<uintptr_t>(inline_entry.method)));
+ }
if (inline_entry.dex_pc != DexFile::kDexNoIndex &&
(dex_pc_max == DexFile::kDexNoIndex || dex_pc_max < inline_entry.dex_pc)) {
dex_pc_max = inline_entry.dex_pc;
}
- invoke_type_max = std::max(invoke_type_max, static_cast<uint32_t>(inline_entry.invoke_type));
}
}
DCHECK_EQ(inline_info_index, inline_infos_.size());
inline_info_encoding_.SetFromSizes(method_index_max,
dex_pc_max,
- invoke_type_max,
+ extra_data_max,
dex_register_maps_size_);
}
@@ -354,9 +378,20 @@ void StackMapStream::FillIn(MemoryRegion region) {
DCHECK_LE(entry.inline_infos_start_index + entry.inlining_depth, inline_infos_.size());
for (size_t depth = 0; depth < entry.inlining_depth; ++depth) {
InlineInfoEntry inline_entry = inline_infos_[depth + entry.inline_infos_start_index];
- inline_info.SetMethodIndexAtDepth(inline_info_encoding_, depth, inline_entry.method_index);
+ if (inline_entry.method != nullptr) {
+ inline_info.SetMethodIndexAtDepth(
+ inline_info_encoding_,
+ depth,
+ High32Bits(reinterpret_cast<uintptr_t>(inline_entry.method)));
+ inline_info.SetExtraDataAtDepth(
+ inline_info_encoding_,
+ depth,
+ Low32Bits(reinterpret_cast<uintptr_t>(inline_entry.method)));
+ } else {
+ inline_info.SetMethodIndexAtDepth(inline_info_encoding_, depth, inline_entry.method_index);
+ inline_info.SetExtraDataAtDepth(inline_info_encoding_, depth, 1);
+ }
inline_info.SetDexPcAtDepth(inline_info_encoding_, depth, inline_entry.dex_pc);
- inline_info.SetInvokeTypeAtDepth(inline_info_encoding_, depth, inline_entry.invoke_type);
if (inline_entry.num_dex_registers == 0) {
// No dex map available.
inline_info.SetDexRegisterMapOffsetAtDepth(inline_info_encoding_,
@@ -544,10 +579,13 @@ void StackMapStream::CheckCodeInfo(MemoryRegion region) const {
InlineInfoEntry inline_entry = inline_infos_[inline_info_index];
DCHECK_EQ(inline_info.GetDexPcAtDepth(encoding.inline_info_encoding, d),
inline_entry.dex_pc);
- DCHECK_EQ(inline_info.GetMethodIndexAtDepth(encoding.inline_info_encoding, d),
- inline_entry.method_index);
- DCHECK_EQ(inline_info.GetInvokeTypeAtDepth(encoding.inline_info_encoding, d),
- inline_entry.invoke_type);
+ if (inline_info.EncodesArtMethodAtDepth(encoding.inline_info_encoding, d)) {
+ DCHECK_EQ(inline_info.GetArtMethodAtDepth(encoding.inline_info_encoding, d),
+ inline_entry.method);
+ } else {
+ DCHECK_EQ(inline_info.GetMethodIndexAtDepth(encoding.inline_info_encoding, d),
+ inline_entry.method_index);
+ }
CheckDexRegisterMap(code_info,
code_info.GetDexRegisterMapAtDepth(
diff --git a/compiler/optimizing/stack_map_stream.h b/compiler/optimizing/stack_map_stream.h
index 53a9795d52..d6f42b373c 100644
--- a/compiler/optimizing/stack_map_stream.h
+++ b/compiler/optimizing/stack_map_stream.h
@@ -109,8 +109,8 @@ class StackMapStream : public ValueObject {
struct InlineInfoEntry {
uint32_t dex_pc; // DexFile::kDexNoIndex for intrinsified native methods.
+ ArtMethod* method;
uint32_t method_index;
- InvokeType invoke_type;
uint32_t num_dex_registers;
BitVector* live_dex_registers_mask;
size_t dex_register_locations_start_index;
@@ -126,10 +126,10 @@ class StackMapStream : public ValueObject {
void AddDexRegisterEntry(DexRegisterLocation::Kind kind, int32_t value);
- void BeginInlineInfoEntry(uint32_t method_index,
+ void BeginInlineInfoEntry(ArtMethod* method,
uint32_t dex_pc,
- InvokeType invoke_type,
- uint32_t num_dex_registers);
+ uint32_t num_dex_registers,
+ const DexFile* outer_dex_file = nullptr);
void EndInlineInfoEntry();
size_t GetNumberOfStackMaps() const {
diff --git a/compiler/optimizing/stack_map_test.cc b/compiler/optimizing/stack_map_test.cc
index 967fd96561..22810ea4f7 100644
--- a/compiler/optimizing/stack_map_test.cc
+++ b/compiler/optimizing/stack_map_test.cc
@@ -16,6 +16,7 @@
#include "stack_map.h"
+#include "art_method.h"
#include "base/arena_bit_vector.h"
#include "stack_map_stream.h"
@@ -128,6 +129,7 @@ TEST(StackMapTest, Test2) {
ArenaPool pool;
ArenaAllocator arena(&pool);
StackMapStream stream(&arena);
+ ArtMethod art_method;
ArenaBitVector sp_mask1(&arena, 0, true);
sp_mask1.SetBit(2);
@@ -137,9 +139,9 @@ TEST(StackMapTest, Test2) {
stream.BeginStackMapEntry(0, 64, 0x3, &sp_mask1, number_of_dex_registers, 2);
stream.AddDexRegisterEntry(Kind::kInStack, 0); // Short location.
stream.AddDexRegisterEntry(Kind::kConstant, -2); // Large location.
- stream.BeginInlineInfoEntry(82, 3, kDirect, number_of_dex_registers_in_inline_info);
+ stream.BeginInlineInfoEntry(&art_method, 3, number_of_dex_registers_in_inline_info);
stream.EndInlineInfoEntry();
- stream.BeginInlineInfoEntry(42, 2, kStatic, number_of_dex_registers_in_inline_info);
+ stream.BeginInlineInfoEntry(&art_method, 2, number_of_dex_registers_in_inline_info);
stream.EndInlineInfoEntry();
stream.EndStackMapEntry();
@@ -238,12 +240,10 @@ TEST(StackMapTest, Test2) {
ASSERT_TRUE(stack_map.HasInlineInfo(encoding.stack_map_encoding));
InlineInfo inline_info = code_info.GetInlineInfoOf(stack_map, encoding);
ASSERT_EQ(2u, inline_info.GetDepth(encoding.inline_info_encoding));
- ASSERT_EQ(82u, inline_info.GetMethodIndexAtDepth(encoding.inline_info_encoding, 0));
- ASSERT_EQ(42u, inline_info.GetMethodIndexAtDepth(encoding.inline_info_encoding, 1));
ASSERT_EQ(3u, inline_info.GetDexPcAtDepth(encoding.inline_info_encoding, 0));
ASSERT_EQ(2u, inline_info.GetDexPcAtDepth(encoding.inline_info_encoding, 1));
- ASSERT_EQ(kDirect, inline_info.GetInvokeTypeAtDepth(encoding.inline_info_encoding, 0));
- ASSERT_EQ(kStatic, inline_info.GetInvokeTypeAtDepth(encoding.inline_info_encoding, 1));
+ ASSERT_TRUE(inline_info.EncodesArtMethodAtDepth(encoding.inline_info_encoding, 0));
+ ASSERT_TRUE(inline_info.EncodesArtMethodAtDepth(encoding.inline_info_encoding, 1));
}
// Second stack map.
@@ -662,6 +662,7 @@ TEST(StackMapTest, InlineTest) {
ArenaPool pool;
ArenaAllocator arena(&pool);
StackMapStream stream(&arena);
+ ArtMethod art_method;
ArenaBitVector sp_mask1(&arena, 0, true);
sp_mask1.SetBit(2);
@@ -672,10 +673,10 @@ TEST(StackMapTest, InlineTest) {
stream.AddDexRegisterEntry(Kind::kInStack, 0);
stream.AddDexRegisterEntry(Kind::kConstant, 4);
- stream.BeginInlineInfoEntry(42, 2, kStatic, 1);
+ stream.BeginInlineInfoEntry(&art_method, 2, 1);
stream.AddDexRegisterEntry(Kind::kInStack, 8);
stream.EndInlineInfoEntry();
- stream.BeginInlineInfoEntry(82, 3, kStatic, 3);
+ stream.BeginInlineInfoEntry(&art_method, 3, 3);
stream.AddDexRegisterEntry(Kind::kInStack, 16);
stream.AddDexRegisterEntry(Kind::kConstant, 20);
stream.AddDexRegisterEntry(Kind::kInRegister, 15);
@@ -688,15 +689,15 @@ TEST(StackMapTest, InlineTest) {
stream.AddDexRegisterEntry(Kind::kInStack, 56);
stream.AddDexRegisterEntry(Kind::kConstant, 0);
- stream.BeginInlineInfoEntry(42, 2, kDirect, 1);
+ stream.BeginInlineInfoEntry(&art_method, 2, 1);
stream.AddDexRegisterEntry(Kind::kInStack, 12);
stream.EndInlineInfoEntry();
- stream.BeginInlineInfoEntry(82, 3, kStatic, 3);
+ stream.BeginInlineInfoEntry(&art_method, 3, 3);
stream.AddDexRegisterEntry(Kind::kInStack, 80);
stream.AddDexRegisterEntry(Kind::kConstant, 10);
stream.AddDexRegisterEntry(Kind::kInRegister, 5);
stream.EndInlineInfoEntry();
- stream.BeginInlineInfoEntry(52, 5, kVirtual, 0);
+ stream.BeginInlineInfoEntry(&art_method, 5, 0);
stream.EndInlineInfoEntry();
stream.EndStackMapEntry();
@@ -712,12 +713,12 @@ TEST(StackMapTest, InlineTest) {
stream.AddDexRegisterEntry(Kind::kInStack, 56);
stream.AddDexRegisterEntry(Kind::kConstant, 0);
- stream.BeginInlineInfoEntry(42, 2, kVirtual, 0);
+ stream.BeginInlineInfoEntry(&art_method, 2, 0);
stream.EndInlineInfoEntry();
- stream.BeginInlineInfoEntry(52, 5, kInterface, 1);
+ stream.BeginInlineInfoEntry(&art_method, 5, 1);
stream.AddDexRegisterEntry(Kind::kInRegister, 2);
stream.EndInlineInfoEntry();
- stream.BeginInlineInfoEntry(52, 10, kStatic, 2);
+ stream.BeginInlineInfoEntry(&art_method, 10, 2);
stream.AddDexRegisterEntry(Kind::kNone, 0);
stream.AddDexRegisterEntry(Kind::kInRegister, 3);
stream.EndInlineInfoEntry();
@@ -743,11 +744,9 @@ TEST(StackMapTest, InlineTest) {
InlineInfo if0 = ci.GetInlineInfoOf(sm0, encoding);
ASSERT_EQ(2u, if0.GetDepth(encoding.inline_info_encoding));
ASSERT_EQ(2u, if0.GetDexPcAtDepth(encoding.inline_info_encoding, 0));
- ASSERT_EQ(42u, if0.GetMethodIndexAtDepth(encoding.inline_info_encoding, 0));
- ASSERT_EQ(kStatic, if0.GetInvokeTypeAtDepth(encoding.inline_info_encoding, 0));
+ ASSERT_TRUE(if0.EncodesArtMethodAtDepth(encoding.inline_info_encoding, 0));
ASSERT_EQ(3u, if0.GetDexPcAtDepth(encoding.inline_info_encoding, 1));
- ASSERT_EQ(82u, if0.GetMethodIndexAtDepth(encoding.inline_info_encoding, 1));
- ASSERT_EQ(kStatic, if0.GetInvokeTypeAtDepth(encoding.inline_info_encoding, 1));
+ ASSERT_TRUE(if0.EncodesArtMethodAtDepth(encoding.inline_info_encoding, 1));
DexRegisterMap dex_registers1 = ci.GetDexRegisterMapAtDepth(0, if0, encoding, 1);
ASSERT_EQ(8, dex_registers1.GetStackOffsetInBytes(0, 1, ci, encoding));
@@ -769,14 +768,11 @@ TEST(StackMapTest, InlineTest) {
InlineInfo if1 = ci.GetInlineInfoOf(sm1, encoding);
ASSERT_EQ(3u, if1.GetDepth(encoding.inline_info_encoding));
ASSERT_EQ(2u, if1.GetDexPcAtDepth(encoding.inline_info_encoding, 0));
- ASSERT_EQ(42u, if1.GetMethodIndexAtDepth(encoding.inline_info_encoding, 0));
- ASSERT_EQ(kDirect, if1.GetInvokeTypeAtDepth(encoding.inline_info_encoding, 0));
+ ASSERT_TRUE(if1.EncodesArtMethodAtDepth(encoding.inline_info_encoding, 0));
ASSERT_EQ(3u, if1.GetDexPcAtDepth(encoding.inline_info_encoding, 1));
- ASSERT_EQ(82u, if1.GetMethodIndexAtDepth(encoding.inline_info_encoding, 1));
- ASSERT_EQ(kStatic, if1.GetInvokeTypeAtDepth(encoding.inline_info_encoding, 1));
+ ASSERT_TRUE(if1.EncodesArtMethodAtDepth(encoding.inline_info_encoding, 1));
ASSERT_EQ(5u, if1.GetDexPcAtDepth(encoding.inline_info_encoding, 2));
- ASSERT_EQ(52u, if1.GetMethodIndexAtDepth(encoding.inline_info_encoding, 2));
- ASSERT_EQ(kVirtual, if1.GetInvokeTypeAtDepth(encoding.inline_info_encoding, 2));
+ ASSERT_TRUE(if1.EncodesArtMethodAtDepth(encoding.inline_info_encoding, 2));
DexRegisterMap dex_registers1 = ci.GetDexRegisterMapAtDepth(0, if1, encoding, 1);
ASSERT_EQ(12, dex_registers1.GetStackOffsetInBytes(0, 1, ci, encoding));
@@ -810,14 +806,11 @@ TEST(StackMapTest, InlineTest) {
InlineInfo if2 = ci.GetInlineInfoOf(sm3, encoding);
ASSERT_EQ(3u, if2.GetDepth(encoding.inline_info_encoding));
ASSERT_EQ(2u, if2.GetDexPcAtDepth(encoding.inline_info_encoding, 0));
- ASSERT_EQ(42u, if2.GetMethodIndexAtDepth(encoding.inline_info_encoding, 0));
- ASSERT_EQ(kVirtual, if2.GetInvokeTypeAtDepth(encoding.inline_info_encoding, 0));
+ ASSERT_TRUE(if2.EncodesArtMethodAtDepth(encoding.inline_info_encoding, 0));
ASSERT_EQ(5u, if2.GetDexPcAtDepth(encoding.inline_info_encoding, 1));
- ASSERT_EQ(52u, if2.GetMethodIndexAtDepth(encoding.inline_info_encoding, 1));
- ASSERT_EQ(kInterface, if2.GetInvokeTypeAtDepth(encoding.inline_info_encoding, 1));
+ ASSERT_TRUE(if2.EncodesArtMethodAtDepth(encoding.inline_info_encoding, 1));
ASSERT_EQ(10u, if2.GetDexPcAtDepth(encoding.inline_info_encoding, 2));
- ASSERT_EQ(52u, if2.GetMethodIndexAtDepth(encoding.inline_info_encoding, 2));
- ASSERT_EQ(kStatic, if2.GetInvokeTypeAtDepth(encoding.inline_info_encoding, 2));
+ ASSERT_TRUE(if2.EncodesArtMethodAtDepth(encoding.inline_info_encoding, 2));
ASSERT_FALSE(if2.HasDexRegisterMapAtDepth(encoding.inline_info_encoding, 0));
diff --git a/compiler/utils/assembler_thumb_test_expected.cc.inc b/compiler/utils/assembler_thumb_test_expected.cc.inc
index a3fce02970..f132e2737d 100644
--- a/compiler/utils/assembler_thumb_test_expected.cc.inc
+++ b/compiler/utils/assembler_thumb_test_expected.cc.inc
@@ -5610,7 +5610,7 @@ const char* const VixlJniHelpersResults[] = {
" 214: ecbd 8a10 vpop {s16-s31}\n",
" 218: e8bd 8de0 ldmia.w sp!, {r5, r6, r7, r8, sl, fp, pc}\n",
" 21c: 4660 mov r0, ip\n",
- " 21e: f8d9 c2ac ldr.w ip, [r9, #684] ; 0x2ac\n",
+ " 21e: f8d9 c2a4 ldr.w ip, [r9, #676] ; 0x2a4\n",
" 222: 47e0 blx ip\n",
nullptr
};
diff --git a/compiler/utils/x86/assembler_x86.cc b/compiler/utils/x86/assembler_x86.cc
index cd30872986..d3b15ac8cf 100644
--- a/compiler/utils/x86/assembler_x86.cc
+++ b/compiler/utils/x86/assembler_x86.cc
@@ -350,6 +350,38 @@ void X86Assembler::movaps(XmmRegister dst, XmmRegister src) {
}
+void X86Assembler::movaps(XmmRegister dst, const Address& src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x0F);
+ EmitUint8(0x28);
+ EmitOperand(dst, src);
+}
+
+
+void X86Assembler::movups(XmmRegister dst, const Address& src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x0F);
+ EmitUint8(0x10);
+ EmitOperand(dst, src);
+}
+
+
+void X86Assembler::movaps(const Address& dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x0F);
+ EmitUint8(0x29);
+ EmitOperand(src, dst);
+}
+
+
+void X86Assembler::movups(const Address& dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x0F);
+ EmitUint8(0x11);
+ EmitOperand(src, dst);
+}
+
+
void X86Assembler::movss(XmmRegister dst, const Address& src) {
AssemblerBuffer::EnsureCapacity ensured(&buffer_);
EmitUint8(0xF3);
@@ -467,6 +499,83 @@ void X86Assembler::divss(XmmRegister dst, const Address& src) {
}
+void X86Assembler::addps(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x0F);
+ EmitUint8(0x58);
+ EmitXmmRegisterOperand(dst, src);
+}
+
+
+void X86Assembler::subps(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x0F);
+ EmitUint8(0x5C);
+ EmitXmmRegisterOperand(dst, src);
+}
+
+
+void X86Assembler::mulps(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x0F);
+ EmitUint8(0x59);
+ EmitXmmRegisterOperand(dst, src);
+}
+
+
+void X86Assembler::divps(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x0F);
+ EmitUint8(0x5E);
+ EmitXmmRegisterOperand(dst, src);
+}
+
+
+void X86Assembler::movapd(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitUint8(0x0F);
+ EmitUint8(0x28);
+ EmitXmmRegisterOperand(dst, src);
+}
+
+
+void X86Assembler::movapd(XmmRegister dst, const Address& src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitUint8(0x0F);
+ EmitUint8(0x28);
+ EmitOperand(dst, src);
+}
+
+
+void X86Assembler::movupd(XmmRegister dst, const Address& src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitUint8(0x0F);
+ EmitUint8(0x10);
+ EmitOperand(dst, src);
+}
+
+
+void X86Assembler::movapd(const Address& dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitUint8(0x0F);
+ EmitUint8(0x29);
+ EmitOperand(src, dst);
+}
+
+
+void X86Assembler::movupd(const Address& dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitUint8(0x0F);
+ EmitUint8(0x11);
+ EmitOperand(src, dst);
+}
+
+
void X86Assembler::flds(const Address& src) {
AssemblerBuffer::EnsureCapacity ensured(&buffer_);
EmitUint8(0xD9);
@@ -638,6 +747,42 @@ void X86Assembler::divsd(XmmRegister dst, const Address& src) {
}
+void X86Assembler::addpd(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitUint8(0x0F);
+ EmitUint8(0x58);
+ EmitXmmRegisterOperand(dst, src);
+}
+
+
+void X86Assembler::subpd(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitUint8(0x0F);
+ EmitUint8(0x5C);
+ EmitXmmRegisterOperand(dst, src);
+}
+
+
+void X86Assembler::mulpd(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitUint8(0x0F);
+ EmitUint8(0x59);
+ EmitXmmRegisterOperand(dst, src);
+}
+
+
+void X86Assembler::divpd(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitUint8(0x0F);
+ EmitUint8(0x5E);
+ EmitXmmRegisterOperand(dst, src);
+}
+
+
void X86Assembler::cvtsi2ss(XmmRegister dst, Register src) {
AssemblerBuffer::EnsureCapacity ensured(&buffer_);
EmitUint8(0xF3);
diff --git a/compiler/utils/x86/assembler_x86.h b/compiler/utils/x86/assembler_x86.h
index 114986b3e7..a93616c3e5 100644
--- a/compiler/utils/x86/assembler_x86.h
+++ b/compiler/utils/x86/assembler_x86.h
@@ -371,7 +371,12 @@ class X86Assembler FINAL : public Assembler {
void setb(Condition condition, Register dst);
- void movaps(XmmRegister dst, XmmRegister src);
+ void movaps(XmmRegister dst, XmmRegister src); // move
+ void movaps(XmmRegister dst, const Address& src); // load aligned
+ void movups(XmmRegister dst, const Address& src); // load unaligned
+ void movaps(const Address& dst, XmmRegister src); // store aligned
+ void movups(const Address& dst, XmmRegister src); // store unaligned
+
void movss(XmmRegister dst, const Address& src);
void movss(const Address& dst, XmmRegister src);
void movss(XmmRegister dst, XmmRegister src);
@@ -388,6 +393,17 @@ class X86Assembler FINAL : public Assembler {
void divss(XmmRegister dst, XmmRegister src);
void divss(XmmRegister dst, const Address& src);
+ void addps(XmmRegister dst, XmmRegister src); // no addr variant (for now)
+ void subps(XmmRegister dst, XmmRegister src);
+ void mulps(XmmRegister dst, XmmRegister src);
+ void divps(XmmRegister dst, XmmRegister src);
+
+ void movapd(XmmRegister dst, XmmRegister src); // move
+ void movapd(XmmRegister dst, const Address& src); // load aligned
+ void movupd(XmmRegister dst, const Address& src); // load unaligned
+ void movapd(const Address& dst, XmmRegister src); // store aligned
+ void movupd(const Address& dst, XmmRegister src); // store unaligned
+
void movsd(XmmRegister dst, const Address& src);
void movsd(const Address& dst, XmmRegister src);
void movsd(XmmRegister dst, XmmRegister src);
@@ -409,6 +425,11 @@ class X86Assembler FINAL : public Assembler {
void divsd(XmmRegister dst, XmmRegister src);
void divsd(XmmRegister dst, const Address& src);
+ void addpd(XmmRegister dst, XmmRegister src); // no addr variant (for now)
+ void subpd(XmmRegister dst, XmmRegister src);
+ void mulpd(XmmRegister dst, XmmRegister src);
+ void divpd(XmmRegister dst, XmmRegister src);
+
void cvtsi2ss(XmmRegister dst, Register src);
void cvtsi2sd(XmmRegister dst, Register src);
diff --git a/compiler/utils/x86/assembler_x86_test.cc b/compiler/utils/x86/assembler_x86_test.cc
index 9bae6c20bd..4d60a12cb9 100644
--- a/compiler/utils/x86/assembler_x86_test.cc
+++ b/compiler/utils/x86/assembler_x86_test.cc
@@ -423,6 +423,98 @@ TEST_F(AssemblerX86Test, TestlAddressImmediate) {
DriverStr(expected, "TestlAddressImmediate");
}
+TEST_F(AssemblerX86Test, Movaps) {
+ DriverStr(RepeatFF(&x86::X86Assembler::movaps, "movaps %{reg2}, %{reg1}"), "movaps");
+}
+
+TEST_F(AssemblerX86Test, MovapsAddr) {
+ GetAssembler()->movaps(x86::XmmRegister(x86::XMM0), x86::Address(x86::Register(x86::ESP), 4));
+ GetAssembler()->movaps(x86::Address(x86::Register(x86::ESP), 2), x86::XmmRegister(x86::XMM1));
+ const char* expected =
+ "movaps 0x4(%ESP), %xmm0\n"
+ "movaps %xmm1, 0x2(%ESP)\n";
+ DriverStr(expected, "movaps_address");
+}
+
+TEST_F(AssemblerX86Test, MovupsAddr) {
+ GetAssembler()->movups(x86::XmmRegister(x86::XMM0), x86::Address(x86::Register(x86::ESP), 4));
+ GetAssembler()->movups(x86::Address(x86::Register(x86::ESP), 2), x86::XmmRegister(x86::XMM1));
+ const char* expected =
+ "movups 0x4(%ESP), %xmm0\n"
+ "movups %xmm1, 0x2(%ESP)\n";
+ DriverStr(expected, "movups_address");
+}
+
+TEST_F(AssemblerX86Test, Movapd) {
+ DriverStr(RepeatFF(&x86::X86Assembler::movapd, "movapd %{reg2}, %{reg1}"), "movapd");
+}
+
+TEST_F(AssemblerX86Test, MovapdAddr) {
+ GetAssembler()->movapd(x86::XmmRegister(x86::XMM0), x86::Address(x86::Register(x86::ESP), 4));
+ GetAssembler()->movapd(x86::Address(x86::Register(x86::ESP), 2), x86::XmmRegister(x86::XMM1));
+ const char* expected =
+ "movapd 0x4(%ESP), %xmm0\n"
+ "movapd %xmm1, 0x2(%ESP)\n";
+ DriverStr(expected, "movapd_address");
+}
+
+TEST_F(AssemblerX86Test, MovupdAddr) {
+ GetAssembler()->movupd(x86::XmmRegister(x86::XMM0), x86::Address(x86::Register(x86::ESP), 4));
+ GetAssembler()->movupd(x86::Address(x86::Register(x86::ESP), 2), x86::XmmRegister(x86::XMM1));
+ const char* expected =
+ "movupd 0x4(%ESP), %xmm0\n"
+ "movupd %xmm1, 0x2(%ESP)\n";
+ DriverStr(expected, "movupd_address");
+}
+
+TEST_F(AssemblerX86Test, AddPS) {
+ GetAssembler()->addps(x86::XmmRegister(x86::XMM0), x86::XmmRegister(x86::XMM1));
+ const char* expected = "addps %xmm1, %xmm0\n";
+ DriverStr(expected, "addps");
+}
+
+TEST_F(AssemblerX86Test, AddPD) {
+ GetAssembler()->addpd(x86::XmmRegister(x86::XMM0), x86::XmmRegister(x86::XMM1));
+ const char* expected = "addpd %xmm1, %xmm0\n";
+ DriverStr(expected, "addpd");
+}
+
+TEST_F(AssemblerX86Test, SubPS) {
+ GetAssembler()->subps(x86::XmmRegister(x86::XMM0), x86::XmmRegister(x86::XMM1));
+ const char* expected = "subps %xmm1, %xmm0\n";
+ DriverStr(expected, "subps");
+}
+
+TEST_F(AssemblerX86Test, SubPD) {
+ GetAssembler()->subpd(x86::XmmRegister(x86::XMM0), x86::XmmRegister(x86::XMM1));
+ const char* expected = "subpd %xmm1, %xmm0\n";
+ DriverStr(expected, "subpd");
+}
+
+TEST_F(AssemblerX86Test, MulPS) {
+ GetAssembler()->mulps(x86::XmmRegister(x86::XMM0), x86::XmmRegister(x86::XMM1));
+ const char* expected = "mulps %xmm1, %xmm0\n";
+ DriverStr(expected, "mulps");
+}
+
+TEST_F(AssemblerX86Test, MulPD) {
+ GetAssembler()->mulpd(x86::XmmRegister(x86::XMM0), x86::XmmRegister(x86::XMM1));
+ const char* expected = "mulpd %xmm1, %xmm0\n";
+ DriverStr(expected, "mulpd");
+}
+
+TEST_F(AssemblerX86Test, DivPS) {
+ GetAssembler()->divps(x86::XmmRegister(x86::XMM0), x86::XmmRegister(x86::XMM1));
+ const char* expected = "divps %xmm1, %xmm0\n";
+ DriverStr(expected, "divps");
+}
+
+TEST_F(AssemblerX86Test, DivPD) {
+ GetAssembler()->divpd(x86::XmmRegister(x86::XMM0), x86::XmmRegister(x86::XMM1));
+ const char* expected = "divpd %xmm1, %xmm0\n";
+ DriverStr(expected, "divpd");
+}
+
/////////////////
// Near labels //
/////////////////
diff --git a/compiler/utils/x86_64/assembler_x86_64.cc b/compiler/utils/x86_64/assembler_x86_64.cc
index e9a0607290..2366b68f11 100644
--- a/compiler/utils/x86_64/assembler_x86_64.cc
+++ b/compiler/utils/x86_64/assembler_x86_64.cc
@@ -386,6 +386,42 @@ void X86_64Assembler::movaps(XmmRegister dst, XmmRegister src) {
}
+void X86_64Assembler::movaps(XmmRegister dst, const Address& src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitOptionalRex32(dst, src);
+ EmitUint8(0x0F);
+ EmitUint8(0x28);
+ EmitOperand(dst.LowBits(), src);
+}
+
+
+void X86_64Assembler::movups(XmmRegister dst, const Address& src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitOptionalRex32(dst, src);
+ EmitUint8(0x0F);
+ EmitUint8(0x10);
+ EmitOperand(dst.LowBits(), src);
+}
+
+
+void X86_64Assembler::movaps(const Address& dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitOptionalRex32(src, dst);
+ EmitUint8(0x0F);
+ EmitUint8(0x29);
+ EmitOperand(src.LowBits(), dst);
+}
+
+
+void X86_64Assembler::movups(const Address& dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitOptionalRex32(src, dst);
+ EmitUint8(0x0F);
+ EmitUint8(0x11);
+ EmitOperand(src.LowBits(), dst);
+}
+
+
void X86_64Assembler::movss(XmmRegister dst, const Address& src) {
AssemblerBuffer::EnsureCapacity ensured(&buffer_);
EmitUint8(0xF3);
@@ -539,6 +575,42 @@ void X86_64Assembler::divss(XmmRegister dst, const Address& src) {
}
+void X86_64Assembler::addps(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitOptionalRex32(dst, src);
+ EmitUint8(0x0F);
+ EmitUint8(0x58);
+ EmitXmmRegisterOperand(dst.LowBits(), src);
+}
+
+
+void X86_64Assembler::subps(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitOptionalRex32(dst, src);
+ EmitUint8(0x0F);
+ EmitUint8(0x5C);
+ EmitXmmRegisterOperand(dst.LowBits(), src);
+}
+
+
+void X86_64Assembler::mulps(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitOptionalRex32(dst, src);
+ EmitUint8(0x0F);
+ EmitUint8(0x59);
+ EmitXmmRegisterOperand(dst.LowBits(), src);
+}
+
+
+void X86_64Assembler::divps(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitOptionalRex32(dst, src);
+ EmitUint8(0x0F);
+ EmitUint8(0x5E);
+ EmitXmmRegisterOperand(dst.LowBits(), src);
+}
+
+
void X86_64Assembler::flds(const Address& src) {
AssemblerBuffer::EnsureCapacity ensured(&buffer_);
EmitUint8(0xD9);
@@ -560,6 +632,56 @@ void X86_64Assembler::fstps(const Address& dst) {
}
+void X86_64Assembler::movapd(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitOptionalRex32(dst, src);
+ EmitUint8(0x0F);
+ EmitUint8(0x28);
+ EmitXmmRegisterOperand(dst.LowBits(), src);
+}
+
+
+void X86_64Assembler::movapd(XmmRegister dst, const Address& src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitOptionalRex32(dst, src);
+ EmitUint8(0x0F);
+ EmitUint8(0x28);
+ EmitOperand(dst.LowBits(), src);
+}
+
+
+void X86_64Assembler::movupd(XmmRegister dst, const Address& src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitOptionalRex32(dst, src);
+ EmitUint8(0x0F);
+ EmitUint8(0x10);
+ EmitOperand(dst.LowBits(), src);
+}
+
+
+void X86_64Assembler::movapd(const Address& dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitOptionalRex32(src, dst);
+ EmitUint8(0x0F);
+ EmitUint8(0x29);
+ EmitOperand(src.LowBits(), dst);
+}
+
+
+void X86_64Assembler::movupd(const Address& dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitOptionalRex32(src, dst);
+ EmitUint8(0x0F);
+ EmitUint8(0x11);
+ EmitOperand(src.LowBits(), dst);
+}
+
+
void X86_64Assembler::movsd(XmmRegister dst, const Address& src) {
AssemblerBuffer::EnsureCapacity ensured(&buffer_);
EmitUint8(0xF2);
@@ -670,6 +792,46 @@ void X86_64Assembler::divsd(XmmRegister dst, const Address& src) {
}
+void X86_64Assembler::addpd(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitOptionalRex32(dst, src);
+ EmitUint8(0x0F);
+ EmitUint8(0x58);
+ EmitXmmRegisterOperand(dst.LowBits(), src);
+}
+
+
+void X86_64Assembler::subpd(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitOptionalRex32(dst, src);
+ EmitUint8(0x0F);
+ EmitUint8(0x5C);
+ EmitXmmRegisterOperand(dst.LowBits(), src);
+}
+
+
+void X86_64Assembler::mulpd(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitOptionalRex32(dst, src);
+ EmitUint8(0x0F);
+ EmitUint8(0x59);
+ EmitXmmRegisterOperand(dst.LowBits(), src);
+}
+
+
+void X86_64Assembler::divpd(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitOptionalRex32(dst, src);
+ EmitUint8(0x0F);
+ EmitUint8(0x5E);
+ EmitXmmRegisterOperand(dst.LowBits(), src);
+}
+
+
void X86_64Assembler::cvtsi2ss(XmmRegister dst, CpuRegister src) {
cvtsi2ss(dst, src, false);
}
diff --git a/compiler/utils/x86_64/assembler_x86_64.h b/compiler/utils/x86_64/assembler_x86_64.h
index acad86d161..5923a41fe3 100644
--- a/compiler/utils/x86_64/assembler_x86_64.h
+++ b/compiler/utils/x86_64/assembler_x86_64.h
@@ -390,7 +390,11 @@ class X86_64Assembler FINAL : public Assembler {
void leaq(CpuRegister dst, const Address& src);
void leal(CpuRegister dst, const Address& src);
- void movaps(XmmRegister dst, XmmRegister src);
+ void movaps(XmmRegister dst, XmmRegister src); // move
+ void movaps(XmmRegister dst, const Address& src); // load aligned
+ void movups(XmmRegister dst, const Address& src); // load unaligned
+ void movaps(const Address& dst, XmmRegister src); // store aligned
+ void movups(const Address& dst, XmmRegister src); // store unaligned
void movss(XmmRegister dst, const Address& src);
void movss(const Address& dst, XmmRegister src);
@@ -413,6 +417,17 @@ class X86_64Assembler FINAL : public Assembler {
void divss(XmmRegister dst, XmmRegister src);
void divss(XmmRegister dst, const Address& src);
+ void addps(XmmRegister dst, XmmRegister src); // no addr variant (for now)
+ void subps(XmmRegister dst, XmmRegister src);
+ void mulps(XmmRegister dst, XmmRegister src);
+ void divps(XmmRegister dst, XmmRegister src);
+
+ void movapd(XmmRegister dst, XmmRegister src); // move
+ void movapd(XmmRegister dst, const Address& src); // load aligned
+ void movupd(XmmRegister dst, const Address& src); // load unaligned
+ void movapd(const Address& dst, XmmRegister src); // store aligned
+ void movupd(const Address& dst, XmmRegister src); // store unaligned
+
void movsd(XmmRegister dst, const Address& src);
void movsd(const Address& dst, XmmRegister src);
void movsd(XmmRegister dst, XmmRegister src);
@@ -426,6 +441,11 @@ class X86_64Assembler FINAL : public Assembler {
void divsd(XmmRegister dst, XmmRegister src);
void divsd(XmmRegister dst, const Address& src);
+ void addpd(XmmRegister dst, XmmRegister src); // no addr variant (for now)
+ void subpd(XmmRegister dst, XmmRegister src);
+ void mulpd(XmmRegister dst, XmmRegister src);
+ void divpd(XmmRegister dst, XmmRegister src);
+
void cvtsi2ss(XmmRegister dst, CpuRegister src); // Note: this is the r/m32 version.
void cvtsi2ss(XmmRegister dst, CpuRegister src, bool is64bit);
void cvtsi2ss(XmmRegister dst, const Address& src, bool is64bit);
diff --git a/compiler/utils/x86_64/assembler_x86_64_test.cc b/compiler/utils/x86_64/assembler_x86_64_test.cc
index ff01429058..2812c34406 100644
--- a/compiler/utils/x86_64/assembler_x86_64_test.cc
+++ b/compiler/utils/x86_64/assembler_x86_64_test.cc
@@ -986,10 +986,50 @@ TEST_F(AssemblerX86_64Test, Movaps) {
DriverStr(RepeatFF(&x86_64::X86_64Assembler::movaps, "movaps %{reg2}, %{reg1}"), "movaps");
}
+TEST_F(AssemblerX86_64Test, MovapsAddr) {
+ GetAssembler()->movaps(x86_64::XmmRegister(x86_64::XMM0), x86_64::Address(x86_64::CpuRegister(x86_64::RSP), 4));
+ GetAssembler()->movaps(x86_64::Address(x86_64::CpuRegister(x86_64::RSP), 2), x86_64::XmmRegister(x86_64::XMM1));
+ const char* expected =
+ "movaps 0x4(%RSP), %xmm0\n"
+ "movaps %xmm1, 0x2(%RSP)\n";
+ DriverStr(expected, "movaps_address");
+}
+
+TEST_F(AssemblerX86_64Test, MovupsAddr) {
+ GetAssembler()->movups(x86_64::XmmRegister(x86_64::XMM0), x86_64::Address(x86_64::CpuRegister(x86_64::RSP), 4));
+ GetAssembler()->movups(x86_64::Address(x86_64::CpuRegister(x86_64::RSP), 2), x86_64::XmmRegister(x86_64::XMM1));
+ const char* expected =
+ "movups 0x4(%RSP), %xmm0\n"
+ "movups %xmm1, 0x2(%RSP)\n";
+ DriverStr(expected, "movups_address");
+}
+
TEST_F(AssemblerX86_64Test, Movss) {
DriverStr(RepeatFF(&x86_64::X86_64Assembler::movss, "movss %{reg2}, %{reg1}"), "movss");
}
+TEST_F(AssemblerX86_64Test, Movapd) {
+ DriverStr(RepeatFF(&x86_64::X86_64Assembler::movapd, "movapd %{reg2}, %{reg1}"), "movapd");
+}
+
+TEST_F(AssemblerX86_64Test, MovapdAddr) {
+ GetAssembler()->movapd(x86_64::XmmRegister(x86_64::XMM0), x86_64::Address(x86_64::CpuRegister(x86_64::RSP), 4));
+ GetAssembler()->movapd(x86_64::Address(x86_64::CpuRegister(x86_64::RSP), 2), x86_64::XmmRegister(x86_64::XMM1));
+ const char* expected =
+ "movapd 0x4(%RSP), %xmm0\n"
+ "movapd %xmm1, 0x2(%RSP)\n";
+ DriverStr(expected, "movapd_address");
+}
+
+TEST_F(AssemblerX86_64Test, MovupdAddr) {
+ GetAssembler()->movupd(x86_64::XmmRegister(x86_64::XMM0), x86_64::Address(x86_64::CpuRegister(x86_64::RSP), 4));
+ GetAssembler()->movupd(x86_64::Address(x86_64::CpuRegister(x86_64::RSP), 2), x86_64::XmmRegister(x86_64::XMM1));
+ const char* expected =
+ "movupd 0x4(%RSP), %xmm0\n"
+ "movupd %xmm1, 0x2(%RSP)\n";
+ DriverStr(expected, "movupd_address");
+}
+
TEST_F(AssemblerX86_64Test, Movsd) {
DriverStr(RepeatFF(&x86_64::X86_64Assembler::movsd, "movsd %{reg2}, %{reg1}"), "movsd");
}
@@ -1010,6 +1050,14 @@ TEST_F(AssemblerX86_64Test, Addsd) {
DriverStr(RepeatFF(&x86_64::X86_64Assembler::addsd, "addsd %{reg2}, %{reg1}"), "addsd");
}
+TEST_F(AssemblerX86_64Test, Addps) {
+ DriverStr(RepeatFF(&x86_64::X86_64Assembler::addps, "addps %{reg2}, %{reg1}"), "addps");
+}
+
+TEST_F(AssemblerX86_64Test, Addpd) {
+ DriverStr(RepeatFF(&x86_64::X86_64Assembler::addpd, "addpd %{reg2}, %{reg1}"), "addpd");
+}
+
TEST_F(AssemblerX86_64Test, Subss) {
DriverStr(RepeatFF(&x86_64::X86_64Assembler::subss, "subss %{reg2}, %{reg1}"), "subss");
}
@@ -1018,6 +1066,14 @@ TEST_F(AssemblerX86_64Test, Subsd) {
DriverStr(RepeatFF(&x86_64::X86_64Assembler::subsd, "subsd %{reg2}, %{reg1}"), "subsd");
}
+TEST_F(AssemblerX86_64Test, Subps) {
+ DriverStr(RepeatFF(&x86_64::X86_64Assembler::subps, "subps %{reg2}, %{reg1}"), "subps");
+}
+
+TEST_F(AssemblerX86_64Test, Subpd) {
+ DriverStr(RepeatFF(&x86_64::X86_64Assembler::subpd, "subpd %{reg2}, %{reg1}"), "subpd");
+}
+
TEST_F(AssemblerX86_64Test, Mulss) {
DriverStr(RepeatFF(&x86_64::X86_64Assembler::mulss, "mulss %{reg2}, %{reg1}"), "mulss");
}
@@ -1026,6 +1082,14 @@ TEST_F(AssemblerX86_64Test, Mulsd) {
DriverStr(RepeatFF(&x86_64::X86_64Assembler::mulsd, "mulsd %{reg2}, %{reg1}"), "mulsd");
}
+TEST_F(AssemblerX86_64Test, Mulps) {
+ DriverStr(RepeatFF(&x86_64::X86_64Assembler::mulps, "mulps %{reg2}, %{reg1}"), "mulps");
+}
+
+TEST_F(AssemblerX86_64Test, Mulpd) {
+ DriverStr(RepeatFF(&x86_64::X86_64Assembler::mulpd, "mulpd %{reg2}, %{reg1}"), "mulpd");
+}
+
TEST_F(AssemblerX86_64Test, Divss) {
DriverStr(RepeatFF(&x86_64::X86_64Assembler::divss, "divss %{reg2}, %{reg1}"), "divss");
}
@@ -1034,6 +1098,14 @@ TEST_F(AssemblerX86_64Test, Divsd) {
DriverStr(RepeatFF(&x86_64::X86_64Assembler::divsd, "divsd %{reg2}, %{reg1}"), "divsd");
}
+TEST_F(AssemblerX86_64Test, Divps) {
+ DriverStr(RepeatFF(&x86_64::X86_64Assembler::divps, "divps %{reg2}, %{reg1}"), "divps");
+}
+
+TEST_F(AssemblerX86_64Test, Divpd) {
+ DriverStr(RepeatFF(&x86_64::X86_64Assembler::divpd, "divpd %{reg2}, %{reg1}"), "divpd");
+}
+
TEST_F(AssemblerX86_64Test, Cvtsi2ss) {
DriverStr(RepeatFr(&x86_64::X86_64Assembler::cvtsi2ss, "cvtsi2ss %{reg2}, %{reg1}"), "cvtsi2ss");
}
diff --git a/compiler/verifier_deps_test.cc b/compiler/verifier_deps_test.cc
index 4f06a91448..5fc9972d09 100644
--- a/compiler/verifier_deps_test.cc
+++ b/compiler/verifier_deps_test.cc
@@ -1414,7 +1414,14 @@ TEST_F(VerifierDepsTest, VerifyDeps) {
ASSERT_FALSE(decoded_deps.ValidateDependencies(new_class_loader, soa.Self()));
}
- {
+ // The two tests below make sure that fiddling with the method kind
+ // (static, virtual, interface) is detected by `ValidateDependencies`.
+
+ // An interface method lookup can succeed with a virtual method lookup on the same class.
+ // That's OK, as we only want to make sure there is a method being defined with the right
+ // flags. Therefore, polluting the interface methods with virtual methods does not have
+ // to fail verification.
+ if (resolution_kind != kVirtualMethodResolution) {
VerifierDeps decoded_deps(dex_files_, ArrayRef<const uint8_t>(buffer));
VerifierDeps::DexFileDeps* deps = decoded_deps.GetDexFileDeps(*primary_dex_file_);
bool found = false;
@@ -1433,7 +1440,8 @@ TEST_F(VerifierDepsTest, VerifyDeps) {
ASSERT_FALSE(decoded_deps.ValidateDependencies(new_class_loader, soa.Self()));
}
- {
+ // See comment above that applies the same way.
+ if (resolution_kind != kInterfaceMethodResolution) {
VerifierDeps decoded_deps(dex_files_, ArrayRef<const uint8_t>(buffer));
VerifierDeps::DexFileDeps* deps = decoded_deps.GetDexFileDeps(*primary_dex_file_);
bool found = false;
diff --git a/dex2oat/dex2oat.cc b/dex2oat/dex2oat.cc
index 21b03eb8ba..e8a92c1914 100644
--- a/dex2oat/dex2oat.cc
+++ b/dex2oat/dex2oat.cc
@@ -64,7 +64,7 @@
#include "gc/space/space-inl.h"
#include "image_writer.h"
#include "interpreter/unstarted_runtime.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
#include "leb128.h"
#include "linker/buffered_output_stream.h"
#include "linker/file_output_stream.h"
@@ -1095,6 +1095,8 @@ class Dex2Oat FINAL {
compiler_options_->GetNativeDebuggable() ? OatHeader::kTrueValue : OatHeader::kFalseValue);
key_value_store_->Put(OatHeader::kCompilerFilter,
CompilerFilter::NameOfFilter(compiler_options_->GetCompilerFilter()));
+ key_value_store_->Put(OatHeader::kConcurrentCopying,
+ kUseReadBarrier ? OatHeader::kTrueValue : OatHeader::kFalseValue);
}
// Parse the arguments from the command line. In case of an unrecognized option or impossible
diff --git a/dex2oat/dex2oat_test.cc b/dex2oat/dex2oat_test.cc
index cdb3b9fe2a..e86e560b1a 100644
--- a/dex2oat/dex2oat_test.cc
+++ b/dex2oat/dex2oat_test.cc
@@ -30,7 +30,7 @@
#include "base/macros.h"
#include "dex_file-inl.h"
#include "dex2oat_environment_test.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
#include "oat.h"
#include "oat_file.h"
#include "utils.h"
diff --git a/dexlayout/dex_visualize.cc b/dexlayout/dex_visualize.cc
index 02274b25a3..75d47e4013 100644
--- a/dexlayout/dex_visualize.cc
+++ b/dexlayout/dex_visualize.cc
@@ -31,7 +31,7 @@
#include "dex_ir.h"
#include "dexlayout.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
namespace art {
diff --git a/dexlayout/dexlayout.cc b/dexlayout/dexlayout.cc
index cac60900bc..1add6bfede 100644
--- a/dexlayout/dexlayout.cc
+++ b/dexlayout/dexlayout.cc
@@ -37,7 +37,7 @@
#include "dex_instruction-inl.h"
#include "dex_visualize.h"
#include "dex_writer.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
#include "mem_map.h"
#include "os.h"
#include "utils.h"
diff --git a/dexlayout/dexlayout_main.cc b/dexlayout/dexlayout_main.cc
index 5f8a118bde..ad599aed93 100644
--- a/dexlayout/dexlayout_main.cc
+++ b/dexlayout/dexlayout_main.cc
@@ -30,7 +30,7 @@
#include <fcntl.h>
#include "base/logging.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
#include "runtime.h"
#include "mem_map.h"
diff --git a/patchoat/patchoat.cc b/patchoat/patchoat.cc
index 7ae13a574b..9a73830f99 100644
--- a/patchoat/patchoat.cc
+++ b/patchoat/patchoat.cc
@@ -790,8 +790,6 @@ void PatchOat::FixupMethod(ArtMethod* object, ArtMethod* copy) {
copy->SetDeclaringClass(RelocatedAddressOfPointer(object->GetDeclaringClass()));
copy->SetDexCacheResolvedMethods(
RelocatedAddressOfPointer(object->GetDexCacheResolvedMethods(pointer_size)), pointer_size);
- copy->SetDexCacheResolvedTypes(
- RelocatedAddressOfPointer(object->GetDexCacheResolvedTypes(pointer_size)), pointer_size);
copy->SetEntryPointFromQuickCompiledCodePtrSize(RelocatedAddressOfPointer(
object->GetEntryPointFromQuickCompiledCodePtrSize(pointer_size)), pointer_size);
// No special handling for IMT conflict table since all pointers are moved by the same offset.
diff --git a/profman/profile_assistant.h b/profman/profile_assistant.h
index d3c75b817a..be703abda8 100644
--- a/profman/profile_assistant.h
+++ b/profman/profile_assistant.h
@@ -21,7 +21,7 @@
#include <vector>
#include "base/scoped_flock.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
namespace art {
diff --git a/profman/profile_assistant_test.cc b/profman/profile_assistant_test.cc
index 776c31a662..2f40fef42e 100644
--- a/profman/profile_assistant_test.cc
+++ b/profman/profile_assistant_test.cc
@@ -19,7 +19,7 @@
#include "base/unix_file/fd_file.h"
#include "common_runtime_test.h"
#include "profile_assistant.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
#include "utils.h"
namespace art {
diff --git a/profman/profman.cc b/profman/profman.cc
index e5384078f1..ffebb6a2ea 100644
--- a/profman/profman.cc
+++ b/profman/profman.cc
@@ -34,7 +34,7 @@
#include "base/time_utils.h"
#include "base/unix_file/fd_file.h"
#include "dex_file.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
#include "runtime.h"
#include "utils.h"
#include "zip_archive.h"
diff --git a/runtime/Android.bp b/runtime/Android.bp
index 86019bf71c..81f174e43b 100644
--- a/runtime/Android.bp
+++ b/runtime/Android.bp
@@ -112,7 +112,7 @@ cc_defaults {
"jit/debugger_interface.cc",
"jit/jit.cc",
"jit/jit_code_cache.cc",
- "jit/offline_profiling_info.cc",
+ "jit/profile_compilation_info.cc",
"jit/profiling_info.cc",
"jit/profile_saver.cc",
"jni_internal.cc",
@@ -184,6 +184,7 @@ cc_defaults {
"reference_table.cc",
"reflection.cc",
"runtime.cc",
+ "runtime_callbacks.cc",
"runtime_options.cc",
"signal_catcher.cc",
"stack.cc",
@@ -563,6 +564,7 @@ art_cc_test {
"parsed_options_test.cc",
"prebuilt_tools_test.cc",
"reference_table_test.cc",
+ "runtime_callbacks_test.cc",
"thread_pool_test.cc",
"transaction_test.cc",
"type_lookup_table_test.cc",
diff --git a/runtime/arch/arm/quick_entrypoints_arm.S b/runtime/arch/arm/quick_entrypoints_arm.S
index 61d1607112..db1cad670d 100644
--- a/runtime/arch/arm/quick_entrypoints_arm.S
+++ b/runtime/arch/arm/quick_entrypoints_arm.S
@@ -856,27 +856,6 @@ END art_quick_check_instance_of
#endif // USE_READ_BARRIER
.endm
- /*
- * Entry from managed code for array put operations of objects where the value being stored
- * needs to be checked for compatibility.
- * r0 = array, r1 = index, r2 = value
- */
-ENTRY art_quick_aput_obj_with_null_and_bound_check
- tst r0, r0
- bne art_quick_aput_obj_with_bound_check
- b art_quick_throw_null_pointer_exception
-END art_quick_aput_obj_with_null_and_bound_check
-
- .hidden art_quick_aput_obj_with_bound_check
-ENTRY art_quick_aput_obj_with_bound_check
- ldr r3, [r0, #MIRROR_ARRAY_LENGTH_OFFSET]
- cmp r3, r1
- bhi art_quick_aput_obj
- mov r0, r1
- mov r1, r3
- b art_quick_throw_array_bounds
-END art_quick_aput_obj_with_bound_check
-
#ifdef USE_READ_BARRIER
.extern artReadBarrierSlow
#endif
@@ -2010,3 +1989,83 @@ READ_BARRIER_MARK_REG art_quick_read_barrier_mark_reg08, r8
READ_BARRIER_MARK_REG art_quick_read_barrier_mark_reg09, r9
READ_BARRIER_MARK_REG art_quick_read_barrier_mark_reg10, r10
READ_BARRIER_MARK_REG art_quick_read_barrier_mark_reg11, r11
+
+.extern artInvokePolymorphic
+ENTRY art_quick_invoke_polymorphic
+ SETUP_SAVE_REFS_AND_ARGS_FRAME r2
+ mov r2, r9 @ pass Thread::Current
+ mov r3, sp @ pass SP
+ mov r0, #0 @ initialize 64-bit JValue as zero.
+ str r0, [sp, #-4]!
+ .cfi_adjust_cfa_offset 4
+ str r0, [sp, #-4]!
+ .cfi_adjust_cfa_offset 4
+ mov r0, sp @ pass JValue for return result as first argument.
+ bl artInvokePolymorphic @ artInvokePolymorphic(JValue, receiver, Thread*, SP)
+ sub r0, 'A' @ return value is descriptor of handle's return type.
+ cmp r0, 'Z' - 'A' @ check if value is in bounds of handler table
+ bgt .Lcleanup_and_return @ and clean-up if not.
+ adr r1, .Lhandler_table
+ tbb [r0, r1] @ branch to handler for return value based on return type.
+
+.Lstart_of_handlers:
+.Lstore_boolean_result:
+ ldrb r0, [sp] @ Copy boolean value to return value of this function.
+ b .Lcleanup_and_return
+.Lstore_char_result:
+ ldrh r0, [sp] @ Copy char value to return value of this function.
+ b .Lcleanup_and_return
+.Lstore_float_result:
+ vldr s0, [sp] @ Copy float value from JValue result to the context restored by
+ vstr s0, [sp, #16] @ RESTORE_SAVE_REFS_AND_ARGS_FRAME.
+ b .Lcleanup_and_return
+.Lstore_double_result:
+ vldr d0, [sp] @ Copy double value from JValue result to the context restored by
+ vstr d0, [sp, #16] @ RESTORE_SAVE_REFS_AND_ARGS_FRAME.
+ b .Lcleanup_and_return
+.Lstore_long_result:
+ ldr r1, [sp, #4] @ Copy the upper bits from JValue result to the context restored by
+ str r1, [sp, #80] @ RESTORE_SAVE_REFS_AND_ARGS_FRAME.
+ // Fall-through for lower bits.
+.Lstore_int_result:
+ ldr r0, [sp] @ Copy int value to return value of this function.
+ // Fall-through to clean up and return.
+.Lcleanup_and_return:
+ add sp, #8
+ .cfi_adjust_cfa_offset -8
+ RESTORE_SAVE_REFS_AND_ARGS_FRAME
+ RETURN_OR_DELIVER_PENDING_EXCEPTION_REG r2
+
+.macro HANDLER_TABLE_OFFSET handler_label
+ .byte (\handler_label - .Lstart_of_handlers) / 2
+.endm
+
+.Lhandler_table:
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // A
+ HANDLER_TABLE_OFFSET(.Lstore_int_result) // B (byte)
+ HANDLER_TABLE_OFFSET(.Lstore_char_result) // C (char)
+ HANDLER_TABLE_OFFSET(.Lstore_double_result) // D (double)
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // E
+ HANDLER_TABLE_OFFSET(.Lstore_float_result) // F (float)
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // G
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // H
+ HANDLER_TABLE_OFFSET(.Lstore_int_result) // I (int)
+ HANDLER_TABLE_OFFSET(.Lstore_long_result) // J (long)
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // K
+ HANDLER_TABLE_OFFSET(.Lstore_int_result) // L (object)
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // M
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // N
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // O
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // P
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // Q
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // R
+ HANDLER_TABLE_OFFSET(.Lstore_int_result) // S (short)
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // T
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // U
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // V (void)
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // W
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // X
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // Y
+ HANDLER_TABLE_OFFSET(.Lstore_boolean_result) // Z (boolean)
+.purgem HANDLER_TABLE_OFFSET
+END art_quick_invoke_polymorphic
diff --git a/runtime/arch/arm64/quick_entrypoints_arm64.S b/runtime/arch/arm64/quick_entrypoints_arm64.S
index 8b1e0388c6..00518e16be 100644
--- a/runtime/arch/arm64/quick_entrypoints_arm64.S
+++ b/runtime/arch/arm64/quick_entrypoints_arm64.S
@@ -1404,33 +1404,6 @@ END art_quick_check_instance_of
#endif // USE_READ_BARRIER
.endm
- /*
- * Entry from managed code for array put operations of objects where the value being stored
- * needs to be checked for compatibility.
- * x0 = array, x1 = index, x2 = value
- *
- * Currently all values should fit into w0/w1/w2, and w1 always will as indices are 32b. We
- * assume, though, that the upper 32b are zeroed out. At least for x1/w1 we can do better by
- * using index-zero-extension in load/stores.
- *
- * Temporaries: x3, x4
- * TODO: x4 OK? ip seems wrong here.
- */
-ENTRY art_quick_aput_obj_with_null_and_bound_check
- tst x0, x0
- bne art_quick_aput_obj_with_bound_check
- b art_quick_throw_null_pointer_exception
-END art_quick_aput_obj_with_null_and_bound_check
-
-ENTRY art_quick_aput_obj_with_bound_check
- ldr w3, [x0, #MIRROR_ARRAY_LENGTH_OFFSET]
- cmp w3, w1
- bhi art_quick_aput_obj
- mov x0, x1
- mov x1, x3
- b art_quick_throw_array_bounds
-END art_quick_aput_obj_with_bound_check
-
#ifdef USE_READ_BARRIER
.extern artReadBarrierSlow
#endif
@@ -1672,11 +1645,7 @@ GENERATE_ALLOC_ENTRYPOINTS_FOR_NON_REGION_TLAB_ALLOCATORS
// GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_region_tlab, RegionTLAB)
// GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_region_tlab, RegionTLAB)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_region_tlab, RegionTLAB)
-// GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_region_tlab, RegionTLAB) implemented in asm
// GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_region_tlab, RegionTLAB)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_region_tlab, RegionTLAB)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_region_tlab, RegionTLAB)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_region_tlab, RegionTLAB)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_region_tlab, RegionTLAB)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_region_tlab, RegionTLAB)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_region_tlab, RegionTLAB)
@@ -1764,13 +1733,6 @@ END art_quick_alloc_object_resolved_rosalloc
// The common fast path code for art_quick_alloc_array_region_tlab.
-.macro ALLOC_ARRAY_TLAB_FAST_PATH slowPathLabel, xClass, wClass, xCount, wCount, xTemp0, wTemp0, xTemp1, wTemp1, xTemp2, wTemp2
- // Check null class
- cbz \wClass, \slowPathLabel
- ALLOC_ARRAY_TLAB_FAST_PATH_RESOLVED \slowPathLabel, \xClass, \wClass, \xCount, \wCount, \xTemp0, \wTemp0, \xTemp1, \wTemp1, \xTemp2, \wTemp2
-.endm
-
-// The common fast path code for art_quick_alloc_array_region_tlab.
.macro ALLOC_ARRAY_TLAB_FAST_PATH_RESOLVED slowPathLabel, xClass, wClass, xCount, wCount, xTemp0, wTemp0, xTemp1, wTemp1, xTemp2, wTemp2
// Array classes are never finalizable or uninitialized, no need to check.
ldr \wTemp0, [\xClass, #MIRROR_CLASS_COMPONENT_TYPE_OFFSET] // Load component type
@@ -1907,64 +1869,31 @@ GENERATE_ALLOC_OBJECT_RESOLVED_REGION_TLAB art_quick_alloc_object_initialized_re
// TODO: We could use this macro for the normal tlab allocator too.
// The common code for art_quick_alloc_array_*region_tlab
-.macro GENERATE_ALLOC_ARRAY_REGION_TLAB name, entrypoint, fast_path, is_resolved
+.macro GENERATE_ALLOC_ARRAY_REGION_TLAB name, entrypoint, fast_path
ENTRY \name
// Fast path array allocation for region tlab allocation.
- // x0: uint32_t type_idx
+ // x0: mirror::Class* type
// x1: int32_t component_count
- // x2: ArtMethod* method
- // x3-x7: free.
+ // x2-x7: free.
#if !defined(USE_READ_BARRIER)
mvn x0, xzr // Read barrier must be enabled here.
ret // Return -1.
#endif
-.if \is_resolved
mov x3, x0
- // If already resolved, class is stored in x0
-.else
- ldr x3, [x2, #ART_METHOD_DEX_CACHE_TYPES_OFFSET_64] // Load dex cache resolved types array
- // Load the class (x2)
- ldr w3, [x3, x0, lsl #COMPRESSED_REFERENCE_SIZE_SHIFT]
-.endif
- // Most common case: GC is not marking.
- ldr w4, [xSELF, #THREAD_IS_GC_MARKING_OFFSET]
- cbnz x4, .Lmarking\name
-.Ldo_allocation\name:
\fast_path .Lslow_path\name, x3, w3, x1, w1, x4, w4, x5, w5, x6, w6
-.Lmarking\name:
- // GC is marking, check the lock word of the class for the mark bit.
- // If the class is null, go slow path. The check is required to read the lock word.
- cbz w3, .Lslow_path\name
- // Class is not null, check mark bit in lock word.
- ldr w4, [x3, #MIRROR_OBJECT_LOCK_WORD_OFFSET]
- // If the bit is not zero, do the allocation.
- tbnz w4, #LOCK_WORD_MARK_BIT_SHIFT, .Ldo_allocation\name
- // The read barrier slow path. Mark
- // the class.
- stp x0, x1, [sp, #-32]! // Save registers (x0, x1, x2, lr).
- stp x2, xLR, [sp, #16]
- mov x0, x3 // Pass the class as the first param.
- bl artReadBarrierMark
- mov x3, x0 // Get the (marked) class back.
- ldp x2, xLR, [sp, #16]
- ldp x0, x1, [sp], #32 // Restore registers.
- b .Ldo_allocation\name
.Lslow_path\name:
- // x0: uint32_t type_idx / mirror::Class* klass (if resolved)
+ // x0: mirror::Class* klass
// x1: int32_t component_count
- // x2: ArtMethod* method
- // x3: Thread* self
+ // x2: Thread* self
SETUP_SAVE_REFS_ONLY_FRAME // save callee saves in case of GC
- mov x3, xSELF // pass Thread::Current
+ mov x2, xSELF // pass Thread::Current
bl \entrypoint
RESTORE_SAVE_REFS_ONLY_FRAME
RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
END \name
.endm
-GENERATE_ALLOC_ARRAY_REGION_TLAB art_quick_alloc_array_region_tlab, artAllocArrayFromCodeRegionTLAB, ALLOC_ARRAY_TLAB_FAST_PATH, 0
-// TODO: art_quick_alloc_array_resolved_region_tlab seems to not get called. Investigate compiler.
-GENERATE_ALLOC_ARRAY_REGION_TLAB art_quick_alloc_array_resolved_region_tlab, artAllocArrayFromCodeResolvedRegionTLAB, ALLOC_ARRAY_TLAB_FAST_PATH_RESOLVED, 1
+GENERATE_ALLOC_ARRAY_REGION_TLAB art_quick_alloc_array_resolved_region_tlab, artAllocArrayFromCodeResolvedRegionTLAB, ALLOC_ARRAY_TLAB_FAST_PATH_RESOLVED
/*
* Called by managed code when the thread has been asked to suspend.
@@ -2567,3 +2496,82 @@ READ_BARRIER_MARK_REG art_quick_read_barrier_mark_reg26, w26, x26
READ_BARRIER_MARK_REG art_quick_read_barrier_mark_reg27, w27, x27
READ_BARRIER_MARK_REG art_quick_read_barrier_mark_reg28, w28, x28
READ_BARRIER_MARK_REG art_quick_read_barrier_mark_reg29, w29, x29
+
+.extern artInvokePolymorphic
+ENTRY art_quick_invoke_polymorphic
+ SETUP_SAVE_REFS_AND_ARGS_FRAME // Save callee saves in case allocation triggers GC.
+ mov x2, xSELF
+ mov x3, sp
+ INCREASE_FRAME 16 // Reserve space for JValue result.
+ str xzr, [sp, #0] // Initialize result to zero.
+ mov x0, sp // Set r0 to point to result.
+ bl artInvokePolymorphic // ArtInvokePolymorphic(result, receiver, thread, save_area)
+ uxtb w0, w0 // Result is the return type descriptor as a char.
+ sub w0, w0, 'A' // Convert to zero based index.
+ cmp w0, 'Z' - 'A'
+ bhi .Lcleanup_and_return // Clean-up if out-of-bounds.
+ adrp x1, .Lhandler_table // Compute address of handler table.
+ add x1, x1, :lo12:.Lhandler_table
+ ldrb w0, [x1, w0, uxtw] // Lookup handler offset in handler table.
+ adr x1, .Lstart_of_handlers
+ add x0, x1, w0, sxtb #2 // Convert relative offset to absolute address.
+ br x0 // Branch to handler.
+
+.Lstart_of_handlers:
+.Lstore_boolean_result:
+ ldrb w0, [sp]
+ b .Lcleanup_and_return
+.Lstore_char_result:
+ ldrh w0, [sp]
+ b .Lcleanup_and_return
+.Lstore_float_result:
+ ldr s0, [sp]
+ str s0, [sp, #32]
+ b .Lcleanup_and_return
+.Lstore_double_result:
+ ldr d0, [sp]
+ str d0, [sp, #32]
+ b .Lcleanup_and_return
+.Lstore_long_result:
+ ldr x0, [sp]
+ // Fall-through
+.Lcleanup_and_return:
+ DECREASE_FRAME 16
+ RESTORE_SAVE_REFS_AND_ARGS_FRAME
+ RETURN_OR_DELIVER_PENDING_EXCEPTION_X1
+
+ .section .rodata // Place handler table in read-only section away from text.
+ .align 2
+.macro HANDLER_TABLE_OFFSET handler_label
+ .byte (\handler_label - .Lstart_of_handlers) / 4
+.endm
+.Lhandler_table:
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // A
+ HANDLER_TABLE_OFFSET(.Lstore_long_result) // B (byte)
+ HANDLER_TABLE_OFFSET(.Lstore_char_result) // C (char)
+ HANDLER_TABLE_OFFSET(.Lstore_double_result) // D (double)
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // E
+ HANDLER_TABLE_OFFSET(.Lstore_float_result) // F (float)
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // G
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // H
+ HANDLER_TABLE_OFFSET(.Lstore_long_result) // I (int)
+ HANDLER_TABLE_OFFSET(.Lstore_long_result) // J (long)
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // K
+ HANDLER_TABLE_OFFSET(.Lstore_long_result) // L (object - references are compressed and only 32-bits)
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // M
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // N
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // O
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // P
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // Q
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // R
+ HANDLER_TABLE_OFFSET(.Lstore_long_result) // S (short)
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // T
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // U
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // V (void)
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // W
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // X
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // Y
+ HANDLER_TABLE_OFFSET(.Lstore_boolean_result) // Z (boolean)
+ .text
+
+END art_quick_invoke_polymorphic
diff --git a/runtime/arch/mips/entrypoints_init_mips.cc b/runtime/arch/mips/entrypoints_init_mips.cc
index 5c569232ac..36f9ea78e1 100644
--- a/runtime/arch/mips/entrypoints_init_mips.cc
+++ b/runtime/arch/mips/entrypoints_init_mips.cc
@@ -142,16 +142,8 @@ void InitEntryPoints(JniEntryPoints* jpoints, QuickEntryPoints* qpoints) {
static_assert(!IsDirectEntrypoint(kQuickGetObjStatic), "Non-direct C stub marked direct.");
// Array
- qpoints->pAputObjectWithNullAndBoundCheck = art_quick_aput_obj_with_null_and_bound_check;
- static_assert(!IsDirectEntrypoint(kQuickAputObjectWithNullAndBoundCheck),
- "Non-direct C stub marked direct.");
- qpoints->pAputObjectWithBoundCheck = art_quick_aput_obj_with_bound_check;
- static_assert(!IsDirectEntrypoint(kQuickAputObjectWithBoundCheck),
- "Non-direct C stub marked direct.");
qpoints->pAputObject = art_quick_aput_obj;
static_assert(!IsDirectEntrypoint(kQuickAputObject), "Non-direct C stub marked direct.");
- qpoints->pHandleFillArrayData = art_quick_handle_fill_data;
- static_assert(!IsDirectEntrypoint(kQuickHandleFillArrayData), "Non-direct C stub marked direct.");
// JNI
qpoints->pJniMethodStart = JniMethodStart;
@@ -262,6 +254,7 @@ void InitEntryPoints(JniEntryPoints* jpoints, QuickEntryPoints* qpoints) {
art_quick_invoke_virtual_trampoline_with_access_check;
static_assert(!IsDirectEntrypoint(kQuickInvokeVirtualTrampolineWithAccessCheck),
"Non-direct C stub marked direct.");
+ qpoints->pInvokePolymorphic = art_quick_invoke_polymorphic;
// Thread
qpoints->pTestSuspend = art_quick_test_suspend;
diff --git a/runtime/arch/mips/quick_entrypoints_mips.S b/runtime/arch/mips/quick_entrypoints_mips.S
index 964ea563b0..76218fb542 100644
--- a/runtime/arch/mips/quick_entrypoints_mips.S
+++ b/runtime/arch/mips/quick_entrypoints_mips.S
@@ -1389,28 +1389,6 @@ END art_quick_check_instance_of
#endif // USE_READ_BARRIER
.endm
- /*
- * Entry from managed code for array put operations of objects where the value being stored
- * needs to be checked for compatibility.
- * a0 = array, a1 = index, a2 = value
- */
-ENTRY art_quick_aput_obj_with_null_and_bound_check
- bnez $a0, .Lart_quick_aput_obj_with_bound_check_gp_set
- nop
- b art_quick_throw_null_pointer_exception
- nop
-END art_quick_aput_obj_with_null_and_bound_check
-
-ENTRY art_quick_aput_obj_with_bound_check
- lw $t0, MIRROR_ARRAY_LENGTH_OFFSET($a0)
- sltu $t1, $a1, $t0
- bnez $t1, .Lart_quick_aput_obj_gp_set
- nop
- move $a0, $a1
- b art_quick_throw_array_bounds
- move $a1, $t0
-END art_quick_aput_obj_with_bound_check
-
#ifdef USE_READ_BARRIER
.extern artReadBarrierSlow
#endif
@@ -2230,7 +2208,7 @@ ENTRY_NO_GP art_quick_indexof
li $v0, -1 # return -1;
sll $v0, $a2, 1 # $a0 += $a2 * 2
- addu $a0, $a0, $v0 # " " " " "
+ addu $a0, $a0, $v0 # " ditto "
move $v0, $a2 # Set i to fromIndex.
1:
@@ -2280,3 +2258,59 @@ ENTRY_NO_GP art_quick_string_compareto
j $ra
nop
END art_quick_string_compareto
+
+.extern artInvokePolymorphic
+ENTRY art_quick_invoke_polymorphic
+ SETUP_SAVE_REFS_AND_ARGS_FRAME
+ move $a2, rSELF # Make $a2 an alias for the current Thread.
+ addiu $a3, $sp, ARG_SLOT_SIZE # Make $a3 a pointer to the saved frame context.
+ sw $zero, 20($sp) # Initialize JValue result.
+ sw $zero, 16($sp)
+ la $t9, artInvokePolymorphic
+ jalr $t9 # (result, receiver, Thread*, context)
+ addiu $a0, $sp, 16 # Make $a0 a pointer to the JValue result
+.macro MATCH_RETURN_TYPE c, handler
+ li $t0, \c
+ beq $v0, $t0, \handler
+.endm
+ MATCH_RETURN_TYPE 'V', .Lcleanup_and_return
+ MATCH_RETURN_TYPE 'L', .Lstore_int_result
+ MATCH_RETURN_TYPE 'I', .Lstore_int_result
+ MATCH_RETURN_TYPE 'J', .Lstore_long_result
+ MATCH_RETURN_TYPE 'B', .Lstore_int_result
+ MATCH_RETURN_TYPE 'C', .Lstore_char_result
+ MATCH_RETURN_TYPE 'D', .Lstore_double_result
+ MATCH_RETURN_TYPE 'F', .Lstore_float_result
+ MATCH_RETURN_TYPE 'S', .Lstore_int_result
+ MATCH_RETURN_TYPE 'Z', .Lstore_boolean_result
+.purgem MATCH_RETURN_TYPE
+ nop
+ b .Lcleanup_and_return
+ nop
+.Lstore_boolean_result:
+ b .Lcleanup_and_return
+ lbu $v0, 16($sp) # Move byte from JValue result to return value register.
+.Lstore_char_result:
+ b .Lcleanup_and_return
+ lhu $v0, 16($sp) # Move char from JValue result to return value register.
+.Lstore_double_result:
+.Lstore_float_result:
+ LDu $f0, $f1, 16, $sp, $t0 # Move double/float from JValue result to return value register.
+ b .Lcleanup_and_return
+ nop
+.Lstore_long_result:
+ lw $v1, 20($sp) # Move upper bits from JValue result to return value register.
+ // Fall-through for lower bits.
+.Lstore_int_result:
+ lw $v0, 16($sp) # Move lower bits from JValue result to return value register.
+ // Fall-through to clean up and return.
+.Lcleanup_and_return:
+ lw $t7, THREAD_EXCEPTION_OFFSET(rSELF) # Load Thread::Current()->exception_
+ RESTORE_SAVE_REFS_AND_ARGS_FRAME
+ bnez $t7, 1f # Success if no exception is pending.
+ nop
+ jalr $zero, $ra
+ nop
+1:
+ DELIVER_PENDING_EXCEPTION
+END art_quick_invoke_polymorphic
diff --git a/runtime/arch/mips64/instruction_set_features_mips64.cc b/runtime/arch/mips64/instruction_set_features_mips64.cc
index 5606c1d858..5757906618 100644
--- a/runtime/arch/mips64/instruction_set_features_mips64.cc
+++ b/runtime/arch/mips64/instruction_set_features_mips64.cc
@@ -70,7 +70,7 @@ uint32_t Mips64InstructionSetFeatures::AsBitmap() const {
}
std::string Mips64InstructionSetFeatures::GetFeatureString() const {
- return "";
+ return "default";
}
std::unique_ptr<const InstructionSetFeatures>
diff --git a/runtime/arch/mips64/instruction_set_features_mips64_test.cc b/runtime/arch/mips64/instruction_set_features_mips64_test.cc
index 1d037947fa..380c4e5433 100644
--- a/runtime/arch/mips64/instruction_set_features_mips64_test.cc
+++ b/runtime/arch/mips64/instruction_set_features_mips64_test.cc
@@ -27,7 +27,7 @@ TEST(Mips64InstructionSetFeaturesTest, Mips64Features) {
ASSERT_TRUE(mips64_features.get() != nullptr) << error_msg;
EXPECT_EQ(mips64_features->GetInstructionSet(), kMips64);
EXPECT_TRUE(mips64_features->Equals(mips64_features.get()));
- EXPECT_STREQ("", mips64_features->GetFeatureString().c_str());
+ EXPECT_STREQ("default", mips64_features->GetFeatureString().c_str());
EXPECT_EQ(mips64_features->AsBitmap(), 0U);
}
diff --git a/runtime/arch/mips64/quick_entrypoints_mips64.S b/runtime/arch/mips64/quick_entrypoints_mips64.S
index 2a18d53aea..b53fd100fa 100644
--- a/runtime/arch/mips64/quick_entrypoints_mips64.S
+++ b/runtime/arch/mips64/quick_entrypoints_mips64.S
@@ -1360,29 +1360,6 @@ END art_quick_check_instance_of
#endif // USE_READ_BARRIER
.endm
- /*
- * Entry from managed code for array put operations of objects where the value being stored
- * needs to be checked for compatibility.
- * a0 = array, a1 = index, a2 = value
- */
-ENTRY art_quick_aput_obj_with_null_and_bound_check
- bne $a0, $zero, .Lart_quick_aput_obj_with_bound_check_gp_set
- nop
- b art_quick_throw_null_pointer_exception
- .cpreturn # Restore gp from t8 in branch delay slot.
-END art_quick_aput_obj_with_null_and_bound_check
-
-ENTRY art_quick_aput_obj_with_bound_check
- lwu $t0, MIRROR_ARRAY_LENGTH_OFFSET($a0)
- sltu $t1, $a1, $t0
- bne $t1, $zero, .Lart_quick_aput_obj_gp_set
- nop
- move $a0, $a1
- move $a1, $t0
- b art_quick_throw_array_bounds
- .cpreturn # Restore gp from t8 in branch delay slot.
-END art_quick_aput_obj_with_bound_check
-
ENTRY art_quick_aput_obj
beq $a2, $zero, .Ldo_aput_null
nop
@@ -2105,7 +2082,7 @@ ENTRY_NO_GP art_quick_indexof
li $v0,-1 # return -1;
sll $v0,$a2,1 # $a0 += $a2 * 2
- daddu $a0,$a0,$v0 # " " " " "
+ daddu $a0,$a0,$v0 # " ditto "
move $v0,$a2 # Set i to fromIndex.
1:
@@ -2124,4 +2101,61 @@ ENTRY_NO_GP art_quick_indexof
nop
END art_quick_indexof
+.extern artInvokePolymorphic
+ENTRY art_quick_invoke_polymorphic
+ SETUP_SAVE_REFS_AND_ARGS_FRAME
+ move $a2, rSELF # Make $a2 an alias for the current Thread.
+ move $a3, $sp # Make $a3 a pointer to the saved frame context.
+ daddiu $sp, $sp, -8 # Reserve space for JValue result.
+ .cfi_adjust_cfa_offset 8
+ sd $zero, 0($sp) # Initialize JValue result.
+ jal artInvokePolymorphic # (result, receiver, Thread*, context)
+ move $a0, $sp # Make $a0 a pointer to the JValue result
+.macro MATCH_RETURN_TYPE c, handler
+ li $t0, \c
+ beq $v0, $t0, \handler
+.endm
+ MATCH_RETURN_TYPE 'V', .Lcleanup_and_return
+ MATCH_RETURN_TYPE 'L', .Lstore_ref_result
+ MATCH_RETURN_TYPE 'I', .Lstore_long_result
+ MATCH_RETURN_TYPE 'J', .Lstore_long_result
+ MATCH_RETURN_TYPE 'B', .Lstore_long_result
+ MATCH_RETURN_TYPE 'C', .Lstore_char_result
+ MATCH_RETURN_TYPE 'D', .Lstore_double_result
+ MATCH_RETURN_TYPE 'F', .Lstore_float_result
+ MATCH_RETURN_TYPE 'S', .Lstore_long_result
+ MATCH_RETURN_TYPE 'Z', .Lstore_boolean_result
+.purgem MATCH_RETURN_TYPE
+ nop
+ b .Lcleanup_and_return
+ nop
+.Lstore_boolean_result:
+ b .Lcleanup_and_return
+ lbu $v0, 0($sp) # Move byte from JValue result to return value register.
+.Lstore_char_result:
+ b .Lcleanup_and_return
+ lhu $v0, 0($sp) # Move char from JValue result to return value register.
+.Lstore_double_result:
+.Lstore_float_result:
+ b .Lcleanup_and_return
+ l.d $f0, 0($sp) # Move double/float from JValue result to return value register.
+.Lstore_ref_result:
+ b .Lcleanup_and_return
+ lwu $v0, 0($sp) # Move zero extended lower 32-bits to return value register.
+.Lstore_long_result:
+ ld $v0, 0($sp) # Move long from JValue result to return value register.
+ // Fall-through to clean up and return.
+.Lcleanup_and_return:
+ daddiu $sp, $sp, 8 # Remove space for JValue result.
+ .cfi_adjust_cfa_offset -8
+ ld $t0, THREAD_EXCEPTION_OFFSET(rSELF) # Load Thread::Current()->exception_
+ RESTORE_SAVE_REFS_AND_ARGS_FRAME
+ bnez $t0, 1f # Success if no exception is pending.
+ nop
+ jalr $zero, $ra
+ nop
+1:
+ DELIVER_PENDING_EXCEPTION
+END art_quick_invoke_polymorphic
+
.set pop
diff --git a/runtime/arch/quick_alloc_entrypoints.S b/runtime/arch/quick_alloc_entrypoints.S
index abd9046174..e79dc6029b 100644
--- a/runtime/arch/quick_alloc_entrypoints.S
+++ b/runtime/arch/quick_alloc_entrypoints.S
@@ -22,17 +22,8 @@ ONE_ARG_DOWNCALL art_quick_alloc_object_initialized\c_suffix, artAllocObjectFrom
// Called by managed code to allocate an object when the caller doesn't know whether it has access
// to the created type.
ONE_ARG_DOWNCALL art_quick_alloc_object_with_checks\c_suffix, artAllocObjectFromCodeWithChecks\cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
-// Called by managed code to allocate an array.
-THREE_ARG_DOWNCALL art_quick_alloc_array\c_suffix, artAllocArrayFromCode\cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
// Called by managed code to allocate an array of a resolve class.
-THREE_ARG_DOWNCALL art_quick_alloc_array_resolved\c_suffix, artAllocArrayFromCodeResolved\cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
-// Called by managed code to allocate an array when the caller doesn't know whether it has access
-// to the created type.
-THREE_ARG_DOWNCALL art_quick_alloc_array_with_access_check\c_suffix, artAllocArrayFromCodeWithAccessCheck\cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
-// Called by managed code to allocate an array in a special case for FILLED_NEW_ARRAY.
-THREE_ARG_DOWNCALL art_quick_check_and_alloc_array\c_suffix, artCheckAndAllocArrayFromCode\cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
-// Called by managed code to allocate an array in a special case for FILLED_NEW_ARRAY.
-THREE_ARG_DOWNCALL art_quick_check_and_alloc_array_with_access_check\c_suffix, artCheckAndAllocArrayFromCodeWithAccessCheck\cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
+TWO_ARG_DOWNCALL art_quick_alloc_array_resolved\c_suffix, artAllocArrayFromCodeResolved\cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
// Called by managed code to allocate a string from bytes
FOUR_ARG_DOWNCALL art_quick_alloc_string_from_bytes\c_suffix, artAllocStringFromBytesFromCode\cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
// Called by managed code to allocate a string from chars
@@ -65,16 +56,8 @@ GENERATE_ALLOC_ENTRYPOINTS _region_tlab_instrumented, RegionTLABInstrumented
ONE_ARG_DOWNCALL art_quick_alloc_object_initialized ## c_suffix, artAllocObjectFromCodeInitialized ## cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
#define GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(c_suffix, cxx_suffix) \
ONE_ARG_DOWNCALL art_quick_alloc_object_with_checks ## c_suffix, artAllocObjectFromCodeWithChecks ## cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
-#define GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(c_suffix, cxx_suffix) \
- THREE_ARG_DOWNCALL art_quick_alloc_array ## c_suffix, artAllocArrayFromCode ## cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
#define GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(c_suffix, cxx_suffix) \
- THREE_ARG_DOWNCALL art_quick_alloc_array_resolved ## c_suffix, artAllocArrayFromCodeResolved ## cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
-#define GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(c_suffix, cxx_suffix) \
- THREE_ARG_DOWNCALL art_quick_alloc_array_with_access_check ## c_suffix, artAllocArrayFromCodeWithAccessCheck ## cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
-#define GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(c_suffix, cxx_suffix) \
- THREE_ARG_DOWNCALL art_quick_check_and_alloc_array ## c_suffix, artCheckAndAllocArrayFromCode ## cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
-#define GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(c_suffix, cxx_suffix) \
- THREE_ARG_DOWNCALL art_quick_check_and_alloc_array_with_access_check ## c_suffix, artCheckAndAllocArrayFromCodeWithAccessCheck ## cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
+ TWO_ARG_DOWNCALL art_quick_alloc_array_resolved ## c_suffix, artAllocArrayFromCodeResolved ## cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
#define GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(c_suffix, cxx_suffix) \
FOUR_ARG_DOWNCALL art_quick_alloc_string_from_bytes ## c_suffix, artAllocStringFromBytesFromCode ## cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
#define GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(c_suffix, cxx_suffix) \
@@ -92,11 +75,7 @@ GENERATE_ALLOC_ENTRYPOINTS_FOR_REGION_TLAB_ALLOCATOR
// GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_region_tlab, RegionTLAB)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_region_tlab, RegionTLAB)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_region_tlab, RegionTLAB)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_region_tlab, RegionTLAB)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_region_tlab, RegionTLAB)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_region_tlab, RegionTLAB)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_region_tlab, RegionTLAB)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_region_tlab, RegionTLAB)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_region_tlab, RegionTLAB)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_region_tlab, RegionTLAB)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_region_tlab, RegionTLAB)
@@ -107,11 +86,7 @@ GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_region_tlab, RegionTLAB)
// GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_tlab, TLAB)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_tlab, TLAB)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_tlab, TLAB)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_tlab, TLAB)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_tlab, TLAB)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_tlab, TLAB)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_tlab, TLAB)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_tlab, TLAB)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_tlab, TLAB)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_tlab, TLAB)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_tlab, TLAB)
@@ -126,11 +101,7 @@ GENERATE_ALLOC_ENTRYPOINTS_FOR_TLAB_ALLOCATOR
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_dlmalloc, DlMalloc)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_dlmalloc, DlMalloc)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_dlmalloc, DlMalloc)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_dlmalloc, DlMalloc)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_dlmalloc, DlMalloc)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_dlmalloc, DlMalloc)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_dlmalloc, DlMalloc)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_dlmalloc, DlMalloc)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_dlmalloc, DlMalloc)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_dlmalloc, DlMalloc)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_dlmalloc, DlMalloc)
@@ -138,11 +109,7 @@ GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_dlmalloc, DlMalloc)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_dlmalloc_instrumented, DlMallocInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_dlmalloc_instrumented, DlMallocInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_dlmalloc_instrumented, DlMallocInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_dlmalloc_instrumented, DlMallocInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_dlmalloc_instrumented, DlMallocInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_dlmalloc_instrumented, DlMallocInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_dlmalloc_instrumented, DlMallocInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_dlmalloc_instrumented, DlMallocInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_dlmalloc_instrumented, DlMallocInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_dlmalloc_instrumented, DlMallocInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_dlmalloc_instrumented, DlMallocInstrumented)
@@ -151,11 +118,7 @@ GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_dlmalloc_instrumented, DlMa
// GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_rosalloc, RosAlloc)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_rosalloc, RosAlloc)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_rosalloc, RosAlloc)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_rosalloc, RosAlloc)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_rosalloc, RosAlloc)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_rosalloc, RosAlloc)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_rosalloc, RosAlloc)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_rosalloc, RosAlloc)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_rosalloc, RosAlloc)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_rosalloc, RosAlloc)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_rosalloc, RosAlloc)
@@ -163,11 +126,7 @@ GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_rosalloc, RosAlloc)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_rosalloc_instrumented, RosAllocInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_rosalloc_instrumented, RosAllocInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_rosalloc_instrumented, RosAllocInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_rosalloc_instrumented, RosAllocInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_rosalloc_instrumented, RosAllocInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_rosalloc_instrumented, RosAllocInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_rosalloc_instrumented, RosAllocInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_rosalloc_instrumented, RosAllocInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_rosalloc_instrumented, RosAllocInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_rosalloc_instrumented, RosAllocInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_rosalloc_instrumented, RosAllocInstrumented)
@@ -175,11 +134,7 @@ GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_rosalloc_instrumented, RosA
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_bump_pointer, BumpPointer)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_bump_pointer, BumpPointer)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_bump_pointer, BumpPointer)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_bump_pointer, BumpPointer)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_bump_pointer, BumpPointer)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_bump_pointer, BumpPointer)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_bump_pointer, BumpPointer)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_bump_pointer, BumpPointer)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_bump_pointer, BumpPointer)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_bump_pointer, BumpPointer)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_bump_pointer, BumpPointer)
@@ -187,11 +142,7 @@ GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_bump_pointer, BumpPointer)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_bump_pointer_instrumented, BumpPointerInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_bump_pointer_instrumented, BumpPointerInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_bump_pointer_instrumented, BumpPointerInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_bump_pointer_instrumented, BumpPointerInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_bump_pointer_instrumented, BumpPointerInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_bump_pointer_instrumented, BumpPointerInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_bump_pointer_instrumented, BumpPointerInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_bump_pointer_instrumented, BumpPointerInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_bump_pointer_instrumented, BumpPointerInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_bump_pointer_instrumented, BumpPointerInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_bump_pointer_instrumented, BumpPointerInstrumented)
@@ -199,11 +150,7 @@ GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_bump_pointer_instrumented,
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_tlab_instrumented, TLABInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_tlab_instrumented, TLABInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_tlab_instrumented, TLABInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_tlab_instrumented, TLABInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_tlab_instrumented, TLABInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_tlab_instrumented, TLABInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_tlab_instrumented, TLABInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_tlab_instrumented, TLABInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_tlab_instrumented, TLABInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_tlab_instrumented, TLABInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_tlab_instrumented, TLABInstrumented)
@@ -211,11 +158,7 @@ GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_tlab_instrumented, TLABInst
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_region, Region)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_region, Region)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_region, Region)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_region, Region)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_region, Region)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_region, Region)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_region, Region)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_region, Region)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_region, Region)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_region, Region)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_region, Region)
@@ -223,11 +166,7 @@ GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_region, Region)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_region_instrumented, RegionInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_region_instrumented, RegionInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_region_instrumented, RegionInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_region_instrumented, RegionInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_region_instrumented, RegionInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_region_instrumented, RegionInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_region_instrumented, RegionInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_region_instrumented, RegionInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_region_instrumented, RegionInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_region_instrumented, RegionInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_region_instrumented, RegionInstrumented)
@@ -235,11 +174,7 @@ GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_region_instrumented, Region
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_region_tlab_instrumented, RegionTLABInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_region_tlab_instrumented, RegionTLABInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_region_tlab_instrumented, RegionTLABInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_region_tlab_instrumented, RegionTLABInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_region_tlab_instrumented, RegionTLABInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_region_tlab_instrumented, RegionTLABInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_region_tlab_instrumented, RegionTLABInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_region_tlab_instrumented, RegionTLABInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_region_tlab_instrumented, RegionTLABInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_region_tlab_instrumented, RegionTLABInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_region_tlab_instrumented, RegionTLABInstrumented)
diff --git a/runtime/arch/stub_test.cc b/runtime/arch/stub_test.cc
index ee65fa8ab0..547b57ee1a 100644
--- a/runtime/arch/stub_test.cc
+++ b/runtime/arch/stub_test.cc
@@ -908,139 +908,6 @@ TEST_F(StubTest, CheckCast) {
#endif
}
-
-TEST_F(StubTest, APutObj) {
-#if defined(__i386__) || defined(__arm__) || defined(__aarch64__) || defined(__mips__) || \
- (defined(__x86_64__) && !defined(__APPLE__))
- Thread* self = Thread::Current();
-
- // Do not check non-checked ones, we'd need handlers and stuff...
- const uintptr_t art_quick_aput_obj_with_null_and_bound_check =
- StubTest::GetEntrypoint(self, kQuickAputObjectWithNullAndBoundCheck);
-
- // Create an object
- ScopedObjectAccess soa(self);
- // garbage is created during ClassLinker::Init
-
- StackHandleScope<5> hs(soa.Self());
- Handle<mirror::Class> c(
- hs.NewHandle(class_linker_->FindSystemClass(soa.Self(), "Ljava/lang/Object;")));
- Handle<mirror::Class> ca(
- hs.NewHandle(class_linker_->FindSystemClass(soa.Self(), "[Ljava/lang/String;")));
-
- // Build a string array of size 1
- Handle<mirror::ObjectArray<mirror::Object>> array(
- hs.NewHandle(mirror::ObjectArray<mirror::Object>::Alloc(soa.Self(), ca.Get(), 10)));
-
- // Build a string -> should be assignable
- Handle<mirror::String> str_obj(
- hs.NewHandle(mirror::String::AllocFromModifiedUtf8(soa.Self(), "hello, world!")));
-
- // Build a generic object -> should fail assigning
- Handle<mirror::Object> obj_obj(hs.NewHandle(c->AllocObject(soa.Self())));
-
- // Play with it...
-
- // 1) Success cases
- // 1.1) Assign str_obj to array[0..3]
-
- EXPECT_FALSE(self->IsExceptionPending());
-
- Invoke3(reinterpret_cast<size_t>(array.Get()), 0U, reinterpret_cast<size_t>(str_obj.Get()),
- art_quick_aput_obj_with_null_and_bound_check, self);
-
- EXPECT_FALSE(self->IsExceptionPending());
- EXPECT_EQ(str_obj.Get(), array->Get(0));
-
- Invoke3(reinterpret_cast<size_t>(array.Get()), 1U, reinterpret_cast<size_t>(str_obj.Get()),
- art_quick_aput_obj_with_null_and_bound_check, self);
-
- EXPECT_FALSE(self->IsExceptionPending());
- EXPECT_EQ(str_obj.Get(), array->Get(1));
-
- Invoke3(reinterpret_cast<size_t>(array.Get()), 2U, reinterpret_cast<size_t>(str_obj.Get()),
- art_quick_aput_obj_with_null_and_bound_check, self);
-
- EXPECT_FALSE(self->IsExceptionPending());
- EXPECT_EQ(str_obj.Get(), array->Get(2));
-
- Invoke3(reinterpret_cast<size_t>(array.Get()), 3U, reinterpret_cast<size_t>(str_obj.Get()),
- art_quick_aput_obj_with_null_and_bound_check, self);
-
- EXPECT_FALSE(self->IsExceptionPending());
- EXPECT_EQ(str_obj.Get(), array->Get(3));
-
- // 1.2) Assign null to array[0..3]
-
- Invoke3(reinterpret_cast<size_t>(array.Get()), 0U, reinterpret_cast<size_t>(nullptr),
- art_quick_aput_obj_with_null_and_bound_check, self);
-
- EXPECT_FALSE(self->IsExceptionPending());
- EXPECT_EQ(nullptr, array->Get(0));
-
- Invoke3(reinterpret_cast<size_t>(array.Get()), 1U, reinterpret_cast<size_t>(nullptr),
- art_quick_aput_obj_with_null_and_bound_check, self);
-
- EXPECT_FALSE(self->IsExceptionPending());
- EXPECT_EQ(nullptr, array->Get(1));
-
- Invoke3(reinterpret_cast<size_t>(array.Get()), 2U, reinterpret_cast<size_t>(nullptr),
- art_quick_aput_obj_with_null_and_bound_check, self);
-
- EXPECT_FALSE(self->IsExceptionPending());
- EXPECT_EQ(nullptr, array->Get(2));
-
- Invoke3(reinterpret_cast<size_t>(array.Get()), 3U, reinterpret_cast<size_t>(nullptr),
- art_quick_aput_obj_with_null_and_bound_check, self);
-
- EXPECT_FALSE(self->IsExceptionPending());
- EXPECT_EQ(nullptr, array->Get(3));
-
- // TODO: Check _which_ exception is thrown. Then make 3) check that it's the right check order.
-
- // 2) Failure cases (str into str[])
- // 2.1) Array = null
- // TODO: Throwing NPE needs actual DEX code
-
-// Invoke3(reinterpret_cast<size_t>(nullptr), 0U, reinterpret_cast<size_t>(str_obj.Get()),
-// reinterpret_cast<uintptr_t>(&art_quick_aput_obj_with_null_and_bound_check), self);
-//
-// EXPECT_TRUE(self->IsExceptionPending());
-// self->ClearException();
-
- // 2.2) Index < 0
-
- Invoke3(reinterpret_cast<size_t>(array.Get()), static_cast<size_t>(-1),
- reinterpret_cast<size_t>(str_obj.Get()),
- art_quick_aput_obj_with_null_and_bound_check, self);
-
- EXPECT_TRUE(self->IsExceptionPending());
- self->ClearException();
-
- // 2.3) Index > 0
-
- Invoke3(reinterpret_cast<size_t>(array.Get()), 10U, reinterpret_cast<size_t>(str_obj.Get()),
- art_quick_aput_obj_with_null_and_bound_check, self);
-
- EXPECT_TRUE(self->IsExceptionPending());
- self->ClearException();
-
- // 3) Failure cases (obj into str[])
-
- Invoke3(reinterpret_cast<size_t>(array.Get()), 0U, reinterpret_cast<size_t>(obj_obj.Get()),
- art_quick_aput_obj_with_null_and_bound_check, self);
-
- EXPECT_TRUE(self->IsExceptionPending());
- self->ClearException();
-
- // Tests done.
-#else
- LOG(INFO) << "Skipping aput_obj as I don't know how to do that on " << kRuntimeISA;
- // Force-print to std::cout so it's also outside the logcat.
- std::cout << "Skipping aput_obj as I don't know how to do that on " << kRuntimeISA << std::endl;
-#endif
-}
-
TEST_F(StubTest, AllocObject) {
#if defined(__i386__) || defined(__arm__) || defined(__aarch64__) || defined(__mips__) || \
(defined(__x86_64__) && !defined(__APPLE__))
@@ -1171,39 +1038,14 @@ TEST_F(StubTest, AllocObjectArray) {
ScopedObjectAccess soa(self);
// garbage is created during ClassLinker::Init
- StackHandleScope<2> hs(self);
+ StackHandleScope<1> hs(self);
Handle<mirror::Class> c(
hs.NewHandle(class_linker_->FindSystemClass(soa.Self(), "[Ljava/lang/Object;")));
- // Needed to have a linked method.
- Handle<mirror::Class> c_obj(
- hs.NewHandle(class_linker_->FindSystemClass(soa.Self(), "Ljava/lang/Object;")));
-
// Play with it...
EXPECT_FALSE(self->IsExceptionPending());
- // For some reason this does not work, as the type_idx is artificial and outside what the
- // resolved types of c_obj allow...
-
- if ((false)) {
- // Use an arbitrary method from c to use as referrer
- size_t result = Invoke3(
- static_cast<size_t>(c->GetDexTypeIndex().index_), // type_idx
- 10U,
- // arbitrary
- reinterpret_cast<size_t>(c_obj->GetVirtualMethod(0, kRuntimePointerSize)),
- StubTest::GetEntrypoint(self, kQuickAllocArray),
- self);
-
- EXPECT_FALSE(self->IsExceptionPending());
- EXPECT_NE(reinterpret_cast<size_t>(nullptr), result);
- mirror::Array* obj = reinterpret_cast<mirror::Array*>(result);
- EXPECT_EQ(c.Get(), obj->GetClass());
- VerifyObject(obj);
- EXPECT_EQ(obj->GetLength(), 10);
- }
-
{
// We can use null in the second argument as we do not need a method here (not used in
// resolved/initialized cases)
diff --git a/runtime/arch/x86/quick_entrypoints_x86.S b/runtime/arch/x86/quick_entrypoints_x86.S
index 62c29cf268..c4202596f2 100644
--- a/runtime/arch/x86/quick_entrypoints_x86.S
+++ b/runtime/arch/x86/quick_entrypoints_x86.S
@@ -468,7 +468,7 @@ TWO_ARG_RUNTIME_EXCEPTION_SAVE_EVERYTHING art_quick_throw_string_bounds, artThro
* The helper will attempt to locate the target and return a 64-bit result in r0/r1 consisting
* of the target Method* in r0 and method->code_ in r1.
*
- * If unsuccessful, the helper will return null/null will bea pending exception in the
+ * If unsuccessful, the helper will return null/null and there will be a pending exception in the
* thread and we branch to another stub to deliver it.
*
* On success this wrapper will restore arguments and *jump* to the target, leaving the lr
@@ -1352,26 +1352,6 @@ MACRO4(READ_BARRIER, obj_reg, offset, dest_reg, pop_eax)
#endif // USE_READ_BARRIER
END_MACRO
- /*
- * Entry from managed code for array put operations of objects where the value being stored
- * needs to be checked for compatibility.
- * eax = array, ecx = index, edx = value
- */
-DEFINE_FUNCTION art_quick_aput_obj_with_null_and_bound_check
- testl %eax, %eax
- jnz SYMBOL(art_quick_aput_obj_with_bound_check)
- jmp SYMBOL(art_quick_throw_null_pointer_exception)
-END_FUNCTION art_quick_aput_obj_with_null_and_bound_check
-
-DEFINE_FUNCTION art_quick_aput_obj_with_bound_check
- movl MIRROR_ARRAY_LENGTH_OFFSET(%eax), %ebx
- cmpl %ebx, %ecx
- jb SYMBOL(art_quick_aput_obj)
- mov %ecx, %eax
- mov %ebx, %ecx
- jmp SYMBOL(art_quick_throw_array_bounds)
-END_FUNCTION art_quick_aput_obj_with_bound_check
-
DEFINE_FUNCTION art_quick_aput_obj
test %edx, %edx // store of null
jz .Ldo_aput_null
@@ -2223,5 +2203,99 @@ DEFINE_FUNCTION art_quick_osr_stub
jmp *%ebx
END_FUNCTION art_quick_osr_stub
+DEFINE_FUNCTION art_quick_invoke_polymorphic
+ SETUP_SAVE_REFS_AND_ARGS_FRAME ebx, ebx // Save frame.
+ mov %esp, %edx // Remember SP.
+ subl LITERAL(16), %esp // Make space for JValue result.
+ CFI_ADJUST_CFA_OFFSET(16)
+ movl LITERAL(0), (%esp) // Initialize result to zero.
+ movl LITERAL(0), 4(%esp)
+ mov %esp, %eax // Store pointer to JValue result in eax.
+ PUSH edx // pass SP
+ pushl %fs:THREAD_SELF_OFFSET // pass Thread::Current()
+ CFI_ADJUST_CFA_OFFSET(4)
+ PUSH ecx // pass receiver (method handle)
+ PUSH eax // pass JResult
+ call SYMBOL(artInvokePolymorphic) // (result, receiver, Thread*, SP)
+ subl LITERAL('A'), %eax // Eliminate out of bounds options
+ cmpb LITERAL('Z' - 'A'), %al
+ ja .Lcleanup_and_return
+ movzbl %al, %eax
+ call .Lput_eip_in_ecx
+.Lbranch_start:
+ movl %ecx, %edx
+ add $(.Lhandler_table - .Lbranch_start), %edx // Make EDX point to handler_table.
+ leal (%edx, %eax, 2), %eax // Calculate address of entry in table.
+ movzwl (%eax), %eax // Lookup relative branch in table.
+ addl %ecx, %eax // Add EIP relative offset.
+ jmp *%eax // Branch to handler.
+
+ // Handlers for different return types.
+.Lstore_boolean_result:
+ movzbl 16(%esp), %eax // Copy boolean result to the accumulator.
+ jmp .Lcleanup_and_return
+.Lstore_char_result:
+ movzwl 16(%esp), %eax // Copy char result to the accumulator.
+ jmp .Lcleanup_and_return
+.Lstore_float_result:
+ movd 16(%esp), %xmm0 // Copy float result to the context restored by
+ movd %xmm0, 36(%esp) // RESTORE_SAVE_REFS_ONLY_FRAME.
+ jmp .Lcleanup_and_return
+.Lstore_double_result:
+ movsd 16(%esp), %xmm0 // Copy double result to the context restored by
+ movsd %xmm0, 36(%esp) // RESTORE_SAVE_REFS_ONLY_FRAME.
+ jmp .Lcleanup_and_return
+.Lstore_long_result:
+ movl 20(%esp), %edx // Copy upper-word of result to the context restored by
+ movl %edx, 72(%esp) // RESTORE_SAVE_REFS_ONLY_FRAME.
+ // Fall-through for lower bits.
+.Lstore_int_result:
+ movl 16(%esp), %eax // Copy int result to the accumulator.
+ // Fall-through to clean up and return.
+.Lcleanup_and_return:
+ addl LITERAL(32), %esp // Pop arguments and stack allocated JValue result.
+ CFI_ADJUST_CFA_OFFSET(-32)
+ RESTORE_SAVE_REFS_AND_ARGS_FRAME
+ RETURN_OR_DELIVER_PENDING_EXCEPTION
+
+.Lput_eip_in_ecx: // Internal function that puts address of
+ movl 0(%esp), %ecx // next instruction into ECX when CALL
+ ret
+
+ // Handler table to handlers for given type.
+.Lhandler_table:
+MACRO1(HANDLER_TABLE_ENTRY, handler_label)
+ // NB some tools require 16-bits for relocations. Shouldn't need adjusting.
+ .word RAW_VAR(handler_label) - .Lbranch_start
+END_MACRO
+ HANDLER_TABLE_ENTRY(.Lcleanup_and_return) // A
+ HANDLER_TABLE_ENTRY(.Lstore_int_result) // B (byte)
+ HANDLER_TABLE_ENTRY(.Lstore_char_result) // C (char)
+ HANDLER_TABLE_ENTRY(.Lstore_double_result) // D (double)
+ HANDLER_TABLE_ENTRY(.Lcleanup_and_return) // E
+ HANDLER_TABLE_ENTRY(.Lstore_float_result) // F (float)
+ HANDLER_TABLE_ENTRY(.Lcleanup_and_return) // G
+ HANDLER_TABLE_ENTRY(.Lcleanup_and_return) // H
+ HANDLER_TABLE_ENTRY(.Lstore_int_result) // I (int)
+ HANDLER_TABLE_ENTRY(.Lstore_long_result) // J (long)
+ HANDLER_TABLE_ENTRY(.Lcleanup_and_return) // K
+ HANDLER_TABLE_ENTRY(.Lstore_int_result) // L (object)
+ HANDLER_TABLE_ENTRY(.Lcleanup_and_return) // M
+ HANDLER_TABLE_ENTRY(.Lcleanup_and_return) // N
+ HANDLER_TABLE_ENTRY(.Lcleanup_and_return) // O
+ HANDLER_TABLE_ENTRY(.Lcleanup_and_return) // P
+ HANDLER_TABLE_ENTRY(.Lcleanup_and_return) // Q
+ HANDLER_TABLE_ENTRY(.Lcleanup_and_return) // R
+ HANDLER_TABLE_ENTRY(.Lstore_int_result) // S (short)
+ HANDLER_TABLE_ENTRY(.Lcleanup_and_return) // T
+ HANDLER_TABLE_ENTRY(.Lcleanup_and_return) // U
+ HANDLER_TABLE_ENTRY(.Lcleanup_and_return) // V (void)
+ HANDLER_TABLE_ENTRY(.Lcleanup_and_return) // W
+ HANDLER_TABLE_ENTRY(.Lcleanup_and_return) // X
+ HANDLER_TABLE_ENTRY(.Lcleanup_and_return) // Y
+ HANDLER_TABLE_ENTRY(.Lstore_boolean_result) // Z (boolean)
+
+END_FUNCTION art_quick_invoke_polymorphic
+
// TODO: implement these!
UNIMPLEMENTED art_quick_memcmp16
diff --git a/runtime/arch/x86_64/quick_entrypoints_x86_64.S b/runtime/arch/x86_64/quick_entrypoints_x86_64.S
index facd563428..46bee399f4 100644
--- a/runtime/arch/x86_64/quick_entrypoints_x86_64.S
+++ b/runtime/arch/x86_64/quick_entrypoints_x86_64.S
@@ -986,11 +986,7 @@ GENERATE_ALLOC_ENTRYPOINTS_FOR_NON_TLAB_ALLOCATORS
// GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_region_tlab, RegionTLAB)
// GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_region_tlab, RegionTLAB)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_region_tlab, RegionTLAB)
-// GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_region_tlab, RegionTLAB)
// GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_region_tlab, RegionTLAB)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_region_tlab, RegionTLAB)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_region_tlab, RegionTLAB)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_region_tlab, RegionTLAB)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_region_tlab, RegionTLAB)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_region_tlab, RegionTLAB)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_region_tlab, RegionTLAB)
@@ -999,9 +995,6 @@ GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_region_tlab, RegionTLAB)
// GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_tlab, TLAB)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_tlab, TLAB)
// GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_tlab, TLAB)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_tlab, TLAB)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_tlab, TLAB)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_tlab, TLAB)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_tlab, TLAB)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_tlab, TLAB)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_tlab, TLAB)
@@ -1119,12 +1112,11 @@ MACRO1(ALLOC_OBJECT_INITIALIZED_TLAB_FAST_PATH, slowPathLabel)
END_MACRO
// The fast path code for art_quick_alloc_array_region_tlab.
-// Inputs: RDI: uint32_t type_idx, RSI: int32_t component_count, RDX: ArtMethod* method
-// Temps: RCX: the class, r8, r9
+// Inputs: RDI: the class, RSI: int32_t component_count
+// Free temps: RCX, RDX, R8, R9
// Output: RAX: return value.
MACRO1(ALLOC_ARRAY_TLAB_FAST_PATH_RESOLVED, slowPathLabel)
- movq %rcx, %r8 // Save class for later
- movl MIRROR_CLASS_COMPONENT_TYPE_OFFSET(%rcx), %ecx // Load component type.
+ movl MIRROR_CLASS_COMPONENT_TYPE_OFFSET(%rdi), %ecx // Load component type.
UNPOISON_HEAP_REF ecx
movl MIRROR_CLASS_OBJECT_PRIMITIVE_TYPE_OFFSET(%rcx), %ecx // Load primitive type.
shrq LITERAL(PRIMITIVE_TYPE_SIZE_SHIFT_SHIFT), %rcx // Get component size shift.
@@ -1151,8 +1143,8 @@ MACRO1(ALLOC_ARRAY_TLAB_FAST_PATH_RESOLVED, slowPathLabel)
// Store the class pointer in the
// header.
// No fence needed for x86.
- POISON_HEAP_REF r8d
- movl %r8d, MIRROR_OBJECT_CLASS_OFFSET(%rax)
+ POISON_HEAP_REF edi
+ movl %edi, MIRROR_OBJECT_CLASS_OFFSET(%rax)
movl %esi, MIRROR_ARRAY_LENGTH_OFFSET(%rax)
ret // Fast path succeeded.
END_MACRO
@@ -1173,8 +1165,8 @@ END_MACRO
MACRO1(ALLOC_ARRAY_TLAB_SLOW_PATH, cxx_name)
SETUP_SAVE_REFS_ONLY_FRAME // save ref containing registers for GC
// Outgoing argument set up
- movq %gs:THREAD_SELF_OFFSET, %rcx // pass Thread::Current()
- call CALLVAR(cxx_name) // cxx_name(arg0, arg1, arg2, Thread*)
+ movq %gs:THREAD_SELF_OFFSET, %rdx // pass Thread::Current()
+ call CALLVAR(cxx_name) // cxx_name(arg0, arg1, Thread*)
RESTORE_SAVE_REFS_ONLY_FRAME // restore frame up to return address
RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER // return or deliver exception
END_MACRO
@@ -1199,73 +1191,21 @@ DEFINE_FUNCTION art_quick_alloc_object_initialized_tlab
ALLOC_OBJECT_TLAB_SLOW_PATH artAllocObjectFromCodeInitializedTLAB
END_FUNCTION art_quick_alloc_object_initialized_tlab
-// A hand-written override for GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_tlab, TLAB).
-DEFINE_FUNCTION art_quick_alloc_array_tlab
- // RDI: uint32_t type_idx, RSI: int32_t component_count, RDX: ArtMethod*
- // RCX: klass, R8, R9: free. RAX: return val.
- movq ART_METHOD_DEX_CACHE_TYPES_OFFSET_64(%rdx), %rcx // Load dex cache resolved types array
- movl 0(%rcx, %rdi, COMPRESSED_REFERENCE_SIZE), %ecx // Load the class
- testl %ecx, %ecx
- jz .Lart_quick_alloc_array_tlab_slow_path
- ALLOC_ARRAY_TLAB_FAST_PATH_RESOLVED .Lart_quick_alloc_array_tlab_slow_path
-.Lart_quick_alloc_array_tlab_slow_path:
- ALLOC_ARRAY_TLAB_SLOW_PATH artAllocArrayFromCodeTLAB
-END_FUNCTION art_quick_alloc_array_tlab
-
// A hand-written override for GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_tlab, TLAB).
DEFINE_FUNCTION art_quick_alloc_array_resolved_tlab
- // RDI: mirror::Class* klass, RSI: int32_t component_count, RDX: ArtMethod*
- // RCX: mirror::Class* klass, R8, R9: free. RAX: return val.
- movq %rdi, %rcx
- // Already resolved, no null check.
+ // RDI: mirror::Class* klass, RSI: int32_t component_count
+ // RDX, RCX, R8, R9: free. RAX: return val.
ALLOC_ARRAY_TLAB_FAST_PATH_RESOLVED .Lart_quick_alloc_array_resolved_tlab_slow_path
.Lart_quick_alloc_array_resolved_tlab_slow_path:
ALLOC_ARRAY_TLAB_SLOW_PATH artAllocArrayFromCodeResolvedTLAB
END_FUNCTION art_quick_alloc_array_resolved_tlab
-// A hand-written override for GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_region_tlab, RegionTLAB).
-DEFINE_FUNCTION art_quick_alloc_array_region_tlab
- // Fast path region tlab allocation.
- // RDI: uint32_t type_idx, RSI: int32_t component_count, RDX: ArtMethod*
- // RCX: klass, R8, R9: free. RAX: return val.
- ASSERT_USE_READ_BARRIER
- movq ART_METHOD_DEX_CACHE_TYPES_OFFSET_64(%rdx), %rcx // Load dex cache resolved types array
- movl 0(%rcx, %rdi, COMPRESSED_REFERENCE_SIZE), %ecx // Load the class
- // Null check so that we can load the lock word.
- testl %ecx, %ecx
- jz .Lart_quick_alloc_array_region_tlab_slow_path
- // Since we have allocation entrypoint switching, we know the GC is marking.
- // Check the mark bit, if it is 0, do the read barrier mark.
- testl LITERAL(LOCK_WORD_MARK_BIT_MASK_SHIFTED), MIRROR_OBJECT_LOCK_WORD_OFFSET(%ecx)
- jz .Lart_quick_alloc_array_region_tlab_class_load_read_barrier_slow_path
-.Lart_quick_alloc_array_region_tlab_class_load_read_barrier_slow_path_exit:
- ALLOC_ARRAY_TLAB_FAST_PATH_RESOLVED .Lart_quick_alloc_array_region_tlab_slow_path
-.Lart_quick_alloc_array_region_tlab_class_load_read_barrier_slow_path:
- // The read barrier slow path. Mark the class.
- PUSH rdi
- PUSH rsi
- PUSH rdx
- // Outgoing argument set up
- movq %rcx, %rdi // Pass the class as the first param.
- call SYMBOL(artReadBarrierMark) // cxx_name(mirror::Object* obj)
- movq %rax, %rcx
- POP rdx
- POP rsi
- POP rdi
- jmp .Lart_quick_alloc_array_region_tlab_class_load_read_barrier_slow_path_exit
-.Lart_quick_alloc_array_region_tlab_slow_path:
- ALLOC_ARRAY_TLAB_SLOW_PATH artAllocArrayFromCodeRegionTLAB
-END_FUNCTION art_quick_alloc_array_region_tlab
-
// A hand-written override for GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_region_tlab, RegionTLAB).
DEFINE_FUNCTION art_quick_alloc_array_resolved_region_tlab
// Fast path region tlab allocation.
- // RDI: mirror::Class* klass, RSI: int32_t component_count, RDX: ArtMethod*
- // RCX: mirror::Class* klass, R8, R9: free. RAX: return val.
+ // RDI: mirror::Class* klass, RSI: int32_t component_count
+ // RCX, RDX, R8, R9: free. RAX: return val.
ASSERT_USE_READ_BARRIER
- movq %rdi, %rcx
- // Caller is responsible for read barrier.
- // Already resolved, no null check.
ALLOC_ARRAY_TLAB_FAST_PATH_RESOLVED .Lart_quick_alloc_array_resolved_region_tlab_slow_path
.Lart_quick_alloc_array_resolved_region_tlab_slow_path:
ALLOC_ARRAY_TLAB_SLOW_PATH artAllocArrayFromCodeResolvedRegionTLAB
@@ -1466,7 +1406,7 @@ END_MACRO
* 64b PUSH/POP and 32b argument.
* TODO: When read barrier has a fast path, add heap unpoisoning support for the fast path.
*
- * As with art_quick_aput_obj* functions, the 64b versions are in comments.
+ * As with art_quick_aput_obj function, the 64b versions are in comments.
*/
MACRO4(READ_BARRIER, obj_reg, offset, dest_reg32, dest_reg64)
#ifdef USE_READ_BARRIER
@@ -1503,46 +1443,6 @@ MACRO4(READ_BARRIER, obj_reg, offset, dest_reg32, dest_reg64)
#endif // USE_READ_BARRIER
END_MACRO
- /*
- * Entry from managed code for array put operations of objects where the value being stored
- * needs to be checked for compatibility.
- *
- * Currently all the parameters should fit into the 32b portions of the registers. Index always
- * will. So we optimize for a tighter encoding. The 64b versions are in comments.
- *
- * rdi(edi) = array, rsi(esi) = index, rdx(edx) = value
- */
-DEFINE_FUNCTION art_quick_aput_obj_with_null_and_bound_check
-#if defined(__APPLE__)
- int3
- int3
-#else
- testl %edi, %edi
-// testq %rdi, %rdi
- jnz art_quick_aput_obj_with_bound_check
- jmp art_quick_throw_null_pointer_exception
-#endif // __APPLE__
-END_FUNCTION art_quick_aput_obj_with_null_and_bound_check
-
-
-DEFINE_FUNCTION art_quick_aput_obj_with_bound_check
-#if defined(__APPLE__)
- int3
- int3
-#else
- movl MIRROR_ARRAY_LENGTH_OFFSET(%edi), %ecx
-// movl MIRROR_ARRAY_LENGTH_OFFSET(%rdi), %ecx // This zero-extends, so value(%rcx)=value(%ecx)
- cmpl %ecx, %esi
- jb art_quick_aput_obj
- mov %esi, %edi
-// mov %rsi, %rdi
- mov %ecx, %esi
-// mov %rcx, %rsi
- jmp art_quick_throw_array_bounds
-#endif // __APPLE__
-END_FUNCTION art_quick_aput_obj_with_bound_check
-
-
DEFINE_FUNCTION art_quick_aput_obj
testl %edx, %edx // store of null
// test %rdx, %rdx
@@ -2394,3 +2294,79 @@ DEFINE_FUNCTION art_quick_osr_stub
rep movsb // while (rcx--) { *rdi++ = *rsi++ }
jmp *%rdx
END_FUNCTION art_quick_osr_stub
+
+DEFINE_FUNCTION art_quick_invoke_polymorphic
+ SETUP_SAVE_REFS_AND_ARGS_FRAME // save callee saves
+ movq %gs:THREAD_SELF_OFFSET, %rdx // pass Thread
+ movq %rsp, %rcx // pass SP
+ subq LITERAL(16), %rsp // make space for JValue result
+ CFI_ADJUST_CFA_OFFSET(16)
+ movq LITERAL(0), (%rsp) // initialize result
+ movq %rsp, %rdi // store pointer to JValue result
+ call SYMBOL(artInvokePolymorphic) // artInvokePolymorphic(result, receiver, Thread*, SP)
+ // save the code pointer
+ subq LITERAL('A'), %rax // Convert type descriptor character value to a zero based index.
+ cmpb LITERAL('Z' - 'A'), %al // Eliminate out of bounds options
+ ja .Lcleanup_and_return
+ movzbq %al, %rax
+ leaq .Lhandler_table(%rip), %rcx // Get the address of the handler table
+ movslq (%rcx, %rax, 4), %rax // Lookup handler offset relative to table
+ addq %rcx, %rax // Add table address to yield handler address.
+ jmpq *%rax // Jump to handler.
+
+.align 4
+.Lhandler_table: // Table of type descriptor to handlers.
+MACRO1(HANDLER_TABLE_OFFSET, handle_label)
+ // NB some tools require 32-bits for relocations. Shouldn't need adjusting.
+ .long RAW_VAR(handle_label) - .Lhandler_table
+END_MACRO
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // A
+ HANDLER_TABLE_OFFSET(.Lstore_long_result) // B (byte)
+ HANDLER_TABLE_OFFSET(.Lstore_char_result) // C (char)
+ HANDLER_TABLE_OFFSET(.Lstore_double_result) // D (double)
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // E
+ HANDLER_TABLE_OFFSET(.Lstore_float_result) // F (float)
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // G
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // H
+ HANDLER_TABLE_OFFSET(.Lstore_long_result) // I (int)
+ HANDLER_TABLE_OFFSET(.Lstore_long_result) // J (long)
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // K
+ HANDLER_TABLE_OFFSET(.Lstore_long_result) // L (object - references are compressed and only 32-bits)
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // M
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // N
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // O
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // P
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // Q
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // R
+ HANDLER_TABLE_OFFSET(.Lstore_long_result) // S (short)
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // T
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // U
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // V (void)
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // W
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // X
+ HANDLER_TABLE_OFFSET(.Lcleanup_and_return) // Y
+ HANDLER_TABLE_OFFSET(.Lstore_boolean_result) // Z (boolean)
+
+.Lstore_boolean_result:
+ movzbq (%rsp), %rax // Copy boolean result to the accumulator
+ jmp .Lcleanup_and_return
+.Lstore_char_result:
+ movzwq (%rsp), %rax // Copy char result to the accumulator
+ jmp .Lcleanup_and_return
+.Lstore_float_result:
+ movd (%rsp), %xmm0 // Copy float result to the context restored by
+ movd %xmm0, 32(%rsp) // RESTORE_SAVE_REFS_AND_ARGS_FRAME.
+ jmp .Lcleanup_and_return
+.Lstore_double_result:
+ movsd (%rsp), %xmm0 // Copy double result to the context restored by
+ movsd %xmm0, 32(%rsp) // RESTORE_SAVE_REFS_AND_ARGS_FRAME.
+ jmp .Lcleanup_and_return
+.Lstore_long_result:
+ movq (%rsp), %rax // Copy long result to the accumulator.
+ // Fall-through
+.Lcleanup_and_return:
+ addq LITERAL(16), %rsp // Pop space for JValue result.
+ CFI_ADJUST_CFA_OFFSET(16)
+ RESTORE_SAVE_REFS_AND_ARGS_FRAME
+ RETURN_OR_DELIVER_PENDING_EXCEPTION
+END_FUNCTION art_quick_invoke_polymorphic
diff --git a/runtime/art_method-inl.h b/runtime/art_method-inl.h
index 96976d9bce..15938c52be 100644
--- a/runtime/art_method-inl.h
+++ b/runtime/art_method-inl.h
@@ -121,7 +121,7 @@ inline uint16_t ArtMethod::GetMethodIndexDuringLinking() {
inline uint32_t ArtMethod::GetDexMethodIndex() {
DCHECK(IsRuntimeMethod() || GetDeclaringClass()->IsIdxLoaded() ||
GetDeclaringClass()->IsErroneous());
- return dex_method_index_;
+ return GetDexMethodIndexUnchecked();
}
inline ArtMethod** ArtMethod::GetDexCacheResolvedMethods(PointerSize pointer_size) {
@@ -175,47 +175,15 @@ inline bool ArtMethod::HasSameDexCacheResolvedMethods(ArtMethod* other, PointerS
other->GetDexCacheResolvedMethods(pointer_size);
}
-inline GcRoot<mirror::Class>* ArtMethod::GetDexCacheResolvedTypes(PointerSize pointer_size) {
- return GetNativePointer<GcRoot<mirror::Class>*>(DexCacheResolvedTypesOffset(pointer_size),
- pointer_size);
-}
-
-template <bool kWithCheck>
-inline mirror::Class* ArtMethod::GetDexCacheResolvedType(dex::TypeIndex type_index,
- PointerSize pointer_size) {
- if (kWithCheck) {
- mirror::DexCache* dex_cache = GetInterfaceMethodIfProxy(pointer_size)->GetDexCache();
- if (UNLIKELY(type_index.index_ >= dex_cache->NumResolvedTypes())) {
- ThrowArrayIndexOutOfBoundsException(type_index.index_, dex_cache->NumResolvedTypes());
- return nullptr;
- }
- }
- mirror::Class* klass = GetDexCacheResolvedTypes(pointer_size)[type_index.index_].Read();
- return (klass != nullptr && !klass->IsErroneous()) ? klass : nullptr;
-}
-
-inline bool ArtMethod::HasDexCacheResolvedTypes(PointerSize pointer_size) {
- return GetDexCacheResolvedTypes(pointer_size) != nullptr;
-}
-
-inline bool ArtMethod::HasSameDexCacheResolvedTypes(GcRoot<mirror::Class>* other_cache,
- PointerSize pointer_size) {
- return GetDexCacheResolvedTypes(pointer_size) == other_cache;
-}
-
-inline bool ArtMethod::HasSameDexCacheResolvedTypes(ArtMethod* other, PointerSize pointer_size) {
- return GetDexCacheResolvedTypes(pointer_size) == other->GetDexCacheResolvedTypes(pointer_size);
-}
-
-inline mirror::Class* ArtMethod::GetClassFromTypeIndex(dex::TypeIndex type_idx,
- bool resolve,
- PointerSize pointer_size) {
- mirror::Class* type = GetDexCacheResolvedType(type_idx, pointer_size);
- if (type == nullptr && resolve) {
- type = Runtime::Current()->GetClassLinker()->ResolveType(type_idx, this);
+inline mirror::Class* ArtMethod::GetClassFromTypeIndex(dex::TypeIndex type_idx, bool resolve) {
+ ObjPtr<mirror::DexCache> dex_cache = GetDexCache();
+ ObjPtr<mirror::Class> type = dex_cache->GetResolvedType(type_idx);
+ if (UNLIKELY(type == nullptr) && resolve) {
+ ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
+ type = class_linker->ResolveType(type_idx, this);
CHECK(type != nullptr || Thread::Current()->IsExceptionPending());
}
- return type;
+ return type.Ptr();
}
inline bool ArtMethod::CheckIncompatibleClassChange(InvokeType type) {
@@ -333,9 +301,9 @@ inline const DexFile::CodeItem* ArtMethod::GetCodeItem() {
return GetDexFile()->GetCodeItem(GetCodeItemOffset());
}
-inline bool ArtMethod::IsResolvedTypeIdx(dex::TypeIndex type_idx, PointerSize pointer_size) {
+inline bool ArtMethod::IsResolvedTypeIdx(dex::TypeIndex type_idx) {
DCHECK(!IsProxyMethod());
- return GetDexCacheResolvedType(type_idx, pointer_size) != nullptr;
+ return GetClassFromTypeIndex(type_idx, /* resolve */ false) != nullptr;
}
inline int32_t ArtMethod::GetLineNumFromDexPC(uint32_t dex_pc) {
@@ -430,23 +398,13 @@ inline void ArtMethod::SetDexCacheResolvedMethods(ArtMethod** new_dex_cache_meth
pointer_size);
}
-inline void ArtMethod::SetDexCacheResolvedTypes(GcRoot<mirror::Class>* new_dex_cache_types,
- PointerSize pointer_size) {
- SetNativePointer(DexCacheResolvedTypesOffset(pointer_size), new_dex_cache_types, pointer_size);
-}
-
-inline mirror::Class* ArtMethod::GetReturnType(bool resolve, PointerSize pointer_size) {
+inline mirror::Class* ArtMethod::GetReturnType(bool resolve) {
DCHECK(!IsProxyMethod());
const DexFile* dex_file = GetDexFile();
const DexFile::MethodId& method_id = dex_file->GetMethodId(GetDexMethodIndex());
const DexFile::ProtoId& proto_id = dex_file->GetMethodPrototype(method_id);
dex::TypeIndex return_type_idx = proto_id.return_type_idx_;
- mirror::Class* type = GetDexCacheResolvedType(return_type_idx, pointer_size);
- if (type == nullptr && resolve) {
- type = Runtime::Current()->GetClassLinker()->ResolveType(return_type_idx, this);
- CHECK(type != nullptr || Thread::Current()->IsExceptionPending());
- }
- return type;
+ return GetClassFromTypeIndex(return_type_idx, resolve);
}
inline bool ArtMethod::HasSingleImplementation() {
@@ -530,11 +488,6 @@ inline void ArtMethod::UpdateObjectsForImageRelocation(const Visitor& visitor,
if (old_methods != new_methods) {
SetDexCacheResolvedMethods(new_methods, pointer_size);
}
- GcRoot<mirror::Class>* old_types = GetDexCacheResolvedTypes(pointer_size);
- GcRoot<mirror::Class>* new_types = visitor(old_types);
- if (old_types != new_types) {
- SetDexCacheResolvedTypes(new_types, pointer_size);
- }
}
template <ReadBarrierOption kReadBarrierOption, typename Visitor>
diff --git a/runtime/art_method.cc b/runtime/art_method.cc
index dfc7837aea..d7d39afa8f 100644
--- a/runtime/art_method.cc
+++ b/runtime/art_method.cc
@@ -236,7 +236,6 @@ uint32_t ArtMethod::FindCatchBlock(Handle<mirror::Class> exception_type,
// Default to handler not found.
uint32_t found_dex_pc = DexFile::kDexNoIndex;
// Iterate over the catch handlers associated with dex_pc.
- PointerSize pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
for (CatchHandlerIterator it(*code_item, dex_pc); it.HasNext(); it.Next()) {
dex::TypeIndex iter_type_idx = it.GetHandlerTypeIndex();
// Catch all case
@@ -245,9 +244,7 @@ uint32_t ArtMethod::FindCatchBlock(Handle<mirror::Class> exception_type,
break;
}
// Does this catch exception type apply?
- mirror::Class* iter_exception_type = GetClassFromTypeIndex(iter_type_idx,
- true /* resolve */,
- pointer_size);
+ mirror::Class* iter_exception_type = GetClassFromTypeIndex(iter_type_idx, true /* resolve */);
if (UNLIKELY(iter_exception_type == nullptr)) {
// Now have a NoClassDefFoundError as exception. Ignore in case the exception class was
// removed by a pro-guard like tool.
diff --git a/runtime/art_method.h b/runtime/art_method.h
index 11dcc35df5..17f343d442 100644
--- a/runtime/art_method.h
+++ b/runtime/art_method.h
@@ -131,12 +131,12 @@ class ArtMethod FINAL {
return (GetAccessFlags() & kAccStatic) != 0;
}
- // Returns true if the method is a constructor.
+ // Returns true if the method is a constructor according to access flags.
bool IsConstructor() {
return (GetAccessFlags() & kAccConstructor) != 0;
}
- // Returns true if the method is a class initializer.
+ // Returns true if the method is a class initializer according to access flags.
bool IsClassInitializer() {
return IsConstructor() && IsStatic();
}
@@ -322,6 +322,9 @@ class ArtMethod FINAL {
// Number of 32bit registers that would be required to hold all the arguments
static size_t NumArgRegisters(const StringPiece& shorty);
+ ALWAYS_INLINE uint32_t GetDexMethodIndexUnchecked() {
+ return dex_method_index_;
+ }
ALWAYS_INLINE uint32_t GetDexMethodIndex() REQUIRES_SHARED(Locks::mutator_lock_);
void SetDexMethodIndex(uint32_t new_idx) {
@@ -348,22 +351,8 @@ class ArtMethod FINAL {
bool HasSameDexCacheResolvedMethods(ArtMethod** other_cache, PointerSize pointer_size)
REQUIRES_SHARED(Locks::mutator_lock_);
- template <bool kWithCheck = true>
- mirror::Class* GetDexCacheResolvedType(dex::TypeIndex type_idx, PointerSize pointer_size)
- REQUIRES_SHARED(Locks::mutator_lock_);
- void SetDexCacheResolvedTypes(GcRoot<mirror::Class>* new_dex_cache_types,
- PointerSize pointer_size)
- REQUIRES_SHARED(Locks::mutator_lock_);
- bool HasDexCacheResolvedTypes(PointerSize pointer_size) REQUIRES_SHARED(Locks::mutator_lock_);
- bool HasSameDexCacheResolvedTypes(ArtMethod* other, PointerSize pointer_size)
- REQUIRES_SHARED(Locks::mutator_lock_);
- bool HasSameDexCacheResolvedTypes(GcRoot<mirror::Class>* other_cache, PointerSize pointer_size)
- REQUIRES_SHARED(Locks::mutator_lock_);
-
// Get the Class* from the type index into this method's dex cache.
- mirror::Class* GetClassFromTypeIndex(dex::TypeIndex type_idx,
- bool resolve,
- PointerSize pointer_size)
+ mirror::Class* GetClassFromTypeIndex(dex::TypeIndex type_idx, bool resolve)
REQUIRES_SHARED(Locks::mutator_lock_);
// Returns true if this method has the same name and signature of the other method.
@@ -414,12 +403,6 @@ class ArtMethod FINAL {
* static_cast<size_t>(pointer_size));
}
- static MemberOffset DexCacheResolvedTypesOffset(PointerSize pointer_size) {
- return MemberOffset(PtrSizedFieldsOffset(pointer_size) + OFFSETOF_MEMBER(
- PtrSizedFields, dex_cache_resolved_types_) / sizeof(void*)
- * static_cast<size_t>(pointer_size));
- }
-
static MemberOffset DataOffset(PointerSize pointer_size) {
return MemberOffset(PtrSizedFieldsOffset(pointer_size) + OFFSETOF_MEMBER(
PtrSizedFields, data_) / sizeof(void*) * static_cast<size_t>(pointer_size));
@@ -555,8 +538,7 @@ class ArtMethod FINAL {
const DexFile::CodeItem* GetCodeItem() REQUIRES_SHARED(Locks::mutator_lock_);
- bool IsResolvedTypeIdx(dex::TypeIndex type_idx, PointerSize pointer_size)
- REQUIRES_SHARED(Locks::mutator_lock_);
+ bool IsResolvedTypeIdx(dex::TypeIndex type_idx) REQUIRES_SHARED(Locks::mutator_lock_);
int32_t GetLineNumFromDexPC(uint32_t dex_pc) REQUIRES_SHARED(Locks::mutator_lock_);
@@ -577,8 +559,7 @@ class ArtMethod FINAL {
// May cause thread suspension due to GetClassFromTypeIdx calling ResolveType this caused a large
// number of bugs at call sites.
- mirror::Class* GetReturnType(bool resolve, PointerSize pointer_size)
- REQUIRES_SHARED(Locks::mutator_lock_);
+ mirror::Class* GetReturnType(bool resolve) REQUIRES_SHARED(Locks::mutator_lock_);
mirror::ClassLoader* GetClassLoader() REQUIRES_SHARED(Locks::mutator_lock_);
@@ -608,9 +589,6 @@ class ArtMethod FINAL {
void CopyFrom(ArtMethod* src, PointerSize image_pointer_size)
REQUIRES_SHARED(Locks::mutator_lock_);
- ALWAYS_INLINE GcRoot<mirror::Class>* GetDexCacheResolvedTypes(PointerSize pointer_size)
- REQUIRES_SHARED(Locks::mutator_lock_);
-
// Note, hotness_counter_ updates are non-atomic but it doesn't need to be precise. Also,
// given that the counter is only 16 bits wide we can expect wrap-around in some
// situations. Consumers of hotness_count_ must be able to deal with that.
@@ -657,8 +635,6 @@ class ArtMethod FINAL {
std::string JniLongName()
REQUIRES_SHARED(Locks::mutator_lock_);
-
-
// Update heap objects and non-entrypoint pointers by the passed in visitor for image relocation.
// Does not use read barrier.
template <typename Visitor>
@@ -707,9 +683,6 @@ class ArtMethod FINAL {
// Short cuts to declaring_class_->dex_cache_ member for fast compiled code access.
ArtMethod** dex_cache_resolved_methods_;
- // Short cuts to declaring_class_->dex_cache_ member for fast compiled code access.
- GcRoot<mirror::Class>* dex_cache_resolved_types_;
-
// Pointer to JNI function registered to this method, or a function to resolve the JNI function,
// or the profiling data for non-native methods, or an ImtConflictTable.
void* data_;
diff --git a/runtime/asm_support.h b/runtime/asm_support.h
index bfdddf7b03..ed83f1c57f 100644
--- a/runtime/asm_support.h
+++ b/runtime/asm_support.h
@@ -90,7 +90,7 @@ ADD_TEST_EQ(THREAD_SELF_OFFSET,
art::Thread::SelfOffset<POINTER_SIZE>().Int32Value())
// Offset of field Thread::tlsPtr_.thread_local_pos.
-#define THREAD_LOCAL_POS_OFFSET (THREAD_CARD_TABLE_OFFSET + 198 * __SIZEOF_POINTER__)
+#define THREAD_LOCAL_POS_OFFSET (THREAD_CARD_TABLE_OFFSET + 34 * __SIZEOF_POINTER__)
ADD_TEST_EQ(THREAD_LOCAL_POS_OFFSET,
art::Thread::ThreadLocalPosOffset<POINTER_SIZE>().Int32Value())
// Offset of field Thread::tlsPtr_.thread_local_end.
@@ -101,8 +101,10 @@ ADD_TEST_EQ(THREAD_LOCAL_END_OFFSET,
#define THREAD_LOCAL_OBJECTS_OFFSET (THREAD_LOCAL_END_OFFSET + __SIZEOF_POINTER__)
ADD_TEST_EQ(THREAD_LOCAL_OBJECTS_OFFSET,
art::Thread::ThreadLocalObjectsOffset<POINTER_SIZE>().Int32Value())
+
// Offset of field Thread::tlsPtr_.mterp_current_ibase.
-#define THREAD_CURRENT_IBASE_OFFSET (THREAD_LOCAL_OBJECTS_OFFSET + __SIZEOF_SIZE_T__)
+#define THREAD_CURRENT_IBASE_OFFSET \
+ (THREAD_LOCAL_OBJECTS_OFFSET + __SIZEOF_SIZE_T__ + (1 + 157) * __SIZEOF_POINTER__)
ADD_TEST_EQ(THREAD_CURRENT_IBASE_OFFSET,
art::Thread::MterpCurrentIBaseOffset<POINTER_SIZE>().Int32Value())
// Offset of field Thread::tlsPtr_.mterp_default_ibase.
diff --git a/runtime/base/mutex.cc b/runtime/base/mutex.cc
index 9116097604..e05a85a116 100644
--- a/runtime/base/mutex.cc
+++ b/runtime/base/mutex.cc
@@ -46,6 +46,7 @@ Mutex* Locks::deoptimization_lock_ = nullptr;
ReaderWriterMutex* Locks::heap_bitmap_lock_ = nullptr;
Mutex* Locks::instrument_entrypoints_lock_ = nullptr;
Mutex* Locks::intern_table_lock_ = nullptr;
+Mutex* Locks::jni_function_table_lock_ = nullptr;
Mutex* Locks::jni_libraries_lock_ = nullptr;
Mutex* Locks::logging_lock_ = nullptr;
Mutex* Locks::mem_maps_lock_ = nullptr;
@@ -957,6 +958,7 @@ void Locks::Init() {
DCHECK(verifier_deps_lock_ != nullptr);
DCHECK(host_dlopen_handles_lock_ != nullptr);
DCHECK(intern_table_lock_ != nullptr);
+ DCHECK(jni_function_table_lock_ != nullptr);
DCHECK(jni_libraries_lock_ != nullptr);
DCHECK(logging_lock_ != nullptr);
DCHECK(mutator_lock_ != nullptr);
@@ -1098,6 +1100,10 @@ void Locks::Init() {
DCHECK(jni_weak_globals_lock_ == nullptr);
jni_weak_globals_lock_ = new Mutex("JNI weak global reference table lock", current_lock_level);
+ UPDATE_CURRENT_LOCK_LEVEL(kJniFunctionTableLock);
+ DCHECK(jni_function_table_lock_ == nullptr);
+ jni_function_table_lock_ = new Mutex("JNI function table lock", current_lock_level);
+
UPDATE_CURRENT_LOCK_LEVEL(kAbortLock);
DCHECK(abort_lock_ == nullptr);
abort_lock_ = new Mutex("abort lock", current_lock_level, true);
diff --git a/runtime/base/mutex.h b/runtime/base/mutex.h
index 2adeb8cc97..21dd437711 100644
--- a/runtime/base/mutex.h
+++ b/runtime/base/mutex.h
@@ -68,6 +68,7 @@ enum LockLevel {
kRosAllocBulkFreeLock,
kMarkSweepMarkStackLock,
kTransactionLogLock,
+ kJniFunctionTableLock,
kJniWeakGlobalsLock,
kJniGlobalsLock,
kReferenceQueueSoftReferencesLock,
@@ -698,8 +699,11 @@ class Locks {
// Guard accesses to the JNI Weak Global Reference table.
static Mutex* jni_weak_globals_lock_ ACQUIRED_AFTER(jni_globals_lock_);
+ // Guard accesses to the JNI function table override.
+ static Mutex* jni_function_table_lock_ ACQUIRED_AFTER(jni_weak_globals_lock_);
+
// Have an exclusive aborting thread.
- static Mutex* abort_lock_ ACQUIRED_AFTER(jni_weak_globals_lock_);
+ static Mutex* abort_lock_ ACQUIRED_AFTER(jni_function_table_lock_);
// Allow mutual exclusion when manipulating Thread::suspend_count_.
// TODO: Does the trade-off of a per-thread lock make sense?
diff --git a/runtime/class_linker-inl.h b/runtime/class_linker-inl.h
index 5fc5f1a2f5..2e17dd85e6 100644
--- a/runtime/class_linker-inl.h
+++ b/runtime/class_linker-inl.h
@@ -25,7 +25,6 @@
#include "mirror/class_loader.h"
#include "mirror/dex_cache-inl.h"
#include "mirror/iftable.h"
-#include "mirror/throwable.h"
#include "mirror/object_array.h"
#include "handle_scope-inl.h"
#include "scoped_thread_state_change-inl.h"
@@ -90,25 +89,16 @@ inline mirror::Class* ClassLinker::ResolveType(dex::TypeIndex type_idx, ArtMetho
if (kIsDebugBuild) {
Thread::Current()->AssertNoPendingException();
}
- ObjPtr<mirror::Class> resolved_type =
- referrer->GetDexCacheResolvedType(type_idx, image_pointer_size_);
+ ObjPtr<mirror::Class> resolved_type = referrer->GetDexCache()->GetResolvedType(type_idx);
if (UNLIKELY(resolved_type == nullptr)) {
StackHandleScope<2> hs(Thread::Current());
- // There could be an out of bounds exception from GetDexCacheResolvedType, don't call
- // ResolveType for this case.
- if (LIKELY(!hs.Self()->IsExceptionPending())) {
- ObjPtr<mirror::Class> declaring_class = referrer->GetDeclaringClass();
- Handle<mirror::DexCache> dex_cache(hs.NewHandle(declaring_class->GetDexCache()));
- Handle<mirror::ClassLoader> class_loader(hs.NewHandle(declaring_class->GetClassLoader()));
- const DexFile& dex_file = *dex_cache->GetDexFile();
- resolved_type = ResolveType(dex_file, type_idx, dex_cache, class_loader);
- // Note: We cannot check here to see whether we added the type to the cache. The type
- // might be an erroneous class, which results in it being hidden from us.
- } else {
- // Make sure its an array out of bounds exception.
- DCHECK(hs.Self()->GetException()->GetClass()->DescriptorEquals(
- "Ljava/lang/ArrayIndexOutOfBoundsException;"));
- }
+ ObjPtr<mirror::Class> declaring_class = referrer->GetDeclaringClass();
+ Handle<mirror::DexCache> dex_cache(hs.NewHandle(declaring_class->GetDexCache()));
+ Handle<mirror::ClassLoader> class_loader(hs.NewHandle(declaring_class->GetClassLoader()));
+ const DexFile& dex_file = *dex_cache->GetDexFile();
+ resolved_type = ResolveType(dex_file, type_idx, dex_cache, class_loader);
+ // Note: We cannot check here to see whether we added the type to the cache. The type
+ // might be an erroneous class, which results in it being hidden from us.
}
return resolved_type.Ptr();
}
@@ -256,8 +246,8 @@ ArtMethod* ClassLinker::FindMethodForProxy(ObjPtr<mirror::Class> proxy_class,
// Locate the dex cache of the original interface/Object
for (const DexCacheData& data : dex_caches_) {
if (!self->IsJWeakCleared(data.weak_root) &&
- proxy_method->HasSameDexCacheResolvedTypes(data.resolved_types,
- image_pointer_size_)) {
+ proxy_method->HasSameDexCacheResolvedMethods(data.resolved_methods,
+ image_pointer_size_)) {
ObjPtr<mirror::DexCache> dex_cache =
ObjPtr<mirror::DexCache>::DownCast(self->DecodeJObject(data.weak_root));
if (dex_cache != nullptr) {
diff --git a/runtime/class_linker.cc b/runtime/class_linker.cc
index 035ceadeb7..14918df4d5 100644
--- a/runtime/class_linker.cc
+++ b/runtime/class_linker.cc
@@ -65,7 +65,7 @@
#include "interpreter/interpreter.h"
#include "jit/jit.h"
#include "jit/jit_code_cache.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
#include "jni_internal.h"
#include "leb128.h"
#include "linear_alloc.h"
@@ -96,6 +96,7 @@
#include "object_lock.h"
#include "os.h"
#include "runtime.h"
+#include "runtime_callbacks.h"
#include "ScopedLocalRef.h"
#include "scoped_thread_state_change-inl.h"
#include "thread-inl.h"
@@ -351,7 +352,7 @@ ClassLinker::ClassLinker(InternTable* intern_table)
array_iftable_(nullptr),
find_array_class_cache_next_victim_(0),
init_done_(false),
- log_new_class_table_roots_(false),
+ log_new_roots_(false),
intern_table_(intern_table),
quick_resolution_trampoline_(nullptr),
quick_imt_conflict_trampoline_(nullptr),
@@ -1099,23 +1100,7 @@ class FixupArtMethodArrayVisitor : public ArtMethodVisitor {
explicit FixupArtMethodArrayVisitor(const ImageHeader& header) : header_(header) {}
virtual void Visit(ArtMethod* method) REQUIRES_SHARED(Locks::mutator_lock_) {
- GcRoot<mirror::Class>* resolved_types = method->GetDexCacheResolvedTypes(kRuntimePointerSize);
const bool is_copied = method->IsCopied();
- if (resolved_types != nullptr) {
- bool in_image_space = false;
- if (kIsDebugBuild || is_copied) {
- in_image_space = header_.GetImageSection(ImageHeader::kSectionDexCacheArrays).Contains(
- reinterpret_cast<const uint8_t*>(resolved_types) - header_.GetImageBegin());
- }
- // Must be in image space for non-miranda method.
- DCHECK(is_copied || in_image_space)
- << resolved_types << " is not in image starting at "
- << reinterpret_cast<void*>(header_.GetImageBegin());
- if (!is_copied || in_image_space) {
- method->SetDexCacheResolvedTypes(method->GetDexCache()->GetResolvedTypes(),
- kRuntimePointerSize);
- }
- }
ArtMethod** resolved_methods = method->GetDexCacheResolvedMethods(kRuntimePointerSize);
if (resolved_methods != nullptr) {
bool in_image_space = false;
@@ -1865,12 +1850,10 @@ bool ClassLinker::AddImageSpace(
<< reinterpret_cast<const void*>(section_end);
}
}
- if (!oat_file->GetBssGcRoots().empty()) {
- // Insert oat file to class table for visiting .bss GC roots.
- class_table->InsertOatFile(oat_file);
- }
- } else {
- DCHECK(oat_file->GetBssGcRoots().empty());
+ }
+ if (!oat_file->GetBssGcRoots().empty()) {
+ // Insert oat file to class table for visiting .bss GC roots.
+ class_table->InsertOatFile(oat_file);
}
if (added_class_table) {
WriterMutexLock mu(self, *Locks::classlinker_classes_lock_);
@@ -1934,14 +1917,27 @@ void ClassLinker::VisitClassRoots(RootVisitor* visitor, VisitRootFlags flags) {
// Concurrent moving GC marked new roots through the to-space invariant.
CHECK_EQ(new_ref, old_ref);
}
+ for (const OatFile* oat_file : new_bss_roots_boot_oat_files_) {
+ for (GcRoot<mirror::Object>& root : oat_file->GetBssGcRoots()) {
+ ObjPtr<mirror::Object> old_ref = root.Read<kWithoutReadBarrier>();
+ if (old_ref != nullptr) {
+ DCHECK(old_ref->IsClass());
+ root.VisitRoot(visitor, RootInfo(kRootStickyClass));
+ ObjPtr<mirror::Object> new_ref = root.Read<kWithoutReadBarrier>();
+ // Concurrent moving GC marked new roots through the to-space invariant.
+ CHECK_EQ(new_ref, old_ref);
+ }
+ }
+ }
}
if ((flags & kVisitRootFlagClearRootLog) != 0) {
new_class_roots_.clear();
+ new_bss_roots_boot_oat_files_.clear();
}
if ((flags & kVisitRootFlagStartLoggingNewRoots) != 0) {
- log_new_class_table_roots_ = true;
+ log_new_roots_ = true;
} else if ((flags & kVisitRootFlagStopLoggingNewRoots) != 0) {
- log_new_class_table_roots_ = false;
+ log_new_roots_ = false;
}
// We deliberately ignore the class roots in the image since we
// handle image roots by using the MS/CMS rescanning of dirty cards.
@@ -2683,6 +2679,11 @@ mirror::Class* ClassLinker::DefineClass(Thread* self,
return nullptr;
}
CHECK(klass->IsLoaded());
+
+ // At this point the class is loaded. Publish a ClassLoad even.
+ // Note: this may be a temporary class. It is a listener's responsibility to handle this.
+ Runtime::Current()->GetRuntimeCallbacks()->ClassLoad(klass);
+
// Link the class (if necessary)
CHECK(!klass->IsResolved());
// TODO: Use fast jobjects?
@@ -2700,10 +2701,6 @@ mirror::Class* ClassLinker::DefineClass(Thread* self,
CHECK(h_new_class.Get() != nullptr) << descriptor;
CHECK(h_new_class->IsResolved()) << descriptor;
- // Update the dex cache of where the class is defined. Inlining depends on having
- // this filled.
- h_new_class->GetDexCache()->SetResolvedType(h_new_class->GetDexTypeIndex(), h_new_class.Get());
-
// Instrumentation may have updated entrypoints for all methods of all
// classes. However it could not update methods of this class while we
// were loading it. Now the class is resolved, we can update entrypoints
@@ -2727,7 +2724,7 @@ mirror::Class* ClassLinker::DefineClass(Thread* self,
* The class has been prepared and resolved but possibly not yet verified
* at this point.
*/
- Dbg::PostClassPrepare(h_new_class.Get());
+ Runtime::Current()->GetRuntimeCallbacks()->ClassPrepare(klass, h_new_class);
// Notify native debugger of the new class and its layout.
jit::Jit::NewTypeLoadedIfUsingJit(h_new_class.Get());
@@ -3200,7 +3197,6 @@ void ClassLinker::LoadMethod(const DexFile& dex_file,
dst->SetCodeItemOffset(it.GetMethodCodeItemOffset());
dst->SetDexCacheResolvedMethods(klass->GetDexCache()->GetResolvedMethods(), image_pointer_size_);
- dst->SetDexCacheResolvedTypes(klass->GetDexCache()->GetResolvedTypes(), image_pointer_size_);
uint32_t access_flags = it.GetMethodAccessFlags();
@@ -3296,7 +3292,7 @@ void ClassLinker::RegisterDexFileLocked(const DexFile& dex_file,
DexCacheData data;
data.weak_root = dex_cache_jweak;
data.dex_file = dex_cache->GetDexFile();
- data.resolved_types = dex_cache->GetResolvedTypes();
+ data.resolved_methods = dex_cache->GetResolvedMethods();
dex_caches_.push_back(data);
}
@@ -3307,6 +3303,7 @@ mirror::DexCache* ClassLinker::RegisterDexFile(const DexFile& dex_file,
ReaderMutexLock mu(self, *Locks::dex_lock_);
ObjPtr<mirror::DexCache> dex_cache = FindDexCacheLocked(self, dex_file, true);
if (dex_cache != nullptr) {
+ // TODO: Check if the dex file was registered with the same class loader. Bug: 34193123
return dex_cache.Ptr();
}
}
@@ -3651,7 +3648,7 @@ mirror::Class* ClassLinker::InsertClass(const char* descriptor, ObjPtr<mirror::C
// This is necessary because we need to have the card dirtied for remembered sets.
Runtime::Current()->GetHeap()->WriteBarrierEveryFieldOf(class_loader);
}
- if (log_new_class_table_roots_) {
+ if (log_new_roots_) {
new_class_roots_.push_back(GcRoot<mirror::Class>(klass));
}
}
@@ -3664,6 +3661,14 @@ mirror::Class* ClassLinker::InsertClass(const char* descriptor, ObjPtr<mirror::C
return nullptr;
}
+void ClassLinker::WriteBarrierForBootOatFileBssRoots(const OatFile* oat_file) {
+ WriterMutexLock mu(Thread::Current(), *Locks::classlinker_classes_lock_);
+ DCHECK(!oat_file->GetBssGcRoots().empty()) << oat_file->GetLocation();
+ if (log_new_roots_ && !ContainsElement(new_bss_roots_boot_oat_files_, oat_file)) {
+ new_bss_roots_boot_oat_files_.push_back(oat_file);
+ }
+}
+
// TODO This should really be in mirror::Class.
void ClassLinker::UpdateClassMethods(ObjPtr<mirror::Class> klass,
LengthPrefixedArray<ArtMethod>* new_methods) {
@@ -4349,7 +4354,6 @@ void ClassLinker::CheckProxyMethod(ArtMethod* method, ArtMethod* prototype) cons
// The proxy method doesn't have its own dex cache or dex file and so it steals those of its
// interface prototype. The exception to this are Constructors and the Class of the Proxy itself.
CHECK(prototype->HasSameDexCacheResolvedMethods(method, image_pointer_size_));
- CHECK(prototype->HasSameDexCacheResolvedTypes(method, image_pointer_size_));
auto* np = method->GetInterfaceMethodIfProxy(image_pointer_size_);
CHECK_EQ(prototype->GetDeclaringClass()->GetDexCache(), np->GetDexCache());
CHECK_EQ(prototype->GetDexMethodIndex(), method->GetDexMethodIndex());
@@ -4357,8 +4361,7 @@ void ClassLinker::CheckProxyMethod(ArtMethod* method, ArtMethod* prototype) cons
CHECK_STREQ(np->GetName(), prototype->GetName());
CHECK_STREQ(np->GetShorty(), prototype->GetShorty());
// More complex sanity - via dex cache
- CHECK_EQ(np->GetReturnType(true /* resolve */, image_pointer_size_),
- prototype->GetReturnType(true /* resolve */, image_pointer_size_));
+ CHECK_EQ(np->GetReturnType(true /* resolve */), prototype->GetReturnType(true /* resolve */));
}
bool ClassLinker::CanWeInitializeClass(ObjPtr<mirror::Class> klass, bool can_init_statics,
@@ -4820,7 +4823,6 @@ static void ThrowSignatureMismatch(Handle<mirror::Class> klass,
}
static bool HasSameSignatureWithDifferentClassLoaders(Thread* self,
- PointerSize pointer_size,
Handle<mirror::Class> klass,
Handle<mirror::Class> super_klass,
ArtMethod* method1,
@@ -4828,14 +4830,12 @@ static bool HasSameSignatureWithDifferentClassLoaders(Thread* self,
REQUIRES_SHARED(Locks::mutator_lock_) {
{
StackHandleScope<1> hs(self);
- Handle<mirror::Class> return_type(hs.NewHandle(method1->GetReturnType(true /* resolve */,
- pointer_size)));
+ Handle<mirror::Class> return_type(hs.NewHandle(method1->GetReturnType(true /* resolve */)));
if (UNLIKELY(return_type.Get() == nullptr)) {
ThrowSignatureCheckResolveReturnTypeException(klass, super_klass, method1, method1);
return false;
}
- ObjPtr<mirror::Class> other_return_type = method2->GetReturnType(true /* resolve */,
- pointer_size);
+ ObjPtr<mirror::Class> other_return_type = method2->GetReturnType(true /* resolve */);
if (UNLIKELY(other_return_type == nullptr)) {
ThrowSignatureCheckResolveReturnTypeException(klass, super_klass, method1, method2);
return false;
@@ -4880,7 +4880,7 @@ static bool HasSameSignatureWithDifferentClassLoaders(Thread* self,
StackHandleScope<1> hs(self);
dex::TypeIndex param_type_idx = types1->GetTypeItem(i).type_idx_;
Handle<mirror::Class> param_type(hs.NewHandle(
- method1->GetClassFromTypeIndex(param_type_idx, true /* resolve */, pointer_size)));
+ method1->GetClassFromTypeIndex(param_type_idx, true /* resolve */)));
if (UNLIKELY(param_type.Get() == nullptr)) {
ThrowSignatureCheckResolveArgException(klass, super_klass, method1,
method1, i, param_type_idx);
@@ -4888,7 +4888,7 @@ static bool HasSameSignatureWithDifferentClassLoaders(Thread* self,
}
dex::TypeIndex other_param_type_idx = types2->GetTypeItem(i).type_idx_;
ObjPtr<mirror::Class> other_param_type =
- method2->GetClassFromTypeIndex(other_param_type_idx, true /* resolve */, pointer_size);
+ method2->GetClassFromTypeIndex(other_param_type_idx, true /* resolve */);
if (UNLIKELY(other_param_type == nullptr)) {
ThrowSignatureCheckResolveArgException(klass, super_klass, method1,
method2, i, other_param_type_idx);
@@ -4924,9 +4924,11 @@ bool ClassLinker::ValidateSuperClassDescriptors(Handle<mirror::Class> klass) {
auto* m = klass->GetVTableEntry(i, image_pointer_size_);
auto* super_m = klass->GetSuperClass()->GetVTableEntry(i, image_pointer_size_);
if (m != super_m) {
- if (UNLIKELY(!HasSameSignatureWithDifferentClassLoaders(self, image_pointer_size_,
- klass, super_klass,
- m, super_m))) {
+ if (UNLIKELY(!HasSameSignatureWithDifferentClassLoaders(self,
+ klass,
+ super_klass,
+ m,
+ super_m))) {
self->AssertPendingException();
return false;
}
@@ -4942,9 +4944,11 @@ bool ClassLinker::ValidateSuperClassDescriptors(Handle<mirror::Class> klass) {
j, image_pointer_size_);
auto* super_m = super_klass->GetVirtualMethod(j, image_pointer_size_);
if (m != super_m) {
- if (UNLIKELY(!HasSameSignatureWithDifferentClassLoaders(self, image_pointer_size_,
- klass, super_klass,
- m, super_m))) {
+ if (UNLIKELY(!HasSameSignatureWithDifferentClassLoaders(self,
+ klass,
+ super_klass,
+ m,
+ super_m))) {
self->AssertPendingException();
return false;
}
@@ -5161,7 +5165,7 @@ bool ClassLinker::LinkClass(Thread* self,
Runtime::Current()->GetHeap()->WriteBarrierEveryFieldOf(class_loader);
}
CHECK_EQ(existing, klass.Get());
- if (log_new_class_table_roots_) {
+ if (log_new_roots_) {
new_class_roots_.push_back(GcRoot<mirror::Class>(h_new_class.Get()));
}
}
diff --git a/runtime/class_linker.h b/runtime/class_linker.h
index 77322ede08..8da979b36f 100644
--- a/runtime/class_linker.h
+++ b/runtime/class_linker.h
@@ -34,6 +34,7 @@
#include "dex_file.h"
#include "dex_file_types.h"
#include "gc_root.h"
+#include "handle.h"
#include "jni.h"
#include "mirror/class.h"
#include "object_callbacks.h"
@@ -64,6 +65,7 @@ class ImtConflictTable;
template<typename T> class LengthPrefixedArray;
template<class T> class MutableHandle;
class InternTable;
+class OatFile;
template<class T> class ObjectLock;
class Runtime;
class ScopedObjectAccessAlreadyRunnable;
@@ -535,6 +537,12 @@ class ClassLinker {
REQUIRES(!Locks::classlinker_classes_lock_)
REQUIRES_SHARED(Locks::mutator_lock_);
+ // Add an oat file with .bss GC roots to be visited again at the end of GC
+ // for collector types that need it.
+ void WriteBarrierForBootOatFileBssRoots(const OatFile* oat_file)
+ REQUIRES(!Locks::classlinker_classes_lock_)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
mirror::ObjectArray<mirror::Class>* GetClassRoots() REQUIRES_SHARED(Locks::mutator_lock_) {
mirror::ObjectArray<mirror::Class>* class_roots = class_roots_.Read();
DCHECK(class_roots != nullptr);
@@ -638,6 +646,14 @@ class ClassLinker {
mirror::Class* GetHoldingClassOfCopiedMethod(ArtMethod* method)
REQUIRES_SHARED(Locks::mutator_lock_);
+ // Returns null if not found.
+ ClassTable* ClassTableForClassLoader(ObjPtr<mirror::ClassLoader> class_loader)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
+ void AppendToBootClassPath(Thread* self, const DexFile& dex_file)
+ REQUIRES_SHARED(Locks::mutator_lock_)
+ REQUIRES(!Locks::dex_lock_);
+
struct DexCacheData {
// Weak root to the DexCache. Note: Do not decode this unnecessarily or else class unloading may
// not work properly.
@@ -646,7 +662,7 @@ class ClassLinker {
// jweak decode that triggers read barriers (and mark them alive unnecessarily and mess with
// class unloading.)
const DexFile* dex_file;
- GcRoot<mirror::Class>* resolved_types;
+ ArtMethod** resolved_methods;
};
private:
@@ -733,9 +749,6 @@ class ClassLinker {
REQUIRES_SHARED(Locks::mutator_lock_)
REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_);
- void AppendToBootClassPath(Thread* self, const DexFile& dex_file)
- REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!Locks::dex_lock_);
void AppendToBootClassPath(const DexFile& dex_file, Handle<mirror::DexCache> dex_cache)
REQUIRES_SHARED(Locks::mutator_lock_)
REQUIRES(!Locks::dex_lock_);
@@ -1032,10 +1045,6 @@ class ClassLinker {
REQUIRES_SHARED(Locks::mutator_lock_)
REQUIRES(Locks::classlinker_classes_lock_);
- // Returns null if not found.
- ClassTable* ClassTableForClassLoader(ObjPtr<mirror::ClassLoader> class_loader)
- REQUIRES_SHARED(Locks::mutator_lock_);
-
// Insert a new class table if not found.
ClassTable* InsertClassTableForClassLoader(ObjPtr<mirror::ClassLoader> class_loader)
REQUIRES_SHARED(Locks::mutator_lock_)
@@ -1138,6 +1147,10 @@ class ClassLinker {
// New class roots, only used by CMS since the GC needs to mark these in the pause.
std::vector<GcRoot<mirror::Class>> new_class_roots_ GUARDED_BY(Locks::classlinker_classes_lock_);
+ // Boot image oat files with new .bss GC roots to be visited in the pause by CMS.
+ std::vector<const OatFile*> new_bss_roots_boot_oat_files_
+ GUARDED_BY(Locks::classlinker_classes_lock_);
+
// Number of times we've searched dex caches for a class. After a certain number of misses we move
// the classes into the class_table_ to avoid dex cache based searches.
Atomic<uint32_t> failed_dex_cache_class_lookups_;
@@ -1155,7 +1168,7 @@ class ClassLinker {
size_t find_array_class_cache_next_victim_;
bool init_done_;
- bool log_new_class_table_roots_ GUARDED_BY(Locks::classlinker_classes_lock_);
+ bool log_new_roots_ GUARDED_BY(Locks::classlinker_classes_lock_);
InternTable* intern_table_;
@@ -1182,6 +1195,21 @@ class ClassLinker {
DISALLOW_COPY_AND_ASSIGN(ClassLinker);
};
+class ClassLoadCallback {
+ public:
+ virtual ~ClassLoadCallback() {}
+
+ // A class has been loaded.
+ // Note: the class may be temporary, in which case a following ClassPrepare event will be a
+ // different object. It is the listener's responsibility to handle this.
+ virtual void ClassLoad(Handle<mirror::Class> klass) REQUIRES_SHARED(Locks::mutator_lock_) = 0;
+
+ // A class has been prepared, i.e., resolved. As the ClassLoad event might have been for a
+ // temporary class, provide both the former and the current class.
+ virtual void ClassPrepare(Handle<mirror::Class> temp_klass,
+ Handle<mirror::Class> klass) REQUIRES_SHARED(Locks::mutator_lock_) = 0;
+};
+
} // namespace art
#endif // ART_RUNTIME_CLASS_LINKER_H_
diff --git a/runtime/class_linker_test.cc b/runtime/class_linker_test.cc
index 42108d8621..d98daa51fe 100644
--- a/runtime/class_linker_test.cc
+++ b/runtime/class_linker_test.cc
@@ -242,13 +242,9 @@ class ClassLinkerTest : public CommonRuntimeTest {
EXPECT_TRUE(method->GetSignature() != Signature::NoSignature());
EXPECT_TRUE(method->HasDexCacheResolvedMethods(kRuntimePointerSize));
- EXPECT_TRUE(method->HasDexCacheResolvedTypes(kRuntimePointerSize));
EXPECT_TRUE(method->HasSameDexCacheResolvedMethods(
method->GetDeclaringClass()->GetDexCache()->GetResolvedMethods(),
kRuntimePointerSize));
- EXPECT_TRUE(method->HasSameDexCacheResolvedTypes(
- method->GetDeclaringClass()->GetDexCache()->GetResolvedTypes(),
- kRuntimePointerSize));
}
void AssertField(ObjPtr<mirror::Class> klass, ArtField* field)
@@ -460,7 +456,6 @@ class ClassLinkerMethodHandlesTest : public ClassLinkerTest {
protected:
virtual void SetUpRuntimeOptions(RuntimeOptions* options) OVERRIDE {
CommonRuntimeTest::SetUpRuntimeOptions(options);
- options->push_back(std::make_pair("-Xexperimental:method-handles", nullptr));
}
};
@@ -617,7 +612,7 @@ struct ClassExtOffsets : public CheckOffsets<mirror::ClassExt> {
ClassExtOffsets() : CheckOffsets<mirror::ClassExt>(false, "Ldalvik/system/ClassExt;") {
addOffset(OFFSETOF_MEMBER(mirror::ClassExt, obsolete_dex_caches_), "obsoleteDexCaches");
addOffset(OFFSETOF_MEMBER(mirror::ClassExt, obsolete_methods_), "obsoleteMethods");
- addOffset(OFFSETOF_MEMBER(mirror::ClassExt, original_dex_cache_), "originalDexCache");
+ addOffset(OFFSETOF_MEMBER(mirror::ClassExt, original_dex_file_bytes_), "originalDexFile");
addOffset(OFFSETOF_MEMBER(mirror::ClassExt, verify_error_), "verifyError");
}
};
@@ -757,6 +752,7 @@ struct MethodHandleImplOffsets : public CheckOffsets<mirror::MethodHandleImpl> {
struct EmulatedStackFrameOffsets : public CheckOffsets<mirror::EmulatedStackFrame> {
EmulatedStackFrameOffsets() : CheckOffsets<mirror::EmulatedStackFrame>(
false, "Ldalvik/system/EmulatedStackFrame;") {
+ addOffset(OFFSETOF_MEMBER(mirror::EmulatedStackFrame, callsite_type_), "callsiteType");
addOffset(OFFSETOF_MEMBER(mirror::EmulatedStackFrame, references_), "references");
addOffset(OFFSETOF_MEMBER(mirror::EmulatedStackFrame, stack_frame_), "stackFrame");
addOffset(OFFSETOF_MEMBER(mirror::EmulatedStackFrame, type_), "type");
@@ -899,7 +895,6 @@ TEST_F(ClassLinkerTest, LookupResolvedType) {
dex::TypeIndex type_idx = klass->GetClassDef()->class_idx_;
ObjPtr<mirror::DexCache> dex_cache = klass->GetDexCache();
const DexFile& dex_file = klass->GetDexFile();
- EXPECT_OBJ_PTR_EQ(dex_cache->GetResolvedType(type_idx), klass);
EXPECT_OBJ_PTR_EQ(
class_linker_->LookupResolvedType(dex_file, type_idx, dex_cache, class_loader.Get()),
klass);
diff --git a/runtime/common_runtime_test.cc b/runtime/common_runtime_test.cc
index 743fcc87eb..fc82264b6a 100644
--- a/runtime/common_runtime_test.cc
+++ b/runtime/common_runtime_test.cc
@@ -133,7 +133,9 @@ void ScratchFile::Unlink() {
static bool unstarted_initialized_ = false;
-CommonRuntimeTestImpl::CommonRuntimeTestImpl() {}
+CommonRuntimeTestImpl::CommonRuntimeTestImpl()
+ : class_linker_(nullptr), java_lang_dex_file_(nullptr) {
+}
CommonRuntimeTestImpl::~CommonRuntimeTestImpl() {
// Ensure the dex files are cleaned up before the runtime.
@@ -425,7 +427,9 @@ void CommonRuntimeTestImpl::TearDown() {
TearDownAndroidData(android_data_, true);
dalvik_cache_.clear();
- Runtime::Current()->GetHeap()->VerifyHeap(); // Check for heap corruption after the test
+ if (runtime_ != nullptr) {
+ runtime_->GetHeap()->VerifyHeap(); // Check for heap corruption after the test
+ }
}
static std::string GetDexFileName(const std::string& jar_prefix, bool host) {
diff --git a/runtime/common_throws.cc b/runtime/common_throws.cc
index c30272e114..a44f79e193 100644
--- a/runtime/common_throws.cc
+++ b/runtime/common_throws.cc
@@ -428,6 +428,8 @@ static bool IsValidImplicitCheck(uintptr_t addr, ArtMethod* method, const Instru
case Instruction::INVOKE_VIRTUAL_RANGE:
case Instruction::INVOKE_INTERFACE:
case Instruction::INVOKE_INTERFACE_RANGE:
+ case Instruction::INVOKE_POLYMORPHIC:
+ case Instruction::INVOKE_POLYMORPHIC_RANGE:
case Instruction::INVOKE_VIRTUAL_QUICK:
case Instruction::INVOKE_VIRTUAL_RANGE_QUICK: {
// Without inlining, we could just check that the offset is the class offset.
@@ -551,6 +553,12 @@ void ThrowNullPointerExceptionFromDexPC(bool check_address, uintptr_t addr) {
case Instruction::INVOKE_INTERFACE_RANGE:
ThrowNullPointerExceptionForMethodAccess(instr->VRegB_3rc(), kInterface);
break;
+ case Instruction::INVOKE_POLYMORPHIC:
+ ThrowNullPointerExceptionForMethodAccess(instr->VRegB_45cc(), kVirtual);
+ break;
+ case Instruction::INVOKE_POLYMORPHIC_RANGE:
+ ThrowNullPointerExceptionForMethodAccess(instr->VRegB_4rcc(), kVirtual);
+ break;
case Instruction::INVOKE_VIRTUAL_QUICK:
case Instruction::INVOKE_VIRTUAL_RANGE_QUICK: {
// Since we replaced the method index, we ask the verifier to tell us which
diff --git a/runtime/debugger.cc b/runtime/debugger.cc
index df4413d52c..22a31635a6 100644
--- a/runtime/debugger.cc
+++ b/runtime/debugger.cc
@@ -320,6 +320,9 @@ size_t Dbg::field_write_event_ref_count_ = 0;
size_t Dbg::exception_catch_event_ref_count_ = 0;
uint32_t Dbg::instrumentation_events_ = 0;
+Dbg::DbgThreadLifecycleCallback Dbg::thread_lifecycle_callback_;
+Dbg::DbgClassLoadCallback Dbg::class_load_callback_;
+
// Breakpoints.
static std::vector<Breakpoint> gBreakpoints GUARDED_BY(Locks::breakpoint_lock_);
@@ -3985,9 +3988,7 @@ JDWP::JdwpError Dbg::PrepareInvokeMethod(uint32_t request_id, JDWP::ObjectId thr
if (shorty[i + 1] == 'L') {
// Did we really get an argument of an appropriate reference type?
mirror::Class* parameter_type =
- m->GetClassFromTypeIndex(types->GetTypeItem(i).type_idx_,
- true /* resolve */,
- kRuntimePointerSize);
+ m->GetClassFromTypeIndex(types->GetTypeItem(i).type_idx_, true /* resolve */);
mirror::Object* argument = gRegistry->Get<mirror::Object*>(arg_values[i], &error);
if (error != JDWP::ERR_NONE) {
return JDWP::ERR_INVALID_OBJECT;
@@ -5137,4 +5138,20 @@ void Dbg::VisitRoots(RootVisitor* visitor) {
}
}
+void Dbg::DbgThreadLifecycleCallback::ThreadStart(Thread* self) {
+ Dbg::PostThreadStart(self);
+}
+
+void Dbg::DbgThreadLifecycleCallback::ThreadDeath(Thread* self) {
+ Dbg::PostThreadDeath(self);
+}
+
+void Dbg::DbgClassLoadCallback::ClassLoad(Handle<mirror::Class> klass ATTRIBUTE_UNUSED) {
+ // Ignore ClassLoad;
+}
+void Dbg::DbgClassLoadCallback::ClassPrepare(Handle<mirror::Class> temp_klass ATTRIBUTE_UNUSED,
+ Handle<mirror::Class> klass) {
+ Dbg::PostClassPrepare(klass.Get());
+}
+
} // namespace art
diff --git a/runtime/debugger.h b/runtime/debugger.h
index 3b4a5e16b0..a7fd1605df 100644
--- a/runtime/debugger.h
+++ b/runtime/debugger.h
@@ -28,6 +28,8 @@
#include <vector>
#include "gc_root.h"
+#include "class_linker.h"
+#include "handle.h"
#include "jdwp/jdwp.h"
#include "jni.h"
#include "jvalue.h"
@@ -502,12 +504,6 @@ class Dbg {
REQUIRES_SHARED(Locks::mutator_lock_);
static void PostException(mirror::Throwable* exception)
REQUIRES_SHARED(Locks::mutator_lock_);
- static void PostThreadStart(Thread* t)
- REQUIRES_SHARED(Locks::mutator_lock_);
- static void PostThreadDeath(Thread* t)
- REQUIRES_SHARED(Locks::mutator_lock_);
- static void PostClassPrepare(mirror::Class* c)
- REQUIRES_SHARED(Locks::mutator_lock_);
static void UpdateDebugger(Thread* thread, mirror::Object* this_object,
ArtMethod* method, uint32_t new_dex_pc,
@@ -707,6 +703,13 @@ class Dbg {
return instrumentation_events_;
}
+ static ThreadLifecycleCallback* GetThreadLifecycleCallback() {
+ return &thread_lifecycle_callback_;
+ }
+ static ClassLoadCallback* GetClassLoadCallback() {
+ return &class_load_callback_;
+ }
+
private:
static void ExecuteMethodWithoutPendingException(ScopedObjectAccess& soa, DebugInvokeReq* pReq)
REQUIRES_SHARED(Locks::mutator_lock_);
@@ -725,9 +728,17 @@ class Dbg {
REQUIRES(!Locks::thread_list_lock_) REQUIRES_SHARED(Locks::mutator_lock_);
static void DdmBroadcast(bool connect) REQUIRES_SHARED(Locks::mutator_lock_);
+
+ static void PostThreadStart(Thread* t)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+ static void PostThreadDeath(Thread* t)
+ REQUIRES_SHARED(Locks::mutator_lock_);
static void PostThreadStartOrStop(Thread*, uint32_t)
REQUIRES_SHARED(Locks::mutator_lock_);
+ static void PostClassPrepare(mirror::Class* c)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
static void PostLocationEvent(ArtMethod* method, int pcOffset,
mirror::Object* thisPtr, int eventFlags,
const JValue* return_value)
@@ -789,6 +800,22 @@ class Dbg {
static size_t exception_catch_event_ref_count_ GUARDED_BY(Locks::deoptimization_lock_);
static uint32_t instrumentation_events_ GUARDED_BY(Locks::mutator_lock_);
+ class DbgThreadLifecycleCallback : public ThreadLifecycleCallback {
+ public:
+ void ThreadStart(Thread* self) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_);
+ void ThreadDeath(Thread* self) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_);
+ };
+
+ class DbgClassLoadCallback : public ClassLoadCallback {
+ public:
+ void ClassLoad(Handle<mirror::Class> klass) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_);
+ void ClassPrepare(Handle<mirror::Class> temp_klass,
+ Handle<mirror::Class> klass) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_);
+ };
+
+ static DbgThreadLifecycleCallback thread_lifecycle_callback_;
+ static DbgClassLoadCallback class_load_callback_;
+
DISALLOW_COPY_AND_ASSIGN(Dbg);
};
diff --git a/runtime/dex2oat_environment_test.h b/runtime/dex2oat_environment_test.h
index b0c4597d73..7ae9f03c83 100644
--- a/runtime/dex2oat_environment_test.h
+++ b/runtime/dex2oat_environment_test.h
@@ -160,7 +160,7 @@ class Dex2oatEnvironmentTest : public CommonRuntimeTest {
// image at GetImageLocation(). This is used for testing mismatched
// image checksums in the oat_file_assistant_tests.
std::string GetImageLocation2() const {
- return GetImageDirectory() + "/core-npic.art";
+ return GetImageDirectory() + "/core-interpreter.art";
}
std::string GetDexSrc1() const {
diff --git a/runtime/dex_file.cc b/runtime/dex_file.cc
index 7d704ad0cc..f59420d332 100644
--- a/runtime/dex_file.cc
+++ b/runtime/dex_file.cc
@@ -1274,6 +1274,16 @@ std::string Signature::ToString() const {
return result;
}
+uint32_t Signature::GetNumberOfParameters() const {
+ const DexFile::TypeList* params = dex_file_->GetProtoParameters(*proto_id_);
+ return (params != nullptr) ? params->Size() : 0;
+}
+
+bool Signature::IsVoid() const {
+ const char* return_type = dex_file_->GetReturnTypeDescriptor(*proto_id_);
+ return strcmp(return_type, "V") == 0;
+}
+
bool Signature::operator==(const StringPiece& rhs) const {
if (dex_file_ == nullptr) {
return false;
diff --git a/runtime/dex_file.h b/runtime/dex_file.h
index 250795b21d..cb7f174787 100644
--- a/runtime/dex_file.h
+++ b/runtime/dex_file.h
@@ -1197,6 +1197,9 @@ class Signature : public ValueObject {
return Signature();
}
+ bool IsVoid() const;
+ uint32_t GetNumberOfParameters() const;
+
bool operator==(const Signature& rhs) const;
bool operator!=(const Signature& rhs) const {
return !(*this == rhs);
diff --git a/runtime/dex_file_annotations.cc b/runtime/dex_file_annotations.cc
index 9504e8bd29..16a447b0a6 100644
--- a/runtime/dex_file_annotations.cc
+++ b/runtime/dex_file_annotations.cc
@@ -608,7 +608,7 @@ mirror::Object* CreateAnnotationMember(Handle<mirror::Class> klass,
return nullptr;
}
Handle<mirror::Class> method_return(hs.NewHandle(
- annotation_method->GetReturnType(true /* resolve */, pointer_size)));
+ annotation_method->GetReturnType(true /* resolve */)));
DexFile::AnnotationValue annotation_value;
if (!ProcessAnnotationValue(klass, annotation, &annotation_value, method_return,
@@ -948,9 +948,7 @@ mirror::Object* GetAnnotationDefaultValue(ArtMethod* method) {
DexFile::AnnotationValue annotation_value;
StackHandleScope<2> hs(Thread::Current());
Handle<mirror::Class> h_klass(hs.NewHandle(klass));
- PointerSize pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
- Handle<mirror::Class> return_type(hs.NewHandle(
- method->GetReturnType(true /* resolve */, pointer_size)));
+ Handle<mirror::Class> return_type(hs.NewHandle(method->GetReturnType(true /* resolve */)));
if (!ProcessAnnotationValue(h_klass, &annotation, &annotation_value, return_type,
DexFile::kAllObjects)) {
return nullptr;
diff --git a/runtime/dex_file_verifier.cc b/runtime/dex_file_verifier.cc
index a3ab9fa5bd..318123edcd 100644
--- a/runtime/dex_file_verifier.cc
+++ b/runtime/dex_file_verifier.cc
@@ -91,6 +91,66 @@ const char* DexFileVerifier::CheckLoadStringByIdx(dex::StringIndex idx, const ch
return dex_file_->StringDataByIdx(idx);
}
+// Try to find the name of the method with the given index. We do not want to rely on DexFile
+// infrastructure at this point, so do it all by hand. begin and header correspond to begin_ and
+// header_ of the DexFileVerifier. str will contain the pointer to the method name on success
+// (flagged by the return value), otherwise error_msg will contain an error string.
+static bool FindMethodName(uint32_t method_index,
+ const uint8_t* begin,
+ const DexFile::Header* header,
+ const char** str,
+ std::string* error_msg) {
+ if (method_index >= header->method_ids_size_) {
+ *error_msg = "Method index not available for method flags verification";
+ return false;
+ }
+ uint32_t string_idx =
+ (reinterpret_cast<const DexFile::MethodId*>(begin + header->method_ids_off_) +
+ method_index)->name_idx_.index_;
+ if (string_idx >= header->string_ids_size_) {
+ *error_msg = "String index not available for method flags verification";
+ return false;
+ }
+ uint32_t string_off =
+ (reinterpret_cast<const DexFile::StringId*>(begin + header->string_ids_off_) + string_idx)->
+ string_data_off_;
+ if (string_off >= header->file_size_) {
+ *error_msg = "String offset out of bounds for method flags verification";
+ return false;
+ }
+ const uint8_t* str_data_ptr = begin + string_off;
+ uint32_t dummy;
+ if (!DecodeUnsignedLeb128Checked(&str_data_ptr, begin + header->file_size_, &dummy)) {
+ *error_msg = "String size out of bounds for method flags verification";
+ return false;
+ }
+ *str = reinterpret_cast<const char*>(str_data_ptr);
+ return true;
+}
+
+// Gets constructor flags based on the |method_name|. Returns true if
+// method_name is either <clinit> or <init> and sets
+// |constructor_flags_by_name| appropriately. Otherwise set
+// |constructor_flags_by_name| to zero and returns whether
+// |method_name| is valid.
+bool GetConstructorFlagsForMethodName(const char* method_name,
+ uint32_t* constructor_flags_by_name) {
+ if (method_name[0] != '<') {
+ *constructor_flags_by_name = 0;
+ return true;
+ }
+ if (strcmp(method_name + 1, "clinit>") == 0) {
+ *constructor_flags_by_name = kAccStatic | kAccConstructor;
+ return true;
+ }
+ if (strcmp(method_name + 1, "init>") == 0) {
+ *constructor_flags_by_name = kAccConstructor;
+ return true;
+ }
+ *constructor_flags_by_name = 0;
+ return false;
+}
+
const char* DexFileVerifier::CheckLoadStringByTypeIdx(dex::TypeIndex type_idx,
const char* error_string) {
if (UNLIKELY(!CheckIndex(type_idx.index_, dex_file_->NumTypeIds(), error_string))) {
@@ -113,6 +173,13 @@ const DexFile::MethodId* DexFileVerifier::CheckLoadMethodId(uint32_t idx, const
return &dex_file_->GetMethodId(idx);
}
+const DexFile::ProtoId* DexFileVerifier::CheckLoadProtoId(uint32_t idx, const char* err_string) {
+ if (UNLIKELY(!CheckIndex(idx, dex_file_->NumProtoIds(), err_string))) {
+ return nullptr;
+ }
+ return &dex_file_->GetProtoId(idx);
+}
+
// Helper macro to load string and return false on error.
#define LOAD_STRING(var, idx, error) \
const char* (var) = CheckLoadStringByIdx(idx, error); \
@@ -606,12 +673,24 @@ bool DexFileVerifier::CheckClassDataItemMethod(uint32_t idx,
return false;
}
- // Check method access flags.
- bool has_code = (code_offset != 0);
std::string error_msg;
+ const char* method_name;
+ if (!FindMethodName(idx, begin_, header_, &method_name, &error_msg)) {
+ ErrorStringPrintf("%s", error_msg.c_str());
+ return false;
+ }
+
+ uint32_t constructor_flags_by_name = 0;
+ if (!GetConstructorFlagsForMethodName(method_name, &constructor_flags_by_name)) {
+ ErrorStringPrintf("Bad method name: %s", method_name);
+ return false;
+ }
+
+ bool has_code = (code_offset != 0);
if (!CheckMethodAccessFlags(idx,
access_flags,
class_access_flags,
+ constructor_flags_by_name,
has_code,
expect_direct,
&error_msg)) {
@@ -619,6 +698,13 @@ bool DexFileVerifier::CheckClassDataItemMethod(uint32_t idx,
return false;
}
+ if (constructor_flags_by_name != 0) {
+ if (!CheckConstructorProperties(idx, constructor_flags_by_name)) {
+ DCHECK(FailureReasonIsSet());
+ return false;
+ }
+ }
+
return true;
}
@@ -2653,46 +2739,10 @@ bool DexFileVerifier::CheckFieldAccessFlags(uint32_t idx,
return true;
}
-// Try to find the name of the method with the given index. We do not want to rely on DexFile
-// infrastructure at this point, so do it all by hand. begin and header correspond to begin_ and
-// header_ of the DexFileVerifier. str will contain the pointer to the method name on success
-// (flagged by the return value), otherwise error_msg will contain an error string.
-static bool FindMethodName(uint32_t method_index,
- const uint8_t* begin,
- const DexFile::Header* header,
- const char** str,
- std::string* error_msg) {
- if (method_index >= header->method_ids_size_) {
- *error_msg = "Method index not available for method flags verification";
- return false;
- }
- uint32_t string_idx =
- (reinterpret_cast<const DexFile::MethodId*>(begin + header->method_ids_off_) +
- method_index)->name_idx_.index_;
- if (string_idx >= header->string_ids_size_) {
- *error_msg = "String index not available for method flags verification";
- return false;
- }
- uint32_t string_off =
- (reinterpret_cast<const DexFile::StringId*>(begin + header->string_ids_off_) + string_idx)->
- string_data_off_;
- if (string_off >= header->file_size_) {
- *error_msg = "String offset out of bounds for method flags verification";
- return false;
- }
- const uint8_t* str_data_ptr = begin + string_off;
- uint32_t dummy;
- if (!DecodeUnsignedLeb128Checked(&str_data_ptr, begin + header->file_size_, &dummy)) {
- *error_msg = "String size out of bounds for method flags verification";
- return false;
- }
- *str = reinterpret_cast<const char*>(str_data_ptr);
- return true;
-}
-
bool DexFileVerifier::CheckMethodAccessFlags(uint32_t method_index,
uint32_t method_access_flags,
uint32_t class_access_flags,
+ uint32_t constructor_flags_by_name,
bool has_code,
bool expect_direct,
std::string* error_msg) {
@@ -2728,36 +2778,23 @@ bool DexFileVerifier::CheckMethodAccessFlags(uint32_t method_index,
return false;
}
- // Try to find the name, to check for constructor properties.
- const char* str;
- if (!FindMethodName(method_index, begin_, header_, &str, error_msg)) {
- return false;
- }
- bool is_init_by_name = false;
- constexpr const char* kInitName = "<init>";
- size_t str_offset = (reinterpret_cast<const uint8_t*>(str) - begin_);
- if (header_->file_size_ - str_offset >= sizeof(kInitName)) {
- is_init_by_name = strcmp(kInitName, str) == 0;
- }
- bool is_clinit_by_name = false;
- constexpr const char* kClinitName = "<clinit>";
- if (header_->file_size_ - str_offset >= sizeof(kClinitName)) {
- is_clinit_by_name = strcmp(kClinitName, str) == 0;
- }
- bool is_constructor = is_init_by_name || is_clinit_by_name;
+ constexpr uint32_t kConstructorFlags = kAccStatic | kAccConstructor;
+ const bool is_constructor_by_name = (constructor_flags_by_name & kConstructorFlags) != 0;
+ const bool is_clinit_by_name = constructor_flags_by_name == kConstructorFlags;
// Only methods named "<clinit>" or "<init>" may be marked constructor. Note: we cannot enforce
// the reverse for backwards compatibility reasons.
- if (((method_access_flags & kAccConstructor) != 0) && !is_constructor) {
+ if (((method_access_flags & kAccConstructor) != 0) && !is_constructor_by_name) {
*error_msg =
StringPrintf("Method %" PRIu32 "(%s) is marked constructor, but doesn't match name",
- method_index,
- GetMethodDescriptionOrError(begin_, header_, method_index).c_str());
+ method_index,
+ GetMethodDescriptionOrError(begin_, header_, method_index).c_str());
return false;
}
- // Check that the static constructor (= static initializer) is named "<clinit>" and that the
- // instance constructor is called "<init>".
- if (is_constructor) {
+
+ if (is_constructor_by_name) {
+ // Check that the static constructor (= static initializer) is named "<clinit>" and that the
+ // instance constructor is called "<init>".
bool is_static = (method_access_flags & kAccStatic) != 0;
if (is_static ^ is_clinit_by_name) {
*error_msg = StringPrintf("Constructor %" PRIu32 "(%s) is not flagged correctly wrt/ static.",
@@ -2772,9 +2809,11 @@ bool DexFileVerifier::CheckMethodAccessFlags(uint32_t method_index,
}
}
}
+
// Check that static and private methods, as well as constructors, are in the direct methods list,
// and other methods in the virtual methods list.
- bool is_direct = (method_access_flags & (kAccStatic | kAccPrivate)) != 0 || is_constructor;
+ bool is_direct = ((method_access_flags & (kAccStatic | kAccPrivate)) != 0) ||
+ is_constructor_by_name;
if (is_direct != expect_direct) {
*error_msg = StringPrintf("Direct/virtual method %" PRIu32 "(%s) not in expected list %d",
method_index,
@@ -2783,7 +2822,6 @@ bool DexFileVerifier::CheckMethodAccessFlags(uint32_t method_index,
return false;
}
-
// From here on out it is easier to mask out the bits we're supposed to ignore.
method_access_flags &= kMethodAccessFlags;
@@ -2819,7 +2857,7 @@ bool DexFileVerifier::CheckMethodAccessFlags(uint32_t method_index,
return false;
}
// Constructors must always have code.
- if (is_constructor) {
+ if (is_constructor_by_name) {
*error_msg = StringPrintf("Constructor %u(%s) must not be abstract or native",
method_index,
GetMethodDescriptionOrError(begin_, header_, method_index).c_str());
@@ -2881,7 +2919,7 @@ bool DexFileVerifier::CheckMethodAccessFlags(uint32_t method_index,
}
// Instance constructors must not be synchronized and a few other flags.
- if (is_init_by_name) {
+ if (constructor_flags_by_name == kAccConstructor) {
static constexpr uint32_t kInitAllowed =
kAccPrivate | kAccProtected | kAccPublic | kAccStrict | kAccVarargs | kAccSynthetic;
if ((method_access_flags & ~kInitAllowed) != 0) {
@@ -2896,4 +2934,44 @@ bool DexFileVerifier::CheckMethodAccessFlags(uint32_t method_index,
return true;
}
+bool DexFileVerifier::CheckConstructorProperties(
+ uint32_t method_index,
+ uint32_t constructor_flags) {
+ DCHECK(constructor_flags == kAccConstructor ||
+ constructor_flags == (kAccConstructor | kAccStatic));
+
+ // Check signature matches expectations.
+ const DexFile::MethodId* const method_id = CheckLoadMethodId(method_index,
+ "Bad <init>/<clinit> method id");
+ if (method_id == nullptr) {
+ return false;
+ }
+
+ // Check the ProtoId for the corresponding method.
+ //
+ // TODO(oth): the error message here is to satisfy the MethodId test
+ // in the DexFileVerifierTest. The test is checking that the error
+ // contains this string if the index is out of range.
+ const DexFile::ProtoId* const proto_id = CheckLoadProtoId(method_id->proto_idx_,
+ "inter_method_id_item proto_idx");
+ if (proto_id == nullptr) {
+ return false;
+ }
+
+ Signature signature = dex_file_->GetMethodSignature(*method_id);
+ if (constructor_flags == (kAccStatic | kAccConstructor)) {
+ if (!signature.IsVoid() || signature.GetNumberOfParameters() != 0) {
+ ErrorStringPrintf("<clinit> must have descriptor ()V");
+ return false;
+ }
+ } else if (!signature.IsVoid()) {
+ ErrorStringPrintf("Constructor %u(%s) must be void",
+ method_index,
+ GetMethodDescriptionOrError(begin_, header_, method_index).c_str());
+ return false;
+ }
+
+ return true;
+}
+
} // namespace art
diff --git a/runtime/dex_file_verifier.h b/runtime/dex_file_verifier.h
index 0327367059..ae206132dd 100644
--- a/runtime/dex_file_verifier.h
+++ b/runtime/dex_file_verifier.h
@@ -153,13 +153,15 @@ class DexFileVerifier {
const char* CheckLoadStringByIdx(dex::StringIndex idx, const char* error_fmt);
const char* CheckLoadStringByTypeIdx(dex::TypeIndex type_idx, const char* error_fmt);
- // Load a field/method Id by index. Checks whether the index is in bounds, printing the error if
- // not. If there is an error, null is returned.
+ // Load a field/method/proto Id by index. Checks whether the index is in bounds, printing the
+ // error if not. If there is an error, null is returned.
const DexFile::FieldId* CheckLoadFieldId(uint32_t idx, const char* error_fmt);
const DexFile::MethodId* CheckLoadMethodId(uint32_t idx, const char* error_fmt);
+ const DexFile::ProtoId* CheckLoadProtoId(uint32_t idx, const char* error_fmt);
void ErrorStringPrintf(const char* fmt, ...)
__attribute__((__format__(__printf__, 2, 3))) COLD_ATTR;
+ bool FailureReasonIsSet() const { return failure_reason_.size() != 0; }
// Retrieve class index and class access flag from the given member. index is the member index,
// which is taken as either a field or a method index (as designated by is_field). The result,
@@ -177,15 +179,20 @@ class DexFileVerifier {
bool CheckFieldAccessFlags(uint32_t idx,
uint32_t field_access_flags,
uint32_t class_access_flags,
- std::string* error_msg);
+ std::string* error_message);
+
// Check validity of the given method and access flags, in the context of a class with the given
// second access flags.
bool CheckMethodAccessFlags(uint32_t method_index,
uint32_t method_access_flags,
uint32_t class_access_flags,
+ uint32_t constructor_flags_by_name,
bool has_code,
bool expect_direct,
- std::string* error_msg);
+ std::string* error_message);
+
+ // Check validity of given method if it's a constructor or class initializer.
+ bool CheckConstructorProperties(uint32_t method_index, uint32_t constructor_flags);
const DexFile* const dex_file_;
const uint8_t* const begin_;
diff --git a/runtime/dex_file_verifier_test.cc b/runtime/dex_file_verifier_test.cc
index f14b1d56cb..c56b20057d 100644
--- a/runtime/dex_file_verifier_test.cc
+++ b/runtime/dex_file_verifier_test.cc
@@ -632,12 +632,8 @@ TEST_F(DexFileVerifierTest, B28552165) {
"b28552165",
[](DexFile* dex_file) {
OrMaskToMethodFlags(dex_file, "foo", kAccPublic | kAccProtected);
- uint32_t method_idx;
- FindMethodData(dex_file, "foo", &method_idx);
- auto* method_id = const_cast<DexFile::MethodId*>(&dex_file->GetMethodId(method_idx));
- method_id->name_idx_ = dex::StringIndex(dex_file->NumStringIds());
},
- "Method may have only one of public/protected/private, LMethodFlags;.(error)");
+ "Method may have only one of public/protected/private, LMethodFlags;.foo");
}
// Set of dex files for interface method tests. As it's not as easy to mutate method names, it's
@@ -1674,4 +1670,219 @@ TEST_F(DexFileVerifierTest, Checksum) {
EXPECT_NE(error_msg.find("Bad checksum"), std::string::npos) << error_msg;
}
+TEST_F(DexFileVerifierTest, BadStaticMethodName) {
+ // Generated DEX file version (037) from:
+ //
+ // .class public LBadName;
+ // .super Ljava/lang/Object;
+ //
+ // .method public static <bad_name> (II)V
+ // .registers 2
+ // .prologue
+ // return-void
+ // .end method
+ //
+ // .method public constructor <init>()V
+ // .registers 1
+ // .prologue
+ // .line 1
+ // invoke-direct {p0}, Ljava/lang/Object;-><init>()V
+ // return-void
+ // .end method
+ //
+ static const char kDexBase64[] =
+ "ZGV4CjAzNwC2NYlwyxEc/h6hv+hMeUVQPtiX6MQBcfgwAgAAcAAAAHhWNBIAAAAAAAAAAJABAAAI"
+ "AAAAcAAAAAQAAACQAAAAAgAAAKAAAAAAAAAAAAAAAAMAAAC4AAAAAQAAANAAAABAAQAA8AAAAPAA"
+ "AAD8AAAABAEAABIBAAAVAQAAIAEAADQBAAA3AQAAAwAAAAQAAAAFAAAABgAAAAYAAAADAAAAAAAA"
+ "AAcAAAADAAAAPAEAAAEAAQAAAAAAAQAAAAEAAAACAAAAAQAAAAEAAAABAAAAAgAAAAAAAAACAAAA"
+ "AAAAAIABAAAAAAAACjxiYWRfbmFtZT4ABjxpbml0PgAMQmFkTmFtZS5qYXZhAAFJAAlMQmFkTmFt"
+ "ZTsAEkxqYXZhL2xhbmcvT2JqZWN0OwABVgADVklJAAIAAAAAAAAAAAAAAAACAAAHAAEABw4AAAIA"
+ "AgAAAAAASAEAAAEAAAAOAAAAAQABAAEAAABOAQAABAAAAHAQAgAAAA4AAAACAAAJ1AIBgYAE6AIA"
+ "AA0AAAAAAAAAAQAAAAAAAAABAAAACAAAAHAAAAACAAAABAAAAJAAAAADAAAAAgAAAKAAAAAFAAAA"
+ "AwAAALgAAAAGAAAAAQAAANAAAAACIAAACAAAAPAAAAABEAAAAQAAADwBAAADEAAAAQAAAEQBAAAD"
+ "IAAAAgAAAEgBAAABIAAAAgAAAFQBAAAAIAAAAQAAAIABAAAAEAAAAQAAAJABAAA=";
+
+ size_t length;
+ std::unique_ptr<uint8_t[]> dex_bytes(DecodeBase64(kDexBase64, &length));
+ CHECK(dex_bytes != nullptr);
+ // Note: `dex_file` will be destroyed before `dex_bytes`.
+ std::unique_ptr<DexFile> dex_file(GetDexFile(dex_bytes.get(), length));
+ std::string error_msg;
+ EXPECT_FALSE(DexFileVerifier::Verify(dex_file.get(),
+ dex_file->Begin(),
+ dex_file->Size(),
+ "bad static method name",
+ /*verify_checksum*/ true,
+ &error_msg));
+}
+
+TEST_F(DexFileVerifierTest, BadVirtualMethodName) {
+ // Generated DEX file version (037) from:
+ //
+ // .class public LBadVirtualName;
+ // .super Ljava/lang/Object;
+ //
+ // .method public <bad_name> (II)V
+ // .registers 2
+ // return-void
+ // .end method
+ //
+ // .method public constructor <init>()V
+ // .registers 1
+ // invoke-direct {p0}, Ljava/lang/Object;-><init>()V
+ // return-void
+ // .end method
+ //
+ static const char kDexBase64[] =
+ "ZGV4CjAzNwDcPC8B2E7kYTZmeHX2u2IqrpWV9EXBHpE8AgAAcAAAAHhWNBIAAAAAAAAAAJwBAAAI"
+ "AAAAcAAAAAQAAACQAAAAAgAAAKAAAAAAAAAAAAAAAAMAAAC4AAAAAQAAANAAAABMAQAA8AAAAPAA"
+ "AAD8AAAABAEAABkBAAAcAQAALgEAAEIBAABFAQAAAwAAAAQAAAAFAAAABgAAAAYAAAADAAAAAAAA"
+ "AAcAAAADAAAATAEAAAEAAQAAAAAAAQAAAAEAAAACAAAAAQAAAAEAAAABAAAAAgAAAAAAAAACAAAA"
+ "AAAAAI4BAAAAAAAACjxiYWRfbmFtZT4ABjxpbml0PgATQmFkVmlydHVhbE5hbWUuamF2YQABSQAQ"
+ "TEJhZFZpcnR1YWxOYW1lOwASTGphdmEvbGFuZy9PYmplY3Q7AAFWAANWSUkAAAACAAAAAAAAAAAA"
+ "AAABAAcOAAACAAAHAAABAAEAAQAAAFgBAAAEAAAAcBACAAAADgADAAMAAAAAAF0BAAABAAAADgAA"
+ "AAEBAYGABOQCAAH8Ag0AAAAAAAAAAQAAAAAAAAABAAAACAAAAHAAAAACAAAABAAAAJAAAAADAAAA"
+ "AgAAAKAAAAAFAAAAAwAAALgAAAAGAAAAAQAAANAAAAACIAAACAAAAPAAAAABEAAAAQAAAEwBAAAD"
+ "EAAAAQAAAFQBAAADIAAAAgAAAFgBAAABIAAAAgAAAGQBAAAAIAAAAQAAAI4BAAAAEAAAAQAAAJwB"
+ "AAA=";
+
+ size_t length;
+ std::unique_ptr<uint8_t[]> dex_bytes(DecodeBase64(kDexBase64, &length));
+ CHECK(dex_bytes != nullptr);
+ // Note: `dex_file` will be destroyed before `dex_bytes`.
+ std::unique_ptr<DexFile> dex_file(GetDexFile(dex_bytes.get(), length));
+ std::string error_msg;
+ EXPECT_FALSE(DexFileVerifier::Verify(dex_file.get(),
+ dex_file->Begin(),
+ dex_file->Size(),
+ "bad virtual method name",
+ /*verify_checksum*/ true,
+ &error_msg));
+}
+
+TEST_F(DexFileVerifierTest, BadClinitSignature) {
+ // Generated DEX file version (037) from:
+ //
+ // .class public LOneClinitBadSig;
+ // .super Ljava/lang/Object;
+ //
+ // .method public static constructor <clinit>(II)V
+ // .registers 2
+ // return-void
+ // .end method
+ //
+ // .method public constructor <init>()V
+ // .registers 1
+ // invoke-direct {p0}, Ljava/lang/Object;-><init>()V
+ // return-void
+ // .end method
+ //
+ static const char kDexBase64[] =
+ "ZGV4CjAzNwBNOwTbfJmWq5eMOlxUY4EICGiEGJMVg8RAAgAAcAAAAHhWNBIAAAAAAAAAAKABAAAI"
+ "AAAAcAAAAAQAAACQAAAAAgAAAKAAAAAAAAAAAAAAAAMAAAC4AAAAAQAAANAAAABQAQAA8AAAAPAA"
+ "AAD6AAAAAgEAAAUBAAAYAQAALAEAAEIBAABFAQAAAgAAAAMAAAAEAAAABgAAAAYAAAADAAAAAAAA"
+ "AAcAAAADAAAATAEAAAEAAQAAAAAAAQAAAAEAAAACAAAAAQAAAAEAAAABAAAAAgAAAAAAAAAFAAAA"
+ "AAAAAJABAAAAAAAACDxjbGluaXQ+AAY8aW5pdD4AAUkAEUxPbmVDbGluaXRCYWRTaWc7ABJMamF2"
+ "YS9sYW5nL09iamVjdDsAFE9uZUNsaW5pdEJhZFNpZy5qYXZhAAFWAANWSUkAAAACAAAAAAAAAAAA"
+ "AAAAAgAABwABAAcOAAACAAIAAAAAAFgBAAABAAAADgAAAAEAAQABAAAAXgEAAAQAAABwEAIAAAAO"
+ "AAAAAgAAiYAE5AIBgYAE+AINAAAAAAAAAAEAAAAAAAAAAQAAAAgAAABwAAAAAgAAAAQAAACQAAAA"
+ "AwAAAAIAAACgAAAABQAAAAMAAAC4AAAABgAAAAEAAADQAAAAAiAAAAgAAADwAAAAARAAAAEAAABM"
+ "AQAAAxAAAAEAAABUAQAAAyAAAAIAAABYAQAAASAAAAIAAABkAQAAACAAAAEAAACQAQAAABAAAAEA"
+ "AACgAQAA";
+
+ size_t length;
+ std::unique_ptr<uint8_t[]> dex_bytes(DecodeBase64(kDexBase64, &length));
+ CHECK(dex_bytes != nullptr);
+ // Note: `dex_file` will be destroyed before `dex_bytes`.
+ std::unique_ptr<DexFile> dex_file(GetDexFile(dex_bytes.get(), length));
+ std::string error_msg;
+ EXPECT_FALSE(DexFileVerifier::Verify(dex_file.get(),
+ dex_file->Begin(),
+ dex_file->Size(),
+ "bad clinit signature",
+ /*verify_checksum*/ true,
+ &error_msg));
+}
+
+TEST_F(DexFileVerifierTest, BadClinitSignatureAgain) {
+ // Generated DEX file version (037) from:
+ //
+ // .class public LOneClinitBadSigAgain;
+ // .super Ljava/lang/Object;
+ //
+ // .method public static constructor <clinit>()I
+ // .registers 1
+ // const/4 v0, 1
+ // return v0
+ // .end method
+ //
+ // .method public constructor <init>()V
+ // .registers 1
+ // invoke-direct {p0}, Ljava/lang/Object;-><init>()V
+ // return-void
+ // .end method
+ //
+ static const char kDexBase64[] =
+ "ZGV4CjAzNwBfPcPu5NVwKUqZIu/YR8xqVlVD5UzTk0gEAgAAcAAAAHhWNBIAAAAAAAAAAIgBAAAH"
+ "AAAAcAAAAAQAAACMAAAAAgAAAJwAAAAAAAAAAAAAAAMAAAC0AAAAAQAAAMwAAAAYAQAA7AAAAOwA"
+ "AAD2AAAA/gAAAAEBAAAZAQAALQEAAEgBAAACAAAAAwAAAAQAAAAGAAAAAgAAAAAAAAAAAAAABgAA"
+ "AAMAAAAAAAAAAQAAAAAAAAABAAEAAQAAAAIAAQABAAAAAQAAAAEAAAACAAAAAAAAAAUAAAAAAAAA"
+ "eAEAAAAAAAAIPGNsaW5pdD4ABjxpbml0PgABSQAWTE9uZUNsaW5pdEJhZFNpZ0FnYWluOwASTGph"
+ "dmEvbGFuZy9PYmplY3Q7ABlPbmVDbGluaXRCYWRTaWdBZ2Fpbi5qYXZhAAFWAAABAAAAAAAAAAAA"
+ "AAACAAAAEhAPAAEAAQABAAAAAAAAAAQAAABwEAIAAAAOAAAAAgAAiYAEzAIBgYAE4AIKAAAAAAAA"
+ "AAEAAAAAAAAAAQAAAAcAAABwAAAAAgAAAAQAAACMAAAAAwAAAAIAAACcAAAABQAAAAMAAAC0AAAA"
+ "BgAAAAEAAADMAAAAAiAAAAcAAADsAAAAASAAAAIAAABMAQAAACAAAAEAAAB4AQAAABAAAAEAAACI"
+ "AQAA";
+
+ size_t length;
+ std::unique_ptr<uint8_t[]> dex_bytes(DecodeBase64(kDexBase64, &length));
+ CHECK(dex_bytes != nullptr);
+ // Note: `dex_file` will be destroyed before `dex_bytes`.
+ std::unique_ptr<DexFile> dex_file(GetDexFile(dex_bytes.get(), length));
+ std::string error_msg;
+ EXPECT_FALSE(DexFileVerifier::Verify(dex_file.get(),
+ dex_file->Begin(),
+ dex_file->Size(),
+ "bad clinit signature",
+ /*verify_checksum*/ true,
+ &error_msg));
+}
+
+TEST_F(DexFileVerifierTest, BadInitSignature) {
+ // Generated DEX file version (037) from:
+ //
+ // .class public LBadInitSig;
+ // .super Ljava/lang/Object;
+ //
+ // .method public constructor <init>()I
+ // .registers 1
+ // invoke-direct {p0}, Ljava/lang/Object;-><init>()V
+ // const v0, 1
+ // return v0
+ // .end method
+ //
+ static const char kDexBase64[] =
+ "ZGV4CjAzNwCdMdeh1KoHWamF2Prq32LF39YZ78fV7q+wAQAAcAAAAHhWNBIAAAAAAAAAADQBAAAF"
+ "AAAAcAAAAAQAAACEAAAAAgAAAJQAAAAAAAAAAAAAAAIAAACsAAAAAQAAALwAAADUAAAA3AAAANwA"
+ "AADkAAAA5wAAAPUAAAAJAQAAAQAAAAIAAAADAAAABAAAAAEAAAAAAAAAAAAAAAQAAAADAAAAAAAA"
+ "AAEAAAAAAAAAAgABAAAAAAABAAAAAQAAAAIAAAAAAAAA/////wAAAAAqAQAAAAAAAAY8aW5pdD4A"
+ "AUkADExCYWRJbml0U2lnOwASTGphdmEvbGFuZy9PYmplY3Q7AAFWAAEAAQABAAAAAAAAAAcAAABw"
+ "EAEAAAAUAAEAAAAPAAAAAQAAgYAEjAIKAAAAAAAAAAEAAAAAAAAAAQAAAAUAAABwAAAAAgAAAAQA"
+ "AACEAAAAAwAAAAIAAACUAAAABQAAAAIAAACsAAAABgAAAAEAAAC8AAAAAiAAAAUAAADcAAAAASAA"
+ "AAEAAAAMAQAAACAAAAEAAAAqAQAAABAAAAEAAAA0AQAA";
+
+ size_t length;
+ std::unique_ptr<uint8_t[]> dex_bytes(DecodeBase64(kDexBase64, &length));
+ CHECK(dex_bytes != nullptr);
+ // Note: `dex_file` will be destroyed before `dex_bytes`.
+ std::unique_ptr<DexFile> dex_file(GetDexFile(dex_bytes.get(), length));
+ std::string error_msg;
+ EXPECT_FALSE(DexFileVerifier::Verify(dex_file.get(),
+ dex_file->Begin(),
+ dex_file->Size(),
+ "bad init signature",
+ /*verify_checksum*/ true,
+ &error_msg));
+}
+
} // namespace art
diff --git a/runtime/dex_instruction.cc b/runtime/dex_instruction.cc
index 7b8974fa5a..37f3ac92e9 100644
--- a/runtime/dex_instruction.cc
+++ b/runtime/dex_instruction.cc
@@ -358,7 +358,7 @@ std::string Instruction::DumpString(const DexFile* file) const {
}
break;
case k35c: {
- uint32_t arg[5];
+ uint32_t arg[kMaxVarArgRegs];
GetVarArgs(arg);
switch (Opcode()) {
case FILLED_NEW_ARRAY:
@@ -443,8 +443,50 @@ std::string Instruction::DumpString(const DexFile* file) const {
}
break;
}
+ case k45cc: {
+ uint32_t arg[kMaxVarArgRegs];
+ GetVarArgs(arg);
+ uint32_t method_idx = VRegB_45cc();
+ uint32_t proto_idx = VRegH_45cc();
+ os << opcode << " {";
+ for (int i = 0; i < VRegA_45cc(); ++i) {
+ if (i != 0) {
+ os << ", ";
+ }
+ os << "v" << arg[i];
+ }
+ os << "}";
+ if (file != nullptr) {
+ os << ", " << file->PrettyMethod(method_idx) << ", " << file->GetShorty(proto_idx)
+ << " // ";
+ } else {
+ os << ", ";
+ }
+ os << "method@" << method_idx << ", proto@" << proto_idx;
+ break;
+ }
+ case k4rcc:
+ switch (Opcode()) {
+ case INVOKE_POLYMORPHIC_RANGE: {
+ if (file != nullptr) {
+ uint32_t method_idx = VRegB_4rcc();
+ uint32_t proto_idx = VRegH_4rcc();
+ os << opcode << ", {v" << VRegC_4rcc() << " .. v" << (VRegC_4rcc() + VRegA_4rcc())
+ << "}, " << file->PrettyMethod(method_idx) << ", " << file->GetShorty(proto_idx)
+ << " // method@" << method_idx << ", proto@" << proto_idx;
+ break;
+ }
+ }
+ FALLTHROUGH_INTENDED;
+ default: {
+ uint32_t method_idx = VRegB_4rcc();
+ uint32_t proto_idx = VRegH_4rcc();
+ os << opcode << ", {v" << VRegC_4rcc() << " .. v" << (VRegC_4rcc() + VRegA_4rcc())
+ << "}, method@" << method_idx << ", proto@" << proto_idx;
+ }
+ }
+ break;
case k51l: os << StringPrintf("%s v%d, #%+" PRId64, opcode, VRegA_51l(), VRegB_51l()); break;
- default: os << " unknown format (" << DumpHex(5) << ")"; break;
}
return os.str();
}
diff --git a/runtime/entrypoints/entrypoint_utils-inl.h b/runtime/entrypoints/entrypoint_utils-inl.h
index 469c45c10c..ac0ce36016 100644
--- a/runtime/entrypoints/entrypoint_utils-inl.h
+++ b/runtime/entrypoints/entrypoint_utils-inl.h
@@ -52,21 +52,19 @@ inline ArtMethod* GetResolvedMethod(ArtMethod* outer_method,
// suspended while executing it.
ScopedAssertNoThreadSuspension sants(__FUNCTION__);
+ if (inline_info.EncodesArtMethodAtDepth(encoding, inlining_depth)) {
+ return inline_info.GetArtMethodAtDepth(encoding, inlining_depth);
+ }
+
uint32_t method_index = inline_info.GetMethodIndexAtDepth(encoding, inlining_depth);
- InvokeType invoke_type = static_cast<InvokeType>(
- inline_info.GetInvokeTypeAtDepth(encoding, inlining_depth));
- ArtMethod* inlined_method = outer_method->GetDexCacheResolvedMethod(method_index,
- kRuntimePointerSize);
- if (!inlined_method->IsRuntimeMethod()) {
+ if (inline_info.GetDexPcAtDepth(encoding, inlining_depth) == static_cast<uint32_t>(-1)) {
+ // "charAt" special case. It is the only non-leaf method we inline across dex files.
+ ArtMethod* inlined_method = jni::DecodeArtMethod(WellKnownClasses::java_lang_String_charAt);
+ DCHECK_EQ(inlined_method->GetDexMethodIndex(), method_index);
return inlined_method;
}
- // The method in the dex cache is the runtime method responsible for invoking
- // the stub that will then update the dex cache. Therefore, we need to do the
- // resolution ourselves.
-
- // We first find the dex cache of our caller. If it is the outer method, we can directly
- // use its dex cache. Otherwise, we also need to resolve our caller.
+ // Find which method did the call in the inlining hierarchy.
ArtMethod* caller = outer_method;
if (inlining_depth != 0) {
caller = GetResolvedMethod(outer_method,
@@ -74,59 +72,41 @@ inline ArtMethod* GetResolvedMethod(ArtMethod* outer_method,
encoding,
inlining_depth - 1);
}
- DCHECK_EQ(caller->GetDexCache(), outer_method->GetDexCache())
- << "Compiler only supports inlining calls within the same dex cache";
- const DexFile* dex_file = outer_method->GetDexFile();
- const DexFile::MethodId& method_id = dex_file->GetMethodId(method_index);
- if (inline_info.GetDexPcAtDepth(encoding, inlining_depth) == static_cast<uint32_t>(-1)) {
- // "charAt" special case. It is the only non-leaf method we inline across dex files.
- if (kIsDebugBuild) {
- const char* name = dex_file->StringDataByIdx(method_id.name_idx_);
- DCHECK_EQ(std::string(name), "charAt");
- DCHECK_EQ(std::string(dex_file->GetMethodShorty(method_id)), "CI")
- << std::string(dex_file->GetMethodShorty(method_id));
- DCHECK_EQ(std::string(dex_file->StringByTypeIdx(method_id.class_idx_)), "Ljava/lang/String;")
- << std::string(dex_file->StringByTypeIdx(method_id.class_idx_));
- }
- mirror::Class* cls =
- Runtime::Current()->GetClassLinker()->GetClassRoot(ClassLinker::kJavaLangString);
- // Update the dex cache for future lookups.
- caller->GetDexCache()->SetResolvedType(method_id.class_idx_, cls);
- inlined_method = cls->FindVirtualMethod("charAt", "(I)C", kRuntimePointerSize);
- } else {
- mirror::Class* klass = caller->GetDexCache()->GetResolvedType(method_id.class_idx_);
- DCHECK_EQ(klass->GetDexCache(), caller->GetDexCache())
- << "Compiler only supports inlining calls within the same dex cache";
- switch (invoke_type) {
- case kDirect:
- case kStatic:
- inlined_method =
- klass->FindDirectMethod(klass->GetDexCache(), method_index, kRuntimePointerSize);
- break;
- case kSuper:
- case kVirtual:
- inlined_method =
- klass->FindVirtualMethod(klass->GetDexCache(), method_index, kRuntimePointerSize);
- break;
- default:
- LOG(FATAL) << "Unimplemented inlined invocation type: " << invoke_type;
- UNREACHABLE();
+ // Lookup the declaring class of the inlined method.
+ const DexFile* dex_file = caller->GetDexFile();
+ const DexFile::MethodId& method_id = dex_file->GetMethodId(method_index);
+ const char* descriptor = dex_file->StringByTypeIdx(method_id.class_idx_);
+ ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
+ Thread* self = Thread::Current();
+ mirror::ClassLoader* class_loader = caller->GetDeclaringClass()->GetClassLoader();
+ mirror::Class* klass = class_linker->LookupClass(self, descriptor, class_loader);
+ if (klass == nullptr) {
+ LOG(FATAL) << "Could not find an inlined method from an .oat file: "
+ << "the class " << descriptor << " was not found in the class loader of "
+ << caller->PrettyMethod() << ". "
+ << "This must be due to playing wrongly with class loaders";
+ }
+
+ // Lookup the method.
+ const char* method_name = dex_file->GetMethodName(method_id);
+ const Signature signature = dex_file->GetMethodSignature(method_id);
+
+ ArtMethod* inlined_method =
+ klass->FindDeclaredDirectMethod(method_name, signature, kRuntimePointerSize);
+ if (inlined_method == nullptr) {
+ inlined_method = klass->FindDeclaredVirtualMethod(method_name, signature, kRuntimePointerSize);
+ if (inlined_method == nullptr) {
+ LOG(FATAL) << "Could not find an inlined method from an .oat file: "
+ << "the class " << descriptor << " does not have "
+ << method_name << signature << " declared. "
+ << "This must be due to duplicate classes or playing wrongly with class loaders";
}
}
- // Update the dex cache for future lookups. Note that for static methods, this is safe
- // when the class is being initialized, as the entrypoint for the ArtMethod is at
- // this point still the resolution trampoline.
- outer_method->SetDexCacheResolvedMethod(method_index, inlined_method, kRuntimePointerSize);
return inlined_method;
}
-inline ArtMethod* GetCalleeSaveMethodCaller(Thread* self, Runtime::CalleeSaveType type) {
- return GetCalleeSaveMethodCaller(
- self->GetManagedStack()->GetTopQuickFrame(), type, true /* do_caller_check */);
-}
-
ALWAYS_INLINE inline mirror::Class* CheckObjectAlloc(mirror::Class* klass,
Thread* self,
bool* slow_path)
@@ -261,10 +241,9 @@ inline mirror::Class* CheckArrayAlloc(dex::TypeIndex type_idx,
*slow_path = true;
return nullptr; // Failure
}
- ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
- PointerSize pointer_size = class_linker->GetImagePointerSize();
- mirror::Class* klass = method->GetDexCacheResolvedType<false>(type_idx, pointer_size);
+ mirror::Class* klass = method->GetDexCache()->GetResolvedType(type_idx);
if (UNLIKELY(klass == nullptr)) { // Not in dex cache so try to resolve
+ ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
klass = class_linker->ResolveType(type_idx, method);
*slow_path = true;
if (klass == nullptr) { // Error
@@ -314,11 +293,10 @@ inline mirror::Array* AllocArrayFromCode(dex::TypeIndex type_idx,
klass->GetComponentSizeShift(), allocator_type);
}
-template <bool kAccessCheck, bool kInstrumented>
+template <bool kInstrumented>
ALWAYS_INLINE
inline mirror::Array* AllocArrayFromCodeResolved(mirror::Class* klass,
int32_t component_count,
- ArtMethod* method,
Thread* self,
gc::AllocatorType allocator_type) {
DCHECK(klass != nullptr);
@@ -326,13 +304,6 @@ inline mirror::Array* AllocArrayFromCodeResolved(mirror::Class* klass,
ThrowNegativeArraySizeException(component_count);
return nullptr; // Failure
}
- if (kAccessCheck) {
- mirror::Class* referrer = method->GetDeclaringClass();
- if (UNLIKELY(!referrer->CanAccess(klass))) {
- ThrowIllegalAccessErrorClass(referrer, klass);
- return nullptr; // Failure
- }
- }
// No need to retry a slow-path allocation as the above code won't cause a GC or thread
// suspension.
return mirror::Array::Alloc<kInstrumented>(self, klass, component_count,
diff --git a/runtime/entrypoints/entrypoint_utils.cc b/runtime/entrypoints/entrypoint_utils.cc
index 5390165ecd..25fd727968 100644
--- a/runtime/entrypoints/entrypoint_utils.cc
+++ b/runtime/entrypoints/entrypoint_utils.cc
@@ -38,98 +38,13 @@
namespace art {
-static inline mirror::Class* CheckFilledNewArrayAlloc(dex::TypeIndex type_idx,
- int32_t component_count,
- ArtMethod* referrer,
- Thread* self,
- bool access_check)
- REQUIRES_SHARED(Locks::mutator_lock_) REQUIRES(!Roles::uninterruptible_) {
- if (UNLIKELY(component_count < 0)) {
- ThrowNegativeArraySizeException(component_count);
- return nullptr; // Failure
- }
- ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
- PointerSize pointer_size = class_linker->GetImagePointerSize();
- mirror::Class* klass = referrer->GetDexCacheResolvedType<false>(type_idx, pointer_size);
- if (UNLIKELY(klass == nullptr)) { // Not in dex cache so try to resolve
- klass = class_linker->ResolveType(type_idx, referrer);
- if (klass == nullptr) { // Error
- DCHECK(self->IsExceptionPending());
- return nullptr; // Failure
- }
- }
- if (UNLIKELY(klass->IsPrimitive() && !klass->IsPrimitiveInt())) {
- if (klass->IsPrimitiveLong() || klass->IsPrimitiveDouble()) {
- ThrowRuntimeException("Bad filled array request for type %s",
- klass->PrettyDescriptor().c_str());
- } else {
- self->ThrowNewExceptionF(
- "Ljava/lang/InternalError;",
- "Found type %s; filled-new-array not implemented for anything but 'int'",
- klass->PrettyDescriptor().c_str());
- }
- return nullptr; // Failure
- }
- if (access_check) {
- mirror::Class* referrer_klass = referrer->GetDeclaringClass();
- if (UNLIKELY(!referrer_klass->CanAccess(klass))) {
- ThrowIllegalAccessErrorClass(referrer_klass, klass);
- return nullptr; // Failure
- }
- }
- DCHECK(klass->IsArrayClass()) << klass->PrettyClass();
- return klass;
-}
-
-// Helper function to allocate array for FILLED_NEW_ARRAY.
-mirror::Array* CheckAndAllocArrayFromCode(dex::TypeIndex type_idx,
- int32_t component_count,
- ArtMethod* referrer,
- Thread* self,
- bool access_check,
- gc::AllocatorType allocator_type ATTRIBUTE_UNUSED) {
- mirror::Class* klass = CheckFilledNewArrayAlloc(type_idx, component_count, referrer, self,
- access_check);
- if (UNLIKELY(klass == nullptr)) {
- return nullptr;
- }
- // Always go slow path for now, filled new array is not common.
- gc::Heap* heap = Runtime::Current()->GetHeap();
- // Use the current allocator type in case CheckFilledNewArrayAlloc caused us to suspend and then
- // the heap switched the allocator type while we were suspended.
- return mirror::Array::Alloc<false>(self, klass, component_count,
- klass->GetComponentSizeShift(),
- heap->GetCurrentAllocator());
-}
-
-// Helper function to allocate array for FILLED_NEW_ARRAY.
-mirror::Array* CheckAndAllocArrayFromCodeInstrumented(
- dex::TypeIndex type_idx,
- int32_t component_count,
- ArtMethod* referrer,
- Thread* self,
- bool access_check,
- gc::AllocatorType allocator_type ATTRIBUTE_UNUSED) {
- mirror::Class* klass = CheckFilledNewArrayAlloc(type_idx, component_count, referrer, self,
- access_check);
- if (UNLIKELY(klass == nullptr)) {
- return nullptr;
- }
- gc::Heap* heap = Runtime::Current()->GetHeap();
- // Use the current allocator type in case CheckFilledNewArrayAlloc caused us to suspend and then
- // the heap switched the allocator type while we were suspended.
- return mirror::Array::Alloc<true>(self, klass, component_count,
- klass->GetComponentSizeShift(),
- heap->GetCurrentAllocator());
-}
-
void CheckReferenceResult(Handle<mirror::Object> o, Thread* self) {
if (o.Get() == nullptr) {
return;
}
// Make sure that the result is an instance of the type this method was expected to return.
ArtMethod* method = self->GetCurrentMethod(nullptr);
- mirror::Class* return_type = method->GetReturnType(true /* resolve */, kRuntimePointerSize);
+ mirror::Class* return_type = method->GetReturnType(true /* resolve */);
if (!o->InstanceOf(return_type)) {
Runtime::Current()->GetJavaVM()->JniAbortF(nullptr,
@@ -192,8 +107,7 @@ JValue InvokeProxyInvocationHandler(ScopedObjectAccessAlreadyRunnable& soa, cons
ArtMethod* interface_method =
soa.Decode<mirror::Method>(interface_method_jobj)->GetArtMethod();
// This can cause thread suspension.
- PointerSize pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
- mirror::Class* result_type = interface_method->GetReturnType(true /* resolve */, pointer_size);
+ mirror::Class* result_type = interface_method->GetReturnType(true /* resolve */);
ObjPtr<mirror::Object> result_ref = soa.Decode<mirror::Object>(result);
JValue result_unboxed;
if (!UnboxPrimitiveForResult(result_ref.Ptr(), result_type, &result_unboxed)) {
@@ -261,11 +175,8 @@ bool FillArrayData(ObjPtr<mirror::Object> obj, const Instruction::ArrayDataPaylo
return true;
}
-ArtMethod* GetCalleeSaveMethodCaller(ArtMethod** sp,
- Runtime::CalleeSaveType type,
- bool do_caller_check)
- REQUIRES_SHARED(Locks::mutator_lock_) {
- ScopedAssertNoThreadSuspension ants(__FUNCTION__);
+static inline std::pair<ArtMethod*, uintptr_t> DoGetCalleeSaveMethodOuterCallerAndPc(
+ ArtMethod** sp, Runtime::CalleeSaveType type) REQUIRES_SHARED(Locks::mutator_lock_) {
DCHECK_EQ(*sp, Runtime::Current()->GetCalleeSaveMethod(type));
const size_t callee_frame_size = GetCalleeSaveFrameSize(kRuntimeISA, type);
@@ -275,6 +186,13 @@ ArtMethod* GetCalleeSaveMethodCaller(ArtMethod** sp,
uintptr_t caller_pc = *reinterpret_cast<uintptr_t*>(
(reinterpret_cast<uint8_t*>(sp) + callee_return_pc_offset));
ArtMethod* outer_method = *caller_sp;
+ return std::make_pair(outer_method, caller_pc);
+}
+
+static inline ArtMethod* DoGetCalleeSaveMethodCaller(ArtMethod* outer_method,
+ uintptr_t caller_pc,
+ bool do_caller_check)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
ArtMethod* caller = outer_method;
if (LIKELY(caller_pc != reinterpret_cast<uintptr_t>(GetQuickInstrumentationExitPc()))) {
if (outer_method != nullptr) {
@@ -308,8 +226,33 @@ ArtMethod* GetCalleeSaveMethodCaller(ArtMethod** sp,
visitor.WalkStack();
caller = visitor.caller;
}
+ return caller;
+}
+ArtMethod* GetCalleeSaveMethodCaller(ArtMethod** sp,
+ Runtime::CalleeSaveType type,
+ bool do_caller_check)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ ScopedAssertNoThreadSuspension ants(__FUNCTION__);
+ auto outer_caller_and_pc = DoGetCalleeSaveMethodOuterCallerAndPc(sp, type);
+ ArtMethod* outer_method = outer_caller_and_pc.first;
+ uintptr_t caller_pc = outer_caller_and_pc.second;
+ ArtMethod* caller = DoGetCalleeSaveMethodCaller(outer_method, caller_pc, do_caller_check);
return caller;
}
+CallerAndOuterMethod GetCalleeSaveMethodCallerAndOuterMethod(Thread* self,
+ Runtime::CalleeSaveType type) {
+ CallerAndOuterMethod result;
+ ScopedAssertNoThreadSuspension ants(__FUNCTION__);
+ ArtMethod** sp = self->GetManagedStack()->GetTopQuickFrame();
+ auto outer_caller_and_pc = DoGetCalleeSaveMethodOuterCallerAndPc(sp, type);
+ result.outer_method = outer_caller_and_pc.first;
+ uintptr_t caller_pc = outer_caller_and_pc.second;
+ result.caller =
+ DoGetCalleeSaveMethodCaller(result.outer_method, caller_pc, /* do_caller_check */ true);
+ return result;
+}
+
+
} // namespace art
diff --git a/runtime/entrypoints/entrypoint_utils.h b/runtime/entrypoints/entrypoint_utils.h
index 4794610ca8..6a04f20f3a 100644
--- a/runtime/entrypoints/entrypoint_utils.h
+++ b/runtime/entrypoints/entrypoint_utils.h
@@ -93,33 +93,14 @@ ALWAYS_INLINE inline mirror::Array* AllocArrayFromCode(dex::TypeIndex type_idx,
REQUIRES_SHARED(Locks::mutator_lock_)
REQUIRES(!Roles::uninterruptible_);
-template <bool kAccessCheck, bool kInstrumented>
+template <bool kInstrumented>
ALWAYS_INLINE inline mirror::Array* AllocArrayFromCodeResolved(mirror::Class* klass,
int32_t component_count,
- ArtMethod* method,
Thread* self,
gc::AllocatorType allocator_type)
REQUIRES_SHARED(Locks::mutator_lock_)
REQUIRES(!Roles::uninterruptible_);
-mirror::Array* CheckAndAllocArrayFromCode(dex::TypeIndex type_idx,
- int32_t component_count,
- ArtMethod* method,
- Thread* self,
- bool access_check,
- gc::AllocatorType allocator_type)
- REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!Roles::uninterruptible_);
-
-mirror::Array* CheckAndAllocArrayFromCodeInstrumented(dex::TypeIndex type_idx,
- int32_t component_count,
- ArtMethod* method,
- Thread* self,
- bool access_check,
- gc::AllocatorType allocator_type)
- REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!Roles::uninterruptible_);
-
// Type of find field operation for fast and slow case.
enum FindFieldType {
InstanceObjectRead,
@@ -201,7 +182,13 @@ ArtMethod* GetCalleeSaveMethodCaller(ArtMethod** sp,
bool do_caller_check = false)
REQUIRES_SHARED(Locks::mutator_lock_);
-ArtMethod* GetCalleeSaveMethodCaller(Thread* self, Runtime::CalleeSaveType type)
+struct CallerAndOuterMethod {
+ ArtMethod* caller;
+ ArtMethod* outer_method;
+};
+
+CallerAndOuterMethod GetCalleeSaveMethodCallerAndOuterMethod(Thread* self,
+ Runtime::CalleeSaveType type)
REQUIRES_SHARED(Locks::mutator_lock_);
} // namespace art
diff --git a/runtime/entrypoints/quick/quick_alloc_entrypoints.cc b/runtime/entrypoints/quick/quick_alloc_entrypoints.cc
index 2d06508069..e9f09b2bd9 100644
--- a/runtime/entrypoints/quick/quick_alloc_entrypoints.cc
+++ b/runtime/entrypoints/quick/quick_alloc_entrypoints.cc
@@ -82,72 +82,12 @@ extern "C" mirror::Object* artAllocObjectFromCodeInitialized##suffix##suffix2( \
REQUIRES_SHARED(Locks::mutator_lock_) { \
return artAllocObjectFromCode<true, false, instrumented_bool, allocator_type>(klass, self); \
} \
-extern "C" mirror::Array* artAllocArrayFromCode##suffix##suffix2( \
- uint32_t type_idx, int32_t component_count, ArtMethod* method, Thread* self) \
- REQUIRES_SHARED(Locks::mutator_lock_) { \
- ScopedQuickEntrypointChecks sqec(self); \
- return AllocArrayFromCode<false, instrumented_bool>(dex::TypeIndex(type_idx), \
- component_count, \
- method, \
- self, \
- allocator_type); \
-} \
extern "C" mirror::Array* artAllocArrayFromCodeResolved##suffix##suffix2( \
- mirror::Class* klass, int32_t component_count, ArtMethod* method, Thread* self) \
- REQUIRES_SHARED(Locks::mutator_lock_) { \
- ScopedQuickEntrypointChecks sqec(self); \
- return AllocArrayFromCodeResolved<false, instrumented_bool>(klass, component_count, method, self, \
- allocator_type); \
-} \
-extern "C" mirror::Array* artAllocArrayFromCodeWithAccessCheck##suffix##suffix2( \
- uint32_t type_idx, int32_t component_count, ArtMethod* method, Thread* self) \
- REQUIRES_SHARED(Locks::mutator_lock_) { \
- ScopedQuickEntrypointChecks sqec(self); \
- return AllocArrayFromCode<true, instrumented_bool>(dex::TypeIndex(type_idx), \
- component_count, \
- method, \
- self, \
- allocator_type); \
-} \
-extern "C" mirror::Array* artCheckAndAllocArrayFromCode##suffix##suffix2( \
- uint32_t type_idx, int32_t component_count, ArtMethod* method, Thread* self) \
- REQUIRES_SHARED(Locks::mutator_lock_) { \
- ScopedQuickEntrypointChecks sqec(self); \
- if (!(instrumented_bool)) { \
- return CheckAndAllocArrayFromCode(dex::TypeIndex(type_idx), \
- component_count, \
- method, \
- self, \
- false, \
- allocator_type); \
- } else { \
- return CheckAndAllocArrayFromCodeInstrumented(dex::TypeIndex(type_idx), \
- component_count, \
- method, \
- self, \
- false, \
- allocator_type); \
- } \
-} \
-extern "C" mirror::Array* artCheckAndAllocArrayFromCodeWithAccessCheck##suffix##suffix2( \
- uint32_t type_idx, int32_t component_count, ArtMethod* method, Thread* self) \
+ mirror::Class* klass, int32_t component_count, Thread* self) \
REQUIRES_SHARED(Locks::mutator_lock_) { \
ScopedQuickEntrypointChecks sqec(self); \
- if (!(instrumented_bool)) { \
- return CheckAndAllocArrayFromCode(dex::TypeIndex(type_idx), \
- component_count, \
- method, \
- self, \
- true, \
- allocator_type); \
- } else { \
- return CheckAndAllocArrayFromCodeInstrumented(dex::TypeIndex(type_idx), \
- component_count, \
- method, \
- self, \
- true, \
- allocator_type); \
- } \
+ return AllocArrayFromCodeResolved<instrumented_bool>(klass, component_count, self, \
+ allocator_type); \
} \
extern "C" mirror::String* artAllocStringFromBytesFromCode##suffix##suffix2( \
mirror::ByteArray* byte_array, int32_t high, int32_t offset, int32_t byte_count, \
@@ -188,9 +128,7 @@ GENERATE_ENTRYPOINTS_FOR_ALLOCATOR(Region, gc::kAllocatorTypeRegion)
GENERATE_ENTRYPOINTS_FOR_ALLOCATOR(RegionTLAB, gc::kAllocatorTypeRegionTLAB)
#define GENERATE_ENTRYPOINTS(suffix) \
-extern "C" void* art_quick_alloc_array##suffix(uint32_t, int32_t, ArtMethod* ref); \
-extern "C" void* art_quick_alloc_array_resolved##suffix(mirror::Class* klass, int32_t, ArtMethod* ref); \
-extern "C" void* art_quick_alloc_array_with_access_check##suffix(uint32_t, int32_t, ArtMethod* ref); \
+extern "C" void* art_quick_alloc_array_resolved##suffix(mirror::Class* klass, int32_t); \
extern "C" void* art_quick_alloc_object_resolved##suffix(mirror::Class* klass); \
extern "C" void* art_quick_alloc_object_initialized##suffix(mirror::Class* klass); \
extern "C" void* art_quick_alloc_object_with_checks##suffix(mirror::Class* klass); \
@@ -200,7 +138,7 @@ extern "C" void* art_quick_alloc_string_from_bytes##suffix(void*, int32_t, int32
extern "C" void* art_quick_alloc_string_from_chars##suffix(int32_t, int32_t, void*); \
extern "C" void* art_quick_alloc_string_from_string##suffix(void*); \
extern "C" void* art_quick_alloc_array##suffix##_instrumented(uint32_t, int32_t, ArtMethod* ref); \
-extern "C" void* art_quick_alloc_array_resolved##suffix##_instrumented(mirror::Class* klass, int32_t, ArtMethod* ref); \
+extern "C" void* art_quick_alloc_array_resolved##suffix##_instrumented(mirror::Class* klass, int32_t); \
extern "C" void* art_quick_alloc_array_with_access_check##suffix##_instrumented(uint32_t, int32_t, ArtMethod* ref); \
extern "C" void* art_quick_alloc_object##suffix##_instrumented(uint32_t type_idx, ArtMethod* ref); \
extern "C" void* art_quick_alloc_object_resolved##suffix##_instrumented(mirror::Class* klass); \
@@ -213,26 +151,18 @@ extern "C" void* art_quick_alloc_string_from_chars##suffix##_instrumented(int32_
extern "C" void* art_quick_alloc_string_from_string##suffix##_instrumented(void*); \
void SetQuickAllocEntryPoints##suffix(QuickEntryPoints* qpoints, bool instrumented) { \
if (instrumented) { \
- qpoints->pAllocArray = art_quick_alloc_array##suffix##_instrumented; \
qpoints->pAllocArrayResolved = art_quick_alloc_array_resolved##suffix##_instrumented; \
- qpoints->pAllocArrayWithAccessCheck = art_quick_alloc_array_with_access_check##suffix##_instrumented; \
qpoints->pAllocObjectResolved = art_quick_alloc_object_resolved##suffix##_instrumented; \
qpoints->pAllocObjectInitialized = art_quick_alloc_object_initialized##suffix##_instrumented; \
qpoints->pAllocObjectWithChecks = art_quick_alloc_object_with_checks##suffix##_instrumented; \
- qpoints->pCheckAndAllocArray = art_quick_check_and_alloc_array##suffix##_instrumented; \
- qpoints->pCheckAndAllocArrayWithAccessCheck = art_quick_check_and_alloc_array_with_access_check##suffix##_instrumented; \
qpoints->pAllocStringFromBytes = art_quick_alloc_string_from_bytes##suffix##_instrumented; \
qpoints->pAllocStringFromChars = art_quick_alloc_string_from_chars##suffix##_instrumented; \
qpoints->pAllocStringFromString = art_quick_alloc_string_from_string##suffix##_instrumented; \
} else { \
- qpoints->pAllocArray = art_quick_alloc_array##suffix; \
qpoints->pAllocArrayResolved = art_quick_alloc_array_resolved##suffix; \
- qpoints->pAllocArrayWithAccessCheck = art_quick_alloc_array_with_access_check##suffix; \
qpoints->pAllocObjectResolved = art_quick_alloc_object_resolved##suffix; \
qpoints->pAllocObjectInitialized = art_quick_alloc_object_initialized##suffix; \
qpoints->pAllocObjectWithChecks = art_quick_alloc_object_with_checks##suffix; \
- qpoints->pCheckAndAllocArray = art_quick_check_and_alloc_array##suffix; \
- qpoints->pCheckAndAllocArrayWithAccessCheck = art_quick_check_and_alloc_array_with_access_check##suffix; \
qpoints->pAllocStringFromBytes = art_quick_alloc_string_from_bytes##suffix; \
qpoints->pAllocStringFromChars = art_quick_alloc_string_from_chars##suffix; \
qpoints->pAllocStringFromString = art_quick_alloc_string_from_string##suffix; \
diff --git a/runtime/entrypoints/quick/quick_default_externs.h b/runtime/entrypoints/quick/quick_default_externs.h
index 64030f36bc..2d0932a0c4 100644
--- a/runtime/entrypoints/quick/quick_default_externs.h
+++ b/runtime/entrypoints/quick/quick_default_externs.h
@@ -109,8 +109,13 @@ extern "C" void art_quick_invoke_direct_trampoline_with_access_check(uint32_t, v
extern "C" void art_quick_invoke_interface_trampoline_with_access_check(uint32_t, void*);
extern "C" void art_quick_invoke_static_trampoline_with_access_check(uint32_t, void*);
extern "C" void art_quick_invoke_super_trampoline_with_access_check(uint32_t, void*);
+
extern "C" void art_quick_invoke_virtual_trampoline_with_access_check(uint32_t, void*);
+// Invoke polymorphic entrypoint. Return type is dynamic and may be void, a primitive value, or
+// reference return type.
+extern "C" void art_quick_invoke_polymorphic(uint32_t, void*);
+
// Thread entrypoints.
extern "C" void art_quick_test_suspend();
diff --git a/runtime/entrypoints/quick/quick_default_init_entrypoints.h b/runtime/entrypoints/quick/quick_default_init_entrypoints.h
index 78dad94dfe..6481b97ae1 100644
--- a/runtime/entrypoints/quick/quick_default_init_entrypoints.h
+++ b/runtime/entrypoints/quick/quick_default_init_entrypoints.h
@@ -66,10 +66,7 @@ void DefaultInitEntryPoints(JniEntryPoints* jpoints, QuickEntryPoints* qpoints)
qpoints->pGetObjStatic = art_quick_get_obj_static;
// Array
- qpoints->pAputObjectWithNullAndBoundCheck = art_quick_aput_obj_with_null_and_bound_check;
- qpoints->pAputObjectWithBoundCheck = art_quick_aput_obj_with_bound_check;
qpoints->pAputObject = art_quick_aput_obj;
- qpoints->pHandleFillArrayData = art_quick_handle_fill_data;
// JNI
qpoints->pJniMethodStart = JniMethodStart;
@@ -106,6 +103,7 @@ void DefaultInitEntryPoints(JniEntryPoints* jpoints, QuickEntryPoints* qpoints)
art_quick_invoke_super_trampoline_with_access_check;
qpoints->pInvokeVirtualTrampolineWithAccessCheck =
art_quick_invoke_virtual_trampoline_with_access_check;
+ qpoints->pInvokePolymorphic = art_quick_invoke_polymorphic;
// Thread
qpoints->pTestSuspend = art_quick_test_suspend;
diff --git a/runtime/entrypoints/quick/quick_dexcache_entrypoints.cc b/runtime/entrypoints/quick/quick_dexcache_entrypoints.cc
index 5dad43e7fa..5b1b2871c2 100644
--- a/runtime/entrypoints/quick/quick_dexcache_entrypoints.cc
+++ b/runtime/entrypoints/quick/quick_dexcache_entrypoints.cc
@@ -31,22 +31,56 @@
namespace art {
+static inline void BssWriteBarrier(ArtMethod* outer_method) REQUIRES_SHARED(Locks::mutator_lock_) {
+ // For AOT code, we need a write barrier for the class loader that holds
+ // the GC roots in the .bss.
+ const DexFile* dex_file = outer_method->GetDexFile();
+ if (dex_file != nullptr &&
+ dex_file->GetOatDexFile() != nullptr &&
+ !dex_file->GetOatDexFile()->GetOatFile()->GetBssGcRoots().empty()) {
+ mirror::ClassLoader* class_loader = outer_method->GetClassLoader();
+ if (class_loader != nullptr) {
+ DCHECK(!class_loader->GetClassTable()->InsertOatFile(dex_file->GetOatDexFile()->GetOatFile()))
+ << "Oat file with .bss GC roots was not registered in class table: "
+ << dex_file->GetOatDexFile()->GetOatFile()->GetLocation();
+ // Note that we emit the barrier before the compiled code stores the String or Class
+ // as a GC root. This is OK as there is no suspend point point in between.
+ Runtime::Current()->GetHeap()->WriteBarrierEveryFieldOf(class_loader);
+ } else {
+ Runtime::Current()->GetClassLinker()->WriteBarrierForBootOatFileBssRoots(
+ dex_file->GetOatDexFile()->GetOatFile());
+ }
+ }
+}
+
extern "C" mirror::Class* artInitializeStaticStorageFromCode(uint32_t type_idx, Thread* self)
REQUIRES_SHARED(Locks::mutator_lock_) {
// Called to ensure static storage base is initialized for direct static field reads and writes.
// A class may be accessing another class' fields when it doesn't have access, as access has been
// given by inheritance.
ScopedQuickEntrypointChecks sqec(self);
- auto* caller = GetCalleeSaveMethodCaller(self, Runtime::kSaveRefsOnly);
- return ResolveVerifyAndClinit(dex::TypeIndex(type_idx), caller, self, true, false);
+ auto caller_and_outer = GetCalleeSaveMethodCallerAndOuterMethod(self, Runtime::kSaveRefsOnly);
+ ArtMethod* caller = caller_and_outer.caller;
+ mirror::Class* result =
+ ResolveVerifyAndClinit(dex::TypeIndex(type_idx), caller, self, true, false);
+ if (LIKELY(result != nullptr)) {
+ BssWriteBarrier(caller_and_outer.outer_method);
+ }
+ return result;
}
extern "C" mirror::Class* artInitializeTypeFromCode(uint32_t type_idx, Thread* self)
REQUIRES_SHARED(Locks::mutator_lock_) {
// Called when method->dex_cache_resolved_types_[] misses.
ScopedQuickEntrypointChecks sqec(self);
- auto* caller = GetCalleeSaveMethodCaller(self, Runtime::kSaveRefsOnly);
- return ResolveVerifyAndClinit(dex::TypeIndex(type_idx), caller, self, false, false);
+ auto caller_and_outer = GetCalleeSaveMethodCallerAndOuterMethod(self, Runtime::kSaveRefsOnly);
+ ArtMethod* caller = caller_and_outer.caller;
+ mirror::Class* result =
+ ResolveVerifyAndClinit(dex::TypeIndex(type_idx), caller, self, false, false);
+ if (LIKELY(result != nullptr)) {
+ BssWriteBarrier(caller_and_outer.outer_method);
+ }
+ return result;
}
extern "C" mirror::Class* artInitializeTypeAndVerifyAccessFromCode(uint32_t type_idx, Thread* self)
@@ -54,36 +88,28 @@ extern "C" mirror::Class* artInitializeTypeAndVerifyAccessFromCode(uint32_t type
// Called when caller isn't guaranteed to have access to a type and the dex cache may be
// unpopulated.
ScopedQuickEntrypointChecks sqec(self);
- auto* caller = GetCalleeSaveMethodCaller(self, Runtime::kSaveRefsOnly);
- return ResolveVerifyAndClinit(dex::TypeIndex(type_idx), caller, self, false, true);
+ auto caller_and_outer = GetCalleeSaveMethodCallerAndOuterMethod(self, Runtime::kSaveRefsOnly);
+ ArtMethod* caller = caller_and_outer.caller;
+ mirror::Class* result =
+ ResolveVerifyAndClinit(dex::TypeIndex(type_idx), caller, self, false, true);
+ if (LIKELY(result != nullptr)) {
+ BssWriteBarrier(caller_and_outer.outer_method);
+ }
+ return result;
}
extern "C" mirror::String* artResolveStringFromCode(int32_t string_idx, Thread* self)
REQUIRES_SHARED(Locks::mutator_lock_) {
ScopedQuickEntrypointChecks sqec(self);
- auto* caller = GetCalleeSaveMethodCaller(
+ auto caller_and_outer = GetCalleeSaveMethodCallerAndOuterMethod(
self,
// TODO: Change art_quick_resolve_string on MIPS and MIPS64 to kSaveEverything.
(kRuntimeISA == kMips || kRuntimeISA == kMips64) ? Runtime::kSaveRefsOnly
: Runtime::kSaveEverything);
+ ArtMethod* caller = caller_and_outer.caller;
mirror::String* result = ResolveStringFromCode(caller, dex::StringIndex(string_idx));
if (LIKELY(result != nullptr)) {
- // For AOT code, we need a write barrier for the class loader that holds
- // the GC roots in the .bss.
- const DexFile* dex_file = caller->GetDexFile();
- if (dex_file != nullptr &&
- dex_file->GetOatDexFile() != nullptr &&
- !dex_file->GetOatDexFile()->GetOatFile()->GetBssGcRoots().empty()) {
- mirror::ClassLoader* class_loader = caller->GetDeclaringClass()->GetClassLoader();
- DCHECK(class_loader != nullptr); // We do not use .bss GC roots for boot image.
- DCHECK(
- !class_loader->GetClassTable()->InsertOatFile(dex_file->GetOatDexFile()->GetOatFile()))
- << "Oat file with .bss GC roots was not registered in class table: "
- << dex_file->GetOatDexFile()->GetOatFile()->GetLocation();
- // Note that we emit the barrier before the compiled code stores the string as GC root.
- // This is OK as there is no suspend point point in between.
- Runtime::Current()->GetHeap()->WriteBarrierEveryFieldOf(class_loader);
- }
+ BssWriteBarrier(caller_and_outer.outer_method);
}
return result;
}
diff --git a/runtime/entrypoints/quick/quick_entrypoints_list.h b/runtime/entrypoints/quick/quick_entrypoints_list.h
index 0911aeb0f4..22b0f921c7 100644
--- a/runtime/entrypoints/quick/quick_entrypoints_list.h
+++ b/runtime/entrypoints/quick/quick_entrypoints_list.h
@@ -20,14 +20,10 @@
// All quick entrypoints. Format is name, return type, argument types.
#define QUICK_ENTRYPOINT_LIST(V) \
- V(AllocArray, void*, uint32_t, int32_t, ArtMethod*) \
- V(AllocArrayResolved, void*, mirror::Class*, int32_t, ArtMethod*) \
- V(AllocArrayWithAccessCheck, void*, uint32_t, int32_t, ArtMethod*) \
+ V(AllocArrayResolved, void*, mirror::Class*, int32_t) \
V(AllocObjectResolved, void*, mirror::Class*) \
V(AllocObjectInitialized, void*, mirror::Class*) \
V(AllocObjectWithChecks, void*, mirror::Class*) \
- V(CheckAndAllocArray, void*, uint32_t, int32_t, ArtMethod*) \
- V(CheckAndAllocArrayWithAccessCheck, void*, uint32_t, int32_t, ArtMethod*) \
V(AllocStringFromBytes, void*, void*, int32_t, int32_t, int32_t) \
V(AllocStringFromChars, void*, int32_t, int32_t, void*) \
V(AllocStringFromString, void*, void*) \
@@ -65,10 +61,7 @@
V(GetObjInstance, void*, uint32_t, void*) \
V(GetObjStatic, void*, uint32_t) \
\
- V(AputObjectWithNullAndBoundCheck, void, mirror::Array*, int32_t, mirror::Object*) \
- V(AputObjectWithBoundCheck, void, mirror::Array*, int32_t, mirror::Object*) \
V(AputObject, void, mirror::Array*, int32_t, mirror::Object*) \
- V(HandleFillArrayData, void, void*, void*) \
\
V(JniMethodStart, uint32_t, Thread*) \
V(JniMethodFastStart, uint32_t, Thread*) \
@@ -133,6 +126,7 @@
V(InvokeStaticTrampolineWithAccessCheck, void, uint32_t, void*) \
V(InvokeSuperTrampolineWithAccessCheck, void, uint32_t, void*) \
V(InvokeVirtualTrampolineWithAccessCheck, void, uint32_t, void*) \
+ V(InvokePolymorphic, void, uint32_t, void*) \
\
V(TestSuspend, void, void) \
\
diff --git a/runtime/entrypoints/quick/quick_trampoline_entrypoints.cc b/runtime/entrypoints/quick/quick_trampoline_entrypoints.cc
index a3e5b552b5..eb76fb6b88 100644
--- a/runtime/entrypoints/quick/quick_trampoline_entrypoints.cc
+++ b/runtime/entrypoints/quick/quick_trampoline_entrypoints.cc
@@ -27,10 +27,12 @@
#include "imtable-inl.h"
#include "interpreter/interpreter.h"
#include "linear_alloc.h"
+#include "method_handles.h"
#include "method_reference.h"
#include "mirror/class-inl.h"
#include "mirror/dex_cache-inl.h"
#include "mirror/method.h"
+#include "mirror/method_handle_impl.h"
#include "mirror/object-inl.h"
#include "mirror/object_array-inl.h"
#include "oat_quick_method_header.h"
@@ -39,6 +41,7 @@
#include "scoped_thread_state_change-inl.h"
#include "stack.h"
#include "debugger.h"
+#include "well_known_classes.h"
namespace art {
@@ -2391,4 +2394,121 @@ extern "C" TwoWordReturn artInvokeInterfaceTrampoline(uint32_t deadbeef ATTRIBUT
reinterpret_cast<uintptr_t>(method));
}
+// Returns shorty type so the caller can determine how to put |result|
+// into expected registers. The shorty type is static so the compiler
+// could call different flavors of this code path depending on the
+// shorty type though this would require different entry points for
+// each type.
+extern "C" uintptr_t artInvokePolymorphic(
+ JValue* result,
+ mirror::Object* raw_method_handle,
+ Thread* self,
+ ArtMethod** sp)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ ScopedQuickEntrypointChecks sqec(self);
+ DCHECK_EQ(*sp, Runtime::Current()->GetCalleeSaveMethod(Runtime::kSaveRefsAndArgs));
+
+ // Start new JNI local reference state
+ JNIEnvExt* env = self->GetJniEnv();
+ ScopedObjectAccessUnchecked soa(env);
+ ScopedJniEnvLocalRefState env_state(env);
+ const char* old_cause = self->StartAssertNoThreadSuspension("Making stack arguments safe.");
+
+ // From the instruction, get the |callsite_shorty| and expose arguments on the stack to the GC.
+ ArtMethod* caller_method = QuickArgumentVisitor::GetCallingMethod(sp);
+ uint32_t dex_pc = QuickArgumentVisitor::GetCallingDexPc(sp);
+ const DexFile::CodeItem* code = caller_method->GetCodeItem();
+ const Instruction* inst = Instruction::At(&code->insns_[dex_pc]);
+ DCHECK(inst->Opcode() == Instruction::INVOKE_POLYMORPHIC ||
+ inst->Opcode() == Instruction::INVOKE_POLYMORPHIC_RANGE);
+ const DexFile* dex_file = caller_method->GetDexFile();
+ const uint32_t proto_idx = inst->VRegH();
+ const char* shorty = dex_file->GetShorty(proto_idx);
+ const size_t shorty_length = strlen(shorty);
+ static const bool kMethodIsStatic = false; // invoke() and invokeExact() are not static.
+ RememberForGcArgumentVisitor gc_visitor(sp, kMethodIsStatic, shorty, shorty_length, &soa);
+ gc_visitor.VisitArguments();
+
+ // Wrap raw_method_handle in a Handle for safety.
+ StackHandleScope<5> hs(self);
+ Handle<mirror::MethodHandleImpl> method_handle(
+ hs.NewHandle(ObjPtr<mirror::MethodHandleImpl>::DownCast(MakeObjPtr(raw_method_handle))));
+ raw_method_handle = nullptr;
+ self->EndAssertNoThreadSuspension(old_cause);
+
+ // Resolve method - it's either MethodHandle.invoke() or MethodHandle.invokeExact().
+ ClassLinker* linker = Runtime::Current()->GetClassLinker();
+ ArtMethod* resolved_method = linker->ResolveMethod<ClassLinker::kForceICCECheck>(self,
+ inst->VRegB(),
+ caller_method,
+ kVirtual);
+ DCHECK((resolved_method ==
+ jni::DecodeArtMethod(WellKnownClasses::java_lang_invoke_MethodHandle_invokeExact)) ||
+ (resolved_method ==
+ jni::DecodeArtMethod(WellKnownClasses::java_lang_invoke_MethodHandle_invoke)));
+ if (UNLIKELY(method_handle.IsNull())) {
+ ThrowNullPointerExceptionForMethodAccess(resolved_method, InvokeType::kVirtual);
+ return static_cast<uintptr_t>('V');
+ }
+
+ Handle<mirror::Class> caller_class(hs.NewHandle(caller_method->GetDeclaringClass()));
+ Handle<mirror::MethodType> method_type(hs.NewHandle(linker->ResolveMethodType(
+ *dex_file, proto_idx,
+ hs.NewHandle<mirror::DexCache>(caller_class->GetDexCache()),
+ hs.NewHandle<mirror::ClassLoader>(caller_class->GetClassLoader()))));
+ // This implies we couldn't resolve one or more types in this method handle.
+ if (UNLIKELY(method_type.IsNull())) {
+ CHECK(self->IsExceptionPending());
+ return static_cast<uintptr_t>('V');
+ }
+
+ DCHECK_EQ(ArtMethod::NumArgRegisters(shorty) + 1u, (uint32_t)inst->VRegA());
+ DCHECK_EQ(resolved_method->IsStatic(), kMethodIsStatic);
+
+ // Fix references before constructing the shadow frame.
+ gc_visitor.FixupReferences();
+
+ // Construct shadow frame placing arguments consecutively from |first_arg|.
+ const bool is_range = (inst->Opcode() == Instruction::INVOKE_POLYMORPHIC_RANGE);
+ const size_t num_vregs = is_range ? inst->VRegA_4rcc() : inst->VRegA_45cc();
+ const size_t first_arg = 0;
+ ShadowFrameAllocaUniquePtr shadow_frame_unique_ptr =
+ CREATE_SHADOW_FRAME(num_vregs, /* link */ nullptr, resolved_method, dex_pc);
+ ShadowFrame* shadow_frame = shadow_frame_unique_ptr.get();
+ ScopedStackedShadowFramePusher
+ frame_pusher(self, shadow_frame, StackedShadowFrameType::kShadowFrameUnderConstruction);
+ BuildQuickShadowFrameVisitor shadow_frame_builder(sp,
+ kMethodIsStatic,
+ shorty,
+ strlen(shorty),
+ shadow_frame,
+ first_arg);
+ shadow_frame_builder.VisitArguments();
+
+ // Push a transition back into managed code onto the linked list in thread.
+ ManagedStack fragment;
+ self->PushManagedStackFragment(&fragment);
+
+ // Call DoInvokePolymorphic with |is_range| = true, as shadow frame has argument registers in
+ // consecutive order.
+ uint32_t unused_args[Instruction::kMaxVarArgRegs] = {};
+ uint32_t first_callee_arg = first_arg + 1;
+ const bool do_assignability_check = false;
+ if (!DoInvokePolymorphic<true /* is_range */, do_assignability_check>(self,
+ resolved_method,
+ *shadow_frame,
+ method_handle,
+ method_type,
+ unused_args,
+ first_callee_arg,
+ result)) {
+ DCHECK(self->IsExceptionPending());
+ }
+
+ // Pop transition record.
+ self->PopManagedStackFragment(fragment);
+
+ return static_cast<uintptr_t>(shorty[0]);
+}
+
} // namespace art
diff --git a/runtime/entrypoints_order_test.cc b/runtime/entrypoints_order_test.cc
index 6866abb6ae..8e84d76e83 100644
--- a/runtime/entrypoints_order_test.cc
+++ b/runtime/entrypoints_order_test.cc
@@ -117,15 +117,14 @@ class EntrypointsOrderTest : public CommonRuntimeTest {
sizeof(void*));
EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, checkpoint_function, active_suspend_barriers,
sizeof(void*));
- EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, active_suspend_barriers, jni_entrypoints,
+ EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, active_suspend_barriers, thread_local_start,
sizeof(Thread::tls_ptr_sized_values::active_suspend_barriers));
-
- // Skip across the entrypoints structures.
-
EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, thread_local_start, thread_local_pos, sizeof(void*));
EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, thread_local_pos, thread_local_end, sizeof(void*));
EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, thread_local_end, thread_local_objects, sizeof(void*));
- EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, thread_local_objects, mterp_current_ibase, sizeof(size_t));
+ EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, thread_local_objects, jni_entrypoints, sizeof(size_t));
+
+ // Skip across the entrypoints structures.
EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, mterp_current_ibase, mterp_default_ibase, sizeof(void*));
EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, mterp_default_ibase, mterp_alt_ibase, sizeof(void*));
EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, mterp_alt_ibase, rosalloc_runs, sizeof(void*));
@@ -151,23 +150,16 @@ class EntrypointsOrderTest : public CommonRuntimeTest {
}
void CheckQuickEntryPoints() {
- CHECKED(OFFSETOF_MEMBER(QuickEntryPoints, pAllocArray) == 0,
- QuickEntryPoints_start_with_allocarray);
- EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pAllocArray, pAllocArrayResolved, sizeof(void*));
- EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pAllocArrayResolved, pAllocArrayWithAccessCheck,
- sizeof(void*));
- EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pAllocArrayWithAccessCheck, pAllocObjectResolved,
+ CHECKED(OFFSETOF_MEMBER(QuickEntryPoints, pAllocArrayResolved) == 0,
+ QuickEntryPoints_start_with_allocarray_resoved);
+ EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pAllocArrayResolved, pAllocObjectResolved,
sizeof(void*));
EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pAllocObjectResolved, pAllocObjectInitialized,
sizeof(void*));
EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pAllocObjectInitialized, pAllocObjectWithChecks,
sizeof(void*));
- EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pAllocObjectWithChecks, pCheckAndAllocArray,
+ EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pAllocObjectWithChecks, pAllocStringFromBytes,
sizeof(void*));
- EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pCheckAndAllocArray, pCheckAndAllocArrayWithAccessCheck,
- sizeof(void*));
- EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pCheckAndAllocArrayWithAccessCheck,
- pAllocStringFromBytes, sizeof(void*));
EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pAllocStringFromBytes, pAllocStringFromChars,
sizeof(void*));
EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pAllocStringFromChars, pAllocStringFromString,
@@ -206,13 +198,8 @@ class EntrypointsOrderTest : public CommonRuntimeTest {
EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pGet64Instance, pGet64Static, sizeof(void*));
EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pGet64Static, pGetObjInstance, sizeof(void*));
EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pGetObjInstance, pGetObjStatic, sizeof(void*));
- EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pGetObjStatic, pAputObjectWithNullAndBoundCheck,
- sizeof(void*));
- EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pAputObjectWithNullAndBoundCheck,
- pAputObjectWithBoundCheck, sizeof(void*));
- EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pAputObjectWithBoundCheck, pAputObject, sizeof(void*));
- EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pAputObject, pHandleFillArrayData, sizeof(void*));
- EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pHandleFillArrayData, pJniMethodStart, sizeof(void*));
+ EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pGetObjStatic, pAputObject, sizeof(void*));
+ EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pAputObject, pJniMethodStart, sizeof(void*));
EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pJniMethodStart, pJniMethodFastStart,
sizeof(void*));
EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pJniMethodFastStart, pJniMethodStartSynchronized,
@@ -286,6 +273,8 @@ class EntrypointsOrderTest : public CommonRuntimeTest {
EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pInvokeSuperTrampolineWithAccessCheck,
pInvokeVirtualTrampolineWithAccessCheck, sizeof(void*));
EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pInvokeVirtualTrampolineWithAccessCheck,
+ pInvokePolymorphic, sizeof(void*));
+ EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pInvokePolymorphic,
pTestSuspend, sizeof(void*));
EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pTestSuspend, pDeliverException, sizeof(void*));
diff --git a/runtime/gc/collector/concurrent_copying.cc b/runtime/gc/collector/concurrent_copying.cc
index 7b86339663..6044053b4f 100644
--- a/runtime/gc/collector/concurrent_copying.cc
+++ b/runtime/gc/collector/concurrent_copying.cc
@@ -846,7 +846,7 @@ void ConcurrentCopying::IssueEmptyCheckpoint() {
// Some threads in 'runnable_thread_ids' are probably stuck. Try to dump their stacks.
// Avoid using ThreadList::Dump() initially because it is likely to get stuck as well.
{
- ReaderMutexLock mu0(self, *Locks::mutator_lock_);
+ ScopedObjectAccess soa(self);
MutexLock mu1(self, *Locks::thread_list_lock_);
for (Thread* thread : thread_list->GetList()) {
uint32_t tid = thread->GetThreadId();
diff --git a/runtime/gc/space/large_object_space.cc b/runtime/gc/space/large_object_space.cc
index e71a397039..4c6b5bfadd 100644
--- a/runtime/gc/space/large_object_space.cc
+++ b/runtime/gc/space/large_object_space.cc
@@ -141,16 +141,6 @@ mirror::Object* LargeObjectMapSpace::Alloc(Thread* self, size_t num_bytes,
return nullptr;
}
mirror::Object* const obj = reinterpret_cast<mirror::Object*>(mem_map->Begin());
- if (kIsDebugBuild) {
- ReaderMutexLock mu2(Thread::Current(), *Locks::heap_bitmap_lock_);
- auto* heap = Runtime::Current()->GetHeap();
- auto* live_bitmap = heap->GetLiveBitmap();
- auto* space_bitmap = live_bitmap->GetContinuousSpaceBitmap(obj);
- CHECK(space_bitmap == nullptr) << obj << " overlaps with bitmap " << *space_bitmap;
- auto* obj_end = reinterpret_cast<mirror::Object*>(mem_map->End());
- space_bitmap = live_bitmap->GetContinuousSpaceBitmap(obj_end - 1);
- CHECK(space_bitmap == nullptr) << obj_end << " overlaps with bitmap " << *space_bitmap;
- }
MutexLock mu(self, lock_);
large_objects_.Put(obj, LargeObject {mem_map, false /* not zygote */});
const size_t allocation_size = mem_map->BaseSize();
diff --git a/runtime/generated/asm_support_gen.h b/runtime/generated/asm_support_gen.h
index bebcd71951..af57397f96 100644
--- a/runtime/generated/asm_support_gen.h
+++ b/runtime/generated/asm_support_gen.h
@@ -60,17 +60,13 @@ DEFINE_CHECK_EQ(static_cast<uint32_t>(ACCESS_FLAGS_CLASS_IS_FINALIZABLE_BIT), (s
DEFINE_CHECK_EQ(static_cast<int32_t>(ART_METHOD_DEX_CACHE_METHODS_OFFSET_32), (static_cast<int32_t>(art::ArtMethod:: DexCacheResolvedMethodsOffset(art::PointerSize::k32).Int32Value())))
#define ART_METHOD_DEX_CACHE_METHODS_OFFSET_64 24
DEFINE_CHECK_EQ(static_cast<int32_t>(ART_METHOD_DEX_CACHE_METHODS_OFFSET_64), (static_cast<int32_t>(art::ArtMethod:: DexCacheResolvedMethodsOffset(art::PointerSize::k64).Int32Value())))
-#define ART_METHOD_DEX_CACHE_TYPES_OFFSET_32 24
-DEFINE_CHECK_EQ(static_cast<int32_t>(ART_METHOD_DEX_CACHE_TYPES_OFFSET_32), (static_cast<int32_t>(art::ArtMethod:: DexCacheResolvedTypesOffset(art::PointerSize::k32).Int32Value())))
-#define ART_METHOD_DEX_CACHE_TYPES_OFFSET_64 32
-DEFINE_CHECK_EQ(static_cast<int32_t>(ART_METHOD_DEX_CACHE_TYPES_OFFSET_64), (static_cast<int32_t>(art::ArtMethod:: DexCacheResolvedTypesOffset(art::PointerSize::k64).Int32Value())))
-#define ART_METHOD_JNI_OFFSET_32 28
+#define ART_METHOD_JNI_OFFSET_32 24
DEFINE_CHECK_EQ(static_cast<int32_t>(ART_METHOD_JNI_OFFSET_32), (static_cast<int32_t>(art::ArtMethod:: EntryPointFromJniOffset(art::PointerSize::k32).Int32Value())))
-#define ART_METHOD_JNI_OFFSET_64 40
+#define ART_METHOD_JNI_OFFSET_64 32
DEFINE_CHECK_EQ(static_cast<int32_t>(ART_METHOD_JNI_OFFSET_64), (static_cast<int32_t>(art::ArtMethod:: EntryPointFromJniOffset(art::PointerSize::k64).Int32Value())))
-#define ART_METHOD_QUICK_CODE_OFFSET_32 32
+#define ART_METHOD_QUICK_CODE_OFFSET_32 28
DEFINE_CHECK_EQ(static_cast<int32_t>(ART_METHOD_QUICK_CODE_OFFSET_32), (static_cast<int32_t>(art::ArtMethod:: EntryPointFromQuickCompiledCodeOffset(art::PointerSize::k32).Int32Value())))
-#define ART_METHOD_QUICK_CODE_OFFSET_64 48
+#define ART_METHOD_QUICK_CODE_OFFSET_64 40
DEFINE_CHECK_EQ(static_cast<int32_t>(ART_METHOD_QUICK_CODE_OFFSET_64), (static_cast<int32_t>(art::ArtMethod:: EntryPointFromQuickCompiledCodeOffset(art::PointerSize::k64).Int32Value())))
#define ART_METHOD_DECLARING_CLASS_OFFSET 0
DEFINE_CHECK_EQ(static_cast<int32_t>(ART_METHOD_DECLARING_CLASS_OFFSET), (static_cast<int32_t>(art::ArtMethod:: DeclaringClassOffset().Int32Value())))
diff --git a/runtime/image.cc b/runtime/image.cc
index 2ef60c3e07..6d8889532f 100644
--- a/runtime/image.cc
+++ b/runtime/image.cc
@@ -25,7 +25,7 @@
namespace art {
const uint8_t ImageHeader::kImageMagic[] = { 'a', 'r', 't', '\n' };
-const uint8_t ImageHeader::kImageVersion[] = { '0', '3', '4', '\0' }; // mirror::Class update
+const uint8_t ImageHeader::kImageVersion[] = { '0', '3', '5', '\0' }; // ArtMethod update
ImageHeader::ImageHeader(uint32_t image_begin,
uint32_t image_size,
diff --git a/runtime/interpreter/interpreter_common.cc b/runtime/interpreter/interpreter_common.cc
index ca26207093..28bcb97105 100644
--- a/runtime/interpreter/interpreter_common.cc
+++ b/runtime/interpreter/interpreter_common.cc
@@ -596,7 +596,7 @@ bool DoInvokePolymorphic(Thread* self,
// Get the register arguments for the invoke.
inst->GetVarArgs(args, inst_data);
// Drop the first register which is the method handle performing the invoke.
- memcpy(args, args + 1, sizeof(args[0]) * (Instruction::kMaxVarArgRegs - 1));
+ memmove(args, args + 1, sizeof(args[0]) * (Instruction::kMaxVarArgRegs - 1));
args[Instruction::kMaxVarArgRegs - 1] = 0;
return DoInvokePolymorphic<is_range, do_access_check>(self,
invoke_method,
@@ -751,16 +751,14 @@ static inline bool DoCallCommon(ArtMethod* called_method,
case 'L': {
ObjPtr<mirror::Object> o = shadow_frame.GetVRegReference(src_reg);
if (do_assignability_check && o != nullptr) {
- PointerSize pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
const dex::TypeIndex type_idx = params->GetTypeItem(shorty_pos).type_idx_;
- ObjPtr<mirror::Class> arg_type = method->GetDexCacheResolvedType(type_idx,
- pointer_size);
+ ObjPtr<mirror::Class> arg_type = method->GetDexCache()->GetResolvedType(type_idx);
if (arg_type == nullptr) {
StackHandleScope<1> hs(self);
// Preserve o since it is used below and GetClassFromTypeIndex may cause thread
// suspension.
HandleWrapperObjPtr<mirror::Object> h = hs.NewHandleWrapper(&o);
- arg_type = method->GetClassFromTypeIndex(type_idx, true /* resolve */, pointer_size);
+ arg_type = method->GetClassFromTypeIndex(type_idx, true /* resolve */);
if (arg_type == nullptr) {
CHECK(self->IsExceptionPending());
return false;
diff --git a/runtime/interpreter/interpreter_switch_impl.cc b/runtime/interpreter/interpreter_switch_impl.cc
index d7dfcd4408..a77a3fc2b3 100644
--- a/runtime/interpreter/interpreter_switch_impl.cc
+++ b/runtime/interpreter/interpreter_switch_impl.cc
@@ -285,9 +285,7 @@ JValue ExecuteSwitchImpl(Thread* self, const DexFile::CodeItem* code_item,
const size_t ref_idx = inst->VRegA_11x(inst_data);
ObjPtr<mirror::Object> obj_result = shadow_frame.GetVRegReference(ref_idx);
if (do_assignability_check && obj_result != nullptr) {
- PointerSize pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
- ObjPtr<mirror::Class> return_type = method->GetReturnType(true /* resolve */,
- pointer_size);
+ ObjPtr<mirror::Class> return_type = method->GetReturnType(true /* resolve */);
// Re-load since it might have moved.
obj_result = shadow_frame.GetVRegReference(ref_idx);
if (return_type == nullptr) {
diff --git a/runtime/jit/jit.cc b/runtime/jit/jit.cc
index b7125a8a43..2bb8819cb3 100644
--- a/runtime/jit/jit.cc
+++ b/runtime/jit/jit.cc
@@ -26,7 +26,7 @@
#include "jit_code_cache.h"
#include "oat_file_manager.h"
#include "oat_quick_method_header.h"
-#include "offline_profiling_info.h"
+#include "profile_compilation_info.h"
#include "profile_saver.h"
#include "runtime.h"
#include "runtime_options.h"
diff --git a/runtime/jit/jit.h b/runtime/jit/jit.h
index 05c390590b..4112142a4f 100644
--- a/runtime/jit/jit.h
+++ b/runtime/jit/jit.h
@@ -25,7 +25,7 @@
#include "jit/profile_saver_options.h"
#include "obj_ptr.h"
#include "object_callbacks.h"
-#include "offline_profiling_info.h"
+#include "profile_compilation_info.h"
#include "thread_pool.h"
namespace art {
diff --git a/runtime/jit/offline_profiling_info.cc b/runtime/jit/profile_compilation_info.cc
index 6f2a8c673f..1405c40096 100644
--- a/runtime/jit/offline_profiling_info.cc
+++ b/runtime/jit/profile_compilation_info.cc
@@ -14,7 +14,7 @@
* limitations under the License.
*/
-#include "offline_profiling_info.h"
+#include "profile_compilation_info.h"
#include "errno.h"
#include <limits.h>
diff --git a/runtime/jit/offline_profiling_info.h b/runtime/jit/profile_compilation_info.h
index 53d0eea932..f8061bcfd8 100644
--- a/runtime/jit/offline_profiling_info.h
+++ b/runtime/jit/profile_compilation_info.h
@@ -14,8 +14,8 @@
* limitations under the License.
*/
-#ifndef ART_RUNTIME_JIT_OFFLINE_PROFILING_INFO_H_
-#define ART_RUNTIME_JIT_OFFLINE_PROFILING_INFO_H_
+#ifndef ART_RUNTIME_JIT_PROFILE_COMPILATION_INFO_H_
+#define ART_RUNTIME_JIT_PROFILE_COMPILATION_INFO_H_
#include <set>
#include <vector>
@@ -29,7 +29,6 @@
namespace art {
-// TODO: rename file.
/**
* Profile information in a format suitable to be queried by the compiler and
* performing profile guided compilation.
@@ -187,4 +186,4 @@ class ProfileCompilationInfo {
} // namespace art
-#endif // ART_RUNTIME_JIT_OFFLINE_PROFILING_INFO_H_
+#endif // ART_RUNTIME_JIT_PROFILE_COMPILATION_INFO_H_
diff --git a/runtime/jit/profile_compilation_info_test.cc b/runtime/jit/profile_compilation_info_test.cc
index 1dd1e36e74..835a5f3495 100644
--- a/runtime/jit/profile_compilation_info_test.cc
+++ b/runtime/jit/profile_compilation_info_test.cc
@@ -25,7 +25,7 @@
#include "mirror/class-inl.h"
#include "mirror/class_loader.h"
#include "handle_scope-inl.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
#include "scoped_thread_state_change-inl.h"
namespace art {
diff --git a/runtime/jit/profile_saver.h b/runtime/jit/profile_saver.h
index 59e2c94790..9c5e41fd13 100644
--- a/runtime/jit/profile_saver.h
+++ b/runtime/jit/profile_saver.h
@@ -19,7 +19,7 @@
#include "base/mutex.h"
#include "jit_code_cache.h"
-#include "offline_profiling_info.h"
+#include "profile_compilation_info.h"
#include "profile_saver_options.h"
#include "safe_map.h"
diff --git a/runtime/jni_env_ext.cc b/runtime/jni_env_ext.cc
index 5a3fafa726..0148a1c3b0 100644
--- a/runtime/jni_env_ext.cc
+++ b/runtime/jni_env_ext.cc
@@ -29,6 +29,7 @@
#include "mirror/object-inl.h"
#include "nth_caller_visitor.h"
#include "thread-inl.h"
+#include "thread_list.h"
namespace art {
@@ -37,6 +38,8 @@ using android::base::StringPrintf;
static constexpr size_t kMonitorsInitial = 32; // Arbitrary.
static constexpr size_t kMonitorsMax = 4096; // Arbitrary sanity check.
+const JNINativeInterface* JNIEnvExt::table_override_ = nullptr;
+
// Checking "locals" requires the mutator lock, but at creation time we're really only interested
// in validity, which isn't changing. To avoid grabbing the mutator lock, factored out and tagged
// with NO_THREAD_SAFETY_ANALYSIS.
@@ -78,10 +81,10 @@ JNIEnvExt::JNIEnvExt(Thread* self_in, JavaVMExt* vm_in, std::string* error_msg)
runtime_deleted(false),
critical(0),
monitors("monitors", kMonitorsInitial, kMonitorsMax) {
- functions = unchecked_functions = GetJniNativeInterface();
- if (vm->IsCheckJniEnabled()) {
- SetCheckJniEnabled(true);
- }
+ MutexLock mu(Thread::Current(), *Locks::jni_function_table_lock_);
+ check_jni = vm->IsCheckJniEnabled();
+ functions = GetFunctionTable(check_jni);
+ unchecked_functions = GetJniNativeInterface();
}
void JNIEnvExt::SetFunctionsToRuntimeShutdownFunctions() {
@@ -107,7 +110,12 @@ void JNIEnvExt::DeleteLocalRef(jobject obj) {
void JNIEnvExt::SetCheckJniEnabled(bool enabled) {
check_jni = enabled;
- functions = enabled ? GetCheckJniNativeInterface() : GetJniNativeInterface();
+ MutexLock mu(Thread::Current(), *Locks::jni_function_table_lock_);
+ functions = GetFunctionTable(enabled);
+ // Check whether this is a no-op because of override.
+ if (enabled && JNIEnvExt::table_override_ != nullptr) {
+ LOG(WARNING) << "Enabling CheckJNI after a JNIEnv function table override is not functional.";
+ }
}
void JNIEnvExt::DumpReferenceTables(std::ostream& os) {
@@ -269,4 +277,33 @@ void JNIEnvExt::CheckNoHeldMonitors() {
}
}
+static void ThreadResetFunctionTable(Thread* thread, void* arg ATTRIBUTE_UNUSED)
+ REQUIRES(Locks::jni_function_table_lock_) {
+ JNIEnvExt* env = thread->GetJniEnv();
+ bool check_jni = env->check_jni;
+ env->functions = JNIEnvExt::GetFunctionTable(check_jni);
+}
+
+void JNIEnvExt::SetTableOverride(const JNINativeInterface* table_override) {
+ MutexLock mu(Thread::Current(), *Locks::thread_list_lock_);
+ MutexLock mu2(Thread::Current(), *Locks::jni_function_table_lock_);
+
+ JNIEnvExt::table_override_ = table_override;
+
+ // See if we have a runtime. Note: we cannot run other code (like JavaVMExt's CheckJNI install
+ // code), as we'd have to recursively lock the mutex.
+ Runtime* runtime = Runtime::Current();
+ if (runtime != nullptr) {
+ runtime->GetThreadList()->ForEach(ThreadResetFunctionTable, nullptr);
+ }
+}
+
+const JNINativeInterface* JNIEnvExt::GetFunctionTable(bool check_jni) {
+ const JNINativeInterface* override = JNIEnvExt::table_override_;
+ if (override != nullptr) {
+ return override;
+ }
+ return check_jni ? GetCheckJniNativeInterface() : GetJniNativeInterface();
+}
+
} // namespace art
diff --git a/runtime/jni_env_ext.h b/runtime/jni_env_ext.h
index 5cca0aef9b..4004c457b5 100644
--- a/runtime/jni_env_ext.h
+++ b/runtime/jni_env_ext.h
@@ -43,7 +43,7 @@ struct JNIEnvExt : public JNIEnv {
void DumpReferenceTables(std::ostream& os)
REQUIRES_SHARED(Locks::mutator_lock_);
- void SetCheckJniEnabled(bool enabled);
+ void SetCheckJniEnabled(bool enabled) REQUIRES(!Locks::jni_function_table_lock_);
void PushFrame(int capacity) REQUIRES_SHARED(Locks::mutator_lock_);
void PopFrame() REQUIRES_SHARED(Locks::mutator_lock_);
@@ -104,10 +104,27 @@ struct JNIEnvExt : public JNIEnv {
// Set the functions to the runtime shutdown functions.
void SetFunctionsToRuntimeShutdownFunctions();
+ // Set the function table override. This will install the override (or original table, if null)
+ // to all threads.
+ // Note: JNI function table overrides are sensitive to the order of operations wrt/ CheckJNI.
+ // After overriding the JNI function table, CheckJNI toggling is ignored.
+ static void SetTableOverride(const JNINativeInterface* table_override)
+ REQUIRES(!Locks::thread_list_lock_, !Locks::jni_function_table_lock_);
+
+ // Return either the regular, or the CheckJNI function table. Will return table_override_ instead
+ // if it is not null.
+ static const JNINativeInterface* GetFunctionTable(bool check_jni)
+ REQUIRES(Locks::jni_function_table_lock_);
+
private:
+ // Override of function tables. This applies to both default as well as instrumented (CheckJNI)
+ // function tables.
+ static const JNINativeInterface* table_override_ GUARDED_BY(Locks::jni_function_table_lock_);
+
// The constructor should not be called directly. It may leave the object in an erroneous state,
// and the result needs to be checked.
- JNIEnvExt(Thread* self, JavaVMExt* vm, std::string* error_msg);
+ JNIEnvExt(Thread* self, JavaVMExt* vm, std::string* error_msg)
+ REQUIRES(!Locks::jni_function_table_lock_);
// All locked objects, with the (Java caller) stack frame that locked them. Used in CheckJNI
// to ensure that only monitors locked in this native frame are being unlocked, and that at
diff --git a/runtime/jni_internal_test.cc b/runtime/jni_internal_test.cc
index 4da5e23502..08d1eeb95d 100644
--- a/runtime/jni_internal_test.cc
+++ b/runtime/jni_internal_test.cc
@@ -2346,4 +2346,39 @@ TEST_F(JniInternalTest, JNIEnvExtOffsets) {
EXPECT_EQ(segment_state_now, segment_state_computed);
}
+static size_t gGlobalRefCount = 0;
+static const JNINativeInterface* gOriginalEnv = nullptr;
+
+static jobject CountNewGlobalRef(JNIEnv* env, jobject o) {
+ ++gGlobalRefCount;
+ return gOriginalEnv->NewGlobalRef(env, o);
+}
+
+// Test the table override.
+TEST_F(JniInternalTest, JNIEnvExtTableOverride) {
+ JNINativeInterface env_override;
+ memcpy(&env_override, env_->functions, sizeof(JNINativeInterface));
+
+ gOriginalEnv = env_->functions;
+ env_override.NewGlobalRef = CountNewGlobalRef;
+ gGlobalRefCount = 0;
+
+ jclass local = env_->FindClass("java/lang/Object");
+ ASSERT_TRUE(local != nullptr);
+
+ // Set the table, add a global ref, see whether the counter increases.
+ JNIEnvExt::SetTableOverride(&env_override);
+
+ jobject global = env_->NewGlobalRef(local);
+ EXPECT_EQ(1u, gGlobalRefCount);
+ env_->DeleteGlobalRef(global);
+
+ // Reset
+ JNIEnvExt::SetTableOverride(nullptr);
+
+ jobject global2 = env_->NewGlobalRef(local);
+ EXPECT_EQ(1u, gGlobalRefCount);
+ env_->DeleteGlobalRef(global2);
+}
+
} // namespace art
diff --git a/runtime/memory_region.h b/runtime/memory_region.h
index f018c1f4c1..fe3f917c76 100644
--- a/runtime/memory_region.h
+++ b/runtime/memory_region.h
@@ -148,14 +148,14 @@ class MemoryRegion FINAL : public ValueObject {
void CopyFrom(size_t offset, const MemoryRegion& from) const;
// Compute a sub memory region based on an existing one.
- MemoryRegion Subregion(uintptr_t offset, uintptr_t size_in) const {
+ ALWAYS_INLINE MemoryRegion Subregion(uintptr_t offset, uintptr_t size_in) const {
CHECK_GE(this->size(), size_in);
CHECK_LE(offset, this->size() - size_in);
return MemoryRegion(reinterpret_cast<void*>(start() + offset), size_in);
}
// Compute an extended memory region based on an existing one.
- void Extend(const MemoryRegion& region, uintptr_t extra) {
+ ALWAYS_INLINE void Extend(const MemoryRegion& region, uintptr_t extra) {
pointer_ = region.pointer();
size_ = (region.size() + extra);
}
diff --git a/runtime/mirror/class_ext.cc b/runtime/mirror/class_ext.cc
index 7c6a710cef..efd949e031 100644
--- a/runtime/mirror/class_ext.cc
+++ b/runtime/mirror/class_ext.cc
@@ -113,6 +113,11 @@ void ClassExt::SetVerifyError(ObjPtr<Object> err) {
}
}
+void ClassExt::SetOriginalDexFileBytes(ObjPtr<ByteArray> bytes) {
+ DCHECK(!Runtime::Current()->IsActiveTransaction());
+ SetFieldObject<false>(OFFSET_OF_OBJECT_MEMBER(ClassExt, original_dex_file_bytes_), bytes);
+}
+
void ClassExt::SetClass(ObjPtr<Class> dalvik_system_ClassExt) {
CHECK(dalvik_system_ClassExt != nullptr);
dalvik_system_ClassExt_ = GcRoot<Class>(dalvik_system_ClassExt);
diff --git a/runtime/mirror/class_ext.h b/runtime/mirror/class_ext.h
index 91046314db..ad8a61b676 100644
--- a/runtime/mirror/class_ext.h
+++ b/runtime/mirror/class_ext.h
@@ -61,6 +61,12 @@ class MANAGED ClassExt : public Object {
return GetFieldObject<PointerArray>(OFFSET_OF_OBJECT_MEMBER(ClassExt, obsolete_methods_));
}
+ ByteArray* GetOriginalDexFileBytes() REQUIRES_SHARED(Locks::mutator_lock_) {
+ return GetFieldObject<ByteArray>(OFFSET_OF_OBJECT_MEMBER(ClassExt, original_dex_file_bytes_));
+ }
+
+ void SetOriginalDexFileBytes(ObjPtr<ByteArray> bytes) REQUIRES_SHARED(Locks::mutator_lock_);
+
void SetObsoleteArrays(ObjPtr<PointerArray> methods, ObjPtr<ObjectArray<DexCache>> dex_caches)
REQUIRES_SHARED(Locks::mutator_lock_);
@@ -80,7 +86,7 @@ class MANAGED ClassExt : public Object {
HeapReference<PointerArray> obsolete_methods_;
- HeapReference<DexCache> original_dex_cache_;
+ HeapReference<ByteArray> original_dex_file_bytes_;
// The saved verification error of this class.
HeapReference<Object> verify_error_;
diff --git a/runtime/mirror/dex_cache_test.cc b/runtime/mirror/dex_cache_test.cc
index 916f1cf1ef..8f978e122c 100644
--- a/runtime/mirror/dex_cache_test.cc
+++ b/runtime/mirror/dex_cache_test.cc
@@ -35,7 +35,6 @@ class DexCacheMethodHandlesTest : public DexCacheTest {
protected:
virtual void SetUpRuntimeOptions(RuntimeOptions* options) OVERRIDE {
CommonRuntimeTest::SetUpRuntimeOptions(options);
- options->push_back(std::make_pair("-Xexperimental:method-handles", nullptr));
}
};
diff --git a/runtime/mirror/emulated_stack_frame.cc b/runtime/mirror/emulated_stack_frame.cc
index d607040486..978cc32320 100644
--- a/runtime/mirror/emulated_stack_frame.cc
+++ b/runtime/mirror/emulated_stack_frame.cc
@@ -195,6 +195,7 @@ mirror::EmulatedStackFrame* EmulatedStackFrame::CreateFromShadowFrameAndArgs(
// Step 5: Construct the EmulatedStackFrame object.
Handle<EmulatedStackFrame> sf(hs.NewHandle(
ObjPtr<EmulatedStackFrame>::DownCast(StaticClass()->AllocObject(self))));
+ sf->SetFieldObject<false>(CallsiteTypeOffset(), caller_type.Get());
sf->SetFieldObject<false>(TypeOffset(), callee_type.Get());
sf->SetFieldObject<false>(ReferencesOffset(), references.Get());
sf->SetFieldObject<false>(StackFrameOffset(), stack_frame.Get());
diff --git a/runtime/mirror/emulated_stack_frame.h b/runtime/mirror/emulated_stack_frame.h
index d83a53652b..ddd84a167d 100644
--- a/runtime/mirror/emulated_stack_frame.h
+++ b/runtime/mirror/emulated_stack_frame.h
@@ -81,6 +81,10 @@ class MANAGED EmulatedStackFrame : public Object {
OFFSET_OF_OBJECT_MEMBER(EmulatedStackFrame, stack_frame_));
}
+ static MemberOffset CallsiteTypeOffset() {
+ return MemberOffset(OFFSETOF_MEMBER(EmulatedStackFrame, callsite_type_));
+ }
+
static MemberOffset TypeOffset() {
return MemberOffset(OFFSETOF_MEMBER(EmulatedStackFrame, type_));
}
@@ -93,6 +97,7 @@ class MANAGED EmulatedStackFrame : public Object {
return MemberOffset(OFFSETOF_MEMBER(EmulatedStackFrame, stack_frame_));
}
+ HeapReference<mirror::MethodType> callsite_type_;
HeapReference<mirror::ObjectArray<mirror::Object>> references_;
HeapReference<mirror::ByteArray> stack_frame_;
HeapReference<mirror::MethodType> type_;
diff --git a/runtime/mirror/object_test.cc b/runtime/mirror/object_test.cc
index a6f56aee42..6a4ec9dca7 100644
--- a/runtime/mirror/object_test.cc
+++ b/runtime/mirror/object_test.cc
@@ -306,23 +306,6 @@ TEST_F(ObjectTest, PrimitiveArray_Float_Alloc) {
}
-TEST_F(ObjectTest, CheckAndAllocArrayFromCode) {
- // pretend we are trying to call 'new char[3]' from String.toCharArray
- ScopedObjectAccess soa(Thread::Current());
- Class* java_util_Arrays = class_linker_->FindSystemClass(soa.Self(), "Ljava/util/Arrays;");
- ArtMethod* sort = java_util_Arrays->FindDirectMethod("sort", "([I)V", kRuntimePointerSize);
- const DexFile::TypeId* type_id = java_lang_dex_file_->FindTypeId("[I");
- ASSERT_TRUE(type_id != nullptr);
- dex::TypeIndex type_idx = java_lang_dex_file_->GetIndexForTypeId(*type_id);
- Object* array = CheckAndAllocArrayFromCodeInstrumented(
- type_idx, 3, sort, Thread::Current(), false,
- Runtime::Current()->GetHeap()->GetCurrentAllocator());
- EXPECT_TRUE(array->IsArrayInstance());
- EXPECT_EQ(3, array->AsArray()->GetLength());
- EXPECT_TRUE(array->GetClass()->IsArrayClass());
- EXPECT_TRUE(array->GetClass()->GetComponentType()->IsPrimitive());
-}
-
TEST_F(ObjectTest, CreateMultiArray) {
ScopedObjectAccess soa(Thread::Current());
diff --git a/runtime/native/java_lang_Class.cc b/runtime/native/java_lang_Class.cc
index 3341f531e4..5438a6ddb4 100644
--- a/runtime/native/java_lang_Class.cc
+++ b/runtime/native/java_lang_Class.cc
@@ -428,6 +428,10 @@ static jobjectArray Class_getDeclaredMethodsUnchecked(JNIEnv* env, jobject javaT
}
auto ret = hs.NewHandle(mirror::ObjectArray<mirror::Method>::Alloc(
soa.Self(), mirror::Method::ArrayClass(), num_methods));
+ if (ret.Get() == nullptr) {
+ soa.Self()->AssertPendingOOMException();
+ return nullptr;
+ }
num_methods = 0;
for (auto& m : klass->GetDeclaredMethods(kRuntimePointerSize)) {
auto modifiers = m.GetAccessFlags();
diff --git a/runtime/oat.cc b/runtime/oat.cc
index 1a07cdc7f3..d14b399a9a 100644
--- a/runtime/oat.cc
+++ b/runtime/oat.cc
@@ -473,6 +473,10 @@ bool OatHeader::IsDebuggable() const {
return IsKeyEnabled(OatHeader::kDebuggableKey);
}
+bool OatHeader::IsConcurrentCopying() const {
+ return IsKeyEnabled(OatHeader::kConcurrentCopying);
+}
+
bool OatHeader::IsNativeDebuggable() const {
return IsKeyEnabled(OatHeader::kNativeDebuggableKey);
}
diff --git a/runtime/oat.h b/runtime/oat.h
index dc103e2b52..953b445e4e 100644
--- a/runtime/oat.h
+++ b/runtime/oat.h
@@ -32,7 +32,7 @@ class InstructionSetFeatures;
class PACKED(4) OatHeader {
public:
static constexpr uint8_t kOatMagic[] = { 'o', 'a', 't', '\n' };
- static constexpr uint8_t kOatVersion[] = { '0', '9', '5', '\0' }; // alloc entrypoints change
+ static constexpr uint8_t kOatVersion[] = { '1', '0', '2', '\0' }; // Enabling CC
static constexpr const char* kImageLocationKey = "image-location";
static constexpr const char* kDex2OatCmdLineKey = "dex2oat-cmdline";
@@ -43,6 +43,7 @@ class PACKED(4) OatHeader {
static constexpr const char* kCompilerFilter = "compiler-filter";
static constexpr const char* kClassPathKey = "classpath";
static constexpr const char* kBootClassPathKey = "bootclasspath";
+ static constexpr const char* kConcurrentCopying = "concurrent-copying";
static constexpr const char kTrueValue[] = "true";
static constexpr const char kFalseValue[] = "false";
@@ -112,6 +113,7 @@ class PACKED(4) OatHeader {
bool IsDebuggable() const;
bool IsNativeDebuggable() const;
CompilerFilter::Filter GetCompilerFilter() const;
+ bool IsConcurrentCopying() const;
private:
bool KeyHasValue(const char* key, const char* value, size_t value_size) const;
diff --git a/runtime/oat_file.cc b/runtime/oat_file.cc
index 38df427ed1..d47f1b5611 100644
--- a/runtime/oat_file.cc
+++ b/runtime/oat_file.cc
@@ -323,8 +323,10 @@ bool OatFileBase::Setup(const char* abs_dex_location, std::string* error_msg) {
}
PointerSize pointer_size = GetInstructionSetPointerSize(GetOatHeader().GetInstructionSet());
- uint8_t* dex_cache_arrays = bss_begin_;
- uint8_t* dex_cache_arrays_end = (bss_roots_ != nullptr) ? bss_roots_ : bss_end_;
+ uint8_t* dex_cache_arrays = (bss_begin_ == bss_roots_) ? nullptr : bss_begin_;
+ uint8_t* dex_cache_arrays_end =
+ (bss_begin_ == bss_roots_) ? nullptr : (bss_roots_ != nullptr) ? bss_roots_ : bss_end_;
+ DCHECK_EQ(dex_cache_arrays != nullptr, dex_cache_arrays_end != nullptr);
uint32_t dex_file_count = GetOatHeader().GetDexFileCount();
oat_dex_files_storage_.reserve(dex_file_count);
for (size_t i = 0; i < dex_file_count; i++) {
diff --git a/runtime/oat_file_assistant.cc b/runtime/oat_file_assistant.cc
index f12a5e7742..8554fa2693 100644
--- a/runtime/oat_file_assistant.cc
+++ b/runtime/oat_file_assistant.cc
@@ -304,6 +304,13 @@ OatFileAssistant::OatStatus OatFileAssistant::OatFileStatus() {
}
OatFileAssistant::OatStatus OatFileAssistant::GivenOatFileStatus(const OatFile& file) {
+ // Verify the ART_USE_READ_BARRIER state.
+ const bool is_cc = file.GetOatHeader().IsConcurrentCopying();
+ constexpr bool kRuntimeIsCC = kUseReadBarrier;
+ if (is_cc != kRuntimeIsCC) {
+ return kOatCannotOpen;
+ }
+
// Verify the dex checksum.
// Note: GetOatDexFile will return null if the dex checksum doesn't match
// what we provide, which verifies the primary dex checksum for us.
@@ -903,4 +910,3 @@ std::unique_ptr<OatFile> OatFileAssistant::OatFileInfo::ReleaseFileForUse() {
return std::unique_ptr<OatFile>();
}
} // namespace art
-
diff --git a/runtime/oat_file_assistant_test.cc b/runtime/oat_file_assistant_test.cc
index afa804c08c..84eacde8b7 100644
--- a/runtime/oat_file_assistant_test.cc
+++ b/runtime/oat_file_assistant_test.cc
@@ -152,15 +152,17 @@ class OatFileAssistantTest : public Dex2oatEnvironmentTest {
}
}
- if (CompilerFilter::IsBytecodeCompilationEnabled(filter)) {
- if (relocate) {
- EXPECT_EQ(reinterpret_cast<uintptr_t>(image_header->GetOatDataBegin()),
- oat_header.GetImageFileLocationOatDataBegin());
- EXPECT_EQ(image_header->GetPatchDelta(), oat_header.GetImagePatchDelta());
- } else {
- EXPECT_NE(reinterpret_cast<uintptr_t>(image_header->GetOatDataBegin()),
- oat_header.GetImageFileLocationOatDataBegin());
- EXPECT_NE(image_header->GetPatchDelta(), oat_header.GetImagePatchDelta());
+ if (!with_alternate_image) {
+ if (CompilerFilter::IsBytecodeCompilationEnabled(filter)) {
+ if (relocate) {
+ EXPECT_EQ(reinterpret_cast<uintptr_t>(image_header->GetOatDataBegin()),
+ oat_header.GetImageFileLocationOatDataBegin());
+ EXPECT_EQ(image_header->GetPatchDelta(), oat_header.GetImagePatchDelta());
+ } else {
+ EXPECT_NE(reinterpret_cast<uintptr_t>(image_header->GetOatDataBegin()),
+ oat_header.GetImageFileLocationOatDataBegin());
+ EXPECT_NE(image_header->GetPatchDelta(), oat_header.GetImagePatchDelta());
+ }
}
}
}
diff --git a/runtime/openjdkjvmti/Android.bp b/runtime/openjdkjvmti/Android.bp
index 4bd21b4c2f..a731c17d9e 100644
--- a/runtime/openjdkjvmti/Android.bp
+++ b/runtime/openjdkjvmti/Android.bp
@@ -21,15 +21,21 @@ cc_defaults {
"object_tagging.cc",
"OpenjdkJvmTi.cc",
"ti_class.cc",
+ "ti_class_definition.cc",
"ti_field.cc",
"ti_heap.cc",
+ "ti_jni.cc",
"ti_method.cc",
"ti_monitor.cc",
"ti_object.cc",
+ "ti_phase.cc",
"ti_properties.cc",
+ "ti_search.cc",
"ti_stack.cc",
"ti_redefine.cc",
"ti_thread.cc",
+ "ti_threadgroup.cc",
+ "ti_timers.cc",
"transform.cc"],
include_dirs: ["art/runtime"],
shared_libs: [
diff --git a/runtime/openjdkjvmti/OpenjdkJvmTi.cc b/runtime/openjdkjvmti/OpenjdkJvmTi.cc
index 2629c9fc07..fcedd4ee4c 100644
--- a/runtime/openjdkjvmti/OpenjdkJvmTi.cc
+++ b/runtime/openjdkjvmti/OpenjdkJvmTi.cc
@@ -30,6 +30,7 @@
*/
#include <string>
+#include <type_traits>
#include <vector>
#include <jni.h>
@@ -37,6 +38,7 @@
#include "openjdkjvmti/jvmti.h"
#include "art_jvmti.h"
+#include "base/logging.h"
#include "base/mutex.h"
#include "events-inl.h"
#include "jni_env_ext-inl.h"
@@ -49,13 +51,18 @@
#include "ti_class.h"
#include "ti_field.h"
#include "ti_heap.h"
+#include "ti_jni.h"
#include "ti_method.h"
#include "ti_monitor.h"
#include "ti_object.h"
+#include "ti_phase.h"
#include "ti_properties.h"
#include "ti_redefine.h"
+#include "ti_search.h"
#include "ti_stack.h"
#include "ti_thread.h"
+#include "ti_threadgroup.h"
+#include "ti_timers.h"
#include "transform.h"
// TODO Remove this at some point by annotating all the methods. It was put in to make the skeleton
@@ -126,7 +133,7 @@ class JvmtiFunctions {
}
static jvmtiError GetAllThreads(jvmtiEnv* env, jint* threads_count_ptr, jthread** threads_ptr) {
- return ERR(NOT_IMPLEMENTED);
+ return ThreadUtil::GetAllThreads(env, threads_count_ptr, threads_ptr);
}
static jvmtiError SuspendThread(jvmtiEnv* env, jthread thread) {
@@ -188,27 +195,27 @@ class JvmtiFunctions {
jvmtiStartFunction proc,
const void* arg,
jint priority) {
- return ERR(NOT_IMPLEMENTED);
+ return ThreadUtil::RunAgentThread(env, thread, proc, arg, priority);
}
static jvmtiError SetThreadLocalStorage(jvmtiEnv* env, jthread thread, const void* data) {
- return ERR(NOT_IMPLEMENTED);
+ return ThreadUtil::SetThreadLocalStorage(env, thread, data);
}
static jvmtiError GetThreadLocalStorage(jvmtiEnv* env, jthread thread, void** data_ptr) {
- return ERR(NOT_IMPLEMENTED);
+ return ThreadUtil::GetThreadLocalStorage(env, thread, data_ptr);
}
static jvmtiError GetTopThreadGroups(jvmtiEnv* env,
jint* group_count_ptr,
jthreadGroup** groups_ptr) {
- return ERR(NOT_IMPLEMENTED);
+ return ThreadGroupUtil::GetTopThreadGroups(env, group_count_ptr, groups_ptr);
}
static jvmtiError GetThreadGroupInfo(jvmtiEnv* env,
jthreadGroup group,
jvmtiThreadGroupInfo* info_ptr) {
- return ERR(NOT_IMPLEMENTED);
+ return ThreadGroupUtil::GetThreadGroupInfo(env, group, info_ptr);
}
static jvmtiError GetThreadGroupChildren(jvmtiEnv* env,
@@ -217,7 +224,12 @@ class JvmtiFunctions {
jthread** threads_ptr,
jint* group_count_ptr,
jthreadGroup** groups_ptr) {
- return ERR(NOT_IMPLEMENTED);
+ return ThreadGroupUtil::GetThreadGroupChildren(env,
+ group,
+ thread_count_ptr,
+ threads_ptr,
+ group_count_ptr,
+ groups_ptr);
}
static jvmtiError GetStackTrace(jvmtiEnv* env,
@@ -246,11 +258,15 @@ class JvmtiFunctions {
const jthread* thread_list,
jint max_frame_count,
jvmtiStackInfo** stack_info_ptr) {
- return ERR(NOT_IMPLEMENTED);
+ return StackUtil::GetThreadListStackTraces(env,
+ thread_count,
+ thread_list,
+ max_frame_count,
+ stack_info_ptr);
}
static jvmtiError GetFrameCount(jvmtiEnv* env, jthread thread, jint* count_ptr) {
- return ERR(NOT_IMPLEMENTED);
+ return StackUtil::GetFrameCount(env, thread, count_ptr);
}
static jvmtiError PopFrame(jvmtiEnv* env, jthread thread) {
@@ -262,7 +278,7 @@ class JvmtiFunctions {
jint depth,
jmethodID* method_ptr,
jlocation* location_ptr) {
- return ERR(NOT_IMPLEMENTED);
+ return StackUtil::GetFrameLocation(env, thread, depth, method_ptr, location_ptr);
}
static jvmtiError NotifyFramePop(jvmtiEnv* env, jthread thread, jint depth) {
@@ -531,7 +547,7 @@ class JvmtiFunctions {
jobject initiating_loader,
jint* class_count_ptr,
jclass** classes_ptr) {
- return ERR(NOT_IMPLEMENTED);
+ return ClassUtil::GetClassLoaderClasses(env, initiating_loader, class_count_ptr, classes_ptr);
}
static jvmtiError GetClassSignature(jvmtiEnv* env,
@@ -578,7 +594,7 @@ class JvmtiFunctions {
jclass klass,
jint* minor_version_ptr,
jint* major_version_ptr) {
- return ERR(NOT_IMPLEMENTED);
+ return ClassUtil::GetClassVersionNumbers(env, klass, minor_version_ptr, major_version_ptr);
}
static jvmtiError GetConstantPool(jvmtiEnv* env,
@@ -616,13 +632,33 @@ class JvmtiFunctions {
}
static jvmtiError RetransformClasses(jvmtiEnv* env, jint class_count, const jclass* classes) {
- return ERR(NOT_IMPLEMENTED);
+ std::string error_msg;
+ jvmtiError res = Transformer::RetransformClasses(ArtJvmTiEnv::AsArtJvmTiEnv(env),
+ art::Runtime::Current(),
+ art::Thread::Current(),
+ class_count,
+ classes,
+ &error_msg);
+ if (res != OK) {
+ LOG(WARNING) << "FAILURE TO RETRANFORM " << error_msg;
+ }
+ return res;
}
static jvmtiError RedefineClasses(jvmtiEnv* env,
jint class_count,
const jvmtiClassDefinition* class_definitions) {
- return ERR(NOT_IMPLEMENTED);
+ std::string error_msg;
+ jvmtiError res = Redefiner::RedefineClasses(ArtJvmTiEnv::AsArtJvmTiEnv(env),
+ art::Runtime::Current(),
+ art::Thread::Current(),
+ class_count,
+ class_definitions,
+ &error_msg);
+ if (res != OK) {
+ LOG(WARNING) << "FAILURE TO REDEFINE " << error_msg;
+ }
+ return res;
}
static jvmtiError GetObjectSize(jvmtiEnv* env, jobject object, jlong* size_ptr) {
@@ -778,11 +814,11 @@ class JvmtiFunctions {
}
static jvmtiError SetJNIFunctionTable(jvmtiEnv* env, const jniNativeInterface* function_table) {
- return ERR(NOT_IMPLEMENTED);
+ return JNIUtil::SetJNIFunctionTable(env, function_table);
}
static jvmtiError GetJNIFunctionTable(jvmtiEnv* env, jniNativeInterface** function_table) {
- return ERR(NOT_IMPLEMENTED);
+ return JNIUtil::GetJNIFunctionTable(env, function_table);
}
// TODO: This will require locking, so that an agent can't remove callbacks when we're dispatching
@@ -833,7 +869,8 @@ class JvmtiFunctions {
}
}
- return gEventHandler.SetEvent(ArtJvmTiEnv::AsArtJvmTiEnv(env), art_thread, event_type, mode);
+ ArtJvmTiEnv* art_env = ArtJvmTiEnv::AsArtJvmTiEnv(env);
+ return gEventHandler.SetEvent(art_env, art_thread, GetArtJvmtiEvent(art_env, event_type), mode);
}
static jvmtiError GenerateEvents(jvmtiEnv* env, jvmtiEvent event_type) {
@@ -879,11 +916,15 @@ class JvmtiFunctions {
ENSURE_NON_NULL(capabilities_ptr);
ArtJvmTiEnv* art_env = static_cast<ArtJvmTiEnv*>(env);
jvmtiError ret = OK;
+ jvmtiCapabilities changed;
#define ADD_CAPABILITY(e) \
do { \
if (capabilities_ptr->e == 1) { \
if (kPotentialCapabilities.e == 1) { \
- art_env->capabilities.e = 1;\
+ if (art_env->capabilities.e != 1) { \
+ art_env->capabilities.e = 1; \
+ changed.e = 1; \
+ }\
} else { \
ret = ERR(NOT_AVAILABLE); \
} \
@@ -932,6 +973,9 @@ class JvmtiFunctions {
ADD_CAPABILITY(can_generate_resource_exhaustion_heap_events);
ADD_CAPABILITY(can_generate_resource_exhaustion_threads_events);
#undef ADD_CAPABILITY
+ gEventHandler.HandleChangedCapabilities(ArtJvmTiEnv::AsArtJvmTiEnv(env),
+ changed,
+ /*added*/true);
return ret;
}
@@ -940,10 +984,14 @@ class JvmtiFunctions {
ENSURE_VALID_ENV(env);
ENSURE_NON_NULL(capabilities_ptr);
ArtJvmTiEnv* art_env = reinterpret_cast<ArtJvmTiEnv*>(env);
+ jvmtiCapabilities changed;
#define DEL_CAPABILITY(e) \
do { \
if (capabilities_ptr->e == 1) { \
- art_env->capabilities.e = 0;\
+ if (art_env->capabilities.e == 1) { \
+ art_env->capabilities.e = 0;\
+ changed.e = 1; \
+ } \
} \
} while (false)
@@ -989,6 +1037,9 @@ class JvmtiFunctions {
DEL_CAPABILITY(can_generate_resource_exhaustion_heap_events);
DEL_CAPABILITY(can_generate_resource_exhaustion_threads_events);
#undef DEL_CAPABILITY
+ gEventHandler.HandleChangedCapabilities(ArtJvmTiEnv::AsArtJvmTiEnv(env),
+ changed,
+ /*added*/false);
return OK;
}
@@ -1017,23 +1068,23 @@ class JvmtiFunctions {
}
static jvmtiError GetTimerInfo(jvmtiEnv* env, jvmtiTimerInfo* info_ptr) {
- return ERR(NOT_IMPLEMENTED);
+ return TimerUtil::GetTimerInfo(env, info_ptr);
}
static jvmtiError GetTime(jvmtiEnv* env, jlong* nanos_ptr) {
- return ERR(NOT_IMPLEMENTED);
+ return TimerUtil::GetTime(env, nanos_ptr);
}
static jvmtiError GetAvailableProcessors(jvmtiEnv* env, jint* processor_count_ptr) {
- return ERR(NOT_IMPLEMENTED);
+ return TimerUtil::GetAvailableProcessors(env, processor_count_ptr);
}
static jvmtiError AddToBootstrapClassLoaderSearch(jvmtiEnv* env, const char* segment) {
- return ERR(NOT_IMPLEMENTED);
+ return SearchUtil::AddToBootstrapClassLoaderSearch(env, segment);
}
static jvmtiError AddToSystemClassLoaderSearch(jvmtiEnv* env, const char* segment) {
- return ERR(NOT_IMPLEMENTED);
+ return SearchUtil::AddToSystemClassLoaderSearch(env, segment);
}
static jvmtiError GetSystemProperties(jvmtiEnv* env, jint* count_ptr, char*** property_ptr) {
@@ -1049,11 +1100,12 @@ class JvmtiFunctions {
}
static jvmtiError GetPhase(jvmtiEnv* env, jvmtiPhase* phase_ptr) {
- return ERR(NOT_IMPLEMENTED);
+ return PhaseUtil::GetPhase(env, phase_ptr);
}
static jvmtiError DisposeEnvironment(jvmtiEnv* env) {
ENSURE_VALID_ENV(env);
+ gEventHandler.RemoveArtJvmTiEnv(ArtJvmTiEnv::AsArtJvmTiEnv(env));
delete env;
return OK;
}
@@ -1154,112 +1206,66 @@ class JvmtiFunctions {
}
static jvmtiError SetVerboseFlag(jvmtiEnv* env, jvmtiVerboseFlag flag, jboolean value) {
- return ERR(NOT_IMPLEMENTED);
- }
-
- static jvmtiError GetJLocationFormat(jvmtiEnv* env, jvmtiJlocationFormat* format_ptr) {
- return ERR(NOT_IMPLEMENTED);
- }
+ if (flag == jvmtiVerboseFlag::JVMTI_VERBOSE_OTHER) {
+ // OTHER is special, as it's 0, so can't do a bit check.
+ bool val = (value == JNI_TRUE) ? true : false;
+
+ art::gLogVerbosity.collector = val;
+ art::gLogVerbosity.compiler = val;
+ art::gLogVerbosity.deopt = val;
+ art::gLogVerbosity.heap = val;
+ art::gLogVerbosity.jdwp = val;
+ art::gLogVerbosity.jit = val;
+ art::gLogVerbosity.monitor = val;
+ art::gLogVerbosity.oat = val;
+ art::gLogVerbosity.profiler = val;
+ art::gLogVerbosity.signals = val;
+ art::gLogVerbosity.simulator = val;
+ art::gLogVerbosity.startup = val;
+ art::gLogVerbosity.third_party_jni = val;
+ art::gLogVerbosity.threads = val;
+ art::gLogVerbosity.verifier = val;
+ art::gLogVerbosity.image = val;
+
+ // Note: can't switch systrace_lock_logging. That requires changing entrypoints.
+
+ art::gLogVerbosity.agents = val;
+ } else {
+ // Spec isn't clear whether "flag" is a mask or supposed to be single. We implement the mask
+ // semantics.
+ constexpr std::underlying_type<jvmtiVerboseFlag>::type kMask =
+ jvmtiVerboseFlag::JVMTI_VERBOSE_GC |
+ jvmtiVerboseFlag::JVMTI_VERBOSE_CLASS |
+ jvmtiVerboseFlag::JVMTI_VERBOSE_JNI;
+ if ((flag & ~kMask) != 0) {
+ return ERR(ILLEGAL_ARGUMENT);
+ }
- // TODO Remove this once events are working.
- static jvmtiError RetransformClassWithHook(jvmtiEnv* env,
- jclass klass,
- jvmtiEventClassFileLoadHook hook) {
- std::vector<jclass> classes;
- classes.push_back(klass);
- return RetransformClassesWithHook(reinterpret_cast<ArtJvmTiEnv*>(env), classes, hook);
- }
-
- static jvmtiError RedefineClassDirect(ArtJvmTiEnv* env,
- jclass klass,
- jint dex_size,
- unsigned char* dex_file) {
- if (!IsValidEnv(env)) {
- return ERR(INVALID_ENVIRONMENT);
- }
- jvmtiError ret = OK;
- std::string location;
- if ((ret = GetClassLocation(env, klass, &location)) != OK) {
- // TODO Do something more here? Maybe give log statements?
- return ret;
- }
- std::string error;
- ret = Redefiner::RedefineClass(env,
- art::Runtime::Current(),
- art::Thread::Current(),
- klass,
- location,
- dex_size,
- reinterpret_cast<uint8_t*>(dex_file),
- &error);
- if (ret != OK) {
- LOG(WARNING) << "FAILURE TO REDEFINE " << error;
- }
- return ret;
- }
+ bool val = (value == JNI_TRUE) ? true : false;
- // TODO This will be called by the event handler for the art::ti Event Load Event
- static jvmtiError RetransformClassesWithHook(ArtJvmTiEnv* env,
- const std::vector<jclass>& classes,
- jvmtiEventClassFileLoadHook hook) {
- if (!IsValidEnv(env)) {
- return ERR(INVALID_ENVIRONMENT);
- }
- jvmtiError res = OK;
- std::string error;
- for (jclass klass : classes) {
- JNIEnv* jni_env = nullptr;
- jobject loader = nullptr;
- std::string name;
- jobject protection_domain = nullptr;
- jint data_len = 0;
- unsigned char* dex_data = nullptr;
- jvmtiError ret = OK;
- std::string location;
- if ((ret = GetTransformationData(env,
- klass,
- /*out*/&location,
- /*out*/&jni_env,
- /*out*/&loader,
- /*out*/&name,
- /*out*/&protection_domain,
- /*out*/&data_len,
- /*out*/&dex_data)) != OK) {
- // TODO Do something more here? Maybe give log statements?
- return ret;
+ if ((flag & jvmtiVerboseFlag::JVMTI_VERBOSE_GC) != 0) {
+ art::gLogVerbosity.gc = val;
}
- jint new_data_len = 0;
- unsigned char* new_dex_data = nullptr;
- hook(env,
- jni_env,
- klass,
- loader,
- name.c_str(),
- protection_domain,
- data_len,
- dex_data,
- /*out*/&new_data_len,
- /*out*/&new_dex_data);
- // Check if anything actually changed.
- if ((new_data_len != 0 || new_dex_data != nullptr) && new_dex_data != dex_data) {
- res = Redefiner::RedefineClass(env,
- art::Runtime::Current(),
- art::Thread::Current(),
- klass,
- location,
- new_data_len,
- new_dex_data,
- &error);
- env->Deallocate(new_dex_data);
+
+ if ((flag & jvmtiVerboseFlag::JVMTI_VERBOSE_CLASS) != 0) {
+ art::gLogVerbosity.class_linker = val;
}
- // Deallocate the old dex data.
- env->Deallocate(dex_data);
- if (res != OK) {
- LOG(ERROR) << "FAILURE TO REDEFINE " << error;
- return res;
+
+ if ((flag & jvmtiVerboseFlag::JVMTI_VERBOSE_JNI) != 0) {
+ art::gLogVerbosity.jni = val;
}
}
- return OK;
+
+ return ERR(NONE);
+ }
+
+ static jvmtiError GetJLocationFormat(jvmtiEnv* env, jvmtiJlocationFormat* format_ptr) {
+ // Report BCI as jlocation format. We report dex bytecode indices.
+ if (format_ptr == nullptr) {
+ return ERR(NULL_POINTER);
+ }
+ *format_ptr = jvmtiJlocationFormat::JVMTI_JLOCATION_JVMBCI;
+ return ERR(NONE);
}
};
@@ -1296,22 +1302,25 @@ static jint GetEnvHandler(art::JavaVMExt* vm, /*out*/void** env, jint version) {
// The plugin initialization function. This adds the jvmti environment.
extern "C" bool ArtPlugin_Initialize() {
art::Runtime* runtime = art::Runtime::Current();
+
+ if (runtime->IsStarted()) {
+ PhaseUtil::SetToLive();
+ } else {
+ PhaseUtil::SetToOnLoad();
+ }
+ PhaseUtil::Register(&gEventHandler);
+
runtime->GetJavaVM()->AddEnvironmentHook(GetEnvHandler);
runtime->AddSystemWeakHolder(&gObjectTagTable);
+
return true;
}
// The actual struct holding all of the entrypoints into the jvmti interface.
const jvmtiInterface_1 gJvmtiInterface = {
- // SPECIAL FUNCTION: RetransformClassWithHook Is normally reserved1
- // TODO Remove once we have events working.
- reinterpret_cast<void*>(JvmtiFunctions::RetransformClassWithHook),
- // nullptr, // reserved1
+ nullptr, // reserved1
JvmtiFunctions::SetEventNotificationMode,
- // SPECIAL FUNCTION: RedefineClassDirect Is normally reserved3
- // TODO Remove once we have events working.
- reinterpret_cast<void*>(JvmtiFunctions::RedefineClassDirect),
- // nullptr, // reserved3
+ nullptr, // reserved3
JvmtiFunctions::GetAllThreads,
JvmtiFunctions::SuspendThread,
JvmtiFunctions::ResumeThread,
diff --git a/runtime/openjdkjvmti/art_jvmti.h b/runtime/openjdkjvmti/art_jvmti.h
index 5eadc5a8e0..256c3a6cec 100644
--- a/runtime/openjdkjvmti/art_jvmti.h
+++ b/runtime/openjdkjvmti/art_jvmti.h
@@ -36,6 +36,7 @@
#include <jni.h>
+#include "base/array_slice.h"
#include "base/casts.h"
#include "base/logging.h"
#include "base/macros.h"
@@ -47,6 +48,7 @@
namespace openjdkjvmti {
extern const jvmtiInterface_1 gJvmtiInterface;
+extern EventHandler gEventHandler;
// A structure that is a jvmtiEnv with additional information for the runtime.
struct ArtJvmTiEnv : public jvmtiEnv {
@@ -134,7 +136,7 @@ const jvmtiCapabilities kPotentialCapabilities = {
.can_get_current_contended_monitor = 0,
.can_get_monitor_info = 0,
.can_pop_frame = 0,
- .can_redefine_classes = 0,
+ .can_redefine_classes = 1,
.can_signal_thread = 0,
.can_get_source_file_name = 0,
.can_get_line_numbers = 0,
@@ -162,7 +164,7 @@ const jvmtiCapabilities kPotentialCapabilities = {
.can_get_owned_monitor_stack_depth_info = 0,
.can_get_constant_pool = 0,
.can_set_native_method_prefix = 0,
- .can_retransform_classes = 0,
+ .can_retransform_classes = 1,
.can_retransform_any_class = 0,
.can_generate_resource_exhaustion_heap_events = 0,
.can_generate_resource_exhaustion_threads_events = 0,
diff --git a/runtime/openjdkjvmti/events-inl.h b/runtime/openjdkjvmti/events-inl.h
index d0272010d4..21ec731ba5 100644
--- a/runtime/openjdkjvmti/events-inl.h
+++ b/runtime/openjdkjvmti/events-inl.h
@@ -17,14 +17,28 @@
#ifndef ART_RUNTIME_OPENJDKJVMTI_EVENTS_INL_H_
#define ART_RUNTIME_OPENJDKJVMTI_EVENTS_INL_H_
+#include <array>
+
#include "events.h"
#include "art_jvmti.h"
namespace openjdkjvmti {
+static inline ArtJvmtiEvent GetArtJvmtiEvent(ArtJvmTiEnv* env, jvmtiEvent e) {
+ if (UNLIKELY(e == JVMTI_EVENT_CLASS_FILE_LOAD_HOOK)) {
+ if (env->capabilities.can_retransform_classes) {
+ return ArtJvmtiEvent::kClassFileLoadHookRetransformable;
+ } else {
+ return ArtJvmtiEvent::kClassFileLoadHookNonRetransformable;
+ }
+ } else {
+ return static_cast<ArtJvmtiEvent>(e);
+ }
+}
+
template <typename FnType>
-ALWAYS_INLINE static inline FnType* GetCallback(ArtJvmTiEnv* env, jvmtiEvent event) {
+ALWAYS_INLINE static inline FnType* GetCallback(ArtJvmTiEnv* env, ArtJvmtiEvent event) {
if (env->event_callbacks == nullptr) {
return nullptr;
}
@@ -33,84 +47,166 @@ ALWAYS_INLINE static inline FnType* GetCallback(ArtJvmTiEnv* env, jvmtiEvent eve
// function.
switch (event) {
- case JVMTI_EVENT_VM_INIT:
+ case ArtJvmtiEvent::kVmInit:
return reinterpret_cast<FnType*>(env->event_callbacks->VMInit);
- case JVMTI_EVENT_VM_DEATH:
+ case ArtJvmtiEvent::kVmDeath:
return reinterpret_cast<FnType*>(env->event_callbacks->VMDeath);
- case JVMTI_EVENT_THREAD_START:
+ case ArtJvmtiEvent::kThreadStart:
return reinterpret_cast<FnType*>(env->event_callbacks->ThreadStart);
- case JVMTI_EVENT_THREAD_END:
+ case ArtJvmtiEvent::kThreadEnd:
return reinterpret_cast<FnType*>(env->event_callbacks->ThreadEnd);
- case JVMTI_EVENT_CLASS_FILE_LOAD_HOOK:
+ case ArtJvmtiEvent::kClassFileLoadHookRetransformable:
+ case ArtJvmtiEvent::kClassFileLoadHookNonRetransformable:
return reinterpret_cast<FnType*>(env->event_callbacks->ClassFileLoadHook);
- case JVMTI_EVENT_CLASS_LOAD:
+ case ArtJvmtiEvent::kClassLoad:
return reinterpret_cast<FnType*>(env->event_callbacks->ClassLoad);
- case JVMTI_EVENT_CLASS_PREPARE:
+ case ArtJvmtiEvent::kClassPrepare:
return reinterpret_cast<FnType*>(env->event_callbacks->ClassPrepare);
- case JVMTI_EVENT_VM_START:
+ case ArtJvmtiEvent::kVmStart:
return reinterpret_cast<FnType*>(env->event_callbacks->VMStart);
- case JVMTI_EVENT_EXCEPTION:
+ case ArtJvmtiEvent::kException:
return reinterpret_cast<FnType*>(env->event_callbacks->Exception);
- case JVMTI_EVENT_EXCEPTION_CATCH:
+ case ArtJvmtiEvent::kExceptionCatch:
return reinterpret_cast<FnType*>(env->event_callbacks->ExceptionCatch);
- case JVMTI_EVENT_SINGLE_STEP:
+ case ArtJvmtiEvent::kSingleStep:
return reinterpret_cast<FnType*>(env->event_callbacks->SingleStep);
- case JVMTI_EVENT_FRAME_POP:
+ case ArtJvmtiEvent::kFramePop:
return reinterpret_cast<FnType*>(env->event_callbacks->FramePop);
- case JVMTI_EVENT_BREAKPOINT:
+ case ArtJvmtiEvent::kBreakpoint:
return reinterpret_cast<FnType*>(env->event_callbacks->Breakpoint);
- case JVMTI_EVENT_FIELD_ACCESS:
+ case ArtJvmtiEvent::kFieldAccess:
return reinterpret_cast<FnType*>(env->event_callbacks->FieldAccess);
- case JVMTI_EVENT_FIELD_MODIFICATION:
+ case ArtJvmtiEvent::kFieldModification:
return reinterpret_cast<FnType*>(env->event_callbacks->FieldModification);
- case JVMTI_EVENT_METHOD_ENTRY:
+ case ArtJvmtiEvent::kMethodEntry:
return reinterpret_cast<FnType*>(env->event_callbacks->MethodEntry);
- case JVMTI_EVENT_METHOD_EXIT:
+ case ArtJvmtiEvent::kMethodExit:
return reinterpret_cast<FnType*>(env->event_callbacks->MethodExit);
- case JVMTI_EVENT_NATIVE_METHOD_BIND:
+ case ArtJvmtiEvent::kNativeMethodBind:
return reinterpret_cast<FnType*>(env->event_callbacks->NativeMethodBind);
- case JVMTI_EVENT_COMPILED_METHOD_LOAD:
+ case ArtJvmtiEvent::kCompiledMethodLoad:
return reinterpret_cast<FnType*>(env->event_callbacks->CompiledMethodLoad);
- case JVMTI_EVENT_COMPILED_METHOD_UNLOAD:
+ case ArtJvmtiEvent::kCompiledMethodUnload:
return reinterpret_cast<FnType*>(env->event_callbacks->CompiledMethodUnload);
- case JVMTI_EVENT_DYNAMIC_CODE_GENERATED:
+ case ArtJvmtiEvent::kDynamicCodeGenerated:
return reinterpret_cast<FnType*>(env->event_callbacks->DynamicCodeGenerated);
- case JVMTI_EVENT_DATA_DUMP_REQUEST:
+ case ArtJvmtiEvent::kDataDumpRequest:
return reinterpret_cast<FnType*>(env->event_callbacks->DataDumpRequest);
- case JVMTI_EVENT_MONITOR_WAIT:
+ case ArtJvmtiEvent::kMonitorWait:
return reinterpret_cast<FnType*>(env->event_callbacks->MonitorWait);
- case JVMTI_EVENT_MONITOR_WAITED:
+ case ArtJvmtiEvent::kMonitorWaited:
return reinterpret_cast<FnType*>(env->event_callbacks->MonitorWaited);
- case JVMTI_EVENT_MONITOR_CONTENDED_ENTER:
+ case ArtJvmtiEvent::kMonitorContendedEnter:
return reinterpret_cast<FnType*>(env->event_callbacks->MonitorContendedEnter);
- case JVMTI_EVENT_MONITOR_CONTENDED_ENTERED:
+ case ArtJvmtiEvent::kMonitorContendedEntered:
return reinterpret_cast<FnType*>(env->event_callbacks->MonitorContendedEntered);
- case JVMTI_EVENT_RESOURCE_EXHAUSTED:
+ case ArtJvmtiEvent::kResourceExhausted:
return reinterpret_cast<FnType*>(env->event_callbacks->ResourceExhausted);
- case JVMTI_EVENT_GARBAGE_COLLECTION_START:
+ case ArtJvmtiEvent::kGarbageCollectionStart:
return reinterpret_cast<FnType*>(env->event_callbacks->GarbageCollectionStart);
- case JVMTI_EVENT_GARBAGE_COLLECTION_FINISH:
+ case ArtJvmtiEvent::kGarbageCollectionFinish:
return reinterpret_cast<FnType*>(env->event_callbacks->GarbageCollectionFinish);
- case JVMTI_EVENT_OBJECT_FREE:
+ case ArtJvmtiEvent::kObjectFree:
return reinterpret_cast<FnType*>(env->event_callbacks->ObjectFree);
- case JVMTI_EVENT_VM_OBJECT_ALLOC:
+ case ArtJvmtiEvent::kVmObjectAlloc:
return reinterpret_cast<FnType*>(env->event_callbacks->VMObjectAlloc);
}
return nullptr;
}
template <typename ...Args>
-inline void EventHandler::DispatchEvent(art::Thread* thread, jvmtiEvent event, Args... args) {
- using FnType = void(jvmtiEnv*, Args...);
- for (ArtJvmTiEnv* env : envs) {
- bool dispatch = env->event_masks.global_event_mask.Test(event);
+inline void EventHandler::DispatchClassFileLoadHookEvent(art::Thread*,
+ ArtJvmtiEvent event,
+ Args... args ATTRIBUTE_UNUSED) const {
+ CHECK(event == ArtJvmtiEvent::kClassFileLoadHookRetransformable ||
+ event == ArtJvmtiEvent::kClassFileLoadHookNonRetransformable);
+ LOG(FATAL) << "Incorrect arguments to ClassFileLoadHook!";
+}
- if (!dispatch && thread != nullptr && env->event_masks.unioned_thread_event_mask.Test(event)) {
- EventMask* mask = env->event_masks.GetEventMaskOrNull(thread);
- dispatch = mask != nullptr && mask->Test(event);
+// TODO Locking of some type!
+template <>
+inline void EventHandler::DispatchClassFileLoadHookEvent(art::Thread* thread,
+ ArtJvmtiEvent event,
+ JNIEnv* jnienv,
+ jclass class_being_redefined,
+ jobject loader,
+ const char* name,
+ jobject protection_domain,
+ jint class_data_len,
+ const unsigned char* class_data,
+ jint* new_class_data_len,
+ unsigned char** new_class_data) const {
+ CHECK(event == ArtJvmtiEvent::kClassFileLoadHookRetransformable ||
+ event == ArtJvmtiEvent::kClassFileLoadHookNonRetransformable);
+ using FnType = void(jvmtiEnv* /* jvmti_env */,
+ JNIEnv* /* jnienv */,
+ jclass /* class_being_redefined */,
+ jobject /* loader */,
+ const char* /* name */,
+ jobject /* protection_domain */,
+ jint /* class_data_len */,
+ const unsigned char* /* class_data */,
+ jint* /* new_class_data_len */,
+ unsigned char** /* new_class_data */);
+ jint current_len = class_data_len;
+ unsigned char* current_class_data = const_cast<unsigned char*>(class_data);
+ ArtJvmTiEnv* last_env = nullptr;
+ for (ArtJvmTiEnv* env : envs) {
+ if (ShouldDispatch(event, env, thread)) {
+ jint new_len;
+ unsigned char* new_data;
+ FnType* callback = GetCallback<FnType>(env, event);
+ callback(env,
+ jnienv,
+ class_being_redefined,
+ loader,
+ name,
+ protection_domain,
+ current_len,
+ current_class_data,
+ &new_len,
+ &new_data);
+ if (new_data != nullptr && new_data != current_class_data) {
+ // Destroy the data the last transformer made. We skip this if the previous state was the
+ // initial one since we don't know here which jvmtiEnv allocated it.
+ // NB Currently this doesn't matter since all allocations just go to malloc but in the
+ // future we might have jvmtiEnv's keep track of their allocations for leak-checking.
+ if (last_env != nullptr) {
+ last_env->Deallocate(current_class_data);
+ }
+ last_env = env;
+ current_class_data = new_data;
+ current_len = new_len;
+ }
}
+ }
+ if (last_env != nullptr) {
+ *new_class_data_len = current_len;
+ *new_class_data = current_class_data;
+ }
+}
+
+template <typename ...Args>
+inline void EventHandler::DispatchEvent(art::Thread* thread,
+ ArtJvmtiEvent event,
+ Args... args) const {
+ switch (event) {
+ case ArtJvmtiEvent::kClassFileLoadHookRetransformable:
+ case ArtJvmtiEvent::kClassFileLoadHookNonRetransformable:
+ return DispatchClassFileLoadHookEvent(thread, event, args...);
+ default:
+ return GenericDispatchEvent(thread, event, args...);
+ }
+}
- if (dispatch) {
+// TODO Locking of some type!
+template <typename ...Args>
+inline void EventHandler::GenericDispatchEvent(art::Thread* thread,
+ ArtJvmtiEvent event,
+ Args... args) const {
+ using FnType = void(jvmtiEnv*, Args...);
+ for (ArtJvmTiEnv* env : envs) {
+ if (ShouldDispatch(event, env, thread)) {
FnType* callback = GetCallback<FnType>(env, event);
if (callback != nullptr) {
(*callback)(env, args...);
@@ -119,6 +215,52 @@ inline void EventHandler::DispatchEvent(art::Thread* thread, jvmtiEvent event, A
}
}
+inline bool EventHandler::ShouldDispatch(ArtJvmtiEvent event,
+ ArtJvmTiEnv* env,
+ art::Thread* thread) {
+ bool dispatch = env->event_masks.global_event_mask.Test(event);
+
+ if (!dispatch && thread != nullptr && env->event_masks.unioned_thread_event_mask.Test(event)) {
+ EventMask* mask = env->event_masks.GetEventMaskOrNull(thread);
+ dispatch = mask != nullptr && mask->Test(event);
+ }
+ return dispatch;
+}
+
+inline void EventHandler::RecalculateGlobalEventMask(ArtJvmtiEvent event) {
+ bool union_value = false;
+ for (const ArtJvmTiEnv* stored_env : envs) {
+ union_value |= stored_env->event_masks.global_event_mask.Test(event);
+ union_value |= stored_env->event_masks.unioned_thread_event_mask.Test(event);
+ if (union_value) {
+ break;
+ }
+ }
+ global_mask.Set(event, union_value);
+}
+
+inline bool EventHandler::NeedsEventUpdate(ArtJvmTiEnv* env,
+ const jvmtiCapabilities& caps,
+ bool added) {
+ ArtJvmtiEvent event = added ? ArtJvmtiEvent::kClassFileLoadHookNonRetransformable
+ : ArtJvmtiEvent::kClassFileLoadHookRetransformable;
+ return caps.can_retransform_classes == 1 &&
+ IsEventEnabledAnywhere(event) &&
+ env->event_masks.IsEnabledAnywhere(event);
+}
+
+inline void EventHandler::HandleChangedCapabilities(ArtJvmTiEnv* env,
+ const jvmtiCapabilities& caps,
+ bool added) {
+ if (UNLIKELY(NeedsEventUpdate(env, caps, added))) {
+ env->event_masks.HandleChangedCapabilities(caps, added);
+ if (caps.can_retransform_classes == 1) {
+ RecalculateGlobalEventMask(ArtJvmtiEvent::kClassFileLoadHookRetransformable);
+ RecalculateGlobalEventMask(ArtJvmtiEvent::kClassFileLoadHookNonRetransformable);
+ }
+ }
+}
+
} // namespace openjdkjvmti
#endif // ART_RUNTIME_OPENJDKJVMTI_EVENTS_INL_H_
diff --git a/runtime/openjdkjvmti/events.cc b/runtime/openjdkjvmti/events.cc
index 12692a168d..7182055b7d 100644
--- a/runtime/openjdkjvmti/events.cc
+++ b/runtime/openjdkjvmti/events.cc
@@ -47,6 +47,10 @@
namespace openjdkjvmti {
+bool EventMasks::IsEnabledAnywhere(ArtJvmtiEvent event) {
+ return global_event_mask.Test(event) || unioned_thread_event_mask.Test(event);
+}
+
EventMask& EventMasks::GetEventMask(art::Thread* thread) {
if (thread == nullptr) {
return global_event_mask;
@@ -83,7 +87,7 @@ EventMask* EventMasks::GetEventMaskOrNull(art::Thread* thread) {
}
-void EventMasks::EnableEvent(art::Thread* thread, jvmtiEvent event) {
+void EventMasks::EnableEvent(art::Thread* thread, ArtJvmtiEvent event) {
DCHECK(EventMask::EventIsInRange(event));
GetEventMask(thread).Set(event);
if (thread != nullptr) {
@@ -91,7 +95,7 @@ void EventMasks::EnableEvent(art::Thread* thread, jvmtiEvent event) {
}
}
-void EventMasks::DisableEvent(art::Thread* thread, jvmtiEvent event) {
+void EventMasks::DisableEvent(art::Thread* thread, ArtJvmtiEvent event) {
DCHECK(EventMask::EventIsInRange(event));
GetEventMask(thread).Set(event, false);
if (thread != nullptr) {
@@ -107,20 +111,61 @@ void EventMasks::DisableEvent(art::Thread* thread, jvmtiEvent event) {
}
}
+void EventMasks::HandleChangedCapabilities(const jvmtiCapabilities& caps, bool caps_added) {
+ if (UNLIKELY(caps.can_retransform_classes == 1)) {
+ // If we are giving this env the retransform classes cap we need to switch all events of
+ // NonTransformable to Transformable and vice versa.
+ ArtJvmtiEvent to_remove = caps_added ? ArtJvmtiEvent::kClassFileLoadHookNonRetransformable
+ : ArtJvmtiEvent::kClassFileLoadHookRetransformable;
+ ArtJvmtiEvent to_add = caps_added ? ArtJvmtiEvent::kClassFileLoadHookRetransformable
+ : ArtJvmtiEvent::kClassFileLoadHookNonRetransformable;
+ if (global_event_mask.Test(to_remove)) {
+ CHECK(!global_event_mask.Test(to_add));
+ global_event_mask.Set(to_remove, false);
+ global_event_mask.Set(to_add, true);
+ }
+
+ if (unioned_thread_event_mask.Test(to_remove)) {
+ CHECK(!unioned_thread_event_mask.Test(to_add));
+ unioned_thread_event_mask.Set(to_remove, false);
+ unioned_thread_event_mask.Set(to_add, true);
+ }
+ for (auto thread_mask : thread_event_masks) {
+ if (thread_mask.second.Test(to_remove)) {
+ CHECK(!thread_mask.second.Test(to_add));
+ thread_mask.second.Set(to_remove, false);
+ thread_mask.second.Set(to_add, true);
+ }
+ }
+ }
+}
+
void EventHandler::RegisterArtJvmTiEnv(ArtJvmTiEnv* env) {
envs.push_back(env);
}
-static bool IsThreadControllable(jvmtiEvent event) {
+void EventHandler::RemoveArtJvmTiEnv(ArtJvmTiEnv* env) {
+ auto it = std::find(envs.begin(), envs.end(), env);
+ if (it != envs.end()) {
+ envs.erase(it);
+ for (size_t i = static_cast<size_t>(ArtJvmtiEvent::kMinEventTypeVal);
+ i <= static_cast<size_t>(ArtJvmtiEvent::kMaxEventTypeVal);
+ ++i) {
+ RecalculateGlobalEventMask(static_cast<ArtJvmtiEvent>(i));
+ }
+ }
+}
+
+static bool IsThreadControllable(ArtJvmtiEvent event) {
switch (event) {
- case JVMTI_EVENT_VM_INIT:
- case JVMTI_EVENT_VM_START:
- case JVMTI_EVENT_VM_DEATH:
- case JVMTI_EVENT_THREAD_START:
- case JVMTI_EVENT_COMPILED_METHOD_LOAD:
- case JVMTI_EVENT_COMPILED_METHOD_UNLOAD:
- case JVMTI_EVENT_DYNAMIC_CODE_GENERATED:
- case JVMTI_EVENT_DATA_DUMP_REQUEST:
+ case ArtJvmtiEvent::kVmInit:
+ case ArtJvmtiEvent::kVmStart:
+ case ArtJvmtiEvent::kVmDeath:
+ case ArtJvmtiEvent::kThreadStart:
+ case ArtJvmtiEvent::kCompiledMethodLoad:
+ case ArtJvmtiEvent::kCompiledMethodUnload:
+ case ArtJvmtiEvent::kDynamicCodeGenerated:
+ case ArtJvmtiEvent::kDataDumpRequest:
return false;
default:
@@ -136,7 +181,7 @@ class JvmtiAllocationListener : public art::gc::AllocationListener {
OVERRIDE REQUIRES_SHARED(art::Locks::mutator_lock_) {
DCHECK_EQ(self, art::Thread::Current());
- if (handler_->IsEventEnabledAnywhere(JVMTI_EVENT_VM_OBJECT_ALLOC)) {
+ if (handler_->IsEventEnabledAnywhere(ArtJvmtiEvent::kVmObjectAlloc)) {
art::StackHandleScope<1> hs(self);
auto h = hs.NewHandleWrapper(obj);
// jvmtiEventVMObjectAlloc parameters:
@@ -162,7 +207,7 @@ class JvmtiAllocationListener : public art::gc::AllocationListener {
jni_env, jni_env->AddLocalReference<jclass>(obj->Ptr()->GetClass()));
handler_->DispatchEvent(self,
- JVMTI_EVENT_VM_OBJECT_ALLOC,
+ ArtJvmtiEvent::kVmObjectAlloc,
jni_env,
thread.get(),
object.get(),
@@ -196,11 +241,11 @@ class JvmtiGcPauseListener : public art::gc::GcPauseListener {
finish_enabled_(false) {}
void StartPause() OVERRIDE {
- handler_->DispatchEvent(nullptr, JVMTI_EVENT_GARBAGE_COLLECTION_START);
+ handler_->DispatchEvent(nullptr, ArtJvmtiEvent::kGarbageCollectionStart);
}
void EndPause() OVERRIDE {
- handler_->DispatchEvent(nullptr, JVMTI_EVENT_GARBAGE_COLLECTION_FINISH);
+ handler_->DispatchEvent(nullptr, ArtJvmtiEvent::kGarbageCollectionFinish);
}
bool IsEnabled() {
@@ -221,10 +266,10 @@ class JvmtiGcPauseListener : public art::gc::GcPauseListener {
bool finish_enabled_;
};
-static void SetupGcPauseTracking(JvmtiGcPauseListener* listener, jvmtiEvent event, bool enable) {
+static void SetupGcPauseTracking(JvmtiGcPauseListener* listener, ArtJvmtiEvent event, bool enable) {
bool old_state = listener->IsEnabled();
- if (event == JVMTI_EVENT_GARBAGE_COLLECTION_START) {
+ if (event == ArtJvmtiEvent::kGarbageCollectionStart) {
listener->SetStartEnabled(enable);
} else {
listener->SetFinishEnabled(enable);
@@ -242,14 +287,14 @@ static void SetupGcPauseTracking(JvmtiGcPauseListener* listener, jvmtiEvent even
}
// Handle special work for the given event type, if necessary.
-void EventHandler::HandleEventType(jvmtiEvent event, bool enable) {
+void EventHandler::HandleEventType(ArtJvmtiEvent event, bool enable) {
switch (event) {
- case JVMTI_EVENT_VM_OBJECT_ALLOC:
+ case ArtJvmtiEvent::kVmObjectAlloc:
SetupObjectAllocationTracking(alloc_listener_.get(), enable);
return;
- case JVMTI_EVENT_GARBAGE_COLLECTION_START:
- case JVMTI_EVENT_GARBAGE_COLLECTION_FINISH:
+ case ArtJvmtiEvent::kGarbageCollectionStart:
+ case ArtJvmtiEvent::kGarbageCollectionFinish:
SetupGcPauseTracking(gc_pause_listener_.get(), event, enable);
return;
@@ -260,7 +305,7 @@ void EventHandler::HandleEventType(jvmtiEvent event, bool enable) {
jvmtiError EventHandler::SetEvent(ArtJvmTiEnv* env,
art::Thread* thread,
- jvmtiEvent event,
+ ArtJvmtiEvent event,
jvmtiEventMode mode) {
if (thread != nullptr) {
art::ThreadState state = thread->GetState();
@@ -293,17 +338,7 @@ jvmtiError EventHandler::SetEvent(ArtJvmTiEnv* env,
DCHECK_EQ(mode, JVMTI_DISABLE);
env->event_masks.DisableEvent(thread, event);
-
- // Gotta recompute the global mask.
- bool union_value = false;
- for (const ArtJvmTiEnv* stored_env : envs) {
- union_value |= stored_env->event_masks.global_event_mask.Test(event);
- union_value |= stored_env->event_masks.unioned_thread_event_mask.Test(event);
- if (union_value) {
- break;
- }
- }
- global_mask.Set(event, union_value);
+ RecalculateGlobalEventMask(event);
}
bool new_state = global_mask.Test(event);
diff --git a/runtime/openjdkjvmti/events.h b/runtime/openjdkjvmti/events.h
index 07d6bfd4c2..8e246ded8e 100644
--- a/runtime/openjdkjvmti/events.h
+++ b/runtime/openjdkjvmti/events.h
@@ -30,22 +30,76 @@ struct ArtJvmTiEnv;
class JvmtiAllocationListener;
class JvmtiGcPauseListener;
+// an enum for ArtEvents. This differs from the JVMTI events only in that we distinguish between
+// retransformation capable and incapable loading
+enum class ArtJvmtiEvent {
+ kMinEventTypeVal = JVMTI_MIN_EVENT_TYPE_VAL,
+ kVmInit = JVMTI_EVENT_VM_INIT,
+ kVmDeath = JVMTI_EVENT_VM_DEATH,
+ kThreadStart = JVMTI_EVENT_THREAD_START,
+ kThreadEnd = JVMTI_EVENT_THREAD_END,
+ kClassFileLoadHookNonRetransformable = JVMTI_EVENT_CLASS_FILE_LOAD_HOOK,
+ kClassLoad = JVMTI_EVENT_CLASS_LOAD,
+ kClassPrepare = JVMTI_EVENT_CLASS_PREPARE,
+ kVmStart = JVMTI_EVENT_VM_START,
+ kException = JVMTI_EVENT_EXCEPTION,
+ kExceptionCatch = JVMTI_EVENT_EXCEPTION_CATCH,
+ kSingleStep = JVMTI_EVENT_SINGLE_STEP,
+ kFramePop = JVMTI_EVENT_FRAME_POP,
+ kBreakpoint = JVMTI_EVENT_BREAKPOINT,
+ kFieldAccess = JVMTI_EVENT_FIELD_ACCESS,
+ kFieldModification = JVMTI_EVENT_FIELD_MODIFICATION,
+ kMethodEntry = JVMTI_EVENT_METHOD_ENTRY,
+ kMethodExit = JVMTI_EVENT_METHOD_EXIT,
+ kNativeMethodBind = JVMTI_EVENT_NATIVE_METHOD_BIND,
+ kCompiledMethodLoad = JVMTI_EVENT_COMPILED_METHOD_LOAD,
+ kCompiledMethodUnload = JVMTI_EVENT_COMPILED_METHOD_UNLOAD,
+ kDynamicCodeGenerated = JVMTI_EVENT_DYNAMIC_CODE_GENERATED,
+ kDataDumpRequest = JVMTI_EVENT_DATA_DUMP_REQUEST,
+ kMonitorWait = JVMTI_EVENT_MONITOR_WAIT,
+ kMonitorWaited = JVMTI_EVENT_MONITOR_WAITED,
+ kMonitorContendedEnter = JVMTI_EVENT_MONITOR_CONTENDED_ENTER,
+ kMonitorContendedEntered = JVMTI_EVENT_MONITOR_CONTENDED_ENTERED,
+ kResourceExhausted = JVMTI_EVENT_RESOURCE_EXHAUSTED,
+ kGarbageCollectionStart = JVMTI_EVENT_GARBAGE_COLLECTION_START,
+ kGarbageCollectionFinish = JVMTI_EVENT_GARBAGE_COLLECTION_FINISH,
+ kObjectFree = JVMTI_EVENT_OBJECT_FREE,
+ kVmObjectAlloc = JVMTI_EVENT_VM_OBJECT_ALLOC,
+ kClassFileLoadHookRetransformable = JVMTI_MAX_EVENT_TYPE_VAL + 1,
+ kMaxEventTypeVal = kClassFileLoadHookRetransformable,
+};
+
+// Convert a jvmtiEvent into a ArtJvmtiEvent
+ALWAYS_INLINE static inline ArtJvmtiEvent GetArtJvmtiEvent(ArtJvmTiEnv* env, jvmtiEvent e);
+
+static inline jvmtiEvent GetJvmtiEvent(ArtJvmtiEvent e) {
+ if (UNLIKELY(e == ArtJvmtiEvent::kClassFileLoadHookRetransformable)) {
+ return JVMTI_EVENT_CLASS_FILE_LOAD_HOOK;
+ } else {
+ return static_cast<jvmtiEvent>(e);
+ }
+}
+
struct EventMask {
- static constexpr size_t kEventsSize = JVMTI_MAX_EVENT_TYPE_VAL - JVMTI_MIN_EVENT_TYPE_VAL + 1;
+ static constexpr size_t kEventsSize =
+ static_cast<size_t>(ArtJvmtiEvent::kMaxEventTypeVal) -
+ static_cast<size_t>(ArtJvmtiEvent::kMinEventTypeVal) + 1;
std::bitset<kEventsSize> bit_set;
- static bool EventIsInRange(jvmtiEvent event) {
- return event >= JVMTI_MIN_EVENT_TYPE_VAL && event <= JVMTI_MAX_EVENT_TYPE_VAL;
+ static bool EventIsInRange(ArtJvmtiEvent event) {
+ return event >= ArtJvmtiEvent::kMinEventTypeVal && event <= ArtJvmtiEvent::kMaxEventTypeVal;
}
- void Set(jvmtiEvent event, bool value = true) {
+ void Set(ArtJvmtiEvent event, bool value = true) {
DCHECK(EventIsInRange(event));
- bit_set.set(event - JVMTI_MIN_EVENT_TYPE_VAL, value);
+ bit_set.set(static_cast<size_t>(event) - static_cast<size_t>(ArtJvmtiEvent::kMinEventTypeVal),
+ value);
}
- bool Test(jvmtiEvent event) const {
+ bool Test(ArtJvmtiEvent event) const {
DCHECK(EventIsInRange(event));
- return bit_set.test(event - JVMTI_MIN_EVENT_TYPE_VAL);
+ return bit_set.test(
+ static_cast<size_t>(event) - static_cast<size_t>(ArtJvmtiEvent::kMinEventTypeVal));
}
};
@@ -68,8 +122,13 @@ struct EventMasks {
EventMask& GetEventMask(art::Thread* thread);
EventMask* GetEventMaskOrNull(art::Thread* thread);
- void EnableEvent(art::Thread* thread, jvmtiEvent event);
- void DisableEvent(art::Thread* thread, jvmtiEvent event);
+ void EnableEvent(art::Thread* thread, ArtJvmtiEvent event);
+ void DisableEvent(art::Thread* thread, ArtJvmtiEvent event);
+ bool IsEnabledAnywhere(ArtJvmtiEvent event);
+ // Make any changes to event masks needed for the given capability changes. If caps_added is true
+ // then caps is all the newly set capabilities of the jvmtiEnv. If it is false then caps is the
+ // set of all capabilities that were removed from the jvmtiEnv.
+ void HandleChangedCapabilities(const jvmtiCapabilities& caps, bool caps_added);
};
// Helper class for event handling.
@@ -82,20 +141,56 @@ class EventHandler {
// enabled, yet.
void RegisterArtJvmTiEnv(ArtJvmTiEnv* env);
- bool IsEventEnabledAnywhere(jvmtiEvent event) {
+ // Remove an env.
+ void RemoveArtJvmTiEnv(ArtJvmTiEnv* env);
+
+ bool IsEventEnabledAnywhere(ArtJvmtiEvent event) const {
if (!EventMask::EventIsInRange(event)) {
return false;
}
return global_mask.Test(event);
}
- jvmtiError SetEvent(ArtJvmTiEnv* env, art::Thread* thread, jvmtiEvent event, jvmtiEventMode mode);
+ jvmtiError SetEvent(ArtJvmTiEnv* env,
+ art::Thread* thread,
+ ArtJvmtiEvent event,
+ jvmtiEventMode mode);
template <typename ...Args>
- ALWAYS_INLINE inline void DispatchEvent(art::Thread* thread, jvmtiEvent event, Args... args);
+ ALWAYS_INLINE
+ inline void DispatchEvent(art::Thread* thread, ArtJvmtiEvent event, Args... args) const;
+
+ // Tell the event handler capabilities were added/lost so it can adjust the sent events.If
+ // caps_added is true then caps is all the newly set capabilities of the jvmtiEnv. If it is false
+ // then caps is the set of all capabilities that were removed from the jvmtiEnv.
+ ALWAYS_INLINE
+ inline void HandleChangedCapabilities(ArtJvmTiEnv* env,
+ const jvmtiCapabilities& caps,
+ bool added);
private:
- void HandleEventType(jvmtiEvent event, bool enable);
+ ALWAYS_INLINE
+ static inline bool ShouldDispatch(ArtJvmtiEvent event, ArtJvmTiEnv* env, art::Thread* thread);
+
+ ALWAYS_INLINE
+ inline bool NeedsEventUpdate(ArtJvmTiEnv* env,
+ const jvmtiCapabilities& caps,
+ bool added);
+
+ // Recalculates the event mask for the given event.
+ ALWAYS_INLINE
+ inline void RecalculateGlobalEventMask(ArtJvmtiEvent event);
+
+ template <typename ...Args>
+ ALWAYS_INLINE inline void GenericDispatchEvent(art::Thread* thread,
+ ArtJvmtiEvent event,
+ Args... args) const;
+ template <typename ...Args>
+ ALWAYS_INLINE inline void DispatchClassFileLoadHookEvent(art::Thread* thread,
+ ArtJvmtiEvent event,
+ Args... args) const;
+
+ void HandleEventType(ArtJvmtiEvent event, bool enable);
// List of all JvmTiEnv objects that have been created, in their creation order.
std::vector<ArtJvmTiEnv*> envs;
diff --git a/runtime/openjdkjvmti/jvmti.h b/runtime/openjdkjvmti/jvmti.h
index ee708cb193..de07c163fc 100644
--- a/runtime/openjdkjvmti/jvmti.h
+++ b/runtime/openjdkjvmti/jvmti.h
@@ -74,7 +74,7 @@ typedef jobject jthreadGroup;
typedef jlong jlocation;
struct _jrawMonitorID;
typedef struct _jrawMonitorID *jrawMonitorID;
-typedef struct JNINativeInterface_ jniNativeInterface;
+typedef struct JNINativeInterface jniNativeInterface;
/* Constants */
diff --git a/runtime/openjdkjvmti/object_tagging.cc b/runtime/openjdkjvmti/object_tagging.cc
index b983e79658..94cb46a428 100644
--- a/runtime/openjdkjvmti/object_tagging.cc
+++ b/runtime/openjdkjvmti/object_tagging.cc
@@ -177,7 +177,7 @@ bool ObjectTagTable::SetLocked(art::Thread* self, art::mirror::Object* obj, jlon
}
void ObjectTagTable::Sweep(art::IsMarkedVisitor* visitor) {
- if (event_handler_->IsEventEnabledAnywhere(JVMTI_EVENT_OBJECT_FREE)) {
+ if (event_handler_->IsEventEnabledAnywhere(ArtJvmtiEvent::kObjectFree)) {
SweepImpl<true>(visitor);
} else {
SweepImpl<false>(visitor);
@@ -207,7 +207,7 @@ void ObjectTagTable::SweepImpl(art::IsMarkedVisitor* visitor) {
}
void ObjectTagTable::HandleNullSweep(jlong tag) {
- event_handler_->DispatchEvent(nullptr, JVMTI_EVENT_OBJECT_FREE, tag);
+ event_handler_->DispatchEvent(nullptr, ArtJvmtiEvent::kObjectFree, tag);
}
template <typename T, ObjectTagTable::TableUpdateNullTarget kTargetNull>
diff --git a/runtime/openjdkjvmti/ti_class.cc b/runtime/openjdkjvmti/ti_class.cc
index 0d1704ca4d..abcc84925b 100644
--- a/runtime/openjdkjvmti/ti_class.cc
+++ b/runtime/openjdkjvmti/ti_class.cc
@@ -32,7 +32,10 @@
#include "ti_class.h"
#include "art_jvmti.h"
+#include "class_table-inl.h"
+#include "class_linker.h"
#include "jni_internal.h"
+#include "runtime.h"
#include "scoped_thread_state_change-inl.h"
#include "thread-inl.h"
@@ -328,4 +331,121 @@ jvmtiError ClassUtil::GetClassLoader(jvmtiEnv* env ATTRIBUTE_UNUSED,
return ERR(NONE);
}
+jvmtiError ClassUtil::GetClassLoaderClasses(jvmtiEnv* env,
+ jobject initiating_loader,
+ jint* class_count_ptr,
+ jclass** classes_ptr) {
+ UNUSED(env, initiating_loader, class_count_ptr, classes_ptr);
+
+ if (class_count_ptr == nullptr || classes_ptr == nullptr) {
+ return ERR(NULL_POINTER);
+ }
+ art::Thread* self = art::Thread::Current();
+ if (!self->GetJniEnv()->IsInstanceOf(initiating_loader,
+ art::WellKnownClasses::java_lang_ClassLoader)) {
+ return ERR(ILLEGAL_ARGUMENT);
+ }
+ if (self->GetJniEnv()->IsInstanceOf(initiating_loader,
+ art::WellKnownClasses::java_lang_BootClassLoader)) {
+ // Need to use null for the BootClassLoader.
+ initiating_loader = nullptr;
+ }
+
+ art::ScopedObjectAccess soa(self);
+ art::ObjPtr<art::mirror::ClassLoader> class_loader =
+ soa.Decode<art::mirror::ClassLoader>(initiating_loader);
+
+ art::ClassLinker* class_linker = art::Runtime::Current()->GetClassLinker();
+
+ art::ReaderMutexLock mu(self, *art::Locks::classlinker_classes_lock_);
+
+ art::ClassTable* class_table = class_linker->ClassTableForClassLoader(class_loader);
+ if (class_table == nullptr) {
+ // Nothing loaded.
+ *class_count_ptr = 0;
+ *classes_ptr = nullptr;
+ return ERR(NONE);
+ }
+
+ struct ClassTableCount {
+ bool operator()(art::ObjPtr<art::mirror::Class> klass) {
+ DCHECK(klass != nullptr);
+ ++count;
+ return true;
+ }
+
+ size_t count = 0;
+ };
+ ClassTableCount ctc;
+ class_table->Visit(ctc);
+
+ if (ctc.count == 0) {
+ // Nothing loaded.
+ *class_count_ptr = 0;
+ *classes_ptr = nullptr;
+ return ERR(NONE);
+ }
+
+ unsigned char* data;
+ jvmtiError data_result = env->Allocate(ctc.count * sizeof(jclass), &data);
+ if (data_result != ERR(NONE)) {
+ return data_result;
+ }
+ jclass* class_array = reinterpret_cast<jclass*>(data);
+
+ struct ClassTableFill {
+ bool operator()(art::ObjPtr<art::mirror::Class> klass)
+ REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ DCHECK(klass != nullptr);
+ DCHECK_LT(count, ctc_ref.count);
+ local_class_array[count++] = soa_ptr->AddLocalReference<jclass>(klass);
+ return true;
+ }
+
+ jclass* local_class_array;
+ const ClassTableCount& ctc_ref;
+ art::ScopedObjectAccess* soa_ptr;
+ size_t count;
+ };
+ ClassTableFill ctf = { class_array, ctc, &soa, 0 };
+ class_table->Visit(ctf);
+ DCHECK_EQ(ctc.count, ctf.count);
+
+ *class_count_ptr = ctc.count;
+ *classes_ptr = class_array;
+
+ return ERR(NONE);
+}
+
+jvmtiError ClassUtil::GetClassVersionNumbers(jvmtiEnv* env ATTRIBUTE_UNUSED,
+ jclass jklass,
+ jint* minor_version_ptr,
+ jint* major_version_ptr) {
+ art::ScopedObjectAccess soa(art::Thread::Current());
+ if (jklass == nullptr) {
+ return ERR(INVALID_CLASS);
+ }
+ art::ObjPtr<art::mirror::Object> jklass_obj = soa.Decode<art::mirror::Object>(jklass);
+ if (!jklass_obj->IsClass()) {
+ return ERR(INVALID_CLASS);
+ }
+ art::ObjPtr<art::mirror::Class> klass = jklass_obj->AsClass();
+ if (klass->IsPrimitive() || klass->IsArrayClass()) {
+ return ERR(INVALID_CLASS);
+ }
+
+ if (minor_version_ptr == nullptr || major_version_ptr == nullptr) {
+ return ERR(NULL_POINTER);
+ }
+
+ // Note: proxies will show the dex file version of java.lang.reflect.Proxy, as that is
+ // what their dex cache copies from.
+ uint32_t version = klass->GetDexFile().GetHeader().GetVersion();
+
+ *major_version_ptr = static_cast<jint>(version);
+ *minor_version_ptr = 0;
+
+ return ERR(NONE);
+}
+
} // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_class.h b/runtime/openjdkjvmti/ti_class.h
index 577fc8e866..9558894deb 100644
--- a/runtime/openjdkjvmti/ti_class.h
+++ b/runtime/openjdkjvmti/ti_class.h
@@ -65,8 +65,18 @@ class ClassUtil {
static jvmtiError GetClassLoader(jvmtiEnv* env, jclass klass, jobject* classloader_ptr);
+ static jvmtiError GetClassLoaderClasses(jvmtiEnv* env,
+ jobject initiating_loader,
+ jint* class_count_ptr,
+ jclass** classes_ptr);
+
static jvmtiError IsInterface(jvmtiEnv* env, jclass klass, jboolean* is_interface_ptr);
static jvmtiError IsArrayClass(jvmtiEnv* env, jclass klass, jboolean* is_array_class_ptr);
+
+ static jvmtiError GetClassVersionNumbers(jvmtiEnv* env,
+ jclass klass,
+ jint* minor_version_ptr,
+ jint* major_version_ptr);
};
} // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_class_definition.cc b/runtime/openjdkjvmti/ti_class_definition.cc
new file mode 100644
index 0000000000..2c2a79bc58
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_class_definition.cc
@@ -0,0 +1,55 @@
+/* Copyright (C) 2016 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h. The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation. Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#include "ti_class_definition.h"
+
+#include "dex_file.h"
+#include "handle_scope-inl.h"
+#include "handle.h"
+#include "mirror/class-inl.h"
+#include "mirror/object-inl.h"
+#include "thread.h"
+
+namespace openjdkjvmti {
+
+bool ArtClassDefinition::IsModified(art::Thread* self) const {
+ if (modified) {
+ return true;
+ }
+ // Check if the dex file we want to set is the same as the current one.
+ art::StackHandleScope<1> hs(self);
+ art::Handle<art::mirror::Class> h_klass(hs.NewHandle(self->DecodeJObject(klass)->AsClass()));
+ const art::DexFile& cur_dex_file = h_klass->GetDexFile();
+ return static_cast<jint>(cur_dex_file.Size()) != dex_len ||
+ memcmp(cur_dex_file.Begin(), dex_data.get(), dex_len) != 0;
+}
+
+} // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_class_definition.h b/runtime/openjdkjvmti/ti_class_definition.h
new file mode 100644
index 0000000000..dbe5da2d63
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_class_definition.h
@@ -0,0 +1,77 @@
+/* Copyright (C) 2017 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h. The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation. Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#ifndef ART_RUNTIME_OPENJDKJVMTI_TI_CLASS_DEFINITION_H_
+#define ART_RUNTIME_OPENJDKJVMTI_TI_CLASS_DEFINITION_H_
+
+#include "art_jvmti.h"
+
+namespace openjdkjvmti {
+
+// A struct that stores data needed for redefining/transforming classes. This structure should only
+// even be accessed from a single thread and must not survive past the completion of the
+// redefinition/retransformation function that created it.
+struct ArtClassDefinition {
+ public:
+ jclass klass;
+ jobject loader;
+ std::string name;
+ jobject protection_domain;
+ jint dex_len;
+ JvmtiUniquePtr dex_data;
+ art::ArraySlice<const unsigned char> original_dex_file;
+
+ ArtClassDefinition() = default;
+ ArtClassDefinition(ArtClassDefinition&& o) = default;
+
+ void SetNewDexData(ArtJvmTiEnv* env, jint new_dex_len, unsigned char* new_dex_data) {
+ if (new_dex_data == nullptr) {
+ return;
+ } else if (new_dex_data != dex_data.get() || new_dex_len != dex_len) {
+ SetModified();
+ dex_len = new_dex_len;
+ dex_data = MakeJvmtiUniquePtr(env, new_dex_data);
+ }
+ }
+
+ void SetModified() {
+ modified = true;
+ }
+
+ bool IsModified(art::Thread* self) const REQUIRES_SHARED(art::Locks::mutator_lock_);
+
+ private:
+ bool modified;
+};
+
+} // namespace openjdkjvmti
+
+#endif // ART_RUNTIME_OPENJDKJVMTI_TI_CLASS_DEFINITION_H_
diff --git a/runtime/openjdkjvmti/ti_jni.cc b/runtime/openjdkjvmti/ti_jni.cc
new file mode 100644
index 0000000000..88f0395ba5
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_jni.cc
@@ -0,0 +1,91 @@
+/* Copyright (C) 2017 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h. The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation. Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#include "ti_jni.h"
+
+#include "jni.h"
+
+#include "art_jvmti.h"
+#include "base/mutex.h"
+#include "java_vm_ext.h"
+#include "jni_env_ext.h"
+#include "runtime.h"
+#include "thread-inl.h"
+
+namespace openjdkjvmti {
+
+jvmtiError JNIUtil::SetJNIFunctionTable(jvmtiEnv* env ATTRIBUTE_UNUSED,
+ const jniNativeInterface* function_table) {
+ // While we supporting setting null (which will reset the table), the spec says no.
+ if (function_table == nullptr) {
+ return ERR(NULL_POINTER);
+ }
+
+ art::JNIEnvExt::SetTableOverride(function_table);
+ return ERR(NONE);
+}
+
+jvmtiError JNIUtil::GetJNIFunctionTable(jvmtiEnv* env, jniNativeInterface** function_table) {
+ if (function_table == nullptr) {
+ return ERR(NULL_POINTER);
+ }
+
+ // We use the generic JNIEnvExt::GetFunctionTable instead of querying a specific JNIEnv, as
+ // this has to work in the start phase.
+
+ // Figure out which table is current. Conservatively assume check-jni is off.
+ bool check_jni = false;
+ art::Runtime* runtime = art::Runtime::Current();
+ if (runtime != nullptr && runtime->GetJavaVM() != nullptr) {
+ check_jni = runtime->GetJavaVM()->IsCheckJniEnabled();
+ }
+
+ // Get that table.
+ const JNINativeInterface* current_table;
+ {
+ art::MutexLock mu(art::Thread::Current(), *art::Locks::jni_function_table_lock_);
+ current_table = art::JNIEnvExt::GetFunctionTable(check_jni);
+ }
+
+ // Allocate memory and copy the table.
+ unsigned char* data;
+ jvmtiError data_result = env->Allocate(sizeof(JNINativeInterface), &data);
+ if (data_result != ERR(NONE)) {
+ return data_result;
+ }
+ memcpy(data, current_table, sizeof(JNINativeInterface));
+
+ *function_table = reinterpret_cast<JNINativeInterface*>(data);
+
+ return ERR(NONE);
+}
+
+} // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_jni.h b/runtime/openjdkjvmti/ti_jni.h
new file mode 100644
index 0000000000..906aab0667
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_jni.h
@@ -0,0 +1,58 @@
+/* Copyright (C) 2017 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h. The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation. Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#ifndef ART_RUNTIME_OPENJDKJVMTI_TI_JNI_H_
+#define ART_RUNTIME_OPENJDKJVMTI_TI_JNI_H_
+
+#include "jni.h"
+#include "jvmti.h"
+
+namespace openjdkjvmti {
+
+// Note: Currently, JNI function table changes are sensitive to the order of operations wrt/
+// CheckJNI. If an agent sets the function table, and a program than late-enables CheckJNI,
+// CheckJNI will not be working (as the agent will forward to the non-CheckJNI table).
+//
+// This behavior results from our usage of the function table to avoid a check of the
+// CheckJNI flag. A future implementation may install on loading of this plugin an
+// intermediate function table that explicitly checks the flag, so that switching CheckJNI
+// is transparently handled.
+
+class JNIUtil {
+ public:
+ static jvmtiError SetJNIFunctionTable(jvmtiEnv* env, const jniNativeInterface* function_table);
+
+ static jvmtiError GetJNIFunctionTable(jvmtiEnv* env, jniNativeInterface** function_table);
+};
+
+} // namespace openjdkjvmti
+
+#endif // ART_RUNTIME_OPENJDKJVMTI_TI_JNI_H_
diff --git a/runtime/openjdkjvmti/ti_phase.cc b/runtime/openjdkjvmti/ti_phase.cc
new file mode 100644
index 0000000000..85d6b729c5
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_phase.cc
@@ -0,0 +1,129 @@
+/* Copyright (C) 2017 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h. The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation. Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#include "ti_phase.h"
+
+#include "art_jvmti.h"
+#include "base/macros.h"
+#include "events-inl.h"
+#include "runtime.h"
+#include "runtime_callbacks.h"
+#include "ScopedLocalRef.h"
+#include "scoped_thread_state_change-inl.h"
+#include "thread-inl.h"
+#include "thread_list.h"
+
+namespace openjdkjvmti {
+
+jvmtiPhase PhaseUtil::current_phase_ = static_cast<jvmtiPhase>(0);
+
+struct PhaseUtil::PhaseCallback : public art::RuntimePhaseCallback {
+ inline static JNIEnv* GetJniEnv() {
+ return reinterpret_cast<JNIEnv*>(art::Thread::Current()->GetJniEnv());
+ }
+
+ inline static jthread GetCurrentJThread() {
+ art::ScopedObjectAccess soa(art::Thread::Current());
+ return soa.AddLocalReference<jthread>(soa.Self()->GetPeer());
+ }
+
+ void NextRuntimePhase(RuntimePhase phase) OVERRIDE {
+ // TODO: Events.
+ switch (phase) {
+ case RuntimePhase::kInitialAgents:
+ PhaseUtil::current_phase_ = JVMTI_PHASE_PRIMORDIAL;
+ break;
+ case RuntimePhase::kStart:
+ event_handler->DispatchEvent(nullptr, ArtJvmtiEvent::kVmStart, GetJniEnv());
+ PhaseUtil::current_phase_ = JVMTI_PHASE_START;
+ break;
+ case RuntimePhase::kInit:
+ {
+ ScopedLocalRef<jthread> thread(GetJniEnv(), GetCurrentJThread());
+ event_handler->DispatchEvent(nullptr,
+ ArtJvmtiEvent::kVmInit,
+ GetJniEnv(),
+ thread.get());
+ PhaseUtil::current_phase_ = JVMTI_PHASE_LIVE;
+ }
+ break;
+ case RuntimePhase::kDeath:
+ event_handler->DispatchEvent(nullptr, ArtJvmtiEvent::kVmDeath, GetJniEnv());
+ PhaseUtil::current_phase_ = JVMTI_PHASE_DEAD;
+ // TODO: Block events now.
+ break;
+ }
+ }
+
+ EventHandler* event_handler = nullptr;
+};
+
+PhaseUtil::PhaseCallback gPhaseCallback;
+
+jvmtiError PhaseUtil::GetPhase(jvmtiEnv* env ATTRIBUTE_UNUSED, jvmtiPhase* phase_ptr) {
+ if (phase_ptr == nullptr) {
+ return ERR(NULL_POINTER);
+ }
+ jvmtiPhase now = PhaseUtil::current_phase_;
+ DCHECK(now == JVMTI_PHASE_ONLOAD ||
+ now == JVMTI_PHASE_PRIMORDIAL ||
+ now == JVMTI_PHASE_START ||
+ now == JVMTI_PHASE_LIVE ||
+ now == JVMTI_PHASE_DEAD);
+ *phase_ptr = now;
+ return ERR(NONE);
+}
+
+void PhaseUtil::SetToOnLoad() {
+ DCHECK_EQ(0u, static_cast<size_t>(PhaseUtil::current_phase_));
+ PhaseUtil::current_phase_ = JVMTI_PHASE_ONLOAD;
+}
+
+void PhaseUtil::SetToPrimordial() {
+ DCHECK_EQ(static_cast<size_t>(JVMTI_PHASE_ONLOAD), static_cast<size_t>(PhaseUtil::current_phase_));
+ PhaseUtil::current_phase_ = JVMTI_PHASE_ONLOAD;
+}
+
+void PhaseUtil::SetToLive() {
+ DCHECK_EQ(static_cast<size_t>(0), static_cast<size_t>(PhaseUtil::current_phase_));
+ PhaseUtil::current_phase_ = JVMTI_PHASE_LIVE;
+}
+
+void PhaseUtil::Register(EventHandler* handler) {
+ gPhaseCallback.event_handler = handler;
+ art::ScopedThreadStateChange stsc(art::Thread::Current(),
+ art::ThreadState::kWaitingForDebuggerToAttach);
+ art::ScopedSuspendAll ssa("Add phase callback");
+ art::Runtime::Current()->GetRuntimeCallbacks()->AddRuntimePhaseCallback(&gPhaseCallback);
+}
+
+
+} // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_phase.h b/runtime/openjdkjvmti/ti_phase.h
new file mode 100644
index 0000000000..054652a48d
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_phase.h
@@ -0,0 +1,65 @@
+/* Copyright (C) 2017 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h. The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation. Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#ifndef ART_RUNTIME_OPENJDKJVMTI_TI_PHASE_H_
+#define ART_RUNTIME_OPENJDKJVMTI_TI_PHASE_H_
+
+#include "jni.h"
+#include "jvmti.h"
+
+namespace openjdkjvmti {
+
+class EventHandler;
+
+class PhaseUtil {
+ public:
+ static jvmtiError GetPhase(jvmtiEnv* env, jvmtiPhase* phase_ptr);
+
+ static void Register(EventHandler* event_handler);
+
+ // Move the phase from unitialized to LOAD.
+ static void SetToOnLoad();
+
+ // Move the phase from LOAD to PRIMORDIAL.
+ static void SetToPrimordial();
+
+ // Move the phase from unitialized to LIVE.
+ static void SetToLive();
+
+ struct PhaseCallback;
+
+ private:
+ static jvmtiPhase current_phase_;
+};
+
+} // namespace openjdkjvmti
+
+#endif // ART_RUNTIME_OPENJDKJVMTI_TI_PHASE_H_
diff --git a/runtime/openjdkjvmti/ti_redefine.cc b/runtime/openjdkjvmti/ti_redefine.cc
index 5bf844564c..34efc502e1 100644
--- a/runtime/openjdkjvmti/ti_redefine.cc
+++ b/runtime/openjdkjvmti/ti_redefine.cc
@@ -36,6 +36,7 @@
#include "android-base/stringprintf.h"
#include "art_jvmti.h"
+#include "base/array_slice.h"
#include "base/logging.h"
#include "dex_file.h"
#include "dex_file_types.h"
@@ -53,6 +54,7 @@
#include "object_lock.h"
#include "runtime.h"
#include "ScopedLocalRef.h"
+#include "transform.h"
namespace openjdkjvmti {
@@ -207,7 +209,7 @@ jvmtiError Redefiner::GetClassRedefinitionError(art::Handle<art::mirror::Class>
// Moves dex data to an anonymous, read-only mmap'd region.
std::unique_ptr<art::MemMap> Redefiner::MoveDataToMemMap(const std::string& original_location,
jint data_len,
- unsigned char* dex_data,
+ const unsigned char* dex_data,
std::string* error_msg) {
std::unique_ptr<art::MemMap> map(art::MemMap::MapAnonymous(
StringPrintf("%s-transformed", original_location.c_str()).c_str(),
@@ -227,34 +229,140 @@ std::unique_ptr<art::MemMap> Redefiner::MoveDataToMemMap(const std::string& orig
return map;
}
-// TODO This should handle doing multiple classes at once so we need to do less cleanup when things
-// go wrong.
-jvmtiError Redefiner::RedefineClass(ArtJvmTiEnv* env,
- art::Runtime* runtime,
- art::Thread* self,
- jclass klass,
- const std::string& original_dex_location,
- jint data_len,
- unsigned char* dex_data,
- std::string* error_msg) {
- std::unique_ptr<art::MemMap> map(MoveDataToMemMap(original_dex_location,
- data_len,
- dex_data,
- error_msg));
- std::ostringstream os;
+Redefiner::ClassRedefinition::ClassRedefinition(
+ Redefiner* driver,
+ jclass klass,
+ const art::DexFile* redefined_dex_file,
+ const char* class_sig,
+ art::ArraySlice<const unsigned char> orig_dex_file) :
+ driver_(driver),
+ klass_(klass),
+ dex_file_(redefined_dex_file),
+ class_sig_(class_sig),
+ original_dex_file_(orig_dex_file) {
+ GetMirrorClass()->MonitorEnter(driver_->self_);
+}
+
+Redefiner::ClassRedefinition::~ClassRedefinition() {
+ if (driver_ != nullptr) {
+ GetMirrorClass()->MonitorExit(driver_->self_);
+ }
+}
+
+jvmtiError Redefiner::RedefineClasses(ArtJvmTiEnv* env,
+ art::Runtime* runtime,
+ art::Thread* self,
+ jint class_count,
+ const jvmtiClassDefinition* definitions,
+ /*out*/std::string* error_msg) {
+ if (env == nullptr) {
+ *error_msg = "env was null!";
+ return ERR(INVALID_ENVIRONMENT);
+ } else if (class_count < 0) {
+ *error_msg = "class_count was less then 0";
+ return ERR(ILLEGAL_ARGUMENT);
+ } else if (class_count == 0) {
+ // We don't actually need to do anything. Just return OK.
+ return OK;
+ } else if (definitions == nullptr) {
+ *error_msg = "null definitions!";
+ return ERR(NULL_POINTER);
+ }
+ std::vector<ArtClassDefinition> def_vector;
+ def_vector.reserve(class_count);
+ for (jint i = 0; i < class_count; i++) {
+ // We make a copy of the class_bytes to pass into the retransformation.
+ // This makes cleanup easier (since we unambiguously own the bytes) and also is useful since we
+ // will need to keep the original bytes around unaltered for subsequent RetransformClasses calls
+ // to get the passed in bytes.
+ // TODO Implement saving the original bytes.
+ unsigned char* class_bytes_copy = nullptr;
+ jvmtiError res = env->Allocate(definitions[i].class_byte_count, &class_bytes_copy);
+ if (res != OK) {
+ return res;
+ }
+ memcpy(class_bytes_copy, definitions[i].class_bytes, definitions[i].class_byte_count);
+
+ ArtClassDefinition def;
+ def.dex_len = definitions[i].class_byte_count;
+ def.dex_data = MakeJvmtiUniquePtr(env, class_bytes_copy);
+ // We are definitely modified.
+ def.SetModified();
+ def.original_dex_file = art::ArraySlice<const unsigned char>(definitions[i].class_bytes,
+ definitions[i].class_byte_count);
+ res = Transformer::FillInTransformationData(env, definitions[i].klass, &def);
+ if (res != OK) {
+ return res;
+ }
+ def_vector.push_back(std::move(def));
+ }
+ // Call all the transformation events.
+ jvmtiError res = Transformer::RetransformClassesDirect(env,
+ self,
+ &def_vector);
+ if (res != OK) {
+ // Something went wrong with transformation!
+ return res;
+ }
+ return RedefineClassesDirect(env, runtime, self, def_vector, error_msg);
+}
+
+jvmtiError Redefiner::RedefineClassesDirect(ArtJvmTiEnv* env,
+ art::Runtime* runtime,
+ art::Thread* self,
+ const std::vector<ArtClassDefinition>& definitions,
+ std::string* error_msg) {
+ DCHECK(env != nullptr);
+ if (definitions.size() == 0) {
+ // We don't actually need to do anything. Just return OK.
+ return OK;
+ }
+ // Stop JIT for the duration of this redefine since the JIT might concurrently compile a method we
+ // are going to redefine.
+ art::jit::ScopedJitSuspend suspend_jit;
+ // Get shared mutator lock so we can lock all the classes.
+ art::ScopedObjectAccess soa(self);
+ Redefiner r(runtime, self, error_msg);
+ for (const ArtClassDefinition& def : definitions) {
+ // Only try to transform classes that have been modified.
+ if (def.IsModified(self)) {
+ jvmtiError res = r.AddRedefinition(env, def);
+ if (res != OK) {
+ return res;
+ }
+ }
+ }
+ return r.Run();
+}
+
+jvmtiError Redefiner::AddRedefinition(ArtJvmTiEnv* env, const ArtClassDefinition& def) {
+ std::string original_dex_location;
+ jvmtiError ret = OK;
+ if ((ret = GetClassLocation(env, def.klass, &original_dex_location))) {
+ *error_msg_ = "Unable to get original dex file location!";
+ return ret;
+ }
char* generic_ptr_unused = nullptr;
char* signature_ptr = nullptr;
- if (env->GetClassSignature(klass, &signature_ptr, &generic_ptr_unused) != OK) {
- signature_ptr = const_cast<char*>("<UNKNOWN CLASS>");
+ if ((ret = env->GetClassSignature(def.klass, &signature_ptr, &generic_ptr_unused)) != OK) {
+ *error_msg_ = "Unable to get class signature!";
+ return ret;
}
+ JvmtiUniquePtr generic_unique_ptr(MakeJvmtiUniquePtr(env, generic_ptr_unused));
+ JvmtiUniquePtr signature_unique_ptr(MakeJvmtiUniquePtr(env, signature_ptr));
+ std::unique_ptr<art::MemMap> map(MoveDataToMemMap(original_dex_location,
+ def.dex_len,
+ def.dex_data.get(),
+ error_msg_));
+ std::ostringstream os;
if (map.get() == nullptr) {
- os << "Failed to create anonymous mmap for modified dex file of class " << signature_ptr
- << "in dex file " << original_dex_location << " because: " << *error_msg;
- *error_msg = os.str();
+ os << "Failed to create anonymous mmap for modified dex file of class " << def.name
+ << "in dex file " << original_dex_location << " because: " << *error_msg_;
+ *error_msg_ = os.str();
return ERR(OUT_OF_MEMORY);
}
if (map->Size() < sizeof(art::DexFile::Header)) {
- *error_msg = "Could not read dex file header because dex_data was too short";
+ *error_msg_ = "Could not read dex file header because dex_data was too short";
return ERR(INVALID_CLASS_FORMAT);
}
uint32_t checksum = reinterpret_cast<const art::DexFile::Header*>(map->Begin())->checksum_;
@@ -263,28 +371,25 @@ jvmtiError Redefiner::RedefineClass(ArtJvmTiEnv* env,
std::move(map),
/*verify*/true,
/*verify_checksum*/true,
- error_msg));
+ error_msg_));
if (dex_file.get() == nullptr) {
- os << "Unable to load modified dex file for " << signature_ptr << ": " << *error_msg;
- *error_msg = os.str();
+ os << "Unable to load modified dex file for " << def.name << ": " << *error_msg_;
+ *error_msg_ = os.str();
return ERR(INVALID_CLASS_FORMAT);
}
- // Stop JIT for the duration of this redefine since the JIT might concurrently compile a method we
- // are going to redefine.
- art::jit::ScopedJitSuspend suspend_jit;
- // Get shared mutator lock.
- art::ScopedObjectAccess soa(self);
- art::StackHandleScope<1> hs(self);
- Redefiner r(runtime, self, klass, signature_ptr, dex_file, error_msg);
- // Lock around this class to avoid races.
- art::ObjectLock<art::mirror::Class> lock(self, hs.NewHandle(r.GetMirrorClass()));
- return r.Run();
+ redefinitions_.push_back(
+ Redefiner::ClassRedefinition(this,
+ def.klass,
+ dex_file.release(),
+ signature_ptr,
+ def.original_dex_file));
+ return OK;
}
// TODO *MAJOR* This should return the actual source java.lang.DexFile object for the klass.
// TODO Make mirror of DexFile and associated types to make this less hellish.
// TODO Make mirror of BaseDexClassLoader and associated types to make this less hellish.
-art::mirror::Object* Redefiner::FindSourceDexFileObject(
+art::mirror::Object* Redefiner::ClassRedefinition::FindSourceDexFileObject(
art::Handle<art::mirror::ClassLoader> loader) {
const char* dex_path_list_element_array_name = "[Ldalvik/system/DexPathList$Element;";
const char* dex_path_list_element_name = "Ldalvik/system/DexPathList$Element;";
@@ -292,14 +397,14 @@ art::mirror::Object* Redefiner::FindSourceDexFileObject(
const char* dex_path_list_name = "Ldalvik/system/DexPathList;";
const char* dex_class_loader_name = "Ldalvik/system/BaseDexClassLoader;";
- CHECK(!self_->IsExceptionPending());
- art::StackHandleScope<11> hs(self_);
- art::ClassLinker* class_linker = runtime_->GetClassLinker();
+ CHECK(!driver_->self_->IsExceptionPending());
+ art::StackHandleScope<11> hs(driver_->self_);
+ art::ClassLinker* class_linker = driver_->runtime_->GetClassLinker();
art::Handle<art::mirror::ClassLoader> null_loader(hs.NewHandle<art::mirror::ClassLoader>(
nullptr));
art::Handle<art::mirror::Class> base_dex_loader_class(hs.NewHandle(class_linker->FindClass(
- self_, dex_class_loader_name, null_loader)));
+ driver_->self_, dex_class_loader_name, null_loader)));
// Get all the ArtFields so we can look in the BaseDexClassLoader
art::ArtField* path_list_field = base_dex_loader_class->FindDeclaredInstanceField(
@@ -307,12 +412,12 @@ art::mirror::Object* Redefiner::FindSourceDexFileObject(
CHECK(path_list_field != nullptr);
art::ArtField* dex_path_list_element_field =
- class_linker->FindClass(self_, dex_path_list_name, null_loader)
+ class_linker->FindClass(driver_->self_, dex_path_list_name, null_loader)
->FindDeclaredInstanceField("dexElements", dex_path_list_element_array_name);
CHECK(dex_path_list_element_field != nullptr);
art::ArtField* element_dex_file_field =
- class_linker->FindClass(self_, dex_path_list_element_name, null_loader)
+ class_linker->FindClass(driver_->self_, dex_path_list_element_name, null_loader)
->FindDeclaredInstanceField("dexFile", dex_file_name);
CHECK(element_dex_file_field != nullptr);
@@ -327,11 +432,11 @@ art::mirror::Object* Redefiner::FindSourceDexFileObject(
art::Handle<art::mirror::Object> path_list(
hs.NewHandle(path_list_field->GetObject(loader.Get())));
CHECK(path_list.Get() != nullptr);
- CHECK(!self_->IsExceptionPending());
+ CHECK(!driver_->self_->IsExceptionPending());
art::Handle<art::mirror::ObjectArray<art::mirror::Object>> dex_elements_list(hs.NewHandle(
dex_path_list_element_field->GetObject(path_list.Get())->
AsObjectArray<art::mirror::Object>()));
- CHECK(!self_->IsExceptionPending());
+ CHECK(!driver_->self_->IsExceptionPending());
CHECK(dex_elements_list.Get() != nullptr);
size_t num_elements = dex_elements_list->GetLength();
art::MutableHandle<art::mirror::Object> current_element(
@@ -343,9 +448,9 @@ art::mirror::Object* Redefiner::FindSourceDexFileObject(
for (size_t i = 0; i < num_elements; i++) {
current_element.Assign(dex_elements_list->Get(i));
CHECK(current_element.Get() != nullptr);
- CHECK(!self_->IsExceptionPending());
+ CHECK(!driver_->self_->IsExceptionPending());
CHECK(dex_elements_list.Get() != nullptr);
- CHECK_EQ(current_element->GetClass(), class_linker->FindClass(self_,
+ CHECK_EQ(current_element->GetClass(), class_linker->FindClass(driver_->self_,
dex_path_list_element_name,
null_loader));
// TODO It would be cleaner to put the art::DexFile into the dalvik.system.DexFile the class
@@ -360,22 +465,23 @@ art::mirror::Object* Redefiner::FindSourceDexFileObject(
return nullptr;
}
-art::mirror::Class* Redefiner::GetMirrorClass() {
- return self_->DecodeJObject(klass_)->AsClass();
+art::mirror::Class* Redefiner::ClassRedefinition::GetMirrorClass() {
+ return driver_->self_->DecodeJObject(klass_)->AsClass();
}
-art::mirror::ClassLoader* Redefiner::GetClassLoader() {
+art::mirror::ClassLoader* Redefiner::ClassRedefinition::GetClassLoader() {
return GetMirrorClass()->GetClassLoader();
}
-art::mirror::DexCache* Redefiner::CreateNewDexCache(art::Handle<art::mirror::ClassLoader> loader) {
- return runtime_->GetClassLinker()->RegisterDexFile(*dex_file_, loader.Get());
+art::mirror::DexCache* Redefiner::ClassRedefinition::CreateNewDexCache(
+ art::Handle<art::mirror::ClassLoader> loader) {
+ return driver_->runtime_->GetClassLinker()->RegisterDexFile(*dex_file_, loader.Get());
}
// TODO Really wishing I had that mirror of java.lang.DexFile now.
-art::mirror::LongArray* Redefiner::AllocateDexFileCookie(
+art::mirror::LongArray* Redefiner::ClassRedefinition::AllocateDexFileCookie(
art::Handle<art::mirror::Object> java_dex_file_obj) {
- art::StackHandleScope<2> hs(self_);
+ art::StackHandleScope<2> hs(driver_->self_);
// mCookie is nulled out if the DexFile has been closed but mInternalCookie sticks around until
// the object is finalized. Since they always point to the same array if mCookie is not null we
// just use the mInternalCookie field. We will update one or both of these fields later.
@@ -390,9 +496,9 @@ art::mirror::LongArray* Redefiner::AllocateDexFileCookie(
CHECK(cookie.Get() != nullptr);
CHECK_GE(cookie->GetLength(), 1);
art::Handle<art::mirror::LongArray> new_cookie(
- hs.NewHandle(art::mirror::LongArray::Alloc(self_, cookie->GetLength() + 1)));
+ hs.NewHandle(art::mirror::LongArray::Alloc(driver_->self_, cookie->GetLength() + 1)));
if (new_cookie.Get() == nullptr) {
- self_->AssertPendingOOMException();
+ driver_->self_->AssertPendingOOMException();
return nullptr;
}
// Copy the oat-dex field at the start.
@@ -405,61 +511,65 @@ art::mirror::LongArray* Redefiner::AllocateDexFileCookie(
return new_cookie.Get();
}
-void Redefiner::RecordFailure(jvmtiError result, const std::string& error_msg) {
+void Redefiner::RecordFailure(jvmtiError result,
+ const std::string& class_sig,
+ const std::string& error_msg) {
*error_msg_ = StringPrintf("Unable to perform redefinition of '%s': %s",
- class_sig_,
+ class_sig.c_str(),
error_msg.c_str());
result_ = result;
}
-bool Redefiner::FinishRemainingAllocations(
- /*out*/art::MutableHandle<art::mirror::ClassLoader>* source_class_loader,
- /*out*/art::MutableHandle<art::mirror::Object>* java_dex_file_obj,
- /*out*/art::MutableHandle<art::mirror::LongArray>* new_dex_file_cookie,
- /*out*/art::MutableHandle<art::mirror::DexCache>* new_dex_cache) {
- art::StackHandleScope<4> hs(self_);
- // This shouldn't allocate
- art::Handle<art::mirror::ClassLoader> loader(hs.NewHandle(GetClassLoader()));
- if (loader.Get() == nullptr) {
- // TODO Better error msg.
- RecordFailure(ERR(INTERNAL), "Unable to find class loader!");
- return false;
+// Allocates a ByteArray big enough to store the given number of bytes and copies them from the
+// bytes pointer.
+static art::mirror::ByteArray* AllocateAndFillBytes(art::Thread* self,
+ const uint8_t* bytes,
+ int32_t num_bytes)
+ REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ art::StackHandleScope<1> hs(self);
+ art::Handle<art::mirror::ByteArray> arr(hs.NewHandle(
+ art::mirror::ByteArray::Alloc(self, num_bytes)));
+ if (!arr.IsNull()) {
+ // Copy it in. Just skip if it's null
+ memcpy(arr->GetData(), bytes, num_bytes);
}
- art::Handle<art::mirror::Object> dex_file_obj(hs.NewHandle(FindSourceDexFileObject(loader)));
- if (dex_file_obj.Get() == nullptr) {
- // TODO Better error msg.
- RecordFailure(ERR(INTERNAL), "Unable to find class loader!");
- return false;
+ return arr.Get();
+}
+
+art::mirror::ByteArray* Redefiner::ClassRedefinition::AllocateOrGetOriginalDexFileBytes() {
+ // If we have been specifically given a new set of bytes use that
+ if (original_dex_file_.size() != 0) {
+ return AllocateAndFillBytes(driver_->self_,
+ &original_dex_file_.At(0),
+ original_dex_file_.size());
}
- art::Handle<art::mirror::LongArray> new_cookie(hs.NewHandle(AllocateDexFileCookie(dex_file_obj)));
- if (new_cookie.Get() == nullptr) {
- self_->AssertPendingOOMException();
- self_->ClearException();
- RecordFailure(ERR(OUT_OF_MEMORY), "Unable to allocate dex file array for class loader");
- return false;
+
+ // See if we already have one set.
+ art::ObjPtr<art::mirror::ClassExt> ext(GetMirrorClass()->GetExtData());
+ if (!ext.IsNull()) {
+ art::ObjPtr<art::mirror::ByteArray> old_original_bytes(ext->GetOriginalDexFileBytes());
+ if (!old_original_bytes.IsNull()) {
+ // We do. Use it.
+ return old_original_bytes.Ptr();
+ }
}
- art::Handle<art::mirror::DexCache> dex_cache(hs.NewHandle(CreateNewDexCache(loader)));
- if (dex_cache.Get() == nullptr) {
- self_->AssertPendingOOMException();
- self_->ClearException();
- RecordFailure(ERR(OUT_OF_MEMORY), "Unable to allocate DexCache");
- return false;
+
+ // Copy the current dex_file
+ const art::DexFile& current_dex_file = GetMirrorClass()->GetDexFile();
+ // TODO Handle this or make it so it cannot happen.
+ if (current_dex_file.NumClassDefs() != 1) {
+ LOG(WARNING) << "Current dex file has more than one class in it. Calling RetransformClasses "
+ << "on this class might fail if no transformations are applied to it!";
}
- source_class_loader->Assign(loader.Get());
- java_dex_file_obj->Assign(dex_file_obj.Get());
- new_dex_file_cookie->Assign(new_cookie.Get());
- new_dex_cache->Assign(dex_cache.Get());
- return true;
+ return AllocateAndFillBytes(driver_->self_, current_dex_file.Begin(), current_dex_file.Size());
}
struct CallbackCtx {
- Redefiner* const r;
art::LinearAlloc* allocator;
std::unordered_map<art::ArtMethod*, art::ArtMethod*> obsolete_map;
std::unordered_set<art::ArtMethod*> obsolete_methods;
- CallbackCtx(Redefiner* self, art::LinearAlloc* alloc)
- : r(self), allocator(alloc) {}
+ explicit CallbackCtx(art::LinearAlloc* alloc) : allocator(alloc) {}
};
void DoAllocateObsoleteMethodsCallback(art::Thread* t, void* vdata) NO_THREAD_SAFETY_ANALYSIS {
@@ -472,11 +582,12 @@ void DoAllocateObsoleteMethodsCallback(art::Thread* t, void* vdata) NO_THREAD_SA
// This creates any ArtMethod* structures needed for obsolete methods and ensures that the stack is
// updated so they will be run.
-void Redefiner::FindAndAllocateObsoleteMethods(art::mirror::Class* art_klass) {
+// TODO Rewrite so we can do this only once regardless of how many redefinitions there are.
+void Redefiner::ClassRedefinition::FindAndAllocateObsoleteMethods(art::mirror::Class* art_klass) {
art::ScopedAssertNoThreadSuspension ns("No thread suspension during thread stack walking");
art::mirror::ClassExt* ext = art_klass->GetExtData();
CHECK(ext->GetObsoleteMethods() != nullptr);
- CallbackCtx ctx(this, art_klass->GetClassLoader()->GetAllocator());
+ CallbackCtx ctx(art_klass->GetClassLoader()->GetAllocator());
// Add all the declared methods to the map
for (auto& m : art_klass->GetDeclaredMethods(art::kRuntimePointerSize)) {
ctx.obsolete_methods.insert(&m);
@@ -484,7 +595,7 @@ void Redefiner::FindAndAllocateObsoleteMethods(art::mirror::Class* art_klass) {
DCHECK(!m.IsIntrinsic());
}
{
- art::MutexLock mu(self_, *art::Locks::thread_list_lock_);
+ art::MutexLock mu(driver_->self_, *art::Locks::thread_list_lock_);
art::ThreadList* list = art::Runtime::Current()->GetThreadList();
list->ForEach(DoAllocateObsoleteMethodsCallback, static_cast<void*>(&ctx));
}
@@ -493,7 +604,7 @@ void Redefiner::FindAndAllocateObsoleteMethods(art::mirror::Class* art_klass) {
// Fills the obsolete method map in the art_klass's extData. This is so obsolete methods are able to
// figure out their DexCaches.
-void Redefiner::FillObsoleteMethodMap(
+void Redefiner::ClassRedefinition::FillObsoleteMethodMap(
art::mirror::Class* art_klass,
const std::unordered_map<art::ArtMethod*, art::ArtMethod*>& obsoletes) {
int32_t index = 0;
@@ -532,9 +643,9 @@ void Redefiner::EnsureObsoleteMethodsAreDeoptimized() {
i->ReJitEverything("libOpenJkdJvmti - Class Redefinition");
}
-bool Redefiner::CheckClass() {
+bool Redefiner::ClassRedefinition::CheckClass() {
// TODO Might just want to put it in a ObjPtr and NoSuspend assert.
- art::StackHandleScope<1> hs(self_);
+ art::StackHandleScope<1> hs(driver_->self_);
// Easy check that only 1 class def is present.
if (dex_file_->NumClassDefs() != 1) {
RecordFailure(ERR(ILLEGAL_ARGUMENT),
@@ -607,14 +718,15 @@ bool Redefiner::CheckClass() {
}
}
LOG(WARNING) << "No verification is done on annotations of redefined classes.";
+ LOG(WARNING) << "Bytecodes of redefinitions are not verified.";
return true;
}
// TODO Move this to use IsRedefinable when that function is made.
-bool Redefiner::CheckRedefinable() {
+bool Redefiner::ClassRedefinition::CheckRedefinable() {
std::string err;
- art::StackHandleScope<1> hs(self_);
+ art::StackHandleScope<1> hs(driver_->self_);
art::Handle<art::mirror::Class> h_klass(hs.NewHandle(GetMirrorClass()));
jvmtiError res = Redefiner::GetClassRedefinitionError(h_klass, &err);
@@ -626,46 +738,233 @@ bool Redefiner::CheckRedefinable() {
}
}
-bool Redefiner::CheckRedefinitionIsValid() {
+bool Redefiner::ClassRedefinition::CheckRedefinitionIsValid() {
return CheckRedefinable() &&
CheckClass() &&
CheckSameFields() &&
CheckSameMethods();
}
+// A wrapper that lets us hold onto the arbitrary sized data needed for redefinitions in a
+// reasonably sane way. This adds no fields to the normal ObjectArray. By doing this we can avoid
+// having to deal with the fact that we need to hold an arbitrary number of references live.
+class RedefinitionDataHolder {
+ public:
+ enum DataSlot : int32_t {
+ kSlotSourceClassLoader = 0,
+ kSlotJavaDexFile = 1,
+ kSlotNewDexFileCookie = 2,
+ kSlotNewDexCache = 3,
+ kSlotMirrorClass = 4,
+ kSlotOrigDexFile = 5,
+
+ // Must be last one.
+ kNumSlots = 6,
+ };
+
+ // This needs to have a HandleScope passed in that is capable of creating a new Handle without
+ // overflowing. Only one handle will be created. This object has a lifetime identical to that of
+ // the passed in handle-scope.
+ RedefinitionDataHolder(art::StackHandleScope<1>* hs,
+ art::Runtime* runtime,
+ art::Thread* self,
+ int32_t num_redefinitions) REQUIRES_SHARED(art::Locks::mutator_lock_) :
+ arr_(
+ hs->NewHandle(
+ art::mirror::ObjectArray<art::mirror::Object>::Alloc(
+ self,
+ runtime->GetClassLinker()->GetClassRoot(art::ClassLinker::kObjectArrayClass),
+ num_redefinitions * kNumSlots))) {}
+
+ bool IsNull() const REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ return arr_.IsNull();
+ }
+
+ // TODO Maybe make an iterable view type to simplify using this.
+ art::mirror::ClassLoader* GetSourceClassLoader(jint klass_index)
+ REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ return art::down_cast<art::mirror::ClassLoader*>(GetSlot(klass_index, kSlotSourceClassLoader));
+ }
+ art::mirror::Object* GetJavaDexFile(jint klass_index) REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ return GetSlot(klass_index, kSlotJavaDexFile);
+ }
+ art::mirror::LongArray* GetNewDexFileCookie(jint klass_index)
+ REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ return art::down_cast<art::mirror::LongArray*>(GetSlot(klass_index, kSlotNewDexFileCookie));
+ }
+ art::mirror::DexCache* GetNewDexCache(jint klass_index)
+ REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ return art::down_cast<art::mirror::DexCache*>(GetSlot(klass_index, kSlotNewDexCache));
+ }
+ art::mirror::Class* GetMirrorClass(jint klass_index) REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ return art::down_cast<art::mirror::Class*>(GetSlot(klass_index, kSlotMirrorClass));
+ }
+
+ art::mirror::ByteArray* GetOriginalDexFileBytes(jint klass_index)
+ REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ return art::down_cast<art::mirror::ByteArray*>(GetSlot(klass_index, kSlotOrigDexFile));
+ }
+
+ void SetSourceClassLoader(jint klass_index, art::mirror::ClassLoader* loader)
+ REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ SetSlot(klass_index, kSlotSourceClassLoader, loader);
+ }
+ void SetJavaDexFile(jint klass_index, art::mirror::Object* dexfile)
+ REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ SetSlot(klass_index, kSlotJavaDexFile, dexfile);
+ }
+ void SetNewDexFileCookie(jint klass_index, art::mirror::LongArray* cookie)
+ REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ SetSlot(klass_index, kSlotNewDexFileCookie, cookie);
+ }
+ void SetNewDexCache(jint klass_index, art::mirror::DexCache* cache)
+ REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ SetSlot(klass_index, kSlotNewDexCache, cache);
+ }
+ void SetMirrorClass(jint klass_index, art::mirror::Class* klass)
+ REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ SetSlot(klass_index, kSlotMirrorClass, klass);
+ }
+ void SetOriginalDexFileBytes(jint klass_index, art::mirror::ByteArray* bytes)
+ REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ SetSlot(klass_index, kSlotOrigDexFile, bytes);
+ }
+
+ int32_t Length() REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ return arr_->GetLength() / kNumSlots;
+ }
+
+ private:
+ art::Handle<art::mirror::ObjectArray<art::mirror::Object>> arr_;
+
+ art::mirror::Object* GetSlot(jint klass_index,
+ DataSlot slot) REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ DCHECK_LT(klass_index, Length());
+ return arr_->Get((kNumSlots * klass_index) + slot);
+ }
+
+ void SetSlot(jint klass_index,
+ DataSlot slot,
+ art::ObjPtr<art::mirror::Object> obj) REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ DCHECK(!art::Runtime::Current()->IsActiveTransaction());
+ DCHECK_LT(klass_index, Length());
+ arr_->Set<false>((kNumSlots * klass_index) + slot, obj);
+ }
+
+ DISALLOW_COPY_AND_ASSIGN(RedefinitionDataHolder);
+};
+
+bool Redefiner::ClassRedefinition::FinishRemainingAllocations(
+ int32_t klass_index, /*out*/RedefinitionDataHolder* holder) {
+ art::StackHandleScope<2> hs(driver_->self_);
+ holder->SetMirrorClass(klass_index, GetMirrorClass());
+ // This shouldn't allocate
+ art::Handle<art::mirror::ClassLoader> loader(hs.NewHandle(GetClassLoader()));
+ holder->SetSourceClassLoader(klass_index, loader.Get());
+ if (loader.Get() == nullptr) {
+ // TODO Better error msg.
+ RecordFailure(ERR(INTERNAL), "Unable to find class loader!");
+ return false;
+ }
+ art::Handle<art::mirror::Object> dex_file_obj(hs.NewHandle(FindSourceDexFileObject(loader)));
+ holder->SetJavaDexFile(klass_index, dex_file_obj.Get());
+ if (dex_file_obj.Get() == nullptr) {
+ // TODO Better error msg.
+ RecordFailure(ERR(INTERNAL), "Unable to find class loader!");
+ return false;
+ }
+ holder->SetNewDexFileCookie(klass_index, AllocateDexFileCookie(dex_file_obj));
+ if (holder->GetNewDexFileCookie(klass_index) == nullptr) {
+ driver_->self_->AssertPendingOOMException();
+ driver_->self_->ClearException();
+ RecordFailure(ERR(OUT_OF_MEMORY), "Unable to allocate dex file array for class loader");
+ return false;
+ }
+ holder->SetNewDexCache(klass_index, CreateNewDexCache(loader));
+ if (holder->GetNewDexCache(klass_index) == nullptr) {
+ driver_->self_->AssertPendingOOMException();
+ driver_->self_->ClearException();
+ RecordFailure(ERR(OUT_OF_MEMORY), "Unable to allocate DexCache");
+ return false;
+ }
+
+ // We won't always need to set this field.
+ holder->SetOriginalDexFileBytes(klass_index, AllocateOrGetOriginalDexFileBytes());
+ if (holder->GetOriginalDexFileBytes(klass_index) == nullptr) {
+ driver_->self_->AssertPendingOOMException();
+ driver_->self_->ClearException();
+ RecordFailure(ERR(OUT_OF_MEMORY), "Unable to allocate array for original dex file");
+ return false;
+ }
+ return true;
+}
+
+bool Redefiner::CheckAllRedefinitionAreValid() {
+ for (Redefiner::ClassRedefinition& redef : redefinitions_) {
+ if (!redef.CheckRedefinitionIsValid()) {
+ return false;
+ }
+ }
+ return true;
+}
+
+bool Redefiner::EnsureAllClassAllocationsFinished() {
+ for (Redefiner::ClassRedefinition& redef : redefinitions_) {
+ if (!redef.EnsureClassAllocationsFinished()) {
+ return false;
+ }
+ }
+ return true;
+}
+
+bool Redefiner::FinishAllRemainingAllocations(RedefinitionDataHolder& holder) {
+ int32_t cnt = 0;
+ for (Redefiner::ClassRedefinition& redef : redefinitions_) {
+ // Allocate the data this redefinition requires.
+ if (!redef.FinishRemainingAllocations(cnt, &holder)) {
+ return false;
+ }
+ cnt++;
+ }
+ return true;
+}
+
+void Redefiner::ClassRedefinition::ReleaseDexFile() {
+ dex_file_.release();
+}
+
+void Redefiner::ReleaseAllDexFiles() {
+ for (Redefiner::ClassRedefinition& redef : redefinitions_) {
+ redef.ReleaseDexFile();
+ }
+}
+
jvmtiError Redefiner::Run() {
- art::StackHandleScope<5> hs(self_);
- // TODO We might want to have a global lock (or one based on the class being redefined at least)
- // in order to make cleanup easier. Not a huge deal though.
- //
+ art::StackHandleScope<1> hs(self_);
+ // Allocate an array to hold onto all java temporary objects associated with this redefinition.
+ // We will let this be collected after the end of this function.
+ RedefinitionDataHolder holder(&hs, runtime_, self_, redefinitions_.size());
+ if (holder.IsNull()) {
+ self_->AssertPendingOOMException();
+ self_->ClearException();
+ RecordFailure(ERR(OUT_OF_MEMORY), "Could not allocate storage for temporaries");
+ return result_;
+ }
+
// First we just allocate the ClassExt and its fields that we need. These can be updated
// atomically without any issues (since we allocate the map arrays as empty) so we don't bother
// doing a try loop. The other allocations we need to ensure that nothing has changed in the time
// between allocating them and pausing all threads before we can update them so we need to do a
// try loop.
- if (!CheckRedefinitionIsValid() || !EnsureClassAllocationsFinished()) {
- return result_;
- }
- art::MutableHandle<art::mirror::ClassLoader> source_class_loader(
- hs.NewHandle<art::mirror::ClassLoader>(nullptr));
- art::MutableHandle<art::mirror::Object> java_dex_file(
- hs.NewHandle<art::mirror::Object>(nullptr));
- art::MutableHandle<art::mirror::LongArray> new_dex_file_cookie(
- hs.NewHandle<art::mirror::LongArray>(nullptr));
- art::MutableHandle<art::mirror::DexCache> new_dex_cache(
- hs.NewHandle<art::mirror::DexCache>(nullptr));
- if (!FinishRemainingAllocations(&source_class_loader,
- &java_dex_file,
- &new_dex_file_cookie,
- &new_dex_cache)) {
+ if (!CheckAllRedefinitionAreValid() ||
+ !EnsureAllClassAllocationsFinished() ||
+ !FinishAllRemainingAllocations(holder)) {
// TODO Null out the ClassExt fields we allocated (if possible, might be racing with another
// redefineclass call which made it even bigger. Leak shouldn't be huge (2x array of size
- // declared_methods_.length) but would be good to get rid of.
- // new_dex_file_cookie & new_dex_cache should be cleaned up by the GC.
+ // declared_methods_.length) but would be good to get rid of. All other allocations should be
+ // cleaned up by the GC eventually.
return result_;
}
- // Get the mirror class now that we aren't allocating anymore.
- art::Handle<art::mirror::Class> art_class(hs.NewHandle(GetMirrorClass()));
// Disable GC and wait for it to be done if we are a moving GC. This is fine since we are done
// allocating so no deadlocks.
art::gc::Heap* heap = runtime_->GetHeap();
@@ -673,31 +972,29 @@ jvmtiError Redefiner::Run() {
// GC moving objects can cause deadlocks as we are deoptimizing the stack.
heap->IncrementDisableMovingGC(self_);
}
- // Enable assertion that this thread isn't interrupted during this installation.
- // After this we will need to do real cleanup in case of failure. Prior to this we could simply
- // return and would let everything get cleaned up or harmlessly leaked.
// Do transition to final suspension
// TODO We might want to give this its own suspended state!
// TODO This isn't right. We need to change state without any chance of suspend ideally!
self_->TransitionFromRunnableToSuspended(art::ThreadState::kNative);
runtime_->GetThreadList()->SuspendAll(
- "Final installation of redefined Class!", /*long_suspend*/true);
+ "Final installation of redefined Classes!", /*long_suspend*/true);
// TODO We need to invalidate all breakpoints in the redefined class with the debugger.
// TODO We need to deal with any instrumentation/debugger deoptimized_methods_.
// TODO We need to update all debugger MethodIDs so they note the method they point to is
// obsolete or implement some other well defined semantics.
// TODO We need to decide on & implement semantics for JNI jmethodids when we redefine methods.
- // TODO Might want to move this into a different type.
- // Now we reach the part where we must do active cleanup if something fails.
- // TODO We should really Retry if this fails instead of simply aborting.
- // Set the new DexFileCookie returns the original so we can fix it back up if redefinition fails
- art::ObjPtr<art::mirror::LongArray> original_dex_file_cookie(nullptr);
- UpdateJavaDexFile(java_dex_file.Get(), new_dex_file_cookie.Get(), &original_dex_file_cookie);
- FindAndAllocateObsoleteMethods(art_class.Get());
- UpdateClass(art_class.Get(), new_dex_cache.Get());
+ int32_t cnt = 0;
+ for (Redefiner::ClassRedefinition& redef : redefinitions_) {
+ art::mirror::Class* klass = holder.GetMirrorClass(cnt);
+ redef.UpdateJavaDexFile(holder.GetJavaDexFile(cnt), holder.GetNewDexFileCookie(cnt));
+ // TODO Rewrite so we don't do a stack walk for each and every class.
+ redef.FindAndAllocateObsoleteMethods(klass);
+ redef.UpdateClass(klass, holder.GetNewDexCache(cnt), holder.GetOriginalDexFileBytes(cnt));
+ cnt++;
+ }
// Ensure that obsolete methods are deoptimized. This is needed since optimized methods may have
// pointers to their ArtMethod's stashed in registers that they then use to attempt to hit the
- // DexCache.
+ // DexCache. (b/33630159)
// TODO This can fail (leave some methods optimized) near runtime methods (including
// quick-to-interpreter transition function).
// TODO We probably don't need this at all once we have a way to ensure that the
@@ -705,26 +1002,25 @@ jvmtiError Redefiner::Run() {
// stack-walker.
EnsureObsoleteMethodsAreDeoptimized();
// TODO Verify the new Class.
- // TODO Failure then undo updates to class
// TODO Shrink the obsolete method maps if possible?
// TODO find appropriate class loader.
// TODO Put this into a scoped thing.
runtime_->GetThreadList()->ResumeAll();
// Get back shared mutator lock as expected for return.
self_->TransitionFromSuspendedToRunnable();
- // TODO Do the dex_file_ release at a more reasonable place. This works but it muddles who really
- // owns the DexFile.
- dex_file_.release();
+ // TODO Do the dex_file release at a more reasonable place. This works but it muddles who really
+ // owns the DexFile and when ownership is transferred.
+ ReleaseAllDexFiles();
if (heap->IsGcConcurrentAndMoving()) {
heap->DecrementDisableMovingGC(self_);
}
return OK;
}
-void Redefiner::UpdateMethods(art::ObjPtr<art::mirror::Class> mclass,
- art::ObjPtr<art::mirror::DexCache> new_dex_cache,
- const art::DexFile::ClassDef& class_def) {
- art::ClassLinker* linker = runtime_->GetClassLinker();
+void Redefiner::ClassRedefinition::UpdateMethods(art::ObjPtr<art::mirror::Class> mclass,
+ art::ObjPtr<art::mirror::DexCache> new_dex_cache,
+ const art::DexFile::ClassDef& class_def) {
+ art::ClassLinker* linker = driver_->runtime_->GetClassLinker();
art::PointerSize image_pointer_size = linker->GetImagePointerSize();
const art::DexFile::TypeId& declaring_class_id = dex_file_->GetTypeId(class_def.class_idx_);
const art::DexFile& old_dex_file = mclass->GetDexFile();
@@ -757,16 +1053,15 @@ void Redefiner::UpdateMethods(art::ObjPtr<art::mirror::Class> mclass,
linker->SetEntryPointsToInterpreter(&method);
method.SetCodeItemOffset(dex_file_->FindCodeItemOffset(class_def, dex_method_idx));
method.SetDexCacheResolvedMethods(new_dex_cache->GetResolvedMethods(), image_pointer_size);
- method.SetDexCacheResolvedTypes(new_dex_cache->GetResolvedTypes(), image_pointer_size);
// Notify the jit that this method is redefined.
- art::jit::Jit* jit = runtime_->GetJit();
+ art::jit::Jit* jit = driver_->runtime_->GetJit();
if (jit != nullptr) {
jit->GetCodeCache()->NotifyMethodRedefined(&method);
}
}
}
-void Redefiner::UpdateFields(art::ObjPtr<art::mirror::Class> mclass) {
+void Redefiner::ClassRedefinition::UpdateFields(art::ObjPtr<art::mirror::Class> mclass) {
// TODO The IFields & SFields pointers should be combined like the methods_ arrays were.
for (auto fields_iter : {mclass->GetIFields(), mclass->GetSFields()}) {
for (art::ArtField& field : fields_iter) {
@@ -787,25 +1082,29 @@ void Redefiner::UpdateFields(art::ObjPtr<art::mirror::Class> mclass) {
}
// Performs updates to class that will allow us to verify it.
-void Redefiner::UpdateClass(art::ObjPtr<art::mirror::Class> mclass,
- art::ObjPtr<art::mirror::DexCache> new_dex_cache) {
- const art::DexFile::ClassDef* class_def = art::OatFile::OatDexFile::FindClassDef(
- *dex_file_, class_sig_, art::ComputeModifiedUtf8Hash(class_sig_));
- DCHECK(class_def != nullptr);
- UpdateMethods(mclass, new_dex_cache, *class_def);
+void Redefiner::ClassRedefinition::UpdateClass(
+ art::ObjPtr<art::mirror::Class> mclass,
+ art::ObjPtr<art::mirror::DexCache> new_dex_cache,
+ art::ObjPtr<art::mirror::ByteArray> original_dex_file) {
+ DCHECK_EQ(dex_file_->NumClassDefs(), 1u);
+ const art::DexFile::ClassDef& class_def = dex_file_->GetClassDef(0);
+ UpdateMethods(mclass, new_dex_cache, class_def);
UpdateFields(mclass);
// Update the class fields.
// Need to update class last since the ArtMethod gets its DexFile from the class (which is needed
// to call GetReturnTypeDescriptor and GetParameterTypeList above).
mclass->SetDexCache(new_dex_cache.Ptr());
- mclass->SetDexClassDefIndex(dex_file_->GetIndexForClassDef(*class_def));
- mclass->SetDexTypeIndex(dex_file_->GetIndexForTypeId(*dex_file_->FindTypeId(class_sig_)));
+ mclass->SetDexClassDefIndex(dex_file_->GetIndexForClassDef(class_def));
+ mclass->SetDexTypeIndex(dex_file_->GetIndexForTypeId(*dex_file_->FindTypeId(class_sig_.c_str())));
+ art::ObjPtr<art::mirror::ClassExt> ext(mclass->GetExtData());
+ CHECK(!ext.IsNull());
+ ext->SetOriginalDexFileBytes(original_dex_file);
}
-void Redefiner::UpdateJavaDexFile(art::ObjPtr<art::mirror::Object> java_dex_file,
- art::ObjPtr<art::mirror::LongArray> new_cookie,
- /*out*/art::ObjPtr<art::mirror::LongArray>* original_cookie) {
+void Redefiner::ClassRedefinition::UpdateJavaDexFile(
+ art::ObjPtr<art::mirror::Object> java_dex_file,
+ art::ObjPtr<art::mirror::LongArray> new_cookie) {
art::ArtField* internal_cookie_field = java_dex_file->GetClass()->FindDeclaredInstanceField(
"mInternalCookie", "Ljava/lang/Object;");
art::ArtField* cookie_field = java_dex_file->GetClass()->FindDeclaredInstanceField(
@@ -816,7 +1115,6 @@ void Redefiner::UpdateJavaDexFile(art::ObjPtr<art::mirror::Object> java_dex_file
art::ObjPtr<art::mirror::LongArray> orig_cookie(
cookie_field->GetObject(java_dex_file)->AsLongArray());
internal_cookie_field->SetObject<false>(java_dex_file, new_cookie);
- *original_cookie = orig_internal_cookie;
if (!orig_cookie.IsNull()) {
cookie_field->SetObject<false>(java_dex_file, new_cookie);
}
@@ -824,21 +1122,22 @@ void Redefiner::UpdateJavaDexFile(art::ObjPtr<art::mirror::Object> java_dex_file
// This function does all (java) allocations we need to do for the Class being redefined.
// TODO Change this name maybe?
-bool Redefiner::EnsureClassAllocationsFinished() {
- art::StackHandleScope<2> hs(self_);
- art::Handle<art::mirror::Class> klass(hs.NewHandle(self_->DecodeJObject(klass_)->AsClass()));
+bool Redefiner::ClassRedefinition::EnsureClassAllocationsFinished() {
+ art::StackHandleScope<2> hs(driver_->self_);
+ art::Handle<art::mirror::Class> klass(hs.NewHandle(
+ driver_->self_->DecodeJObject(klass_)->AsClass()));
if (klass.Get() == nullptr) {
RecordFailure(ERR(INVALID_CLASS), "Unable to decode class argument!");
return false;
}
// Allocate the classExt
- art::Handle<art::mirror::ClassExt> ext(hs.NewHandle(klass->EnsureExtDataPresent(self_)));
+ art::Handle<art::mirror::ClassExt> ext(hs.NewHandle(klass->EnsureExtDataPresent(driver_->self_)));
if (ext.Get() == nullptr) {
// No memory. Clear exception (it's not useful) and return error.
// TODO This doesn't need to be fatal. We could just not support obsolete methods after hitting
// this case.
- self_->AssertPendingOOMException();
- self_->ClearException();
+ driver_->self_->AssertPendingOOMException();
+ driver_->self_->ClearException();
RecordFailure(ERR(OUT_OF_MEMORY), "Could not allocate ClassExt");
return false;
}
@@ -849,12 +1148,12 @@ bool Redefiner::EnsureClassAllocationsFinished() {
// TODO Clear these after we walk the stacks in order to free them in the (likely?) event there
// are no obsolete methods.
{
- art::ObjectLock<art::mirror::ClassExt> lock(self_, ext);
+ art::ObjectLock<art::mirror::ClassExt> lock(driver_->self_, ext);
if (!ext->ExtendObsoleteArrays(
- self_, klass->GetDeclaredMethodsSlice(art::kRuntimePointerSize).size())) {
+ driver_->self_, klass->GetDeclaredMethodsSlice(art::kRuntimePointerSize).size())) {
// OOM. Clear exception and return error.
- self_->AssertPendingOOMException();
- self_->ClearException();
+ driver_->self_->AssertPendingOOMException();
+ driver_->self_->ClearException();
RecordFailure(ERR(OUT_OF_MEMORY), "Unable to allocate/extend obsolete methods map");
return false;
}
diff --git a/runtime/openjdkjvmti/ti_redefine.h b/runtime/openjdkjvmti/ti_redefine.h
index 5852309291..29a7e1f3ac 100644
--- a/runtime/openjdkjvmti/ti_redefine.h
+++ b/runtime/openjdkjvmti/ti_redefine.h
@@ -38,6 +38,7 @@
#include "art_jvmti.h"
#include "art_method.h"
+#include "base/array_slice.h"
#include "class_linker.h"
#include "dex_file.h"
#include "gc_root-inl.h"
@@ -56,6 +57,7 @@
#include "obj_ptr.h"
#include "scoped_thread_state_change-inl.h"
#include "stack.h"
+#include "ti_class_definition.h"
#include "thread_list.h"
#include "transform.h"
#include "utf.h"
@@ -63,50 +65,170 @@
namespace openjdkjvmti {
+class RedefinitionDataHolder;
+
// Class that can redefine a single class's methods.
// TODO We should really make this be driven by an outside class so we can do multiple classes at
// the same time and have less required cleanup.
class Redefiner {
public:
- // Redefine the given class with the given dex data. Note this function does not take ownership of
- // the dex_data pointer. It is not used after this call however and may be freed if desired.
+ // Redefine the given classes with the given dex data. Note this function does not take ownership
+ // of the dex_data pointers. It is not used after this call however and may be freed if desired.
+ // The caller is responsible for freeing it. The runtime makes its own copy of the data. This
+ // function does not call the transformation events.
+ // TODO Check modified flag of the definitions.
+ static jvmtiError RedefineClassesDirect(ArtJvmTiEnv* env,
+ art::Runtime* runtime,
+ art::Thread* self,
+ const std::vector<ArtClassDefinition>& definitions,
+ /*out*/std::string* error_msg);
+
+ // Redefine the given classes with the given dex data. Note this function does not take ownership
+ // of the dex_data pointers. It is not used after this call however and may be freed if desired.
// The caller is responsible for freeing it. The runtime makes its own copy of the data.
- static jvmtiError RedefineClass(ArtJvmTiEnv* env,
- art::Runtime* runtime,
- art::Thread* self,
- jclass klass,
- const std::string& original_dex_location,
- jint data_len,
- unsigned char* dex_data,
- std::string* error_msg);
+ // TODO This function should call the transformation events.
+ static jvmtiError RedefineClasses(ArtJvmTiEnv* env,
+ art::Runtime* runtime,
+ art::Thread* self,
+ jint class_count,
+ const jvmtiClassDefinition* definitions,
+ /*out*/std::string* error_msg);
static jvmtiError IsModifiableClass(jvmtiEnv* env, jclass klass, jboolean* is_redefinable);
private:
+ class ClassRedefinition {
+ public:
+ ClassRedefinition(Redefiner* driver,
+ jclass klass,
+ const art::DexFile* redefined_dex_file,
+ const char* class_sig,
+ art::ArraySlice<const unsigned char> orig_dex_file)
+ REQUIRES_SHARED(art::Locks::mutator_lock_);
+
+ // NO_THREAD_SAFETY_ANALYSIS so we can unlock the class in the destructor.
+ ~ClassRedefinition() NO_THREAD_SAFETY_ANALYSIS;
+
+ // Move constructor so we can put these into a vector.
+ ClassRedefinition(ClassRedefinition&& other)
+ : driver_(other.driver_),
+ klass_(other.klass_),
+ dex_file_(std::move(other.dex_file_)),
+ class_sig_(std::move(other.class_sig_)),
+ original_dex_file_(other.original_dex_file_) {
+ other.driver_ = nullptr;
+ }
+
+ art::mirror::Class* GetMirrorClass() REQUIRES_SHARED(art::Locks::mutator_lock_);
+ art::mirror::ClassLoader* GetClassLoader() REQUIRES_SHARED(art::Locks::mutator_lock_);
+
+ // This finds the java.lang.DexFile we will add the native DexFile to as part of the classpath.
+ // TODO Make sure the DexFile object returned is the one that the klass_ actually comes from.
+ art::mirror::Object* FindSourceDexFileObject(art::Handle<art::mirror::ClassLoader> loader)
+ REQUIRES_SHARED(art::Locks::mutator_lock_);
+
+ art::mirror::DexCache* CreateNewDexCache(art::Handle<art::mirror::ClassLoader> loader)
+ REQUIRES_SHARED(art::Locks::mutator_lock_);
+
+ // Allocates and fills the new DexFileCookie
+ art::mirror::LongArray* AllocateDexFileCookie(art::Handle<art::mirror::Object> j_dex_file_obj)
+ REQUIRES_SHARED(art::Locks::mutator_lock_);
+
+ // This may return nullptr with a OOME pending if allocation fails.
+ art::mirror::ByteArray* AllocateOrGetOriginalDexFileBytes()
+ REQUIRES_SHARED(art::Locks::mutator_lock_);
+
+ void RecordFailure(jvmtiError e, const std::string& err) {
+ driver_->RecordFailure(e, class_sig_, err);
+ }
+
+ bool FinishRemainingAllocations(int32_t klass_index, /*out*/RedefinitionDataHolder* holder)
+ REQUIRES_SHARED(art::Locks::mutator_lock_);
+
+ void FindAndAllocateObsoleteMethods(art::mirror::Class* art_klass)
+ REQUIRES(art::Locks::mutator_lock_);
+
+ void FillObsoleteMethodMap(
+ art::mirror::Class* art_klass,
+ const std::unordered_map<art::ArtMethod*, art::ArtMethod*>& obsoletes)
+ REQUIRES(art::Locks::mutator_lock_);
+
+
+ // Checks that the dex file contains only the single expected class and that the top-level class
+ // data has not been modified in an incompatible manner.
+ bool CheckClass() REQUIRES_SHARED(art::Locks::mutator_lock_);
+
+ // Preallocates all needed allocations in klass so that we can pause execution safely.
+ // TODO We should be able to free the arrays if they end up not being used. Investigate doing
+ // this in the future. For now we will just take the memory hit.
+ bool EnsureClassAllocationsFinished() REQUIRES_SHARED(art::Locks::mutator_lock_);
+
+ // This will check that no constraints are violated (more than 1 class in dex file, any changes
+ // in number/declaration of methods & fields, changes in access flags, etc.)
+ bool CheckRedefinitionIsValid() REQUIRES_SHARED(art::Locks::mutator_lock_);
+
+ // Checks that the class can even be redefined.
+ bool CheckRedefinable() REQUIRES_SHARED(art::Locks::mutator_lock_);
+
+ // Checks that the dex file does not add/remove methods.
+ bool CheckSameMethods() REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ LOG(WARNING) << "methods are not checked for modification currently";
+ return true;
+ }
+
+ // Checks that the dex file does not modify fields
+ bool CheckSameFields() REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ LOG(WARNING) << "Fields are not checked for modification currently";
+ return true;
+ }
+
+ void UpdateJavaDexFile(art::ObjPtr<art::mirror::Object> java_dex_file,
+ art::ObjPtr<art::mirror::LongArray> new_cookie)
+ REQUIRES(art::Locks::mutator_lock_);
+
+ void UpdateFields(art::ObjPtr<art::mirror::Class> mclass)
+ REQUIRES(art::Locks::mutator_lock_);
+
+ void UpdateMethods(art::ObjPtr<art::mirror::Class> mclass,
+ art::ObjPtr<art::mirror::DexCache> new_dex_cache,
+ const art::DexFile::ClassDef& class_def)
+ REQUIRES(art::Locks::mutator_lock_);
+
+ void UpdateClass(art::ObjPtr<art::mirror::Class> mclass,
+ art::ObjPtr<art::mirror::DexCache> new_dex_cache,
+ art::ObjPtr<art::mirror::ByteArray> original_dex_file)
+ REQUIRES(art::Locks::mutator_lock_);
+
+ void ReleaseDexFile() REQUIRES_SHARED(art::Locks::mutator_lock_);
+
+ private:
+ Redefiner* driver_;
+ jclass klass_;
+ std::unique_ptr<const art::DexFile> dex_file_;
+ std::string class_sig_;
+ art::ArraySlice<const unsigned char> original_dex_file_;
+ };
+
jvmtiError result_;
art::Runtime* runtime_;
art::Thread* self_;
+ std::vector<ClassRedefinition> redefinitions_;
// Kept as a jclass since we have weird run-state changes that make keeping it around as a
// mirror::Class difficult and confusing.
- jclass klass_;
- std::unique_ptr<const art::DexFile> dex_file_;
std::string* error_msg_;
- char* class_sig_;
// TODO Maybe change jclass to a mirror::Class
Redefiner(art::Runtime* runtime,
art::Thread* self,
- jclass klass,
- char* class_sig,
- std::unique_ptr<const art::DexFile>& redefined_dex_file,
std::string* error_msg)
: result_(ERR(INTERNAL)),
runtime_(runtime),
self_(self),
- klass_(klass),
- dex_file_(std::move(redefined_dex_file)),
- error_msg_(error_msg),
- class_sig_(class_sig) { }
+ redefinitions_(),
+ error_msg_(error_msg) { }
+
+ jvmtiError AddRedefinition(ArtJvmTiEnv* env, const ArtClassDefinition& def)
+ REQUIRES_SHARED(art::Locks::mutator_lock_);
static jvmtiError GetClassRedefinitionError(art::Handle<art::mirror::Class> klass,
/*out*/std::string* error_msg)
@@ -114,23 +236,17 @@ class Redefiner {
static std::unique_ptr<art::MemMap> MoveDataToMemMap(const std::string& original_location,
jint data_len,
- unsigned char* dex_data,
+ const unsigned char* dex_data,
std::string* error_msg);
// TODO Put on all the lock qualifiers.
jvmtiError Run() REQUIRES_SHARED(art::Locks::mutator_lock_);
- bool FinishRemainingAllocations(
- /*out*/art::MutableHandle<art::mirror::ClassLoader>* source_class_loader,
- /*out*/art::MutableHandle<art::mirror::Object>* source_dex_file_obj,
- /*out*/art::MutableHandle<art::mirror::LongArray>* new_dex_file_cookie,
- /*out*/art::MutableHandle<art::mirror::DexCache>* new_dex_cache)
+ bool CheckAllRedefinitionAreValid() REQUIRES_SHARED(art::Locks::mutator_lock_);
+ bool EnsureAllClassAllocationsFinished() REQUIRES_SHARED(art::Locks::mutator_lock_);
+ bool FinishAllRemainingAllocations(RedefinitionDataHolder& holder)
REQUIRES_SHARED(art::Locks::mutator_lock_);
-
- // Preallocates all needed allocations in klass so that we can pause execution safely.
- // TODO We should be able to free the arrays if they end up not being used. Investigate doing this
- // in the future. For now we will just take the memory hit.
- bool EnsureClassAllocationsFinished() REQUIRES_SHARED(art::Locks::mutator_lock_);
+ void ReleaseAllDexFiles() REQUIRES_SHARED(art::Locks::mutator_lock_);
// Ensure that obsolete methods are deoptimized. This is needed since optimized methods may have
// pointers to their ArtMethods stashed in registers that they then use to attempt to hit the
@@ -140,70 +256,12 @@ class Redefiner {
REQUIRES(!art::Locks::thread_list_lock_,
!art::Locks::classlinker_classes_lock_);
- art::mirror::ClassLoader* GetClassLoader() REQUIRES_SHARED(art::Locks::mutator_lock_);
-
- // This finds the java.lang.DexFile we will add the native DexFile to as part of the classpath.
- // TODO Make sure the DexFile object returned is the one that the klass_ actually comes from.
- art::mirror::Object* FindSourceDexFileObject(art::Handle<art::mirror::ClassLoader> loader)
- REQUIRES_SHARED(art::Locks::mutator_lock_);
-
- art::mirror::Class* GetMirrorClass() REQUIRES_SHARED(art::Locks::mutator_lock_);
-
- // Allocates and fills the new DexFileCookie
- art::mirror::LongArray* AllocateDexFileCookie(art::Handle<art::mirror::Object> java_dex_file_obj)
- REQUIRES_SHARED(art::Locks::mutator_lock_);
-
- art::mirror::DexCache* CreateNewDexCache(art::Handle<art::mirror::ClassLoader> loader)
- REQUIRES_SHARED(art::Locks::mutator_lock_);
-
- void RecordFailure(jvmtiError result, const std::string& error_msg);
-
- // This will check that no constraints are violated (more than 1 class in dex file, any changes in
- // number/declaration of methods & fields, changes in access flags, etc.)
- bool CheckRedefinitionIsValid() REQUIRES_SHARED(art::Locks::mutator_lock_);
-
- // Checks that the class can even be redefined.
- bool CheckRedefinable() REQUIRES_SHARED(art::Locks::mutator_lock_);
-
- // Checks that the dex file does not add/remove methods.
- bool CheckSameMethods() REQUIRES_SHARED(art::Locks::mutator_lock_) {
- LOG(WARNING) << "methods are not checked for modification currently";
- return true;
+ void RecordFailure(jvmtiError result, const std::string& class_sig, const std::string& error_msg);
+ void RecordFailure(jvmtiError result, const std::string& error_msg) {
+ RecordFailure(result, "NO CLASS", error_msg);
}
- // Checks that the dex file does not modify fields
- bool CheckSameFields() REQUIRES_SHARED(art::Locks::mutator_lock_) {
- LOG(WARNING) << "Fields are not checked for modification currently";
- return true;
- }
-
- // Checks that the dex file contains only the single expected class and that the top-level class
- // data has not been modified in an incompatible manner.
- bool CheckClass() REQUIRES_SHARED(art::Locks::mutator_lock_);
-
- void UpdateJavaDexFile(art::ObjPtr<art::mirror::Object> java_dex_file,
- art::ObjPtr<art::mirror::LongArray> new_cookie,
- /*out*/art::ObjPtr<art::mirror::LongArray>* original_cookie)
- REQUIRES(art::Locks::mutator_lock_);
-
- void UpdateFields(art::ObjPtr<art::mirror::Class> mclass)
- REQUIRES(art::Locks::mutator_lock_);
-
- void UpdateMethods(art::ObjPtr<art::mirror::Class> mclass,
- art::ObjPtr<art::mirror::DexCache> new_dex_cache,
- const art::DexFile::ClassDef& class_def)
- REQUIRES(art::Locks::mutator_lock_);
-
- void UpdateClass(art::ObjPtr<art::mirror::Class> mclass,
- art::ObjPtr<art::mirror::DexCache> new_dex_cache)
- REQUIRES(art::Locks::mutator_lock_);
-
- void FindAndAllocateObsoleteMethods(art::mirror::Class* art_klass)
- REQUIRES(art::Locks::mutator_lock_);
-
- void FillObsoleteMethodMap(art::mirror::Class* art_klass,
- const std::unordered_map<art::ArtMethod*, art::ArtMethod*>& obsoletes)
- REQUIRES(art::Locks::mutator_lock_);
+ friend struct CallbackCtx;
};
} // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_search.cc b/runtime/openjdkjvmti/ti_search.cc
new file mode 100644
index 0000000000..913d2b6a74
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_search.cc
@@ -0,0 +1,122 @@
+/* Copyright (C) 2017 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h. The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation. Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#include "ti_search.h"
+
+#include "jni.h"
+
+#include "art_jvmti.h"
+#include "base/macros.h"
+#include "class_linker.h"
+#include "dex_file.h"
+#include "runtime.h"
+#include "scoped_thread_state_change-inl.h"
+#include "ScopedLocalRef.h"
+
+namespace openjdkjvmti {
+
+jvmtiError SearchUtil::AddToBootstrapClassLoaderSearch(jvmtiEnv* env ATTRIBUTE_UNUSED,
+ const char* segment) {
+ art::Runtime* current = art::Runtime::Current();
+ if (current == nullptr) {
+ return ERR(WRONG_PHASE);
+ }
+ if (current->GetClassLinker() == nullptr) {
+ // TODO: Support boot classpath change in OnLoad.
+ return ERR(WRONG_PHASE);
+ }
+ if (segment == nullptr) {
+ return ERR(NULL_POINTER);
+ }
+
+ std::string error_msg;
+ std::vector<std::unique_ptr<const art::DexFile>> dex_files;
+ if (!art::DexFile::Open(segment, segment, true, &error_msg, &dex_files)) {
+ LOG(WARNING) << "Could not open " << segment << " for boot classpath extension: " << error_msg;
+ return ERR(ILLEGAL_ARGUMENT);
+ }
+
+ art::ScopedObjectAccess soa(art::Thread::Current());
+ for (std::unique_ptr<const art::DexFile>& dex_file : dex_files) {
+ current->GetClassLinker()->AppendToBootClassPath(art::Thread::Current(), *dex_file.release());
+ }
+
+ return ERR(NONE);
+}
+
+jvmtiError SearchUtil::AddToSystemClassLoaderSearch(jvmtiEnv* jvmti_env ATTRIBUTE_UNUSED,
+ const char* segment) {
+ if (segment == nullptr) {
+ return ERR(NULL_POINTER);
+ }
+
+ art::Runtime* current = art::Runtime::Current();
+ if (current == nullptr) {
+ return ERR(WRONG_PHASE);
+ }
+ jobject sys_class_loader = current->GetSystemClassLoader();
+ if (sys_class_loader == nullptr) {
+ // TODO: Support classpath change in OnLoad.
+ return ERR(WRONG_PHASE);
+ }
+
+ // We'll use BaseDexClassLoader.addDexPath, as it takes care of array resizing etc. As a downside,
+ // exceptions are swallowed.
+
+ art::Thread* self = art::Thread::Current();
+ JNIEnv* env = self->GetJniEnv();
+ if (!env->IsInstanceOf(sys_class_loader,
+ art::WellKnownClasses::dalvik_system_BaseDexClassLoader)) {
+ return ERR(INTERNAL);
+ }
+
+ jmethodID add_dex_path_id = env->GetMethodID(
+ art::WellKnownClasses::dalvik_system_BaseDexClassLoader,
+ "addDexPath",
+ "(Ljava/lang/String;)V");
+ if (add_dex_path_id == nullptr) {
+ return ERR(INTERNAL);
+ }
+
+ ScopedLocalRef<jstring> dex_path(env, env->NewStringUTF(segment));
+ if (dex_path.get() == nullptr) {
+ return ERR(INTERNAL);
+ }
+ env->CallVoidMethod(sys_class_loader, add_dex_path_id, dex_path.get());
+
+ if (env->ExceptionCheck()) {
+ env->ExceptionClear();
+ return ERR(ILLEGAL_ARGUMENT);
+ }
+ return ERR(NONE);
+}
+
+} // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_search.h b/runtime/openjdkjvmti/ti_search.h
new file mode 100644
index 0000000000..6a52e80405
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_search.h
@@ -0,0 +1,48 @@
+/* Copyright (C) 2017 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h. The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation. Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#ifndef ART_RUNTIME_OPENJDKJVMTI_TI_SEARCH_H_
+#define ART_RUNTIME_OPENJDKJVMTI_TI_SEARCH_H_
+
+#include "jvmti.h"
+
+namespace openjdkjvmti {
+
+class SearchUtil {
+ public:
+ static jvmtiError AddToBootstrapClassLoaderSearch(jvmtiEnv* env, const char* segment);
+
+ static jvmtiError AddToSystemClassLoaderSearch(jvmtiEnv* env, const char* segment);
+};
+
+} // namespace openjdkjvmti
+
+#endif // ART_RUNTIME_OPENJDKJVMTI_TI_SEARCH_H_
diff --git a/runtime/openjdkjvmti/ti_stack.cc b/runtime/openjdkjvmti/ti_stack.cc
index 098cedbffa..4cf55a6a98 100644
--- a/runtime/openjdkjvmti/ti_stack.cc
+++ b/runtime/openjdkjvmti/ti_stack.cc
@@ -31,6 +31,7 @@
#include "ti_stack.h"
+#include <algorithm>
#include <list>
#include <unordered_map>
#include <vector>
@@ -42,6 +43,7 @@
#include "base/mutex.h"
#include "dex_file.h"
#include "dex_file_annotations.h"
+#include "handle_scope-inl.h"
#include "jni_env_ext.h"
#include "jni_internal.h"
#include "mirror/class.h"
@@ -159,24 +161,43 @@ static jvmtiError TranslateFrameVector(const std::vector<jvmtiFrameInfo>& frames
return ERR(NONE);
}
+static jvmtiError GetThread(JNIEnv* env, jthread java_thread, art::Thread** thread) {
+ if (java_thread == nullptr) {
+ *thread = art::Thread::Current();
+ if (*thread == nullptr) {
+ // GetStackTrace can only be run during the live phase, so the current thread should be
+ // attached and thus available. Getting a null for current means we're starting up or
+ // dying.
+ return ERR(WRONG_PHASE);
+ }
+ } else {
+ if (!env->IsInstanceOf(java_thread, art::WellKnownClasses::java_lang_Thread)) {
+ return ERR(INVALID_THREAD);
+ }
+
+ // TODO: Need non-aborting call here, to return JVMTI_ERROR_INVALID_THREAD.
+ art::ScopedObjectAccess soa(art::Thread::Current());
+ art::MutexLock mu(soa.Self(), *art::Locks::thread_list_lock_);
+ *thread = art::Thread::FromManagedThread(soa, java_thread);
+ if (*thread == nullptr) {
+ return ERR(THREAD_NOT_ALIVE);
+ }
+ }
+ return ERR(NONE);
+}
+
jvmtiError StackUtil::GetStackTrace(jvmtiEnv* jvmti_env ATTRIBUTE_UNUSED,
jthread java_thread,
jint start_depth,
jint max_frame_count,
jvmtiFrameInfo* frame_buffer,
jint* count_ptr) {
- if (java_thread == nullptr) {
- return ERR(INVALID_THREAD);
- }
-
art::Thread* thread;
- {
- // TODO: Need non-aborting call here, to return JVMTI_ERROR_INVALID_THREAD.
- art::ScopedObjectAccess soa(art::Thread::Current());
- art::MutexLock mu(soa.Self(), *art::Locks::thread_list_lock_);
- thread = art::Thread::FromManagedThread(soa, java_thread);
- DCHECK(thread != nullptr);
+ jvmtiError thread_error = GetThread(art::Thread::Current()->GetJniEnv(), java_thread, &thread);
+ if (thread_error != ERR(NONE)) {
+ return thread_error;
}
+ DCHECK(thread != nullptr);
art::ThreadState state = thread->GetState();
if (state == art::ThreadState::kStarting ||
@@ -374,4 +395,331 @@ jvmtiError StackUtil::GetAllStackTraces(jvmtiEnv* env,
return ERR(NONE);
}
+jvmtiError StackUtil::GetThreadListStackTraces(jvmtiEnv* env,
+ jint thread_count,
+ const jthread* thread_list,
+ jint max_frame_count,
+ jvmtiStackInfo** stack_info_ptr) {
+ if (max_frame_count < 0) {
+ return ERR(ILLEGAL_ARGUMENT);
+ }
+ if (thread_count < 0) {
+ return ERR(ILLEGAL_ARGUMENT);
+ }
+ if (thread_count == 0) {
+ *stack_info_ptr = nullptr;
+ return ERR(NONE);
+ }
+ if (stack_info_ptr == nullptr || stack_info_ptr == nullptr) {
+ return ERR(NULL_POINTER);
+ }
+
+ art::Thread* current = art::Thread::Current();
+ art::ScopedObjectAccess soa(current); // Now we know we have the shared lock.
+
+ // Decode all threads to raw pointers. Put them into a handle scope to avoid any moving GC bugs.
+ art::VariableSizedHandleScope hs(current);
+ std::vector<art::Handle<art::mirror::Object>> handles;
+ for (jint i = 0; i != thread_count; ++i) {
+ if (thread_list[i] == nullptr) {
+ return ERR(INVALID_THREAD);
+ }
+ if (!soa.Env()->IsInstanceOf(thread_list[i], art::WellKnownClasses::java_lang_Thread)) {
+ return ERR(INVALID_THREAD);
+ }
+ handles.push_back(hs.NewHandle(soa.Decode<art::mirror::Object>(thread_list[i])));
+ }
+
+ std::vector<art::Thread*> threads;
+ std::vector<size_t> thread_list_indices;
+ std::vector<std::vector<jvmtiFrameInfo>> frames;
+
+ {
+ art::ScopedThreadSuspension sts(current, art::kWaitingForDebuggerSuspension);
+ art::ScopedSuspendAll ssa("GetThreadListStackTraces");
+
+ {
+ std::list<art::Thread*> art_thread_list;
+ {
+ art::MutexLock mu(current, *art::Locks::thread_list_lock_);
+ art_thread_list = art::Runtime::Current()->GetThreadList()->GetList();
+ }
+
+ for (art::Thread* thread : art_thread_list) {
+ if (thread->IsStillStarting()) {
+ // Skip this. We can't get the jpeer, and if it is for a thread in the thread_list,
+ // we'll just report STARTING.
+ continue;
+ }
+
+ // Get the peer, and check whether we know it.
+ art::ObjPtr<art::mirror::Object> peer = thread->GetPeer();
+ for (size_t index = 0; index != handles.size(); ++index) {
+ if (peer == handles[index].Get()) {
+ // Found the thread.
+ GetStackTraceClosure closure(0u, static_cast<size_t>(max_frame_count));
+ thread->RequestSynchronousCheckpoint(&closure);
+
+ threads.push_back(thread);
+ thread_list_indices.push_back(index);
+ frames.emplace_back();
+ frames.back().swap(closure.frames);
+
+ continue;
+ }
+ }
+
+ // Must be not started, or dead. We'll deal with it at the end.
+ }
+ }
+ }
+
+ // Convert the data into our output format.
+
+ // Note: we use an array of jvmtiStackInfo for convenience. The spec says we need to
+ // allocate one big chunk for this and the actual frames, which means we need
+ // to either be conservative or rearrange things later (the latter is implemented).
+ std::unique_ptr<jvmtiStackInfo[]> stack_info_array(new jvmtiStackInfo[frames.size()]);
+ std::vector<std::unique_ptr<jvmtiFrameInfo[]>> frame_infos;
+ frame_infos.reserve(frames.size());
+
+ // Now run through and add data for each thread.
+ size_t sum_frames = 0;
+ for (size_t index = 0; index < frames.size(); ++index) {
+ jvmtiStackInfo& stack_info = stack_info_array.get()[index];
+ memset(&stack_info, 0, sizeof(jvmtiStackInfo));
+
+ art::Thread* self = threads[index];
+ const std::vector<jvmtiFrameInfo>& thread_frames = frames[index];
+
+ // For the time being, set the thread to null. We don't have good ScopedLocalRef
+ // infrastructure.
+ DCHECK(self->GetPeer() != nullptr);
+ stack_info.thread = nullptr;
+ stack_info.state = JVMTI_THREAD_STATE_SUSPENDED;
+
+ size_t collected_frames = thread_frames.size();
+ if (max_frame_count == 0 || collected_frames == 0) {
+ stack_info.frame_count = 0;
+ stack_info.frame_buffer = nullptr;
+ continue;
+ }
+ DCHECK_LE(collected_frames, static_cast<size_t>(max_frame_count));
+
+ jvmtiFrameInfo* frame_info = new jvmtiFrameInfo[collected_frames];
+ frame_infos.emplace_back(frame_info);
+
+ jint count;
+ jvmtiError translate_result = TranslateFrameVector(thread_frames,
+ 0,
+ 0,
+ static_cast<jint>(collected_frames),
+ frame_info,
+ &count);
+ DCHECK(translate_result == JVMTI_ERROR_NONE);
+ stack_info.frame_count = static_cast<jint>(collected_frames);
+ stack_info.frame_buffer = frame_info;
+ sum_frames += static_cast<size_t>(count);
+ }
+
+ // No errors, yet. Now put it all into an output buffer. Note that this is not frames.size(),
+ // potentially.
+ size_t rounded_stack_info_size = art::RoundUp(sizeof(jvmtiStackInfo) * thread_count,
+ alignof(jvmtiFrameInfo));
+ size_t chunk_size = rounded_stack_info_size + sum_frames * sizeof(jvmtiFrameInfo);
+ unsigned char* chunk_data;
+ jvmtiError alloc_result = env->Allocate(chunk_size, &chunk_data);
+ if (alloc_result != ERR(NONE)) {
+ return alloc_result;
+ }
+
+ jvmtiStackInfo* stack_info = reinterpret_cast<jvmtiStackInfo*>(chunk_data);
+ jvmtiFrameInfo* frame_info = reinterpret_cast<jvmtiFrameInfo*>(
+ chunk_data + rounded_stack_info_size);
+
+ for (size_t i = 0; i < static_cast<size_t>(thread_count); ++i) {
+ // Check whether we found a running thread for this.
+ // Note: For simplicity, and with the expectation that the list is usually small, use a simple
+ // search. (The list is *not* sorted!)
+ auto it = std::find(thread_list_indices.begin(), thread_list_indices.end(), i);
+ if (it == thread_list_indices.end()) {
+ // No native thread. Must be new or dead. We need to fill out the stack info now.
+ // (Need to read the Java "started" field to know whether this is starting or terminated.)
+ art::ObjPtr<art::mirror::Object> peer = soa.Decode<art::mirror::Object>(thread_list[i]);
+ art::ObjPtr<art::mirror::Class> klass = peer->GetClass();
+ art::ArtField* started_field = klass->FindDeclaredInstanceField("started", "Z");
+ CHECK(started_field != nullptr);
+ bool started = started_field->GetBoolean(peer) != 0;
+ constexpr jint kStartedState = JVMTI_JAVA_LANG_THREAD_STATE_NEW;
+ constexpr jint kTerminatedState = JVMTI_THREAD_STATE_TERMINATED |
+ JVMTI_JAVA_LANG_THREAD_STATE_TERMINATED;
+ stack_info[i].thread = reinterpret_cast<JNIEnv*>(soa.Env())->NewLocalRef(thread_list[i]);
+ stack_info[i].state = started ? kTerminatedState : kStartedState;
+ stack_info[i].frame_count = 0;
+ stack_info[i].frame_buffer = nullptr;
+ } else {
+ // Had a native thread and frames.
+ size_t f_index = it - thread_list_indices.begin();
+
+ jvmtiStackInfo& old_stack_info = stack_info_array.get()[f_index];
+ jvmtiStackInfo& new_stack_info = stack_info[i];
+
+ memcpy(&new_stack_info, &old_stack_info, sizeof(jvmtiStackInfo));
+ new_stack_info.thread = reinterpret_cast<JNIEnv*>(soa.Env())->NewLocalRef(thread_list[i]);
+ if (old_stack_info.frame_count > 0) {
+ // Only copy when there's data - leave the nullptr alone.
+ size_t frames_size =
+ static_cast<size_t>(old_stack_info.frame_count) * sizeof(jvmtiFrameInfo);
+ memcpy(frame_info, old_stack_info.frame_buffer, frames_size);
+ new_stack_info.frame_buffer = frame_info;
+ frame_info += old_stack_info.frame_count;
+ }
+ }
+ }
+
+ * stack_info_ptr = stack_info;
+
+ return ERR(NONE);
+}
+
+// Walks up the stack counting Java frames. This is not StackVisitor::ComputeNumFrames, as
+// runtime methods and transitions must not be counted.
+struct GetFrameCountVisitor : public art::StackVisitor {
+ explicit GetFrameCountVisitor(art::Thread* thread)
+ : art::StackVisitor(thread, nullptr, art::StackVisitor::StackWalkKind::kIncludeInlinedFrames),
+ count(0) {}
+
+ bool VisitFrame() REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ art::ArtMethod* m = GetMethod();
+ const bool do_count = !(m == nullptr || m->IsRuntimeMethod());
+ if (do_count) {
+ count++;
+ }
+ return true;
+ }
+
+ size_t count;
+};
+
+struct GetFrameCountClosure : public art::Closure {
+ public:
+ GetFrameCountClosure() : count(0) {}
+
+ void Run(art::Thread* self) OVERRIDE REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ GetFrameCountVisitor visitor(self);
+ visitor.WalkStack(false);
+
+ count = visitor.count;
+ }
+
+ size_t count;
+};
+
+jvmtiError StackUtil::GetFrameCount(jvmtiEnv* env ATTRIBUTE_UNUSED,
+ jthread java_thread,
+ jint* count_ptr) {
+ art::Thread* thread;
+ jvmtiError thread_error = GetThread(art::Thread::Current()->GetJniEnv(), java_thread, &thread);
+ if (thread_error != ERR(NONE)) {
+ return thread_error;
+ }
+ DCHECK(thread != nullptr);
+
+ if (count_ptr == nullptr) {
+ return ERR(NULL_POINTER);
+ }
+
+ GetFrameCountClosure closure;
+ thread->RequestSynchronousCheckpoint(&closure);
+
+ *count_ptr = closure.count;
+ return ERR(NONE);
+}
+
+// Walks up the stack 'n' callers, when used with Thread::WalkStack.
+struct GetLocationVisitor : public art::StackVisitor {
+ GetLocationVisitor(art::Thread* thread, size_t n_in)
+ : art::StackVisitor(thread, nullptr, art::StackVisitor::StackWalkKind::kIncludeInlinedFrames),
+ n(n_in),
+ count(0),
+ caller(nullptr),
+ caller_dex_pc(0) {}
+
+ bool VisitFrame() REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ art::ArtMethod* m = GetMethod();
+ const bool do_count = !(m == nullptr || m->IsRuntimeMethod());
+ if (do_count) {
+ DCHECK(caller == nullptr);
+ if (count == n) {
+ caller = m;
+ caller_dex_pc = GetDexPc(false);
+ return false;
+ }
+ count++;
+ }
+ return true;
+ }
+
+ const size_t n;
+ size_t count;
+ art::ArtMethod* caller;
+ uint32_t caller_dex_pc;
+};
+
+struct GetLocationClosure : public art::Closure {
+ public:
+ explicit GetLocationClosure(size_t n_in) : n(n_in), method(nullptr), dex_pc(0) {}
+
+ void Run(art::Thread* self) OVERRIDE REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ GetLocationVisitor visitor(self, n);
+ visitor.WalkStack(false);
+
+ method = visitor.caller;
+ dex_pc = visitor.caller_dex_pc;
+ }
+
+ const size_t n;
+ art::ArtMethod* method;
+ uint32_t dex_pc;
+};
+
+jvmtiError StackUtil::GetFrameLocation(jvmtiEnv* env ATTRIBUTE_UNUSED,
+ jthread java_thread,
+ jint depth,
+ jmethodID* method_ptr,
+ jlocation* location_ptr) {
+ art::Thread* thread;
+ jvmtiError thread_error = GetThread(art::Thread::Current()->GetJniEnv(), java_thread, &thread);
+ if (thread_error != ERR(NONE)) {
+ return thread_error;
+ }
+ DCHECK(thread != nullptr);
+
+ if (depth < 0) {
+ return ERR(ILLEGAL_ARGUMENT);
+ }
+ if (method_ptr == nullptr || location_ptr == nullptr) {
+ return ERR(NULL_POINTER);
+ }
+
+ GetLocationClosure closure(static_cast<size_t>(depth));
+ thread->RequestSynchronousCheckpoint(&closure);
+
+ if (closure.method == nullptr) {
+ return ERR(NO_MORE_FRAMES);
+ }
+
+ *method_ptr = art::jni::EncodeArtMethod(closure.method);
+ if (closure.method->IsNative()) {
+ *location_ptr = -1;
+ } else {
+ if (closure.dex_pc == art::DexFile::kDexNoIndex) {
+ return ERR(INTERNAL);
+ }
+ *location_ptr = static_cast<jlocation>(closure.dex_pc);
+ }
+
+ return ERR(NONE);
+}
+
} // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_stack.h b/runtime/openjdkjvmti/ti_stack.h
index 7619f98daf..6a593cfa9c 100644
--- a/runtime/openjdkjvmti/ti_stack.h
+++ b/runtime/openjdkjvmti/ti_stack.h
@@ -47,12 +47,26 @@ class StackUtil {
jint* thread_count_ptr)
REQUIRES(!art::Locks::thread_list_lock_);
+ static jvmtiError GetFrameCount(jvmtiEnv* env, jthread thread, jint* count_ptr);
+
+ static jvmtiError GetFrameLocation(jvmtiEnv* env,
+ jthread thread,
+ jint depth,
+ jmethodID* method_ptr,
+ jlocation* location_ptr);
+
static jvmtiError GetStackTrace(jvmtiEnv* env,
jthread thread,
jint start_depth,
jint max_frame_count,
jvmtiFrameInfo* frame_buffer,
jint* count_ptr);
+
+ static jvmtiError GetThreadListStackTraces(jvmtiEnv* env,
+ jint thread_count,
+ const jthread* thread_list,
+ jint max_frame_count,
+ jvmtiStackInfo** stack_info_ptr);
};
} // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_thread.cc b/runtime/openjdkjvmti/ti_thread.cc
index e20f5605d8..970cc24f12 100644
--- a/runtime/openjdkjvmti/ti_thread.cc
+++ b/runtime/openjdkjvmti/ti_thread.cc
@@ -35,13 +35,17 @@
#include "art_jvmti.h"
#include "base/logging.h"
#include "base/mutex.h"
+#include "gc/system_weak.h"
+#include "gc_root-inl.h"
#include "jni_internal.h"
#include "mirror/class.h"
#include "mirror/object-inl.h"
#include "mirror/string.h"
#include "obj_ptr.h"
+#include "runtime.h"
#include "scoped_thread_state_change-inl.h"
#include "thread-inl.h"
+#include "thread_list.h"
#include "well_known_classes.h"
namespace openjdkjvmti {
@@ -354,4 +358,165 @@ jvmtiError ThreadUtil::GetThreadState(jvmtiEnv* env ATTRIBUTE_UNUSED,
return ERR(NONE);
}
+jvmtiError ThreadUtil::GetAllThreads(jvmtiEnv* env,
+ jint* threads_count_ptr,
+ jthread** threads_ptr) {
+ if (threads_count_ptr == nullptr || threads_ptr == nullptr) {
+ return ERR(NULL_POINTER);
+ }
+
+ art::Thread* current = art::Thread::Current();
+
+ art::ScopedObjectAccess soa(current);
+
+ art::MutexLock mu(current, *art::Locks::thread_list_lock_);
+ std::list<art::Thread*> thread_list = art::Runtime::Current()->GetThreadList()->GetList();
+
+ std::vector<art::ObjPtr<art::mirror::Object>> peers;
+
+ for (art::Thread* thread : thread_list) {
+ // Skip threads that are still starting.
+ if (thread->IsStillStarting()) {
+ continue;
+ }
+
+ art::ObjPtr<art::mirror::Object> peer = thread->GetPeer();
+ if (peer != nullptr) {
+ peers.push_back(peer);
+ }
+ }
+
+ if (peers.empty()) {
+ *threads_count_ptr = 0;
+ *threads_ptr = nullptr;
+ } else {
+ unsigned char* data;
+ jvmtiError data_result = env->Allocate(peers.size() * sizeof(jthread), &data);
+ if (data_result != ERR(NONE)) {
+ return data_result;
+ }
+ jthread* threads = reinterpret_cast<jthread*>(data);
+ for (size_t i = 0; i != peers.size(); ++i) {
+ threads[i] = soa.AddLocalReference<jthread>(peers[i]);
+ }
+
+ *threads_count_ptr = static_cast<jint>(peers.size());
+ *threads_ptr = threads;
+ }
+ return ERR(NONE);
+}
+
+jvmtiError ThreadUtil::SetThreadLocalStorage(jvmtiEnv* env ATTRIBUTE_UNUSED,
+ jthread thread,
+ const void* data) {
+ art::ScopedObjectAccess soa(art::Thread::Current());
+ art::Thread* self = GetNativeThread(thread, soa);
+ if (self == nullptr && thread == nullptr) {
+ return ERR(INVALID_THREAD);
+ }
+ if (self == nullptr) {
+ return ERR(THREAD_NOT_ALIVE);
+ }
+
+ self->SetCustomTLS(data);
+
+ return ERR(NONE);
+}
+
+jvmtiError ThreadUtil::GetThreadLocalStorage(jvmtiEnv* env ATTRIBUTE_UNUSED,
+ jthread thread,
+ void** data_ptr) {
+ if (data_ptr == nullptr) {
+ return ERR(NULL_POINTER);
+ }
+
+ art::ScopedObjectAccess soa(art::Thread::Current());
+ art::Thread* self = GetNativeThread(thread, soa);
+ if (self == nullptr && thread == nullptr) {
+ return ERR(INVALID_THREAD);
+ }
+ if (self == nullptr) {
+ return ERR(THREAD_NOT_ALIVE);
+ }
+
+ *data_ptr = const_cast<void*>(self->GetCustomTLS());
+ return ERR(NONE);
+}
+
+struct AgentData {
+ const void* arg;
+ jvmtiStartFunction proc;
+ jthread thread;
+ JavaVM* java_vm;
+ jvmtiEnv* jvmti_env;
+ jint priority;
+};
+
+static void* AgentCallback(void* arg) {
+ std::unique_ptr<AgentData> data(reinterpret_cast<AgentData*>(arg));
+ CHECK(data->thread != nullptr);
+
+ // We already have a peer. So call our special Attach function.
+ art::Thread* self = art::Thread::Attach("JVMTI Agent thread", true, data->thread);
+ CHECK(self != nullptr);
+ // The name in Attach() is only for logging. Set the thread name. This is important so
+ // that the thread is no longer seen as starting up.
+ {
+ art::ScopedObjectAccess soa(self);
+ self->SetThreadName("JVMTI Agent thread");
+ }
+
+ // Release the peer.
+ JNIEnv* env = self->GetJniEnv();
+ env->DeleteGlobalRef(data->thread);
+ data->thread = nullptr;
+
+ // Run the agent code.
+ data->proc(data->jvmti_env, env, const_cast<void*>(data->arg));
+
+ // Detach the thread.
+ int detach_result = data->java_vm->DetachCurrentThread();
+ CHECK_EQ(detach_result, 0);
+
+ return nullptr;
+}
+
+jvmtiError ThreadUtil::RunAgentThread(jvmtiEnv* jvmti_env,
+ jthread thread,
+ jvmtiStartFunction proc,
+ const void* arg,
+ jint priority) {
+ if (priority < JVMTI_THREAD_MIN_PRIORITY || priority > JVMTI_THREAD_MAX_PRIORITY) {
+ return ERR(INVALID_PRIORITY);
+ }
+ JNIEnv* env = art::Thread::Current()->GetJniEnv();
+ if (thread == nullptr || !env->IsInstanceOf(thread, art::WellKnownClasses::java_lang_Thread)) {
+ return ERR(INVALID_THREAD);
+ }
+ if (proc == nullptr) {
+ return ERR(NULL_POINTER);
+ }
+
+ std::unique_ptr<AgentData> data(new AgentData);
+ data->arg = arg;
+ data->proc = proc;
+ // We need a global ref for Java objects, as local refs will be invalid.
+ data->thread = env->NewGlobalRef(thread);
+ data->java_vm = art::Runtime::Current()->GetJavaVM();
+ data->jvmti_env = jvmti_env;
+ data->priority = priority;
+
+ pthread_t pthread;
+ int pthread_create_result = pthread_create(&pthread,
+ nullptr,
+ &AgentCallback,
+ reinterpret_cast<void*>(data.get()));
+ if (pthread_create_result != 0) {
+ return ERR(INTERNAL);
+ }
+ data.release();
+
+ return ERR(NONE);
+}
+
} // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_thread.h b/runtime/openjdkjvmti/ti_thread.h
index b6ffbb5f65..5aaec583da 100644
--- a/runtime/openjdkjvmti/ti_thread.h
+++ b/runtime/openjdkjvmti/ti_thread.h
@@ -39,11 +39,22 @@ namespace openjdkjvmti {
class ThreadUtil {
public:
+ static jvmtiError GetAllThreads(jvmtiEnv* env, jint* threads_count_ptr, jthread** threads_ptr);
+
static jvmtiError GetCurrentThread(jvmtiEnv* env, jthread* thread_ptr);
static jvmtiError GetThreadInfo(jvmtiEnv* env, jthread thread, jvmtiThreadInfo* info_ptr);
static jvmtiError GetThreadState(jvmtiEnv* env, jthread thread, jint* thread_state_ptr);
+
+ static jvmtiError SetThreadLocalStorage(jvmtiEnv* env, jthread thread, const void* data);
+ static jvmtiError GetThreadLocalStorage(jvmtiEnv* env, jthread thread, void** data_ptr);
+
+ static jvmtiError RunAgentThread(jvmtiEnv* env,
+ jthread thread,
+ jvmtiStartFunction proc,
+ const void* arg,
+ jint priority);
};
} // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_threadgroup.cc b/runtime/openjdkjvmti/ti_threadgroup.cc
new file mode 100644
index 0000000000..35b1bfd920
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_threadgroup.cc
@@ -0,0 +1,285 @@
+/* Copyright (C) 2017 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h. The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation. Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#include "ti_threadgroup.h"
+
+#include "art_field.h"
+#include "art_jvmti.h"
+#include "base/logging.h"
+#include "base/macros.h"
+#include "base/mutex.h"
+#include "handle_scope-inl.h"
+#include "jni_internal.h"
+#include "mirror/class.h"
+#include "mirror/object-inl.h"
+#include "mirror/string.h"
+#include "obj_ptr.h"
+#include "object_lock.h"
+#include "runtime.h"
+#include "scoped_thread_state_change-inl.h"
+#include "thread-inl.h"
+#include "thread_list.h"
+#include "well_known_classes.h"
+
+namespace openjdkjvmti {
+
+
+jvmtiError ThreadGroupUtil::GetTopThreadGroups(jvmtiEnv* env,
+ jint* group_count_ptr,
+ jthreadGroup** groups_ptr) {
+ // We only have a single top group. So we can take the current thread and move upwards.
+ if (group_count_ptr == nullptr || groups_ptr == nullptr) {
+ return ERR(NULL_POINTER);
+ }
+
+ art::Runtime* runtime = art::Runtime::Current();
+ if (runtime == nullptr) {
+ // Must be starting the runtime, or dying.
+ return ERR(WRONG_PHASE);
+ }
+
+ jobject sys_thread_group = runtime->GetSystemThreadGroup();
+ if (sys_thread_group == nullptr) {
+ // Seems we're still starting up.
+ return ERR(WRONG_PHASE);
+ }
+
+ unsigned char* data;
+ jvmtiError result = env->Allocate(sizeof(jthreadGroup), &data);
+ if (result != ERR(NONE)) {
+ return result;
+ }
+
+ jthreadGroup* groups = reinterpret_cast<jthreadGroup*>(data);
+ *groups =
+ reinterpret_cast<JNIEnv*>(art::Thread::Current()->GetJniEnv())->NewLocalRef(sys_thread_group);
+ *groups_ptr = groups;
+ *group_count_ptr = 1;
+
+ return ERR(NONE);
+}
+
+jvmtiError ThreadGroupUtil::GetThreadGroupInfo(jvmtiEnv* env,
+ jthreadGroup group,
+ jvmtiThreadGroupInfo* info_ptr) {
+ if (group == nullptr) {
+ return ERR(INVALID_THREAD_GROUP);
+ }
+
+ art::ScopedObjectAccess soa(art::Thread::Current());
+ if (soa.Env()->IsInstanceOf(group, art::WellKnownClasses::java_lang_ThreadGroup) == JNI_FALSE) {
+ return ERR(INVALID_THREAD_GROUP);
+ }
+
+ art::ObjPtr<art::mirror::Object> obj = soa.Decode<art::mirror::Object>(group);
+
+ // Do the name first. It's the only thing that can fail.
+ {
+ art::ArtField* name_field =
+ art::jni::DecodeArtField(art::WellKnownClasses::java_lang_ThreadGroup_name);
+ CHECK(name_field != nullptr);
+ art::ObjPtr<art::mirror::String> name_obj =
+ art::ObjPtr<art::mirror::String>::DownCast(name_field->GetObject(obj));
+ std::string tmp_str;
+ const char* tmp_cstr;
+ if (name_obj == nullptr) {
+ tmp_cstr = "";
+ } else {
+ tmp_str = name_obj->ToModifiedUtf8();
+ tmp_cstr = tmp_str.c_str();
+ }
+ jvmtiError result =
+ CopyString(env, tmp_cstr, reinterpret_cast<unsigned char**>(&info_ptr->name));
+ if (result != ERR(NONE)) {
+ return result;
+ }
+ }
+
+ // Parent.
+ {
+ art::ArtField* parent_field =
+ art::jni::DecodeArtField(art::WellKnownClasses::java_lang_ThreadGroup_parent);
+ CHECK(parent_field != nullptr);
+ art::ObjPtr<art::mirror::Object> parent_group = parent_field->GetObject(obj);
+ info_ptr->parent = parent_group == nullptr
+ ? nullptr
+ : soa.AddLocalReference<jthreadGroup>(parent_group);
+ }
+
+ // Max priority.
+ {
+ art::ArtField* prio_field = obj->GetClass()->FindDeclaredInstanceField("maxPriority", "I");
+ CHECK(prio_field != nullptr);
+ info_ptr->max_priority = static_cast<jint>(prio_field->GetInt(obj));
+ }
+
+ // Daemon.
+ {
+ art::ArtField* daemon_field = obj->GetClass()->FindDeclaredInstanceField("daemon", "Z");
+ CHECK(daemon_field != nullptr);
+ info_ptr->is_daemon = daemon_field->GetBoolean(obj) == 0 ? JNI_FALSE : JNI_TRUE;
+ }
+
+ return ERR(NONE);
+}
+
+
+static bool IsInDesiredThreadGroup(art::Handle<art::mirror::Object> desired_thread_group,
+ art::ObjPtr<art::mirror::Object> peer)
+ REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ CHECK(desired_thread_group.Get() != nullptr);
+
+ art::ArtField* thread_group_field =
+ art::jni::DecodeArtField(art::WellKnownClasses::java_lang_Thread_group);
+ DCHECK(thread_group_field != nullptr);
+ art::ObjPtr<art::mirror::Object> group = thread_group_field->GetObject(peer);
+ return (group == desired_thread_group.Get());
+}
+
+static void GetThreads(art::Handle<art::mirror::Object> thread_group,
+ std::vector<art::ObjPtr<art::mirror::Object>>* thread_peers)
+ REQUIRES_SHARED(art::Locks::mutator_lock_) REQUIRES(!art::Locks::thread_list_lock_) {
+ CHECK(thread_group.Get() != nullptr);
+
+ art::MutexLock mu(art::Thread::Current(), *art::Locks::thread_list_lock_);
+ for (art::Thread* t : art::Runtime::Current()->GetThreadList()->GetList()) {
+ if (t->IsStillStarting()) {
+ continue;
+ }
+ art::ObjPtr<art::mirror::Object> peer = t->GetPeer();
+ if (peer == nullptr) {
+ continue;
+ }
+ if (IsInDesiredThreadGroup(thread_group, peer)) {
+ thread_peers->push_back(peer);
+ }
+ }
+}
+
+static void GetChildThreadGroups(art::Handle<art::mirror::Object> thread_group,
+ std::vector<art::ObjPtr<art::mirror::Object>>* thread_groups)
+ REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ CHECK(thread_group.Get() != nullptr);
+
+ // Get the ThreadGroup[] "groups" out of this thread group...
+ art::ArtField* groups_field =
+ art::jni::DecodeArtField(art::WellKnownClasses::java_lang_ThreadGroup_groups);
+ art::ObjPtr<art::mirror::Object> groups_array = groups_field->GetObject(thread_group.Get());
+
+ if (groups_array == nullptr) {
+ return;
+ }
+ CHECK(groups_array->IsObjectArray());
+
+ art::ObjPtr<art::mirror::ObjectArray<art::mirror::Object>> groups_array_as_array =
+ groups_array->AsObjectArray<art::mirror::Object>();
+
+ // Copy all non-null elements.
+ for (int32_t i = 0; i < groups_array_as_array->GetLength(); ++i) {
+ art::ObjPtr<art::mirror::Object> entry = groups_array_as_array->Get(i);
+ if (entry != nullptr) {
+ thread_groups->push_back(entry);
+ }
+ }
+}
+
+jvmtiError ThreadGroupUtil::GetThreadGroupChildren(jvmtiEnv* env,
+ jthreadGroup group,
+ jint* thread_count_ptr,
+ jthread** threads_ptr,
+ jint* group_count_ptr,
+ jthreadGroup** groups_ptr) {
+ if (group == nullptr) {
+ return ERR(INVALID_THREAD_GROUP);
+ }
+
+ art::ScopedObjectAccess soa(art::Thread::Current());
+
+ if (!soa.Env()->IsInstanceOf(group, art::WellKnownClasses::java_lang_ThreadGroup)) {
+ return ERR(INVALID_THREAD_GROUP);
+ }
+
+ art::StackHandleScope<1> hs(soa.Self());
+ art::Handle<art::mirror::Object> thread_group = hs.NewHandle(
+ soa.Decode<art::mirror::Object>(group));
+
+ art::ObjectLock<art::mirror::Object> thread_group_lock(soa.Self(), thread_group);
+
+ std::vector<art::ObjPtr<art::mirror::Object>> thread_peers;
+ GetThreads(thread_group, &thread_peers);
+
+ std::vector<art::ObjPtr<art::mirror::Object>> thread_groups;
+ GetChildThreadGroups(thread_group, &thread_groups);
+
+ jthread* thread_data = nullptr;
+ JvmtiUniquePtr peers_uptr;
+ if (!thread_peers.empty()) {
+ unsigned char* data;
+ jvmtiError res = env->Allocate(sizeof(jthread) * thread_peers.size(), &data);
+ if (res != ERR(NONE)) {
+ return res;
+ }
+ thread_data = reinterpret_cast<jthread*>(data);
+ peers_uptr = MakeJvmtiUniquePtr(env, data);
+ }
+
+ jthreadGroup* group_data = nullptr;
+ if (!thread_groups.empty()) {
+ unsigned char* data;
+ jvmtiError res = env->Allocate(sizeof(jthreadGroup) * thread_groups.size(), &data);
+ if (res != ERR(NONE)) {
+ return res;
+ }
+ group_data = reinterpret_cast<jthreadGroup*>(data);
+ }
+
+ // Can't fail anymore from here on.
+
+ // Copy data into out buffers.
+ for (size_t i = 0; i != thread_peers.size(); ++i) {
+ thread_data[i] = soa.AddLocalReference<jthread>(thread_peers[i]);
+ }
+ for (size_t i = 0; i != thread_groups.size(); ++i) {
+ group_data[i] = soa.AddLocalReference<jthreadGroup>(thread_groups[i]);
+ }
+
+ *thread_count_ptr = static_cast<jint>(thread_peers.size());
+ *threads_ptr = thread_data;
+ *group_count_ptr = static_cast<jint>(thread_groups.size());
+ *groups_ptr = group_data;
+
+ // Everything's fine.
+ peers_uptr.release();
+
+ return ERR(NONE);
+}
+
+} // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_threadgroup.h b/runtime/openjdkjvmti/ti_threadgroup.h
new file mode 100644
index 0000000000..c3a0ff5e15
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_threadgroup.h
@@ -0,0 +1,60 @@
+/* Copyright (C) 2017 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h. The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation. Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#ifndef ART_RUNTIME_OPENJDKJVMTI_TI_THREADGROUP_H_
+#define ART_RUNTIME_OPENJDKJVMTI_TI_THREADGROUP_H_
+
+#include "jni.h"
+#include "jvmti.h"
+
+namespace openjdkjvmti {
+
+class ThreadGroupUtil {
+ public:
+ static jvmtiError GetTopThreadGroups(jvmtiEnv* env,
+ jint* group_count_ptr,
+ jthreadGroup** groups_ptr);
+
+ static jvmtiError GetThreadGroupInfo(jvmtiEnv* env,
+ jthreadGroup group,
+ jvmtiThreadGroupInfo* info_ptr);
+
+ static jvmtiError GetThreadGroupChildren(jvmtiEnv* env,
+ jthreadGroup group,
+ jint* thread_count_ptr,
+ jthread** threads_ptr,
+ jint* group_count_ptr,
+ jthreadGroup** groups_ptr);
+};
+
+} // namespace openjdkjvmti
+
+#endif // ART_RUNTIME_OPENJDKJVMTI_TI_THREADGROUP_H_
diff --git a/runtime/openjdkjvmti/ti_timers.cc b/runtime/openjdkjvmti/ti_timers.cc
new file mode 100644
index 0000000000..24fb0419ee
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_timers.cc
@@ -0,0 +1,93 @@
+/* Copyright (C) 2017 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h. The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation. Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#include "ti_timers.h"
+
+#include <limits>
+
+#ifndef __APPLE__
+#include <time.h>
+#else
+#include <sys/time.h>
+#endif
+#include <unistd.h>
+
+#include "art_jvmti.h"
+#include "base/macros.h"
+
+namespace openjdkjvmti {
+
+jvmtiError TimerUtil::GetAvailableProcessors(jvmtiEnv* env ATTRIBUTE_UNUSED,
+ jint* processor_count_ptr) {
+ if (processor_count_ptr == nullptr) {
+ return ERR(NULL_POINTER);
+ }
+
+ *processor_count_ptr = static_cast<jint>(sysconf(_SC_NPROCESSORS_CONF));
+
+ return ERR(NONE);
+}
+
+jvmtiError TimerUtil::GetTimerInfo(jvmtiEnv* env ATTRIBUTE_UNUSED, jvmtiTimerInfo* info_ptr) {
+ if (info_ptr == nullptr) {
+ return ERR(NULL_POINTER);
+ }
+
+ info_ptr->max_value = static_cast<jlong>(std::numeric_limits<uint64_t>::max());
+ info_ptr->may_skip_forward = JNI_TRUE;
+ info_ptr->may_skip_backward = JNI_TRUE;
+ info_ptr->kind = jvmtiTimerKind::JVMTI_TIMER_ELAPSED;
+
+ return ERR(NONE);
+}
+
+jvmtiError TimerUtil::GetTime(jvmtiEnv* env ATTRIBUTE_UNUSED, jlong* nanos_ptr) {
+ if (nanos_ptr == nullptr) {
+ return ERR(NULL_POINTER);
+ }
+
+#ifndef __APPLE__
+ // Use the same implementation as System.nanoTime.
+ struct timespec now;
+ clock_gettime(CLOCK_MONOTONIC, &now);
+ *nanos_ptr = now.tv_sec * 1000000000LL + now.tv_nsec;
+#else
+ // No CLOCK_MONOTONIC support on older Mac OS.
+ struct timeval t;
+ t.tv_sec = t.tv_usec = 0;
+ gettimeofday(&t, NULL);
+ *nanos_ptr = static_cast<jlong>(t.tv_sec)*1000000000LL + static_cast<jlong>(t.tv_usec)*1000LL;
+#endif
+
+ return ERR(NONE);
+}
+
+} // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_timers.h b/runtime/openjdkjvmti/ti_timers.h
new file mode 100644
index 0000000000..6300678ff7
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_timers.h
@@ -0,0 +1,51 @@
+/* Copyright (C) 2017 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h. The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation. Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#ifndef ART_RUNTIME_OPENJDKJVMTI_TI_TIMERS_H_
+#define ART_RUNTIME_OPENJDKJVMTI_TI_TIMERS_H_
+
+#include "jni.h"
+#include "jvmti.h"
+
+namespace openjdkjvmti {
+
+class TimerUtil {
+ public:
+ static jvmtiError GetAvailableProcessors(jvmtiEnv* env, jint* processor_count_ptr);
+
+ static jvmtiError GetTimerInfo(jvmtiEnv* env, jvmtiTimerInfo* info_ptr);
+
+ static jvmtiError GetTime(jvmtiEnv* env, jlong* nanos_ptr);
+};
+
+} // namespace openjdkjvmti
+
+#endif // ART_RUNTIME_OPENJDKJVMTI_TI_TIMERS_H_
diff --git a/runtime/openjdkjvmti/transform.cc b/runtime/openjdkjvmti/transform.cc
index f5451254c0..af4fb7187a 100644
--- a/runtime/openjdkjvmti/transform.cc
+++ b/runtime/openjdkjvmti/transform.cc
@@ -38,6 +38,7 @@
#include "class_linker.h"
#include "dex_file.h"
#include "dex_file_types.h"
+#include "events-inl.h"
#include "gc_root-inl.h"
#include "globals.h"
#include "jni_env_ext-inl.h"
@@ -46,18 +47,83 @@
#include "mem_map.h"
#include "mirror/array.h"
#include "mirror/class-inl.h"
+#include "mirror/class_ext.h"
#include "mirror/class_loader-inl.h"
#include "mirror/string-inl.h"
#include "oat_file.h"
#include "scoped_thread_state_change-inl.h"
#include "stack.h"
#include "thread_list.h"
+#include "ti_redefine.h"
#include "transform.h"
#include "utf.h"
#include "utils/dex_cache_arrays_layout-inl.h"
namespace openjdkjvmti {
+jvmtiError Transformer::RetransformClassesDirect(
+ ArtJvmTiEnv* env,
+ art::Thread* self,
+ /*in-out*/std::vector<ArtClassDefinition>* definitions) {
+ for (ArtClassDefinition& def : *definitions) {
+ jint new_len = -1;
+ unsigned char* new_data = nullptr;
+ // Static casts are so that we get the right template initialization for the special event
+ // handling code required by the ClassFileLoadHooks.
+ gEventHandler.DispatchEvent(self,
+ ArtJvmtiEvent::kClassFileLoadHookRetransformable,
+ GetJniEnv(env),
+ static_cast<jclass>(def.klass),
+ static_cast<jobject>(def.loader),
+ static_cast<const char*>(def.name.c_str()),
+ static_cast<jobject>(def.protection_domain),
+ static_cast<jint>(def.dex_len),
+ static_cast<const unsigned char*>(def.dex_data.get()),
+ static_cast<jint*>(&new_len),
+ static_cast<unsigned char**>(&new_data));
+ def.SetNewDexData(env, new_len, new_data);
+ }
+ return OK;
+}
+
+jvmtiError Transformer::RetransformClasses(ArtJvmTiEnv* env,
+ art::Runtime* runtime,
+ art::Thread* self,
+ jint class_count,
+ const jclass* classes,
+ /*out*/std::string* error_msg) {
+ if (env == nullptr) {
+ *error_msg = "env was null!";
+ return ERR(INVALID_ENVIRONMENT);
+ } else if (class_count < 0) {
+ *error_msg = "class_count was less then 0";
+ return ERR(ILLEGAL_ARGUMENT);
+ } else if (class_count == 0) {
+ // We don't actually need to do anything. Just return OK.
+ return OK;
+ } else if (classes == nullptr) {
+ *error_msg = "null classes!";
+ return ERR(NULL_POINTER);
+ }
+ // A holder that will Deallocate all the class bytes buffers on destruction.
+ std::vector<ArtClassDefinition> definitions;
+ jvmtiError res = OK;
+ for (jint i = 0; i < class_count; i++) {
+ ArtClassDefinition def;
+ res = FillInTransformationData(env, classes[i], &def);
+ if (res != OK) {
+ return res;
+ }
+ definitions.push_back(std::move(def));
+ }
+ res = RetransformClassesDirect(env, self, &definitions);
+ if (res != OK) {
+ return res;
+ }
+ return Redefiner::RedefineClassesDirect(env, runtime, self, definitions, error_msg);
+}
+
+// TODO Move this somewhere else, ti_class?
jvmtiError GetClassLocation(ArtJvmTiEnv* env, jclass klass, /*out*/std::string* location) {
JNIEnv* jni_env = nullptr;
jint ret = env->art_vm->GetEnv(reinterpret_cast<void**>(&jni_env), JNI_VERSION_1_1);
@@ -73,42 +139,74 @@ jvmtiError GetClassLocation(ArtJvmTiEnv* env, jclass klass, /*out*/std::string*
return OK;
}
+static jvmtiError CopyDataIntoJvmtiBuffer(ArtJvmTiEnv* env,
+ const unsigned char* source,
+ jint len,
+ /*out*/unsigned char** dest) {
+ jvmtiError res = env->Allocate(len, dest);
+ if (res != OK) {
+ return res;
+ }
+ memcpy(reinterpret_cast<void*>(*dest),
+ reinterpret_cast<const void*>(source),
+ len);
+ return OK;
+}
+
+jvmtiError Transformer::GetDexDataForRetransformation(ArtJvmTiEnv* env,
+ art::Handle<art::mirror::Class> klass,
+ /*out*/jint* dex_data_len,
+ /*out*/unsigned char** dex_data) {
+ art::StackHandleScope<2> hs(art::Thread::Current());
+ art::Handle<art::mirror::ClassExt> ext(hs.NewHandle(klass->GetExtData()));
+ if (!ext.IsNull()) {
+ art::Handle<art::mirror::ByteArray> orig_dex(hs.NewHandle(ext->GetOriginalDexFileBytes()));
+ if (!orig_dex.IsNull()) {
+ *dex_data_len = static_cast<jint>(orig_dex->GetLength());
+ return CopyDataIntoJvmtiBuffer(env,
+ reinterpret_cast<const unsigned char*>(orig_dex->GetData()),
+ *dex_data_len,
+ /*out*/dex_data);
+ }
+ }
+ // TODO De-quicken the dex file before passing it to the agents.
+ LOG(WARNING) << "Dex file is not de-quickened yet! Quickened dex instructions might be present";
+ const art::DexFile& dex = klass->GetDexFile();
+ *dex_data_len = static_cast<jint>(dex.Size());
+ return CopyDataIntoJvmtiBuffer(env, dex.Begin(), *dex_data_len, /*out*/dex_data);
+}
+
// TODO Move this function somewhere more appropriate.
// Gets the data surrounding the given class.
-jvmtiError GetTransformationData(ArtJvmTiEnv* env,
- jclass klass,
- /*out*/std::string* location,
- /*out*/JNIEnv** jni_env_ptr,
- /*out*/jobject* loader,
- /*out*/std::string* name,
- /*out*/jobject* protection_domain,
- /*out*/jint* data_len,
- /*out*/unsigned char** dex_data) {
- jint ret = env->art_vm->GetEnv(reinterpret_cast<void**>(jni_env_ptr), JNI_VERSION_1_1);
- if (ret != JNI_OK) {
+// TODO Make this less magical.
+jvmtiError Transformer::FillInTransformationData(ArtJvmTiEnv* env,
+ jclass klass,
+ ArtClassDefinition* def) {
+ JNIEnv* jni_env = GetJniEnv(env);
+ if (jni_env == nullptr) {
// TODO Different error might be better?
return ERR(INTERNAL);
}
- JNIEnv* jni_env = *jni_env_ptr;
art::ScopedObjectAccess soa(jni_env);
art::StackHandleScope<3> hs(art::Thread::Current());
art::Handle<art::mirror::Class> hs_klass(hs.NewHandle(soa.Decode<art::mirror::Class>(klass)));
- *loader = soa.AddLocalReference<jobject>(hs_klass->GetClassLoader());
- *name = art::mirror::Class::ComputeName(hs_klass)->ToModifiedUtf8();
+ if (hs_klass.IsNull()) {
+ return ERR(INVALID_CLASS);
+ }
+ def->klass = klass;
+ def->loader = soa.AddLocalReference<jobject>(hs_klass->GetClassLoader());
+ def->name = art::mirror::Class::ComputeName(hs_klass)->ToModifiedUtf8();
// TODO is this always null?
- *protection_domain = nullptr;
- const art::DexFile& dex = hs_klass->GetDexFile();
- *location = dex.GetLocation();
- *data_len = static_cast<jint>(dex.Size());
- // TODO We should maybe change env->Allocate to allow us to mprotect this memory and stop writes.
- jvmtiError alloc_error = env->Allocate(*data_len, dex_data);
- if (alloc_error != OK) {
- return alloc_error;
+ def->protection_domain = nullptr;
+ if (def->dex_data.get() == nullptr) {
+ unsigned char* new_data;
+ jvmtiError res = GetDexDataForRetransformation(env, hs_klass, &def->dex_len, &new_data);
+ if (res == OK) {
+ def->dex_data = MakeJvmtiUniquePtr(env, new_data);
+ } else {
+ return res;
+ }
}
- // Copy the data into a temporary buffer.
- memcpy(reinterpret_cast<void*>(*dex_data),
- reinterpret_cast<const void*>(dex.Begin()),
- *data_len);
return OK;
}
diff --git a/runtime/openjdkjvmti/transform.h b/runtime/openjdkjvmti/transform.h
index 0ad5099daf..65f2ae1353 100644
--- a/runtime/openjdkjvmti/transform.h
+++ b/runtime/openjdkjvmti/transform.h
@@ -37,22 +37,37 @@
#include <jni.h>
#include "art_jvmti.h"
+#include "ti_class_definition.h"
#include "jvmti.h"
namespace openjdkjvmti {
jvmtiError GetClassLocation(ArtJvmTiEnv* env, jclass klass, /*out*/std::string* location);
-// Gets the data surrounding the given class.
-jvmtiError GetTransformationData(ArtJvmTiEnv* env,
- jclass klass,
- /*out*/std::string* location,
- /*out*/JNIEnv** jni_env_ptr,
- /*out*/jobject* loader,
- /*out*/std::string* name,
- /*out*/jobject* protection_domain,
- /*out*/jint* data_len,
- /*out*/unsigned char** dex_data);
+class Transformer {
+ public:
+ static jvmtiError RetransformClassesDirect(
+ ArtJvmTiEnv* env, art::Thread* self, /*in-out*/std::vector<ArtClassDefinition>* definitions);
+
+ static jvmtiError RetransformClasses(ArtJvmTiEnv* env,
+ art::Runtime* runtime,
+ art::Thread* self,
+ jint class_count,
+ const jclass* classes,
+ /*out*/std::string* error_msg);
+
+ // Gets the data surrounding the given class.
+ static jvmtiError FillInTransformationData(ArtJvmTiEnv* env,
+ jclass klass,
+ ArtClassDefinition* def);
+
+ private:
+ static jvmtiError GetDexDataForRetransformation(ArtJvmTiEnv* env,
+ art::Handle<art::mirror::Class> klass,
+ /*out*/jint* dex_data_length,
+ /*out*/unsigned char** dex_data)
+ REQUIRES_SHARED(art::Locks::mutator_lock_);
+};
} // namespace openjdkjvmti
diff --git a/runtime/parsed_options.cc b/runtime/parsed_options.cc
index e1022b000b..a72159bc80 100644
--- a/runtime/parsed_options.cc
+++ b/runtime/parsed_options.cc
@@ -763,8 +763,6 @@ void ParsedOptions::Usage(const char* fmt, ...) {
"(Enable new and experimental agent support)\n");
UsageMessage(stream, " -Xexperimental:agents"
"(Enable new and experimental agent support)\n");
- UsageMessage(stream, " -Xexperimental:method-handles"
- "(Enable new and experimental method handles support)\n");
UsageMessage(stream, "\n");
UsageMessage(stream, "The following previously supported Dalvik options are ignored:\n");
diff --git a/runtime/reflection.cc b/runtime/reflection.cc
index 4d2450135e..a2b4cb37a9 100644
--- a/runtime/reflection.cc
+++ b/runtime/reflection.cc
@@ -216,43 +216,54 @@ class ArgArray {
}
bool BuildArgArrayFromObjectArray(ObjPtr<mirror::Object> receiver,
- ObjPtr<mirror::ObjectArray<mirror::Object>> args,
- ArtMethod* m)
+ ObjPtr<mirror::ObjectArray<mirror::Object>> raw_args,
+ ArtMethod* m,
+ Thread* self)
REQUIRES_SHARED(Locks::mutator_lock_) {
const DexFile::TypeList* classes = m->GetParameterTypeList();
// Set receiver if non-null (method is not static)
if (receiver != nullptr) {
Append(receiver);
}
+ StackHandleScope<2> hs(self);
+ MutableHandle<mirror::Object> arg(hs.NewHandle<mirror::Object>(nullptr));
+ Handle<mirror::ObjectArray<mirror::Object>> args(
+ hs.NewHandle<mirror::ObjectArray<mirror::Object>>(raw_args));
for (size_t i = 1, args_offset = 0; i < shorty_len_; ++i, ++args_offset) {
- ObjPtr<mirror::Object> arg(args->Get(args_offset));
- if (((shorty_[i] == 'L') && (arg != nullptr)) || ((arg == nullptr && shorty_[i] != 'L'))) {
- PointerSize pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
+ arg.Assign(args->Get(args_offset));
+ if (((shorty_[i] == 'L') && (arg.Get() != nullptr)) ||
+ ((arg.Get() == nullptr && shorty_[i] != 'L'))) {
+ // TODO: The method's parameter's type must have been previously resolved, yet
+ // we've seen cases where it's not b/34440020.
ObjPtr<mirror::Class> dst_class(
m->GetClassFromTypeIndex(classes->GetTypeItem(args_offset).type_idx_,
- true /* resolve */,
- pointer_size));
- if (UNLIKELY(arg == nullptr || !arg->InstanceOf(dst_class))) {
+ true /* resolve */));
+ if (dst_class.Ptr() == nullptr) {
+ CHECK(self->IsExceptionPending());
+ return false;
+ }
+ if (UNLIKELY(arg.Get() == nullptr || !arg->InstanceOf(dst_class))) {
ThrowIllegalArgumentException(
StringPrintf("method %s argument %zd has type %s, got %s",
m->PrettyMethod(false).c_str(),
args_offset + 1, // Humans don't count from 0.
mirror::Class::PrettyDescriptor(dst_class).c_str(),
- mirror::Object::PrettyTypeOf(arg).c_str()).c_str());
+ mirror::Object::PrettyTypeOf(arg.Get()).c_str()).c_str());
return false;
}
}
#define DO_FIRST_ARG(match_descriptor, get_fn, append) { \
- if (LIKELY(arg != nullptr && arg->GetClass()->DescriptorEquals(match_descriptor))) { \
+ if (LIKELY(arg.Get() != nullptr && \
+ arg->GetClass()->DescriptorEquals(match_descriptor))) { \
ArtField* primitive_field = arg->GetClass()->GetInstanceField(0); \
- append(primitive_field-> get_fn(arg));
+ append(primitive_field-> get_fn(arg.Get()));
#define DO_ARG(match_descriptor, get_fn, append) \
- } else if (LIKELY(arg != nullptr && \
+ } else if (LIKELY(arg.Get() != nullptr && \
arg->GetClass<>()->DescriptorEquals(match_descriptor))) { \
ArtField* primitive_field = arg->GetClass()->GetInstanceField(0); \
- append(primitive_field-> get_fn(arg));
+ append(primitive_field-> get_fn(arg.Get()));
#define DO_FAIL(expected) \
} else { \
@@ -266,14 +277,14 @@ class ArgArray {
ArtMethod::PrettyMethod(m, false).c_str(), \
args_offset + 1, \
expected, \
- mirror::Object::PrettyTypeOf(arg).c_str()).c_str()); \
+ mirror::Object::PrettyTypeOf(arg.Get()).c_str()).c_str()); \
} \
return false; \
} }
switch (shorty_[i]) {
case 'L':
- Append(arg);
+ Append(arg.Get());
break;
case 'Z':
DO_FIRST_ARG("Ljava/lang/Boolean;", GetBoolean, Append)
@@ -363,12 +374,9 @@ static void CheckMethodArguments(JavaVMExt* vm, ArtMethod* m, uint32_t* args)
}
// TODO: If args contain object references, it may cause problems.
Thread* const self = Thread::Current();
- PointerSize pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
for (uint32_t i = 0; i < num_params; i++) {
dex::TypeIndex type_idx = params->GetTypeItem(i).type_idx_;
- ObjPtr<mirror::Class> param_type(m->GetClassFromTypeIndex(type_idx,
- true /* resolve*/,
- pointer_size));
+ ObjPtr<mirror::Class> param_type(m->GetClassFromTypeIndex(type_idx, true /* resolve */));
if (param_type == nullptr) {
CHECK(self->IsExceptionPending());
LOG(ERROR) << "Internal error: unresolvable type for argument type in JNI invoke: "
@@ -649,7 +657,7 @@ jobject InvokeMethod(const ScopedObjectAccessAlreadyRunnable& soa, jobject javaM
uint32_t shorty_len = 0;
const char* shorty = np_method->GetShorty(&shorty_len);
ArgArray arg_array(shorty, shorty_len);
- if (!arg_array.BuildArgArrayFromObjectArray(receiver, objects, np_method)) {
+ if (!arg_array.BuildArgArrayFromObjectArray(receiver, objects, np_method, soa.Self())) {
CHECK(soa.Self()->IsExceptionPending());
return nullptr;
}
diff --git a/runtime/runtime.cc b/runtime/runtime.cc
index df5fc5ce8a..4936a2f9a7 100644
--- a/runtime/runtime.cc
+++ b/runtime/runtime.cc
@@ -137,6 +137,7 @@
#include "jit/profile_saver.h"
#include "quick/quick_method_frame_info.h"
#include "reflection.h"
+#include "runtime_callbacks.h"
#include "runtime_options.h"
#include "ScopedLocalRef.h"
#include "scoped_thread_state_change-inl.h"
@@ -253,10 +254,12 @@ Runtime::Runtime()
pruned_dalvik_cache_(false),
// Initially assume we perceive jank in case the process state is never updated.
process_state_(kProcessStateJankPerceptible),
- zygote_no_threads_(false) {
+ zygote_no_threads_(false),
+ cha_(nullptr) {
CheckAsmSupportOffsetsAndSizes();
std::fill(callee_save_methods_, callee_save_methods_ + arraysize(callee_save_methods_), 0u);
interpreter::CheckInterpreterAsmConstants();
+ callbacks_.reset(new RuntimeCallbacks());
}
Runtime::~Runtime() {
@@ -301,6 +304,13 @@ Runtime::~Runtime() {
Trace::Shutdown();
+ // Report death. Clients me require a working thread, still, so do it before GC completes and
+ // all non-daemon threads are done.
+ {
+ ScopedObjectAccess soa(self);
+ callbacks_->NextRuntimePhase(RuntimePhaseCallback::RuntimePhase::kDeath);
+ }
+
if (attach_shutdown_thread) {
DetachCurrentThread();
self = nullptr;
@@ -703,6 +713,13 @@ bool Runtime::Start() {
Thread::FinishStartup();
+ // Send the start phase event. We have to wait till here as this is when the main thread peer
+ // has just been generated, important root clinits have been run and JNI is completely functional.
+ {
+ ScopedObjectAccess soa(self);
+ callbacks_->NextRuntimePhase(RuntimePhaseCallback::RuntimePhase::kStart);
+ }
+
system_class_loader_ = CreateSystemClassLoader(this);
if (!is_zygote_) {
@@ -739,6 +756,12 @@ bool Runtime::Start() {
0);
}
+ // Send the initialized phase event.
+ {
+ ScopedObjectAccess soa(self);
+ callbacks_->NextRuntimePhase(RuntimePhaseCallback::RuntimePhase::kInit);
+ }
+
return true;
}
@@ -1100,6 +1123,8 @@ bool Runtime::Init(RuntimeArgumentMap&& runtime_options_in) {
if (runtime_options.Exists(Opt::JdwpOptions)) {
Dbg::ConfigureJdwp(runtime_options.GetOrDefault(Opt::JdwpOptions));
}
+ callbacks_->AddThreadLifecycleCallback(Dbg::GetThreadLifecycleCallback());
+ callbacks_->AddClassLoadCallback(Dbg::GetClassLoadCallback());
jit_options_.reset(jit::JitOptions::CreateFromRuntimeArguments(runtime_options));
if (IsAotCompiler()) {
@@ -1358,6 +1383,10 @@ bool Runtime::Init(RuntimeArgumentMap&& runtime_options_in) {
LOG(ERROR) << "Unable to load an agent: " << err;
}
}
+ {
+ ScopedObjectAccess soa(self);
+ callbacks_->NextRuntimePhase(RuntimePhaseCallback::RuntimePhase::kInitialAgents);
+ }
VLOG(startup) << "Runtime::Init exiting";
@@ -1370,7 +1399,7 @@ static bool EnsureJvmtiPlugin(Runtime* runtime,
constexpr const char* plugin_name = kIsDebugBuild ? "libopenjdkjvmtid.so" : "libopenjdkjvmti.so";
// Is the plugin already loaded?
- for (Plugin p : *plugins) {
+ for (const Plugin& p : *plugins) {
if (p.GetLibrary() == plugin_name) {
return true;
}
@@ -1384,11 +1413,6 @@ static bool EnsureJvmtiPlugin(Runtime* runtime,
Plugin new_plugin = Plugin::Create(plugin_name);
- // Suspend all threads to protect ourself somewhat.
- Thread* self = Thread::Current();
- ScopedObjectAccess soa(self); // Now we know we have the shared lock.
- ScopedThreadSuspension sts(self, art::kWaitingForDebuggerToAttach);
- ScopedSuspendAll ssa("EnsureJvmtiPlugin");
if (!new_plugin.Load(error_msg)) {
return false;
}
@@ -1552,6 +1576,12 @@ void Runtime::DumpForSigQuit(std::ostream& os) {
thread_list_->DumpForSigQuit(os);
BaseMutex::DumpAll(os);
+
+ // Inform anyone else who is interested in SigQuit.
+ {
+ ScopedObjectAccess soa(Thread::Current());
+ callbacks_->SigQuit();
+ }
}
void Runtime::DumpLockHolders(std::ostream& os) {
@@ -2235,6 +2265,8 @@ void Runtime::AddSystemWeakHolder(gc::AbstractSystemWeakHolder* holder) {
gc::ScopedGCCriticalSection gcs(Thread::Current(),
gc::kGcCauseAddRemoveSystemWeakHolder,
gc::kCollectorTypeAddRemoveSystemWeakHolder);
+ // Note: The ScopedGCCriticalSection also ensures that the rest of the function is in
+ // a critical section.
system_weak_holders_.push_back(holder);
}
@@ -2256,4 +2288,8 @@ void Runtime::Aborter(const char* abort_message) {
Runtime::Abort(abort_message);
}
+RuntimeCallbacks* Runtime::GetRuntimeCallbacks() {
+ return callbacks_.get();
+}
+
} // namespace art
diff --git a/runtime/runtime.h b/runtime/runtime.h
index 8fc211c6a3..f7d6810ff5 100644
--- a/runtime/runtime.h
+++ b/runtime/runtime.h
@@ -28,6 +28,7 @@
#include "arch/instruction_set.h"
#include "base/macros.h"
+#include "base/mutex.h"
#include "dex_file_types.h"
#include "experimental_flags.h"
#include "gc_root.h"
@@ -40,7 +41,6 @@
#include "process_state.h"
#include "quick/quick_method_frame_info.h"
#include "runtime_stats.h"
-#include "safe_map.h"
namespace art {
@@ -90,6 +90,7 @@ class NullPointerHandler;
class OatFileManager;
class Plugin;
struct RuntimeArgumentMap;
+class RuntimeCallbacks;
class SignalCatcher;
class StackOverflowHandler;
class SuspensionHandler;
@@ -304,7 +305,7 @@ class Runtime {
}
bool IsMethodHandlesEnabled() const {
- return experimental_flags_ & ExperimentalFlags::kMethodHandles;
+ return true;
}
void DisallowNewSystemWeaks() REQUIRES_SHARED(Locks::mutator_lock_);
@@ -660,6 +661,8 @@ class Runtime {
void AttachAgent(const std::string& agent_arg);
+ RuntimeCallbacks* GetRuntimeCallbacks();
+
private:
static void InitPlatformSignalHandlers();
@@ -917,6 +920,8 @@ class Runtime {
ClassHierarchyAnalysis* cha_;
+ std::unique_ptr<RuntimeCallbacks> callbacks_;
+
DISALLOW_COPY_AND_ASSIGN(Runtime);
};
std::ostream& operator<<(std::ostream& os, const Runtime::CalleeSaveType& rhs);
diff --git a/runtime/runtime_callbacks.cc b/runtime/runtime_callbacks.cc
new file mode 100644
index 0000000000..7b15a4f1b5
--- /dev/null
+++ b/runtime/runtime_callbacks.cc
@@ -0,0 +1,104 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "runtime_callbacks.h"
+
+#include <algorithm>
+
+#include "base/macros.h"
+#include "class_linker.h"
+#include "thread.h"
+
+namespace art {
+
+void RuntimeCallbacks::AddThreadLifecycleCallback(ThreadLifecycleCallback* cb) {
+ thread_callbacks_.push_back(cb);
+}
+
+template <typename T>
+ALWAYS_INLINE
+static inline void Remove(T* cb, std::vector<T*>* data) {
+ auto it = std::find(data->begin(), data->end(), cb);
+ if (it != data->end()) {
+ data->erase(it);
+ }
+}
+
+void RuntimeCallbacks::RemoveThreadLifecycleCallback(ThreadLifecycleCallback* cb) {
+ Remove(cb, &thread_callbacks_);
+}
+
+void RuntimeCallbacks::ThreadStart(Thread* self) {
+ for (ThreadLifecycleCallback* cb : thread_callbacks_) {
+ cb->ThreadStart(self);
+ }
+}
+
+void RuntimeCallbacks::ThreadDeath(Thread* self) {
+ for (ThreadLifecycleCallback* cb : thread_callbacks_) {
+ cb->ThreadDeath(self);
+ }
+}
+
+void RuntimeCallbacks::AddClassLoadCallback(ClassLoadCallback* cb) {
+ class_callbacks_.push_back(cb);
+}
+
+void RuntimeCallbacks::RemoveClassLoadCallback(ClassLoadCallback* cb) {
+ Remove(cb, &class_callbacks_);
+}
+
+void RuntimeCallbacks::ClassLoad(Handle<mirror::Class> klass) {
+ for (ClassLoadCallback* cb : class_callbacks_) {
+ cb->ClassLoad(klass);
+ }
+}
+
+void RuntimeCallbacks::ClassPrepare(Handle<mirror::Class> temp_klass, Handle<mirror::Class> klass) {
+ for (ClassLoadCallback* cb : class_callbacks_) {
+ cb->ClassPrepare(temp_klass, klass);
+ }
+}
+
+void RuntimeCallbacks::AddRuntimeSigQuitCallback(RuntimeSigQuitCallback* cb) {
+ sigquit_callbacks_.push_back(cb);
+}
+
+void RuntimeCallbacks::RemoveRuntimeSigQuitCallback(RuntimeSigQuitCallback* cb) {
+ Remove(cb, &sigquit_callbacks_);
+}
+
+void RuntimeCallbacks::SigQuit() {
+ for (RuntimeSigQuitCallback* cb : sigquit_callbacks_) {
+ cb->SigQuit();
+ }
+}
+
+void RuntimeCallbacks::AddRuntimePhaseCallback(RuntimePhaseCallback* cb) {
+ phase_callbacks_.push_back(cb);
+}
+
+void RuntimeCallbacks::RemoveRuntimePhaseCallback(RuntimePhaseCallback* cb) {
+ Remove(cb, &phase_callbacks_);
+}
+
+void RuntimeCallbacks::NextRuntimePhase(RuntimePhaseCallback::RuntimePhase phase) {
+ for (RuntimePhaseCallback* cb : phase_callbacks_) {
+ cb->NextRuntimePhase(phase);
+ }
+}
+
+} // namespace art
diff --git a/runtime/runtime_callbacks.h b/runtime/runtime_callbacks.h
new file mode 100644
index 0000000000..e580e7875e
--- /dev/null
+++ b/runtime/runtime_callbacks.h
@@ -0,0 +1,115 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#ifndef ART_RUNTIME_RUNTIME_CALLBACKS_H_
+#define ART_RUNTIME_RUNTIME_CALLBACKS_H_
+
+#include <vector>
+
+#include "base/macros.h"
+#include "base/mutex.h"
+#include "handle.h"
+
+namespace art {
+
+namespace mirror {
+class Class;
+} // namespace mirror
+
+class ClassLoadCallback;
+class Thread;
+class ThreadLifecycleCallback;
+
+// Note: RuntimeCallbacks uses the mutator lock to synchronize the callback lists. A thread must
+// hold the exclusive lock to add or remove a listener. A thread must hold the shared lock
+// to dispatch an event. This setup is chosen as some clients may want to suspend the
+// dispatching thread or all threads.
+//
+// To make this safe, the following restrictions apply:
+// * Only the owner of a listener may ever add or remove said listener.
+// * A listener must never add or remove itself or any other listener while running.
+// * It is the responsibility of the owner to not remove the listener while it is running
+// (and suspended).
+//
+// The simplest way to satisfy these restrictions is to never remove a listener, and to do
+// any state checking (is the listener enabled) in the listener itself. For an example, see
+// Dbg.
+
+class RuntimeSigQuitCallback {
+ public:
+ virtual ~RuntimeSigQuitCallback() {}
+
+ virtual void SigQuit() REQUIRES_SHARED(Locks::mutator_lock_) = 0;
+};
+
+class RuntimePhaseCallback {
+ public:
+ enum RuntimePhase {
+ kInitialAgents, // Initial agent loading is done.
+ kStart, // The runtime is started.
+ kInit, // The runtime is initialized (and will run user code soon).
+ kDeath, // The runtime just died.
+ };
+
+ virtual ~RuntimePhaseCallback() {}
+
+ virtual void NextRuntimePhase(RuntimePhase phase) REQUIRES_SHARED(Locks::mutator_lock_) = 0;
+};
+
+class RuntimeCallbacks {
+ public:
+ void AddThreadLifecycleCallback(ThreadLifecycleCallback* cb) REQUIRES(Locks::mutator_lock_);
+ void RemoveThreadLifecycleCallback(ThreadLifecycleCallback* cb) REQUIRES(Locks::mutator_lock_);
+
+ void ThreadStart(Thread* self) REQUIRES_SHARED(Locks::mutator_lock_);
+ void ThreadDeath(Thread* self) REQUIRES_SHARED(Locks::mutator_lock_);
+
+ void AddClassLoadCallback(ClassLoadCallback* cb) REQUIRES(Locks::mutator_lock_);
+ void RemoveClassLoadCallback(ClassLoadCallback* cb) REQUIRES(Locks::mutator_lock_);
+
+ void ClassLoad(Handle<mirror::Class> klass) REQUIRES_SHARED(Locks::mutator_lock_);
+ void ClassPrepare(Handle<mirror::Class> temp_klass, Handle<mirror::Class> klass)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
+ void AddRuntimeSigQuitCallback(RuntimeSigQuitCallback* cb)
+ REQUIRES(Locks::mutator_lock_);
+ void RemoveRuntimeSigQuitCallback(RuntimeSigQuitCallback* cb)
+ REQUIRES(Locks::mutator_lock_);
+
+ void SigQuit() REQUIRES_SHARED(Locks::mutator_lock_);
+
+ void AddRuntimePhaseCallback(RuntimePhaseCallback* cb)
+ REQUIRES(Locks::mutator_lock_);
+ void RemoveRuntimePhaseCallback(RuntimePhaseCallback* cb)
+ REQUIRES(Locks::mutator_lock_);
+
+ void NextRuntimePhase(RuntimePhaseCallback::RuntimePhase phase)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
+ private:
+ std::vector<ThreadLifecycleCallback*> thread_callbacks_
+ GUARDED_BY(Locks::mutator_lock_);
+ std::vector<ClassLoadCallback*> class_callbacks_
+ GUARDED_BY(Locks::mutator_lock_);
+ std::vector<RuntimeSigQuitCallback*> sigquit_callbacks_
+ GUARDED_BY(Locks::mutator_lock_);
+ std::vector<RuntimePhaseCallback*> phase_callbacks_
+ GUARDED_BY(Locks::mutator_lock_);
+};
+
+} // namespace art
+
+#endif // ART_RUNTIME_RUNTIME_CALLBACKS_H_
diff --git a/runtime/runtime_callbacks_test.cc b/runtime/runtime_callbacks_test.cc
new file mode 100644
index 0000000000..8974b595de
--- /dev/null
+++ b/runtime/runtime_callbacks_test.cc
@@ -0,0 +1,410 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "runtime_callbacks.h"
+
+#include "jni.h"
+#include <signal.h>
+#include <sys/types.h>
+#include <unistd.h>
+
+#include <initializer_list>
+#include <memory>
+#include <string>
+
+#include "art_method-inl.h"
+#include "base/mutex.h"
+#include "class_linker.h"
+#include "common_runtime_test.h"
+#include "handle.h"
+#include "handle_scope-inl.h"
+#include "mem_map.h"
+#include "mirror/class-inl.h"
+#include "mirror/class_loader.h"
+#include "obj_ptr.h"
+#include "runtime.h"
+#include "scoped_thread_state_change-inl.h"
+#include "ScopedLocalRef.h"
+#include "thread-inl.h"
+#include "thread_list.h"
+#include "well_known_classes.h"
+
+namespace art {
+
+class RuntimeCallbacksTest : public CommonRuntimeTest {
+ protected:
+ void SetUp() OVERRIDE {
+ CommonRuntimeTest::SetUp();
+
+ Thread* self = Thread::Current();
+ ScopedObjectAccess soa(self);
+ ScopedThreadSuspension sts(self, kWaitingForDebuggerToAttach);
+ ScopedSuspendAll ssa("RuntimeCallbacksTest SetUp");
+ AddListener();
+ }
+
+ void TearDown() OVERRIDE {
+ {
+ Thread* self = Thread::Current();
+ ScopedObjectAccess soa(self);
+ ScopedThreadSuspension sts(self, kWaitingForDebuggerToAttach);
+ ScopedSuspendAll ssa("RuntimeCallbacksTest TearDown");
+ RemoveListener();
+ }
+
+ CommonRuntimeTest::TearDown();
+ }
+
+ virtual void AddListener() REQUIRES(Locks::mutator_lock_) = 0;
+ virtual void RemoveListener() REQUIRES(Locks::mutator_lock_) = 0;
+
+ void MakeExecutable(ObjPtr<mirror::Class> klass) REQUIRES_SHARED(Locks::mutator_lock_) {
+ CHECK(klass != nullptr);
+ PointerSize pointer_size = class_linker_->GetImagePointerSize();
+ for (auto& m : klass->GetMethods(pointer_size)) {
+ if (!m.IsAbstract()) {
+ class_linker_->SetEntryPointsToInterpreter(&m);
+ }
+ }
+ }
+};
+
+class ThreadLifecycleCallbackRuntimeCallbacksTest : public RuntimeCallbacksTest {
+ public:
+ static void* PthreadsCallback(void* arg ATTRIBUTE_UNUSED) {
+ // Attach.
+ Runtime* runtime = Runtime::Current();
+ CHECK(runtime->AttachCurrentThread("ThreadLifecycle test thread", true, nullptr, false));
+
+ // Detach.
+ runtime->DetachCurrentThread();
+
+ // Die...
+ return nullptr;
+ }
+
+ protected:
+ void AddListener() OVERRIDE REQUIRES(Locks::mutator_lock_) {
+ Runtime::Current()->GetRuntimeCallbacks()->AddThreadLifecycleCallback(&cb_);
+ }
+ void RemoveListener() OVERRIDE REQUIRES(Locks::mutator_lock_) {
+ Runtime::Current()->GetRuntimeCallbacks()->RemoveThreadLifecycleCallback(&cb_);
+ }
+
+ enum CallbackState {
+ kBase,
+ kStarted,
+ kDied,
+ kWrongStart,
+ kWrongDeath,
+ };
+
+ struct Callback : public ThreadLifecycleCallback {
+ void ThreadStart(Thread* self) OVERRIDE {
+ if (state == CallbackState::kBase) {
+ state = CallbackState::kStarted;
+ stored_self = self;
+ } else {
+ state = CallbackState::kWrongStart;
+ }
+ }
+
+ void ThreadDeath(Thread* self) OVERRIDE {
+ if (state == CallbackState::kStarted && self == stored_self) {
+ state = CallbackState::kDied;
+ } else {
+ state = CallbackState::kWrongDeath;
+ }
+ }
+
+ Thread* stored_self;
+ CallbackState state = CallbackState::kBase;
+ };
+
+ Callback cb_;
+};
+
+TEST_F(ThreadLifecycleCallbackRuntimeCallbacksTest, ThreadLifecycleCallbackJava) {
+ Thread* self = Thread::Current();
+
+ self->TransitionFromSuspendedToRunnable();
+ bool started = runtime_->Start();
+ ASSERT_TRUE(started);
+
+ cb_.state = CallbackState::kBase; // Ignore main thread attach.
+
+ {
+ ScopedObjectAccess soa(self);
+ MakeExecutable(soa.Decode<mirror::Class>(WellKnownClasses::java_lang_Thread));
+ }
+
+ JNIEnv* env = self->GetJniEnv();
+
+ ScopedLocalRef<jobject> thread_name(env,
+ env->NewStringUTF("ThreadLifecycleCallback test thread"));
+ ASSERT_TRUE(thread_name.get() != nullptr);
+
+ ScopedLocalRef<jobject> thread(env, env->AllocObject(WellKnownClasses::java_lang_Thread));
+ ASSERT_TRUE(thread.get() != nullptr);
+
+ env->CallNonvirtualVoidMethod(thread.get(),
+ WellKnownClasses::java_lang_Thread,
+ WellKnownClasses::java_lang_Thread_init,
+ runtime_->GetMainThreadGroup(),
+ thread_name.get(),
+ kMinThreadPriority,
+ JNI_FALSE);
+ ASSERT_FALSE(env->ExceptionCheck());
+
+ jmethodID start_id = env->GetMethodID(WellKnownClasses::java_lang_Thread, "start", "()V");
+ ASSERT_TRUE(start_id != nullptr);
+
+ env->CallVoidMethod(thread.get(), start_id);
+ ASSERT_FALSE(env->ExceptionCheck());
+
+ jmethodID join_id = env->GetMethodID(WellKnownClasses::java_lang_Thread, "join", "()V");
+ ASSERT_TRUE(join_id != nullptr);
+
+ env->CallVoidMethod(thread.get(), join_id);
+ ASSERT_FALSE(env->ExceptionCheck());
+
+ EXPECT_TRUE(cb_.state == CallbackState::kDied) << static_cast<int>(cb_.state);
+}
+
+TEST_F(ThreadLifecycleCallbackRuntimeCallbacksTest, ThreadLifecycleCallbackAttach) {
+ std::string error_msg;
+ std::unique_ptr<MemMap> stack(MemMap::MapAnonymous("ThreadLifecycleCallback Thread",
+ nullptr,
+ 128 * kPageSize, // Just some small stack.
+ PROT_READ | PROT_WRITE,
+ false,
+ false,
+ &error_msg));
+ ASSERT_FALSE(stack == nullptr) << error_msg;
+
+ const char* reason = "ThreadLifecycleCallback test thread";
+ pthread_attr_t attr;
+ CHECK_PTHREAD_CALL(pthread_attr_init, (&attr), reason);
+ CHECK_PTHREAD_CALL(pthread_attr_setstack, (&attr, stack->Begin(), stack->Size()), reason);
+ pthread_t pthread;
+ CHECK_PTHREAD_CALL(pthread_create,
+ (&pthread,
+ &attr,
+ &ThreadLifecycleCallbackRuntimeCallbacksTest::PthreadsCallback,
+ this),
+ reason);
+ CHECK_PTHREAD_CALL(pthread_attr_destroy, (&attr), reason);
+
+ CHECK_PTHREAD_CALL(pthread_join, (pthread, nullptr), "ThreadLifecycleCallback test shutdown");
+
+ // Detach is not a ThreadDeath event, so we expect to be in state Started.
+ EXPECT_TRUE(cb_.state == CallbackState::kStarted) << static_cast<int>(cb_.state);
+}
+
+class ClassLoadCallbackRuntimeCallbacksTest : public RuntimeCallbacksTest {
+ protected:
+ void AddListener() OVERRIDE REQUIRES(Locks::mutator_lock_) {
+ Runtime::Current()->GetRuntimeCallbacks()->AddClassLoadCallback(&cb_);
+ }
+ void RemoveListener() OVERRIDE REQUIRES(Locks::mutator_lock_) {
+ Runtime::Current()->GetRuntimeCallbacks()->RemoveClassLoadCallback(&cb_);
+ }
+
+ bool Expect(std::initializer_list<const char*> list) {
+ if (cb_.data.size() != list.size()) {
+ PrintError(list);
+ return false;
+ }
+
+ if (!std::equal(cb_.data.begin(), cb_.data.end(), list.begin())) {
+ PrintError(list);
+ return false;
+ }
+
+ return true;
+ }
+
+ void PrintError(std::initializer_list<const char*> list) {
+ LOG(ERROR) << "Expected:";
+ for (const char* expected : list) {
+ LOG(ERROR) << " " << expected;
+ }
+ LOG(ERROR) << "Found:";
+ for (const auto& s : cb_.data) {
+ LOG(ERROR) << " " << s;
+ }
+ }
+
+ struct Callback : public ClassLoadCallback {
+ void ClassLoad(Handle<mirror::Class> klass) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_) {
+ std::string tmp;
+ std::string event = std::string("Load:") + klass->GetDescriptor(&tmp);
+ data.push_back(event);
+ }
+
+ void ClassPrepare(Handle<mirror::Class> temp_klass,
+ Handle<mirror::Class> klass) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_) {
+ std::string tmp, tmp2;
+ std::string event = std::string("Prepare:") + klass->GetDescriptor(&tmp)
+ + "[" + temp_klass->GetDescriptor(&tmp2) + "]";
+ data.push_back(event);
+ }
+
+ std::vector<std::string> data;
+ };
+
+ Callback cb_;
+};
+
+TEST_F(ClassLoadCallbackRuntimeCallbacksTest, ClassLoadCallback) {
+ ScopedObjectAccess soa(Thread::Current());
+ jobject jclass_loader = LoadDex("XandY");
+ VariableSizedHandleScope hs(soa.Self());
+ Handle<mirror::ClassLoader> class_loader(hs.NewHandle(
+ soa.Decode<mirror::ClassLoader>(jclass_loader)));
+
+ const char* descriptor_y = "LY;";
+ Handle<mirror::Class> h_Y(
+ hs.NewHandle(class_linker_->FindClass(soa.Self(), descriptor_y, class_loader)));
+ ASSERT_TRUE(h_Y.Get() != nullptr);
+
+ bool expect1 = Expect({ "Load:LX;", "Prepare:LX;[LX;]", "Load:LY;", "Prepare:LY;[LY;]" });
+ EXPECT_TRUE(expect1);
+
+ cb_.data.clear();
+
+ ASSERT_TRUE(class_linker_->EnsureInitialized(Thread::Current(), h_Y, true, true));
+
+ bool expect2 = Expect({ "Load:LY$Z;", "Prepare:LY$Z;[LY$Z;]" });
+ EXPECT_TRUE(expect2);
+}
+
+class RuntimeSigQuitCallbackRuntimeCallbacksTest : public RuntimeCallbacksTest {
+ protected:
+ void AddListener() OVERRIDE REQUIRES(Locks::mutator_lock_) {
+ Runtime::Current()->GetRuntimeCallbacks()->AddRuntimeSigQuitCallback(&cb_);
+ }
+ void RemoveListener() OVERRIDE REQUIRES(Locks::mutator_lock_) {
+ Runtime::Current()->GetRuntimeCallbacks()->RemoveRuntimeSigQuitCallback(&cb_);
+ }
+
+ struct Callback : public RuntimeSigQuitCallback {
+ void SigQuit() OVERRIDE {
+ ++sigquit_count;
+ }
+
+ size_t sigquit_count = 0;
+ };
+
+ Callback cb_;
+};
+
+TEST_F(RuntimeSigQuitCallbackRuntimeCallbacksTest, SigQuit) {
+ // The runtime needs to be started for the signal handler.
+ Thread* self = Thread::Current();
+
+ self->TransitionFromSuspendedToRunnable();
+ bool started = runtime_->Start();
+ ASSERT_TRUE(started);
+
+ EXPECT_EQ(0u, cb_.sigquit_count);
+
+ kill(getpid(), SIGQUIT);
+
+ // Try a few times.
+ for (size_t i = 0; i != 30; ++i) {
+ if (cb_.sigquit_count == 0) {
+ sleep(1);
+ } else {
+ break;
+ }
+ }
+ EXPECT_EQ(1u, cb_.sigquit_count);
+}
+
+class RuntimePhaseCallbackRuntimeCallbacksTest : public RuntimeCallbacksTest {
+ protected:
+ void AddListener() OVERRIDE REQUIRES(Locks::mutator_lock_) {
+ Runtime::Current()->GetRuntimeCallbacks()->AddRuntimePhaseCallback(&cb_);
+ }
+ void RemoveListener() OVERRIDE REQUIRES(Locks::mutator_lock_) {
+ Runtime::Current()->GetRuntimeCallbacks()->RemoveRuntimePhaseCallback(&cb_);
+ }
+
+ void TearDown() OVERRIDE {
+ // Bypass RuntimeCallbacksTest::TearDown, as the runtime is already gone.
+ CommonRuntimeTest::TearDown();
+ }
+
+ struct Callback : public RuntimePhaseCallback {
+ void NextRuntimePhase(RuntimePhaseCallback::RuntimePhase p) OVERRIDE {
+ if (p == RuntimePhaseCallback::RuntimePhase::kInitialAgents) {
+ if (start_seen > 0 || init_seen > 0 || death_seen > 0) {
+ LOG(FATAL) << "Unexpected order";
+ }
+ ++initial_agents_seen;
+ } else if (p == RuntimePhaseCallback::RuntimePhase::kStart) {
+ if (init_seen > 0 || death_seen > 0) {
+ LOG(FATAL) << "Init seen before start.";
+ }
+ ++start_seen;
+ } else if (p == RuntimePhaseCallback::RuntimePhase::kInit) {
+ ++init_seen;
+ } else if (p == RuntimePhaseCallback::RuntimePhase::kDeath) {
+ ++death_seen;
+ } else {
+ LOG(FATAL) << "Unknown phase " << static_cast<uint32_t>(p);
+ }
+ }
+
+ size_t initial_agents_seen = 0;
+ size_t start_seen = 0;
+ size_t init_seen = 0;
+ size_t death_seen = 0;
+ };
+
+ Callback cb_;
+};
+
+TEST_F(RuntimePhaseCallbackRuntimeCallbacksTest, Phases) {
+ ASSERT_EQ(0u, cb_.initial_agents_seen);
+ ASSERT_EQ(0u, cb_.start_seen);
+ ASSERT_EQ(0u, cb_.init_seen);
+ ASSERT_EQ(0u, cb_.death_seen);
+
+ // Start the runtime.
+ {
+ Thread* self = Thread::Current();
+ self->TransitionFromSuspendedToRunnable();
+ bool started = runtime_->Start();
+ ASSERT_TRUE(started);
+ }
+
+ ASSERT_EQ(0u, cb_.initial_agents_seen);
+ ASSERT_EQ(1u, cb_.start_seen);
+ ASSERT_EQ(1u, cb_.init_seen);
+ ASSERT_EQ(0u, cb_.death_seen);
+
+ // Delete the runtime.
+ runtime_.reset();
+
+ ASSERT_EQ(0u, cb_.initial_agents_seen);
+ ASSERT_EQ(1u, cb_.start_seen);
+ ASSERT_EQ(1u, cb_.init_seen);
+ ASSERT_EQ(1u, cb_.death_seen);
+}
+
+} // namespace art
diff --git a/runtime/runtime_options.def b/runtime/runtime_options.def
index d1970fe7a2..ecabf9adc5 100644
--- a/runtime/runtime_options.def
+++ b/runtime/runtime_options.def
@@ -117,7 +117,7 @@ RUNTIME_OPTIONS_KEY (unsigned int, ZygoteMaxFailedBoots, 10)
RUNTIME_OPTIONS_KEY (Unit, NoDexFileFallback)
RUNTIME_OPTIONS_KEY (std::string, CpuAbiList)
RUNTIME_OPTIONS_KEY (std::string, Fingerprint)
-RUNTIME_OPTIONS_KEY (ExperimentalFlags, Experimental, ExperimentalFlags::kNone) // -Xexperimental:{none, agents, method-handles}
+RUNTIME_OPTIONS_KEY (ExperimentalFlags, Experimental, ExperimentalFlags::kNone) // -Xexperimental:{none, agents}
RUNTIME_OPTIONS_KEY (std::vector<ti::Agent>, AgentLib) // -agentlib:<libname>=<options>, Requires -Xexperimental:agents
RUNTIME_OPTIONS_KEY (std::vector<ti::Agent>, AgentPath) // -agentpath:<libname>=<options>, Requires -Xexperimental:agents
RUNTIME_OPTIONS_KEY (std::vector<Plugin>, Plugins) // -Xplugin:<library> Requires -Xexperimental:runtime-plugins
diff --git a/runtime/stack_map.cc b/runtime/stack_map.cc
index a7e7c21a42..9ebf9a7bdd 100644
--- a/runtime/stack_map.cc
+++ b/runtime/stack_map.cc
@@ -18,8 +18,9 @@
#include <stdint.h>
+#include "art_method.h"
#include "indenter.h"
-#include "invoke_type.h"
+#include "scoped_thread_state_change-inl.h"
namespace art {
@@ -106,7 +107,7 @@ void InlineInfoEncoding::Dump(VariableIndentationOutputStream* vios) const {
<< "InlineInfoEncoding"
<< " (method_index_bit_offset=" << static_cast<uint32_t>(kMethodIndexBitOffset)
<< ", dex_pc_bit_offset=" << static_cast<uint32_t>(dex_pc_bit_offset_)
- << ", invoke_type_bit_offset=" << static_cast<uint32_t>(invoke_type_bit_offset_)
+ << ", extra_data_bit_offset=" << static_cast<uint32_t>(extra_data_bit_offset_)
<< ", dex_register_map_bit_offset=" << static_cast<uint32_t>(dex_register_map_bit_offset_)
<< ", total_bit_size=" << static_cast<uint32_t>(total_bit_size_)
<< ")\n";
@@ -230,12 +231,16 @@ void InlineInfo::Dump(VariableIndentationOutputStream* vios,
vios->Stream()
<< " At depth " << i
<< std::hex
- << " (dex_pc=0x" << GetDexPcAtDepth(inline_info_encoding, i)
- << std::dec
- << ", method_index=" << GetMethodIndexAtDepth(inline_info_encoding, i)
- << ", invoke_type=" << static_cast<InvokeType>(GetInvokeTypeAtDepth(inline_info_encoding,
- i))
- << ")\n";
+ << " (dex_pc=0x" << GetDexPcAtDepth(inline_info_encoding, i);
+ if (EncodesArtMethodAtDepth(inline_info_encoding, i)) {
+ ScopedObjectAccess soa(Thread::Current());
+ vios->Stream() << ", method=" << GetArtMethodAtDepth(inline_info_encoding, i)->PrettyMethod();
+ } else {
+ vios->Stream()
+ << std::dec
+ << ", method_index=" << GetMethodIndexAtDepth(inline_info_encoding, i);
+ }
+ vios->Stream() << ")\n";
if (HasDexRegisterMapAtDepth(inline_info_encoding, i) && (number_of_dex_registers != nullptr)) {
CodeInfoEncoding encoding = code_info.ExtractEncoding();
DexRegisterMap dex_register_map =
diff --git a/runtime/stack_map.h b/runtime/stack_map.h
index 5e556be286..13886f2109 100644
--- a/runtime/stack_map.h
+++ b/runtime/stack_map.h
@@ -35,6 +35,7 @@ static constexpr ssize_t kFrameSlotSize = 4;
// Size of Dex virtual registers.
static constexpr size_t kVRegSize = 4;
+class ArtMethod;
class CodeInfo;
class StackMapEncoding;
struct CodeInfoEncoding;
@@ -887,7 +888,7 @@ class InlineInfoEncoding {
public:
void SetFromSizes(size_t method_index_max,
size_t dex_pc_max,
- size_t invoke_type_max,
+ size_t extra_data_max,
size_t dex_register_map_size) {
total_bit_size_ = kMethodIndexBitOffset;
total_bit_size_ += MinimumBitsToStore(method_index_max);
@@ -899,8 +900,8 @@ class InlineInfoEncoding {
total_bit_size_ += MinimumBitsToStore(1 /* kNoDexPc */ + dex_pc_max);
}
- invoke_type_bit_offset_ = dchecked_integral_cast<uint8_t>(total_bit_size_);
- total_bit_size_ += MinimumBitsToStore(invoke_type_max);
+ extra_data_bit_offset_ = dchecked_integral_cast<uint8_t>(total_bit_size_);
+ total_bit_size_ += MinimumBitsToStore(extra_data_max);
// We also need +1 for kNoDexRegisterMap, but since the size is strictly
// greater than any offset we might try to encode, we already implicitly have it.
@@ -912,10 +913,10 @@ class InlineInfoEncoding {
return FieldEncoding(kMethodIndexBitOffset, dex_pc_bit_offset_);
}
ALWAYS_INLINE FieldEncoding GetDexPcEncoding() const {
- return FieldEncoding(dex_pc_bit_offset_, invoke_type_bit_offset_, -1 /* min_value */);
+ return FieldEncoding(dex_pc_bit_offset_, extra_data_bit_offset_, -1 /* min_value */);
}
- ALWAYS_INLINE FieldEncoding GetInvokeTypeEncoding() const {
- return FieldEncoding(invoke_type_bit_offset_, dex_register_map_bit_offset_);
+ ALWAYS_INLINE FieldEncoding GetExtraDataEncoding() const {
+ return FieldEncoding(extra_data_bit_offset_, dex_register_map_bit_offset_);
}
ALWAYS_INLINE FieldEncoding GetDexRegisterMapEncoding() const {
return FieldEncoding(dex_register_map_bit_offset_, total_bit_size_, -1 /* min_value */);
@@ -930,7 +931,7 @@ class InlineInfoEncoding {
static constexpr uint8_t kIsLastBitOffset = 0;
static constexpr uint8_t kMethodIndexBitOffset = 1;
uint8_t dex_pc_bit_offset_;
- uint8_t invoke_type_bit_offset_;
+ uint8_t extra_data_bit_offset_;
uint8_t dex_register_map_bit_offset_;
uint8_t total_bit_size_;
};
@@ -938,7 +939,11 @@ class InlineInfoEncoding {
/**
* Inline information for a specific PC. The information is of the form:
*
- * [is_last, method_index, dex_pc, invoke_type, dex_register_map_offset]+.
+ * [is_last,
+ * method_index (or ArtMethod high bits),
+ * dex_pc,
+ * extra_data (ArtMethod low bits or 1),
+ * dex_register_map_offset]+.
*/
class InlineInfo {
public:
@@ -960,6 +965,7 @@ class InlineInfo {
ALWAYS_INLINE uint32_t GetMethodIndexAtDepth(const InlineInfoEncoding& encoding,
uint32_t depth) const {
+ DCHECK(!EncodesArtMethodAtDepth(encoding, depth));
return encoding.GetMethodIndexEncoding().Load(GetRegionAtDepth(encoding, depth));
}
@@ -980,15 +986,28 @@ class InlineInfo {
encoding.GetDexPcEncoding().Store(GetRegionAtDepth(encoding, depth), dex_pc);
}
- ALWAYS_INLINE uint32_t GetInvokeTypeAtDepth(const InlineInfoEncoding& encoding,
- uint32_t depth) const {
- return encoding.GetInvokeTypeEncoding().Load(GetRegionAtDepth(encoding, depth));
+ ALWAYS_INLINE bool EncodesArtMethodAtDepth(const InlineInfoEncoding& encoding,
+ uint32_t depth) const {
+ return (encoding.GetExtraDataEncoding().Load(GetRegionAtDepth(encoding, depth)) & 1) == 0;
+ }
+
+ ALWAYS_INLINE void SetExtraDataAtDepth(const InlineInfoEncoding& encoding,
+ uint32_t depth,
+ uint32_t extra_data) {
+ encoding.GetExtraDataEncoding().Store(GetRegionAtDepth(encoding, depth), extra_data);
}
- ALWAYS_INLINE void SetInvokeTypeAtDepth(const InlineInfoEncoding& encoding,
- uint32_t depth,
- uint32_t invoke_type) {
- encoding.GetInvokeTypeEncoding().Store(GetRegionAtDepth(encoding, depth), invoke_type);
+ ALWAYS_INLINE ArtMethod* GetArtMethodAtDepth(const InlineInfoEncoding& encoding,
+ uint32_t depth) const {
+ uint32_t low_bits = encoding.GetExtraDataEncoding().Load(GetRegionAtDepth(encoding, depth));
+ uint32_t high_bits = encoding.GetMethodIndexEncoding().Load(GetRegionAtDepth(encoding, depth));
+ if (high_bits == 0) {
+ return reinterpret_cast<ArtMethod*>(low_bits);
+ } else {
+ uint64_t address = high_bits;
+ address = address << 32;
+ return reinterpret_cast<ArtMethod*>(address | low_bits);
+ }
}
ALWAYS_INLINE uint32_t GetDexRegisterMapOffsetAtDepth(const InlineInfoEncoding& encoding,
@@ -1108,7 +1127,7 @@ class CodeInfo {
GetDexRegisterLocationCatalogSize(encoding)));
}
- StackMap GetStackMapAt(size_t i, const CodeInfoEncoding& encoding) const {
+ ALWAYS_INLINE StackMap GetStackMapAt(size_t i, const CodeInfoEncoding& encoding) const {
size_t stack_map_size = encoding.stack_map_size_in_bytes;
return StackMap(GetStackMaps(encoding).Subregion(i * stack_map_size, stack_map_size));
}
@@ -1269,7 +1288,7 @@ class CodeInfo {
}
private:
- MemoryRegion GetStackMaps(const CodeInfoEncoding& encoding) const {
+ ALWAYS_INLINE MemoryRegion GetStackMaps(const CodeInfoEncoding& encoding) const {
return region_.size() == 0
? MemoryRegion()
: region_.Subregion(GetStackMapsOffset(encoding), GetStackMapsSize(encoding));
diff --git a/runtime/thread.cc b/runtime/thread.cc
index bdd4ca6721..d93eab10a0 100644
--- a/runtime/thread.cc
+++ b/runtime/thread.cc
@@ -67,6 +67,7 @@
#include "quick/quick_method_frame_info.h"
#include "reflection.h"
#include "runtime.h"
+#include "runtime_callbacks.h"
#include "scoped_thread_state_change-inl.h"
#include "ScopedLocalRef.h"
#include "ScopedUtfChars.h"
@@ -431,7 +432,8 @@ void* Thread::CreateCallback(void* arg) {
ArtField* priorityField = jni::DecodeArtField(WellKnownClasses::java_lang_Thread_priority);
self->SetNativePriority(priorityField->GetInt(self->tlsPtr_.opeer));
- Dbg::PostThreadStart(self);
+
+ runtime->GetRuntimeCallbacks()->ThreadStart(self);
// Invoke the 'run' method of our java.lang.Thread.
ObjPtr<mirror::Object> receiver = self->tlsPtr_.opeer;
@@ -723,8 +725,8 @@ bool Thread::Init(ThreadList* thread_list, JavaVMExt* java_vm, JNIEnvExt* jni_en
return true;
}
-Thread* Thread::Attach(const char* thread_name, bool as_daemon, jobject thread_group,
- bool create_peer) {
+template <typename PeerAction>
+Thread* Thread::Attach(const char* thread_name, bool as_daemon, PeerAction peer_action) {
Runtime* runtime = Runtime::Current();
if (runtime == nullptr) {
LOG(ERROR) << "Thread attaching to non-existent runtime: " << thread_name;
@@ -753,32 +755,11 @@ Thread* Thread::Attach(const char* thread_name, bool as_daemon, jobject thread_g
CHECK_NE(self->GetState(), kRunnable);
self->SetState(kNative);
- // If we're the main thread, ClassLinker won't be created until after we're attached,
- // so that thread needs a two-stage attach. Regular threads don't need this hack.
- // In the compiler, all threads need this hack, because no-one's going to be getting
- // a native peer!
- if (create_peer) {
- self->CreatePeer(thread_name, as_daemon, thread_group);
- if (self->IsExceptionPending()) {
- // We cannot keep the exception around, as we're deleting self. Try to be helpful and log it.
- {
- ScopedObjectAccess soa(self);
- LOG(ERROR) << "Exception creating thread peer:";
- LOG(ERROR) << self->GetException()->Dump();
- self->ClearException();
- }
- runtime->GetThreadList()->Unregister(self);
- // Unregister deletes self, no need to do this here.
- return nullptr;
- }
- } else {
- // These aren't necessary, but they improve diagnostics for unit tests & command-line tools.
- if (thread_name != nullptr) {
- self->tlsPtr_.name->assign(thread_name);
- ::art::SetThreadName(thread_name);
- } else if (self->GetJniEnv()->check_jni) {
- LOG(WARNING) << *Thread::Current() << " attached without supplying a name";
- }
+ // Run the action that is acting on the peer.
+ if (!peer_action(self)) {
+ runtime->GetThreadList()->Unregister(self);
+ // Unregister deletes self, no need to do this here.
+ return nullptr;
}
if (VLOG_IS_ON(threads)) {
@@ -793,12 +774,63 @@ Thread* Thread::Attach(const char* thread_name, bool as_daemon, jobject thread_g
{
ScopedObjectAccess soa(self);
- Dbg::PostThreadStart(self);
+ runtime->GetRuntimeCallbacks()->ThreadStart(self);
}
return self;
}
+Thread* Thread::Attach(const char* thread_name,
+ bool as_daemon,
+ jobject thread_group,
+ bool create_peer) {
+ auto create_peer_action = [&](Thread* self) {
+ // If we're the main thread, ClassLinker won't be created until after we're attached,
+ // so that thread needs a two-stage attach. Regular threads don't need this hack.
+ // In the compiler, all threads need this hack, because no-one's going to be getting
+ // a native peer!
+ if (create_peer) {
+ self->CreatePeer(thread_name, as_daemon, thread_group);
+ if (self->IsExceptionPending()) {
+ // We cannot keep the exception around, as we're deleting self. Try to be helpful and log it.
+ {
+ ScopedObjectAccess soa(self);
+ LOG(ERROR) << "Exception creating thread peer:";
+ LOG(ERROR) << self->GetException()->Dump();
+ self->ClearException();
+ }
+ return false;
+ }
+ } else {
+ // These aren't necessary, but they improve diagnostics for unit tests & command-line tools.
+ if (thread_name != nullptr) {
+ self->tlsPtr_.name->assign(thread_name);
+ ::art::SetThreadName(thread_name);
+ } else if (self->GetJniEnv()->check_jni) {
+ LOG(WARNING) << *Thread::Current() << " attached without supplying a name";
+ }
+ }
+ return true;
+ };
+ return Attach(thread_name, as_daemon, create_peer_action);
+}
+
+Thread* Thread::Attach(const char* thread_name, bool as_daemon, jobject thread_peer) {
+ auto set_peer_action = [&](Thread* self) {
+ // Install the given peer.
+ {
+ DCHECK(self == Thread::Current());
+ ScopedObjectAccess soa(self);
+ self->tlsPtr_.opeer = soa.Decode<mirror::Object>(thread_peer).Ptr();
+ }
+ self->GetJniEnv()->SetLongField(thread_peer,
+ WellKnownClasses::java_lang_Thread_nativePeer,
+ reinterpret_cast<jlong>(self));
+ return true;
+ };
+ return Attach(thread_name, as_daemon, set_peer_action);
+}
+
void Thread::CreatePeer(const char* name, bool as_daemon, jobject thread_group) {
Runtime* runtime = Runtime::Current();
CHECK(runtime->IsStarted());
@@ -1929,7 +1961,11 @@ void Thread::Destroy() {
jni::DecodeArtField(WellKnownClasses::java_lang_Thread_nativePeer)
->SetLong<false>(tlsPtr_.opeer, 0);
}
- Dbg::PostThreadDeath(self);
+ Runtime* runtime = Runtime::Current();
+ if (runtime != nullptr) {
+ runtime->GetRuntimeCallbacks()->ThreadDeath(self);
+ }
+
// Thread.join() is implemented as an Object.wait() on the Thread.lock object. Signal anyone
// who is waiting.
@@ -2626,14 +2662,10 @@ void Thread::DumpThreadOffset(std::ostream& os, uint32_t offset) {
os << #x; \
return; \
}
- QUICK_ENTRY_POINT_INFO(pAllocArray)
QUICK_ENTRY_POINT_INFO(pAllocArrayResolved)
- QUICK_ENTRY_POINT_INFO(pAllocArrayWithAccessCheck)
QUICK_ENTRY_POINT_INFO(pAllocObjectResolved)
QUICK_ENTRY_POINT_INFO(pAllocObjectInitialized)
QUICK_ENTRY_POINT_INFO(pAllocObjectWithChecks)
- QUICK_ENTRY_POINT_INFO(pCheckAndAllocArray)
- QUICK_ENTRY_POINT_INFO(pCheckAndAllocArrayWithAccessCheck)
QUICK_ENTRY_POINT_INFO(pAllocStringFromBytes)
QUICK_ENTRY_POINT_INFO(pAllocStringFromChars)
QUICK_ENTRY_POINT_INFO(pAllocStringFromString)
@@ -2667,10 +2699,7 @@ void Thread::DumpThreadOffset(std::ostream& os, uint32_t offset) {
QUICK_ENTRY_POINT_INFO(pGet64Static)
QUICK_ENTRY_POINT_INFO(pGetObjInstance)
QUICK_ENTRY_POINT_INFO(pGetObjStatic)
- QUICK_ENTRY_POINT_INFO(pAputObjectWithNullAndBoundCheck)
- QUICK_ENTRY_POINT_INFO(pAputObjectWithBoundCheck)
QUICK_ENTRY_POINT_INFO(pAputObject)
- QUICK_ENTRY_POINT_INFO(pHandleFillArrayData)
QUICK_ENTRY_POINT_INFO(pJniMethodStart)
QUICK_ENTRY_POINT_INFO(pJniMethodStartSynchronized)
QUICK_ENTRY_POINT_INFO(pJniMethodEnd)
@@ -2727,6 +2756,7 @@ void Thread::DumpThreadOffset(std::ostream& os, uint32_t offset) {
QUICK_ENTRY_POINT_INFO(pInvokeStaticTrampolineWithAccessCheck)
QUICK_ENTRY_POINT_INFO(pInvokeSuperTrampolineWithAccessCheck)
QUICK_ENTRY_POINT_INFO(pInvokeVirtualTrampolineWithAccessCheck)
+ QUICK_ENTRY_POINT_INFO(pInvokePolymorphic)
QUICK_ENTRY_POINT_INFO(pTestSuspend)
QUICK_ENTRY_POINT_INFO(pDeliverException)
QUICK_ENTRY_POINT_INFO(pThrowArrayBounds)
diff --git a/runtime/thread.h b/runtime/thread.h
index a3ef9bc0a3..b609e723e9 100644
--- a/runtime/thread.h
+++ b/runtime/thread.h
@@ -158,6 +158,8 @@ class Thread {
// Used to implement JNI AttachCurrentThread and AttachCurrentThreadAsDaemon calls.
static Thread* Attach(const char* thread_name, bool as_daemon, jobject thread_group,
bool create_peer);
+ // Attaches the calling native thread to the runtime, returning the new native peer.
+ static Thread* Attach(const char* thread_name, bool as_daemon, jobject thread_peer);
// Reset internal state of child thread after fork.
void InitAfterFork();
@@ -1140,6 +1142,14 @@ class Thread {
return debug_disallow_read_barrier_;
}
+ const void* GetCustomTLS() const {
+ return custom_tls_;
+ }
+
+ void SetCustomTLS(const void* data) {
+ custom_tls_ = data;
+ }
+
// Returns true if the current thread is the jit sensitive thread.
bool IsJitSensitiveThread() const {
return this == jit_sensitive_thread_;
@@ -1158,6 +1168,13 @@ class Thread {
~Thread() REQUIRES(!Locks::mutator_lock_, !Locks::thread_suspend_count_lock_);
void Destroy();
+ // Attaches the calling native thread to the runtime, returning the new native peer.
+ // Used to implement JNI AttachCurrentThread and AttachCurrentThreadAsDaemon calls.
+ template <typename PeerAction>
+ static Thread* Attach(const char* thread_name,
+ bool as_daemon,
+ PeerAction p);
+
void CreatePeer(const char* name, bool as_daemon, jobject thread_group);
template<bool kTransactionActive>
@@ -1537,13 +1554,9 @@ class Thread {
// to avoid additional cost of a mutex and a condition variable, as used in art::Barrier.
AtomicInteger* active_suspend_barriers[kMaxSuspendBarriers];
- // Entrypoint function pointers.
- // TODO: move this to more of a global offset table model to avoid per-thread duplication.
- JniEntryPoints jni_entrypoints;
- QuickEntryPoints quick_entrypoints;
-
// Thread-local allocation pointer. Moved here to force alignment for thread_local_pos on ARM.
uint8_t* thread_local_start;
+
// thread_local_pos and thread_local_end must be consecutive for ldrd and are 8 byte aligned for
// potentially better performance.
uint8_t* thread_local_pos;
@@ -1551,6 +1564,11 @@ class Thread {
size_t thread_local_objects;
+ // Entrypoint function pointers.
+ // TODO: move this to more of a global offset table model to avoid per-thread duplication.
+ JniEntryPoints jni_entrypoints;
+ QuickEntryPoints quick_entrypoints;
+
// Mterp jump table bases.
void* mterp_current_ibase;
void* mterp_default_ibase;
@@ -1599,6 +1617,10 @@ class Thread {
// Pending extra checkpoints if checkpoint_function_ is already used.
std::list<Closure*> checkpoint_overflow_ GUARDED_BY(Locks::thread_suspend_count_lock_);
+ // Custom TLS field that can be used by plugins.
+ // TODO: Generalize once we have more plugins.
+ const void* custom_tls_;
+
// True if the thread is allowed to call back into java (for e.g. during class resolution).
// By default this is true.
bool can_call_into_java_;
@@ -1691,6 +1713,14 @@ class ScopedTransitioningToRunnable : public ValueObject {
Thread* const self_;
};
+class ThreadLifecycleCallback {
+ public:
+ virtual ~ThreadLifecycleCallback() {}
+
+ virtual void ThreadStart(Thread* self) REQUIRES_SHARED(Locks::mutator_lock_) = 0;
+ virtual void ThreadDeath(Thread* self) REQUIRES_SHARED(Locks::mutator_lock_) = 0;
+};
+
std::ostream& operator<<(std::ostream& os, const Thread& thread);
std::ostream& operator<<(std::ostream& os, const StackedShadowFrameType& thread);
diff --git a/runtime/vdex_file.h b/runtime/vdex_file.h
index 3b114a9f10..bb9844af65 100644
--- a/runtime/vdex_file.h
+++ b/runtime/vdex_file.h
@@ -61,7 +61,7 @@ class VdexFile {
private:
static constexpr uint8_t kVdexMagic[] = { 'v', 'd', 'e', 'x' };
- static constexpr uint8_t kVdexVersion[] = { '0', '0', '1', '\0' };
+ static constexpr uint8_t kVdexVersion[] = { '0', '0', '2', '\0' }; // Handle verify-profile
uint8_t magic_[4];
uint8_t version_[4];
diff --git a/runtime/verifier/method_verifier.cc b/runtime/verifier/method_verifier.cc
index 715b237a6a..b915457557 100644
--- a/runtime/verifier/method_verifier.cc
+++ b/runtime/verifier/method_verifier.cc
@@ -2901,9 +2901,7 @@ bool MethodVerifier::CodeFlowVerifyInstruction(uint32_t* start_guess) {
ArtMethod* called_method = VerifyInvocationArgs(inst, type, is_range);
const RegType* return_type = nullptr;
if (called_method != nullptr) {
- PointerSize pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
- mirror::Class* return_type_class = called_method->GetReturnType(can_load_classes_,
- pointer_size);
+ mirror::Class* return_type_class = called_method->GetReturnType(can_load_classes_);
if (return_type_class != nullptr) {
return_type = &FromClass(called_method->GetReturnTypeDescriptor(),
return_type_class,
@@ -2946,9 +2944,7 @@ bool MethodVerifier::CodeFlowVerifyInstruction(uint32_t* start_guess) {
} else {
is_constructor = called_method->IsConstructor();
return_type_descriptor = called_method->GetReturnTypeDescriptor();
- PointerSize pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
- mirror::Class* return_type_class = called_method->GetReturnType(can_load_classes_,
- pointer_size);
+ mirror::Class* return_type_class = called_method->GetReturnType(can_load_classes_);
if (return_type_class != nullptr) {
return_type = &FromClass(return_type_descriptor,
return_type_class,
@@ -3106,19 +3102,16 @@ bool MethodVerifier::CodeFlowVerifyInstruction(uint32_t* start_guess) {
break;
}
const uint32_t proto_idx = (is_range) ? inst->VRegH_4rcc() : inst->VRegH_45cc();
- const char* descriptor =
+ const char* return_descriptor =
dex_file_->GetReturnTypeDescriptor(dex_file_->GetProtoId(proto_idx));
const RegType& return_type =
- reg_types_.FromDescriptor(GetClassLoader(), descriptor, false);
+ reg_types_.FromDescriptor(GetClassLoader(), return_descriptor, false);
if (!return_type.IsLowHalf()) {
work_line_->SetResultRegisterType(this, return_type);
} else {
work_line_->SetResultRegisterTypeWide(return_type, return_type.HighHalf(&reg_types_));
}
- // TODO(oth): remove when compiler support is available.
- Fail(VERIFY_ERROR_FORCE_INTERPRETER)
- << "invoke-polymorphic is not supported by compiler";
- have_pending_experimental_failure_ = true;
+ just_set_result = true;
break;
}
case Instruction::NEG_INT:
@@ -5136,9 +5129,7 @@ InstructionFlags* MethodVerifier::CurrentInsnFlags() {
const RegType& MethodVerifier::GetMethodReturnType() {
if (return_type_ == nullptr) {
if (mirror_method_ != nullptr) {
- PointerSize pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
- mirror::Class* return_type_class = mirror_method_->GetReturnType(can_load_classes_,
- pointer_size);
+ mirror::Class* return_type_class = mirror_method_->GetReturnType(can_load_classes_);
if (return_type_class != nullptr) {
return_type_ = &FromClass(mirror_method_->GetReturnTypeDescriptor(),
return_type_class,
diff --git a/runtime/verifier/verifier_deps.cc b/runtime/verifier/verifier_deps.cc
index 15cc566cc6..113160785c 100644
--- a/runtime/verifier/verifier_deps.cc
+++ b/runtime/verifier/verifier_deps.cc
@@ -963,20 +963,25 @@ bool VerifierDeps::VerifyFields(Handle<mirror::ClassLoader> class_loader,
// Check recorded fields are resolved the same way, have the same recorded class,
// and have the same recorded flags.
ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
- StackHandleScope<1> hs(self);
- Handle<mirror::DexCache> dex_cache(
- hs.NewHandle(class_linker->FindDexCache(self, dex_file, /* allow_failure */ false)));
for (const auto& entry : fields) {
- ArtField* field = class_linker->ResolveFieldJLS(
- dex_file, entry.GetDexFieldIndex(), dex_cache, class_loader);
-
- if (field == nullptr) {
- DCHECK(self->IsExceptionPending());
- self->ClearException();
+ const DexFile::FieldId& field_id = dex_file.GetFieldId(entry.GetDexFieldIndex());
+ StringPiece name(dex_file.StringDataByIdx(field_id.name_idx_));
+ StringPiece type(dex_file.StringDataByIdx(dex_file.GetTypeId(field_id.type_idx_).descriptor_idx_));
+ // Only use field_id.class_idx_ when the entry is unresolved, which is rare.
+ // Otherwise, we might end up resolving an application class, which is expensive.
+ std::string expected_decl_klass = entry.IsResolved()
+ ? GetStringFromId(dex_file, entry.GetDeclaringClassIndex())
+ : dex_file.StringByTypeIdx(field_id.class_idx_);
+ mirror::Class* cls = FindClassAndClearException(
+ class_linker, self, expected_decl_klass.c_str(), class_loader);
+ if (cls == nullptr) {
+ LOG(INFO) << "VerifierDeps: Could not resolve class " << expected_decl_klass;
+ return false;
}
+ DCHECK(cls->IsResolved());
+ ArtField* field = mirror::Class::FindField(self, cls, name, type);
if (entry.IsResolved()) {
- std::string expected_decl_klass = GetStringFromId(dex_file, entry.GetDeclaringClassIndex());
std::string temp;
if (field == nullptr) {
LOG(INFO) << "VerifierDeps: Could not resolve field "
@@ -1025,11 +1030,16 @@ bool VerifierDeps::VerifyMethods(Handle<mirror::ClassLoader> class_loader,
const char* name = dex_file.GetMethodName(method_id);
const Signature signature = dex_file.GetMethodSignature(method_id);
- const char* descriptor = dex_file.GetMethodDeclaringClassDescriptor(method_id);
-
- mirror::Class* cls = FindClassAndClearException(class_linker, self, descriptor, class_loader);
+ // Only use method_id.class_idx_ when the entry is unresolved, which is rare.
+ // Otherwise, we might end up resolving an application class, which is expensive.
+ std::string expected_decl_klass = entry.IsResolved()
+ ? GetStringFromId(dex_file, entry.GetDeclaringClassIndex())
+ : dex_file.StringByTypeIdx(method_id.class_idx_);
+
+ mirror::Class* cls = FindClassAndClearException(
+ class_linker, self, expected_decl_klass.c_str(), class_loader);
if (cls == nullptr) {
- LOG(INFO) << "VerifierDeps: Could not resolve class " << descriptor;
+ LOG(INFO) << "VerifierDeps: Could not resolve class " << expected_decl_klass;
return false;
}
DCHECK(cls->IsResolved());
@@ -1045,7 +1055,6 @@ bool VerifierDeps::VerifyMethods(Handle<mirror::ClassLoader> class_loader,
if (entry.IsResolved()) {
std::string temp;
- std::string expected_decl_klass = GetStringFromId(dex_file, entry.GetDeclaringClassIndex());
if (method == nullptr) {
LOG(INFO) << "VerifierDeps: Could not resolve "
<< kind
diff --git a/runtime/well_known_classes.cc b/runtime/well_known_classes.cc
index a5b275cc3b..507ea165e5 100644
--- a/runtime/well_known_classes.cc
+++ b/runtime/well_known_classes.cc
@@ -103,6 +103,7 @@ jmethodID WellKnownClasses::java_lang_reflect_Parameter_init;
jmethodID WellKnownClasses::java_lang_reflect_Proxy_invoke;
jmethodID WellKnownClasses::java_lang_Runtime_nativeLoad;
jmethodID WellKnownClasses::java_lang_Short_valueOf;
+jmethodID WellKnownClasses::java_lang_String_charAt;
jmethodID WellKnownClasses::java_lang_System_runFinalization = nullptr;
jmethodID WellKnownClasses::java_lang_Thread_dispatchUncaughtException;
jmethodID WellKnownClasses::java_lang_Thread_init;
@@ -337,6 +338,7 @@ void WellKnownClasses::Init(JNIEnv* env) {
java_lang_ref_ReferenceQueue_add = CacheMethod(env, java_lang_ref_ReferenceQueue.get(), true, "add", "(Ljava/lang/ref/Reference;)V");
java_lang_reflect_Parameter_init = CacheMethod(env, java_lang_reflect_Parameter, false, "<init>", "(Ljava/lang/String;ILjava/lang/reflect/Executable;I)V");
+ java_lang_String_charAt = CacheMethod(env, java_lang_String, false, "charAt", "(I)C");
java_lang_Thread_dispatchUncaughtException = CacheMethod(env, java_lang_Thread, false, "dispatchUncaughtException", "(Ljava/lang/Throwable;)V");
java_lang_Thread_init = CacheMethod(env, java_lang_Thread, false, "<init>", "(Ljava/lang/ThreadGroup;Ljava/lang/String;IZ)V");
java_lang_Thread_run = CacheMethod(env, java_lang_Thread, false, "run", "()V");
diff --git a/runtime/well_known_classes.h b/runtime/well_known_classes.h
index 371be61f43..b3ce3d1597 100644
--- a/runtime/well_known_classes.h
+++ b/runtime/well_known_classes.h
@@ -113,6 +113,7 @@ struct WellKnownClasses {
static jmethodID java_lang_reflect_Proxy_invoke;
static jmethodID java_lang_Runtime_nativeLoad;
static jmethodID java_lang_Short_valueOf;
+ static jmethodID java_lang_String_charAt;
static jmethodID java_lang_System_runFinalization;
static jmethodID java_lang_Thread_dispatchUncaughtException;
static jmethodID java_lang_Thread_init;
diff --git a/test/080-oom-throw/expected.txt b/test/080-oom-throw/expected.txt
index 904393bc3b..0967278314 100644
--- a/test/080-oom-throw/expected.txt
+++ b/test/080-oom-throw/expected.txt
@@ -1,3 +1,4 @@
Test reflection correctly threw
+Test reflection2 correctly threw
NEW_ARRAY correctly threw OOME
NEW_INSTANCE correctly threw OOME
diff --git a/test/080-oom-throw/src/Main.java b/test/080-oom-throw/src/Main.java
index 0ae92a96dc..a6c18b75fc 100644
--- a/test/080-oom-throw/src/Main.java
+++ b/test/080-oom-throw/src/Main.java
@@ -53,6 +53,30 @@ public class Main {
}
}
+ public static Object eatAllMemory() {
+ Object[] result = null;
+ int size = 1000000;
+ while (result == null && size != 0) {
+ try {
+ result = new Object[size];
+ } catch (OutOfMemoryError oome) {
+ size /= 2;
+ }
+ }
+ if (result != null) {
+ int index = 0;
+ while (index != result.length && size != 0) {
+ try {
+ result[index] = new byte[size];
+ ++index;
+ } catch (OutOfMemoryError oome) {
+ size /= 2;
+ }
+ }
+ }
+ return result;
+ }
+
static boolean triggerArrayOOM() {
ArrayMemEater.blowup(new char[128 * 1024][]);
return ArrayMemEater.sawOome;
@@ -74,6 +98,9 @@ public class Main {
if (triggerReflectionOOM()) {
System.out.println("Test reflection correctly threw");
}
+ if (triggerReflectionOOM2()) {
+ System.out.println("Test reflection2 correctly threw");
+ }
if (triggerArrayOOM()) {
System.out.println("NEW_ARRAY correctly threw OOME");
@@ -125,4 +152,20 @@ public class Main {
}
return true;
}
+
+ static boolean triggerReflectionOOM2() {
+ Object memory = eatAllMemory();
+ boolean result = false;
+ try {
+ Main.class.getDeclaredMethods();
+ } catch (OutOfMemoryError e) {
+ result = true;
+ }
+ if (!result) {
+ boolean memoryWasAllocated = (memory != null);
+ memory = null;
+ System.out.println("memoryWasAllocated = " + memoryWasAllocated);
+ }
+ return result;
+ }
}
diff --git a/test/129-ThreadGetId/src/Main.java b/test/129-ThreadGetId/src/Main.java
index 5aefd17f0e..4e48e0e1a6 100644
--- a/test/129-ThreadGetId/src/Main.java
+++ b/test/129-ThreadGetId/src/Main.java
@@ -14,6 +14,7 @@
* limitations under the License.
*/
+import java.lang.reflect.Field;
import java.util.Map;
public class Main implements Runnable {
@@ -22,7 +23,6 @@ public class Main implements Runnable {
public static void main(String[] args) throws Exception {
final Thread[] threads = new Thread[numberOfThreads];
- test_getStackTraces();
for (int t = 0; t < threads.length; t++) {
threads[t] = new Thread(new Main());
threads[t].start();
@@ -30,17 +30,44 @@ public class Main implements Runnable {
for (Thread t : threads) {
t.join();
}
+ // Do this test after the other part to leave some time for the heap task daemon to start
+ // up.
+ test_getStackTraces();
System.out.println("Finishing");
}
- static void test_getStackTraces() {
+ static Thread getHeapTaskDaemon() throws Exception {
+ Field f = ThreadGroup.class.getDeclaredField("systemThreadGroup");
+ f.setAccessible(true);
+ ThreadGroup systemThreadGroup = (ThreadGroup) f.get(null);
+
+ while (true) {
+ int activeCount = systemThreadGroup.activeCount();
+ Thread[] array = new Thread[activeCount];
+ systemThreadGroup.enumerate(array);
+ for (Thread thread : array) {
+ if (thread.getName().equals("HeapTaskDaemon") &&
+ thread.getState() != Thread.State.NEW) {
+ return thread;
+ }
+ }
+ // Yield to eventually get the daemon started.
+ Thread.sleep(10);
+ }
+ }
+
+ static void test_getStackTraces() throws Exception {
+ Thread heapDaemon = getHeapTaskDaemon();
+
+ // Force a GC to ensure the daemon truly started.
+ Runtime.getRuntime().gc();
// Check all the current threads for positive IDs.
Map<Thread, StackTraceElement[]> map = Thread.getAllStackTraces();
for (Map.Entry<Thread, StackTraceElement[]> pair : map.entrySet()) {
Thread thread = pair.getKey();
// Expect empty stack trace since we do not support suspending the GC thread for
// obtaining stack traces. See b/28261069.
- if (thread.getName().equals("HeapTaskDaemon")) {
+ if (thread == heapDaemon) {
System.out.println(thread.getName() + " depth " + pair.getValue().length);
}
}
diff --git a/test/494-checker-instanceof-tests/src/Main.java b/test/494-checker-instanceof-tests/src/Main.java
index 2eac6c92a5..acd2305f67 100644
--- a/test/494-checker-instanceof-tests/src/Main.java
+++ b/test/494-checker-instanceof-tests/src/Main.java
@@ -142,11 +142,11 @@ public class Main {
/// CHECK: LoadClass
/// CHECK: Return [<<Const>>]
public static boolean knownTestWithUnloadedClass() {
- return $inline$returnMain() instanceof String;
+ return $inline$returnUnrelated() instanceof String;
}
- public static Object $inline$returnMain() {
- return new Main();
+ public static Object $inline$returnUnrelated() {
+ return new Unrelated();
}
public static void expect(boolean expected, boolean actual) {
diff --git a/test/496-checker-inlining-class-loader/src/Main.java b/test/496-checker-inlining-class-loader/src/Main.java
index 15d4dc07bc..5deb77f29e 100644
--- a/test/496-checker-inlining-class-loader/src/Main.java
+++ b/test/496-checker-inlining-class-loader/src/Main.java
@@ -82,10 +82,10 @@ class MyClassLoader extends ClassLoader {
class LoadedByMyClassLoader {
/// CHECK-START: void LoadedByMyClassLoader.bar() inliner (before)
- /// CHECK: LoadClass
+ /// CHECK: LoadClass class_name:FirstSeenByMyClassLoader
/// CHECK-NEXT: ClinitCheck
/// CHECK-NEXT: InvokeStaticOrDirect
- /// CHECK-NEXT: LoadClass
+ /// CHECK-NEXT: LoadClass class_name:java.lang.System
/// CHECK-NEXT: ClinitCheck
/// CHECK-NEXT: StaticFieldGet
/// CHECK-NEXT: LoadString
@@ -93,10 +93,10 @@ class LoadedByMyClassLoader {
/// CHECK-NEXT: InvokeVirtual
/// CHECK-START: void LoadedByMyClassLoader.bar() inliner (after)
- /// CHECK: LoadClass
+ /// CHECK: LoadClass class_name:FirstSeenByMyClassLoader
/// CHECK-NEXT: ClinitCheck
/* We inlined FirstSeenByMyClassLoader.$inline$bar */
- /// CHECK-NEXT: LoadClass
+ /// CHECK-NEXT: LoadClass class_name:java.lang.System
/// CHECK-NEXT: ClinitCheck
/// CHECK-NEXT: StaticFieldGet
/// CHECK-NEXT: LoadString
@@ -105,12 +105,15 @@ class LoadedByMyClassLoader {
/// CHECK-START: void LoadedByMyClassLoader.bar() register (before)
/* Load and initialize FirstSeenByMyClassLoader */
- /// CHECK: LoadClass gen_clinit_check:true
+ /// CHECK: LoadClass class_name:FirstSeenByMyClassLoader gen_clinit_check:true
/* Load and initialize System */
// There may be MipsComputeBaseMethodAddress here.
- /// CHECK: LoadClass gen_clinit_check:true
- /// CHECK-NEXT: StaticFieldGet
- // There may be HArmDexCacheArraysBase or HX86ComputeBaseMethodAddress here.
+ /// CHECK: LoadClass class_name:java.lang.System
+ // The ClinitCheck may (PIC) or may not (non-PIC) be merged into the LoadClass.
+ // (The merging checks for environment match but HLoadClass/kBootImageAddress
+ // used for non-PIC mode does not have an environment at all.)
+ /// CHECK: StaticFieldGet
+ // There may be HX86ComputeBaseMethodAddress or MipsComputeBaseMethodAddress here.
/// CHECK: LoadString
/// CHECK-NEXT: NullCheck
/// CHECK-NEXT: InvokeVirtual
diff --git a/test/552-checker-sharpening/src/Main.java b/test/552-checker-sharpening/src/Main.java
index fe6ff13628..db437686f0 100644
--- a/test/552-checker-sharpening/src/Main.java
+++ b/test/552-checker-sharpening/src/Main.java
@@ -331,32 +331,32 @@ public class Main {
/// CHECK-START-X86: java.lang.Class Main.$noinline$getStringClass() sharpening (after)
// Note: load kind depends on PIC/non-PIC
// TODO: Remove DexCacheViaMethod when read barrier config supports BootImageAddress.
- /// CHECK: LoadClass load_kind:{{BootImageAddress|DexCachePcRelative|DexCacheViaMethod}} class_name:java.lang.String
+ /// CHECK: LoadClass load_kind:{{BootImageAddress|BssEntry|DexCacheViaMethod}} class_name:java.lang.String
/// CHECK-START-X86_64: java.lang.Class Main.$noinline$getStringClass() sharpening (after)
// Note: load kind depends on PIC/non-PIC
// TODO: Remove DexCacheViaMethod when read barrier config supports BootImageAddress.
- /// CHECK: LoadClass load_kind:{{BootImageAddress|DexCachePcRelative|DexCacheViaMethod}} class_name:java.lang.String
+ /// CHECK: LoadClass load_kind:{{BootImageAddress|BssEntry|DexCacheViaMethod}} class_name:java.lang.String
/// CHECK-START-ARM: java.lang.Class Main.$noinline$getStringClass() sharpening (after)
// Note: load kind depends on PIC/non-PIC
// TODO: Remove DexCacheViaMethod when read barrier config supports BootImageAddress.
- /// CHECK: LoadClass load_kind:{{BootImageAddress|DexCachePcRelative|DexCacheViaMethod}} class_name:java.lang.String
+ /// CHECK: LoadClass load_kind:{{BootImageAddress|BssEntry|DexCacheViaMethod}} class_name:java.lang.String
/// CHECK-START-ARM64: java.lang.Class Main.$noinline$getStringClass() sharpening (after)
// Note: load kind depends on PIC/non-PIC
// TODO: Remove DexCacheViaMethod when read barrier config supports BootImageAddress.
- /// CHECK: LoadClass load_kind:{{BootImageAddress|DexCachePcRelative|DexCacheViaMethod}} class_name:java.lang.String
+ /// CHECK: LoadClass load_kind:{{BootImageAddress|BssEntry|DexCacheViaMethod}} class_name:java.lang.String
/// CHECK-START-MIPS: java.lang.Class Main.$noinline$getStringClass() sharpening (after)
// Note: load kind depends on PIC/non-PIC
// TODO: Remove DexCacheViaMethod when read barrier config supports BootImageAddress.
- /// CHECK: LoadClass load_kind:{{BootImageAddress|DexCachePcRelative|DexCacheViaMethod}} class_name:java.lang.String
+ /// CHECK: LoadClass load_kind:{{BootImageAddress|BssEntry|DexCacheViaMethod}} class_name:java.lang.String
/// CHECK-START-MIPS64: java.lang.Class Main.$noinline$getStringClass() sharpening (after)
// Note: load kind depends on PIC/non-PIC
// TODO: Remove DexCacheViaMethod when read barrier config supports BootImageAddress.
- /// CHECK: LoadClass load_kind:{{BootImageAddress|DexCachePcRelative|DexCacheViaMethod}} class_name:java.lang.String
+ /// CHECK: LoadClass load_kind:{{BootImageAddress|BssEntry|DexCacheViaMethod}} class_name:java.lang.String
public static Class<?> $noinline$getStringClass() {
// Prevent inlining to avoid the string comparison being optimized away.
@@ -369,34 +369,34 @@ public class Main {
/// CHECK: LoadClass load_kind:DexCacheViaMethod class_name:Other
/// CHECK-START-X86: java.lang.Class Main.$noinline$getOtherClass() sharpening (after)
- /// CHECK: LoadClass load_kind:DexCachePcRelative class_name:Other
+ /// CHECK: LoadClass load_kind:BssEntry class_name:Other
/// CHECK-START-X86: java.lang.Class Main.$noinline$getOtherClass() pc_relative_fixups_x86 (after)
/// CHECK-DAG: X86ComputeBaseMethodAddress
- /// CHECK-DAG: LoadClass load_kind:DexCachePcRelative class_name:Other
+ /// CHECK-DAG: LoadClass load_kind:BssEntry class_name:Other
/// CHECK-START-X86_64: java.lang.Class Main.$noinline$getOtherClass() sharpening (after)
- /// CHECK: LoadClass load_kind:DexCachePcRelative class_name:Other
+ /// CHECK: LoadClass load_kind:BssEntry class_name:Other
/// CHECK-START-ARM: java.lang.Class Main.$noinline$getOtherClass() sharpening (after)
- /// CHECK: LoadClass load_kind:DexCachePcRelative class_name:Other
+ /// CHECK: LoadClass load_kind:BssEntry class_name:Other
/// CHECK-START-ARM: java.lang.Class Main.$noinline$getOtherClass() dex_cache_array_fixups_arm (after)
/// CHECK-DAG: ArmDexCacheArraysBase
- /// CHECK-DAG: LoadClass load_kind:DexCachePcRelative class_name:Other
+ /// CHECK-DAG: LoadClass load_kind:BssEntry class_name:Other
/// CHECK-START-ARM64: java.lang.Class Main.$noinline$getOtherClass() sharpening (after)
- /// CHECK: LoadClass load_kind:DexCachePcRelative class_name:Other
+ /// CHECK: LoadClass load_kind:BssEntry class_name:Other
/// CHECK-START-MIPS: java.lang.Class Main.$noinline$getOtherClass() sharpening (after)
- /// CHECK: LoadClass load_kind:DexCachePcRelative class_name:Other
+ /// CHECK: LoadClass load_kind:BssEntry class_name:Other
/// CHECK-START-MIPS: java.lang.Class Main.$noinline$getOtherClass() dex_cache_array_fixups_mips (after)
/// CHECK-DAG: MipsDexCacheArraysBase
- /// CHECK-DAG: LoadClass load_kind:DexCachePcRelative class_name:Other
+ /// CHECK-DAG: LoadClass load_kind:BssEntry class_name:Other
/// CHECK-START-MIPS64: java.lang.Class Main.$noinline$getOtherClass() sharpening (after)
- /// CHECK: LoadClass load_kind:DexCachePcRelative class_name:Other
+ /// CHECK: LoadClass load_kind:BssEntry class_name:Other
public static Class<?> $noinline$getOtherClass() {
// Prevent inlining to avoid the string comparison being optimized away.
diff --git a/test/559-checker-irreducible-loop/smali/IrreducibleLoop.smali b/test/559-checker-irreducible-loop/smali/IrreducibleLoop.smali
index af43973073..a30a11afb7 100644
--- a/test/559-checker-irreducible-loop/smali/IrreducibleLoop.smali
+++ b/test/559-checker-irreducible-loop/smali/IrreducibleLoop.smali
@@ -196,7 +196,7 @@
const-class v0, LMain;
if-ne v0, v2, :exit
:other_loop_entry
- const-class v1, Ljava/lang/Class; # LoadClass that can throw
+ const-class v1, LOther; # LoadClass that can throw
goto :loop_entry
:exit
return-object v0
@@ -250,7 +250,7 @@
const/4 v0, 0
if-ne p0, v0, :other_loop_entry
:loop_entry
- const-class v1, Ljava/lang/Class; # LoadClass that can throw
+ const-class v1, LOther; # LoadClass that can throw
if-ne v0, p0, :exit
:other_loop_entry
sub-int v1, p0, p0
@@ -286,7 +286,7 @@
.method public static licm3(III)I
.registers 4
:loop_entry
- const-class v0, Ljava/lang/Class; # LoadClass that can throw
+ const-class v0, LOther; # LoadClass that can throw
if-ne p1, p2, :exit
goto :loop_body
diff --git a/test/559-checker-irreducible-loop/src/Main.java b/test/559-checker-irreducible-loop/src/Main.java
index ab84f81291..023e7695fe 100644
--- a/test/559-checker-irreducible-loop/src/Main.java
+++ b/test/559-checker-irreducible-loop/src/Main.java
@@ -67,3 +67,6 @@ public class Main {
int myField;
}
+
+class Other {
+}
diff --git a/test/559-checker-rtp-ifnotnull/src/Main.java b/test/559-checker-rtp-ifnotnull/src/Main.java
index 2dc5666e18..1e15654950 100644
--- a/test/559-checker-rtp-ifnotnull/src/Main.java
+++ b/test/559-checker-rtp-ifnotnull/src/Main.java
@@ -18,7 +18,6 @@
public class Main {
/// CHECK-START: void Main.boundTypeForIfNotNull() builder (after)
- /// CHECK-DAG: <<Method:(i|j)\d+>> CurrentMethod
/// CHECK-DAG: <<Null:l\d+>> NullConstant
/// CHECK-DAG: <<Cst5:i\d+>> IntConstant 5
/// CHECK-DAG: <<Cst10:i\d+>> IntConstant 10
@@ -28,10 +27,12 @@ public class Main {
/// CHECK-DAG: <<LoopPhi>> Phi [<<Null>>,<<MergePhi:l\d+>>] klass:int[]
/// CHECK-DAG: <<BoundType:l\d+>> BoundType [<<LoopPhi>>] klass:int[] can_be_null:false
- /// CHECK-DAG: <<NewArray10:l\d+>> NewArray [<<Cst10>>,<<Method>>] klass:int[]
+ /// CHECK-DAG: <<LoadClass1:l\d+>> LoadClass
+ /// CHECK-DAG: <<LoadClass2:l\d+>> LoadClass
+ /// CHECK-DAG: <<NewArray10:l\d+>> NewArray [<<LoadClass2>>,<<Cst10>>] klass:int[]
/// CHECK-DAG: <<NotNullPhi:l\d+>> Phi [<<BoundType>>,<<NewArray10>>] klass:int[]
- /// CHECK-DAG: <<NewArray5:l\d+>> NewArray [<<Cst5>>,<<Method>>] klass:int[]
+ /// CHECK-DAG: <<NewArray5:l\d+>> NewArray [<<LoadClass1>>,<<Cst5>>] klass:int[]
/// CHECK-DAG: <<MergePhi>> Phi [<<NewArray5>>,<<NotNullPhi>>] klass:int[]
public static void boundTypeForIfNotNull() {
diff --git a/test/572-checker-array-get-regression/src/Main.java b/test/572-checker-array-get-regression/src/Main.java
index 89b97ed316..03a84486de 100644
--- a/test/572-checker-array-get-regression/src/Main.java
+++ b/test/572-checker-array-get-regression/src/Main.java
@@ -21,10 +21,10 @@ public class Main {
}
/// CHECK-START: java.lang.Integer Main.test() builder (after)
- /// CHECK-DAG: <<Method:[ij]\d+>> CurrentMethod
/// CHECK-DAG: <<Const2P19:i\d+>> IntConstant 524288
/// CHECK-DAG: <<ConstM1:i\d+>> IntConstant -1
- /// CHECK-DAG: <<Array:l\d+>> NewArray [<<Const2P19>>,<<Method>>]
+ /// CHECK-DAG: <<LoadClass:l\d+>> LoadClass
+ /// CHECK-DAG: <<Array:l\d+>> NewArray [<<LoadClass>>,<<Const2P19>>]
/// CHECK-DAG: <<Length1:i\d+>> ArrayLength [<<Array>>]
/// CHECK-DAG: <<Index:i\d+>> Add [<<Length1>>,<<ConstM1>>]
/// CHECK-DAG: <<Length2:i\d+>> ArrayLength [<<Array>>]
@@ -34,10 +34,10 @@ public class Main {
/// CHECK-START: java.lang.Integer Main.test() register (before)
- /// CHECK-DAG: <<Method:[ij]\d+>> CurrentMethod
/// CHECK-DAG: <<Const2P19:i\d+>> IntConstant 524288
/// CHECK-DAG: <<Const2P19M1:i\d+>> IntConstant 524287
- /// CHECK-DAG: <<Array:l\d+>> NewArray [<<Const2P19>>,<<Method>>]
+ /// CHECK-DAG: <<LoadClass:l\d+>> LoadClass
+ /// CHECK-DAG: <<Array:l\d+>> NewArray [<<LoadClass>>,<<Const2P19>>]
/// CHECK-DAG: <<LastElement:l\d+>> ArrayGet [<<Array>>,<<Const2P19M1>>]
/// CHECK-DAG: Return [<<LastElement>>]
diff --git a/test/595-profile-saving/profile-saving.cc b/test/595-profile-saving/profile-saving.cc
index bf3d812f94..0f8dd57385 100644
--- a/test/595-profile-saving/profile-saving.cc
+++ b/test/595-profile-saving/profile-saving.cc
@@ -17,7 +17,7 @@
#include "dex_file.h"
#include "art_method-inl.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
#include "jit/profile_saver.h"
#include "jni.h"
#include "method_reference.h"
diff --git a/test/627-checker-unroll/expected.txt b/test/627-checker-unroll/expected.txt
new file mode 100644
index 0000000000..b0aad4deb5
--- /dev/null
+++ b/test/627-checker-unroll/expected.txt
@@ -0,0 +1 @@
+passed
diff --git a/test/627-checker-unroll/info.txt b/test/627-checker-unroll/info.txt
new file mode 100644
index 0000000000..d7885f4bbc
--- /dev/null
+++ b/test/627-checker-unroll/info.txt
@@ -0,0 +1 @@
+Test on loop unrolling.
diff --git a/test/627-checker-unroll/src/Main.java b/test/627-checker-unroll/src/Main.java
new file mode 100644
index 0000000000..9785bdc58b
--- /dev/null
+++ b/test/627-checker-unroll/src/Main.java
@@ -0,0 +1,119 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+//
+// Test on loop unrolling. Removes loop control overhead (including suspend
+// checks) and exposes more opportunities for constant folding.
+//
+public class Main {
+
+ static int sA = 0;
+
+ /// CHECK-START: void Main.unroll() loop_optimization (before)
+ /// CHECK-DAG: Phi loop:<<Loop:B\d+>>
+ /// CHECK-DAG: StaticFieldSet loop:<<Loop>>
+ //
+ /// CHECK-START: void Main.unroll() loop_optimization (after)
+ /// CHECK-DAG: StaticFieldSet loop:none
+ //
+ /// CHECK-START: void Main.unroll() instruction_simplifier$after_bce (after)
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant 68 loop:none
+ /// CHECK-DAG: StaticFieldSet [{{l\d+}},<<Int>>] loop:none
+ //
+ /// CHECK-START: void Main.unroll() loop_optimization (after)
+ /// CHECK-NOT: Phi
+ public static void unroll() {
+ for (int i = 4; i < 5; i++) {
+ sA = 17 * i;
+ }
+ }
+
+ /// CHECK-START: int Main.unrollLV() loop_optimization (before)
+ /// CHECK-DAG: <<Phi:i\d+>> Phi loop:<<Loop:B\d+>>
+ /// CHECK-DAG: StaticFieldSet loop:<<Loop>>
+ /// CHECK-DAG: Return [<<Phi>>] loop:none
+ //
+ /// CHECK-START: int Main.unrollLV() loop_optimization (after)
+ /// CHECK-DAG: StaticFieldSet loop:none
+ //
+ /// CHECK-START: int Main.unrollLV() instruction_simplifier$after_bce (after)
+ /// CHECK-DAG: <<Int1:i\d+>> IntConstant 187 loop:none
+ /// CHECK-DAG: <<Int2:i\d+>> IntConstant 12 loop:none
+ /// CHECK-DAG: StaticFieldSet [{{l\d+}},<<Int1>>] loop:none
+ /// CHECK-DAG: Return [<<Int2>>] loop:none
+ //
+ /// CHECK-START: int Main.unrollLV() loop_optimization (after)
+ /// CHECK-NOT: Phi
+ public static int unrollLV() {
+ int i;
+ for (i = 11; i < 12; i++) {
+ sA = 17 * i;
+ }
+ return i;
+ }
+
+ /// CHECK-START: void Main.unrollNest() loop_optimization (before)
+ /// CHECK-DAG: SuspendCheck loop:none
+ /// CHECK-DAG: <<Phi1:i\d+>> Phi loop:<<Loop1:B\d+>> outer_loop:none
+ /// CHECK-DAG: SuspendCheck loop:<<Loop1>> outer_loop:none
+ /// CHECK-DAG: <<Phi2:i\d+>> Phi loop:<<Loop2:B\d+>> outer_loop:<<Loop1>>
+ /// CHECK-DAG: SuspendCheck loop:<<Loop2>> outer_loop:<<Loop1>>
+ /// CHECK-DAG: <<Phi3:i\d+>> Phi loop:<<Loop3:B\d+>> outer_loop:<<Loop2>>
+ /// CHECK-DAG: SuspendCheck loop:<<Loop3>> outer_loop:<<Loop2>>
+ /// CHECK-DAG: StaticFieldSet loop:<<Loop3>> outer_loop:<<Loop2>>
+ //
+ /// CHECK-START: void Main.unrollNest() loop_optimization (after)
+ /// CHECK-DAG: StaticFieldSet loop:none
+ /// CHECK-DAG: SuspendCheck loop:none
+ /// CHECK-NOT: SuspendCheck
+ //
+ /// CHECK-START: void Main.unrollNest() instruction_simplifier$after_bce (after)
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant 6 loop:none
+ /// CHECK-DAG: StaticFieldSet [{{l\d+}},<<Int>>] loop:none
+ //
+ /// CHECK-START: void Main.unrollNest() loop_optimization (after)
+ /// CHECK-NOT: Phi
+ public static void unrollNest() {
+ // Unrolling each loop in turn ultimately removes the complete nest!
+ for (int i = 4; i < 5; i++) {
+ for (int j = 5; j < 6; j++) {
+ for (int k = 6; k < 7; k++) {
+ sA = k;
+ }
+ }
+ }
+ }
+
+ //
+ // Verifier.
+ //
+
+ public static void main(String[] args) {
+ unroll();
+ expectEquals(68, sA);
+ expectEquals(12, unrollLV());
+ expectEquals(187, sA);
+ unrollNest();
+ expectEquals(6, sA);
+ System.out.println("passed");
+ }
+
+ private static void expectEquals(int expected, int result) {
+ if (expected != result) {
+ throw new Error("Expected: " + expected + ", found: " + result);
+ }
+ }
+}
diff --git a/test/633-checker-rtp-getclass/expected.txt b/test/633-checker-rtp-getclass/expected.txt
new file mode 100644
index 0000000000..a178d0414b
--- /dev/null
+++ b/test/633-checker-rtp-getclass/expected.txt
@@ -0,0 +1,3 @@
+2
+3
+6
diff --git a/test/633-checker-rtp-getclass/info.txt b/test/633-checker-rtp-getclass/info.txt
new file mode 100644
index 0000000000..e98a0acbbb
--- /dev/null
+++ b/test/633-checker-rtp-getclass/info.txt
@@ -0,0 +1,3 @@
+Regression test for the RTP pass of the compiler, which
+used the wrong block when bounding a type after a obj.getClass()
+check.
diff --git a/test/633-checker-rtp-getclass/src/Main.java b/test/633-checker-rtp-getclass/src/Main.java
new file mode 100644
index 0000000000..f29c139f63
--- /dev/null
+++ b/test/633-checker-rtp-getclass/src/Main.java
@@ -0,0 +1,76 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class Main {
+ public static void main(String[] args) {
+ System.out.println($opt$noinline$foo(new Main()));
+ System.out.println($opt$noinline$foo(new SubMain()));
+ System.out.println($opt$noinline$foo(new SubSubMain()));
+ }
+
+
+ // Checker test to make sure the only inlined instruction is
+ // SubMain.bar.
+ /// CHECK-START: int Main.$opt$noinline$foo(Main) inliner (after)
+ /// CHECK-DAG: InvokeVirtual method_name:Main.foo
+ /// CHECK-DAG: <<Const:i\d+>> IntConstant 3
+ /// CHECK: begin_block
+ /// CHECK: BoundType klass:SubMain
+ /// CHECK: Return [<<Const>>]
+ /// CHECK-NOT: begin_block
+ /// CHECK: end_block
+ public static int $opt$noinline$foo(Main o) {
+ if (doThrow) { throw new Error(); }
+ // To exercise the bug on Jack, we need two getClass compares.
+ if (o.getClass() == Main.class || o.getClass() != SubMain.class) {
+ return o.foo();
+ } else {
+ // We used to wrongly bound the type of o to `Main` here and then realize that's
+ // impossible and mark this branch as dead.
+ return o.bar();
+ }
+ }
+
+ public int bar() {
+ return 1;
+ }
+
+ public int foo() {
+ return 2;
+ }
+
+ public static boolean doThrow = false;
+}
+
+class SubMain extends Main {
+ public int bar() {
+ return 3;
+ }
+
+ public int foo() {
+ return 4;
+ }
+}
+
+class SubSubMain extends SubMain {
+ public int bar() {
+ return 5;
+ }
+
+ public int foo() {
+ return 6;
+ }
+}
diff --git a/test/634-vdex-duplicate/expected.txt b/test/634-vdex-duplicate/expected.txt
new file mode 100644
index 0000000000..557db03de9
--- /dev/null
+++ b/test/634-vdex-duplicate/expected.txt
@@ -0,0 +1 @@
+Hello World
diff --git a/test/634-vdex-duplicate/info.txt b/test/634-vdex-duplicate/info.txt
new file mode 100644
index 0000000000..e69de29bb2
--- /dev/null
+++ b/test/634-vdex-duplicate/info.txt
diff --git a/test/634-vdex-duplicate/run b/test/634-vdex-duplicate/run
new file mode 100644
index 0000000000..1ccb84150b
--- /dev/null
+++ b/test/634-vdex-duplicate/run
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright (C) 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+exec ${RUN} -Xcompiler-option --compiler-filter=verify-profile --vdex-filter speed --vdex "${@}"
diff --git a/test/634-vdex-duplicate/src/Main.java b/test/634-vdex-duplicate/src/Main.java
new file mode 100644
index 0000000000..228310697a
--- /dev/null
+++ b/test/634-vdex-duplicate/src/Main.java
@@ -0,0 +1,21 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class Main {
+ public static void main(String[] args) {
+ System.out.println("Hello World");
+ }
+}
diff --git a/test/634-vdex-duplicate/src/sun/misc/Unsafe.java b/test/634-vdex-duplicate/src/sun/misc/Unsafe.java
new file mode 100644
index 0000000000..c32868cf37
--- /dev/null
+++ b/test/634-vdex-duplicate/src/sun/misc/Unsafe.java
@@ -0,0 +1,20 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package sun.misc;
+
+public class Unsafe {
+}
diff --git a/test/901-hello-ti-agent/basics.cc b/test/901-hello-ti-agent/basics.cc
index 3a475c6fef..0b17656303 100644
--- a/test/901-hello-ti-agent/basics.cc
+++ b/test/901-hello-ti-agent/basics.cc
@@ -22,9 +22,52 @@
#include "base/macros.h"
#include "openjdkjvmti/jvmti.h"
+#include "ti-agent/common_helper.h"
+#include "ti-agent/common_load.h"
+
namespace art {
namespace Test901HelloTi {
+static void EnableEvent(jvmtiEnv* env, jvmtiEvent evt) {
+ jvmtiError error = env->SetEventNotificationMode(JVMTI_ENABLE, evt, nullptr);
+ if (error != JVMTI_ERROR_NONE) {
+ printf("Failed to enable event");
+ }
+}
+
+static void JNICALL VMStartCallback(jvmtiEnv *jenv ATTRIBUTE_UNUSED,
+ JNIEnv* jni_env ATTRIBUTE_UNUSED) {
+ printf("VMStart\n");
+}
+
+static void JNICALL VMInitCallback(jvmtiEnv *jvmti_env ATTRIBUTE_UNUSED,
+ JNIEnv* jni_env ATTRIBUTE_UNUSED,
+ jthread thread ATTRIBUTE_UNUSED) {
+ printf("VMInit\n");
+}
+
+static void JNICALL VMDeatchCallback(jvmtiEnv *jenv ATTRIBUTE_UNUSED,
+ JNIEnv* jni_env ATTRIBUTE_UNUSED) {
+ printf("VMDeath\n");
+}
+
+
+static void InstallVMEvents(jvmtiEnv* env) {
+ jvmtiEventCallbacks callbacks;
+ memset(&callbacks, 0, sizeof(jvmtiEventCallbacks));
+ callbacks.VMStart = VMStartCallback;
+ callbacks.VMInit = VMInitCallback;
+ callbacks.VMDeath = VMDeatchCallback;
+ jvmtiError ret = env->SetEventCallbacks(&callbacks, sizeof(callbacks));
+ if (ret != JVMTI_ERROR_NONE) {
+ printf("Failed to install callbacks");
+ }
+
+ EnableEvent(env, JVMTI_EVENT_VM_START);
+ EnableEvent(env, JVMTI_EVENT_VM_INIT);
+ EnableEvent(env, JVMTI_EVENT_VM_DEATH);
+}
+
jint OnLoad(JavaVM* vm,
char* options ATTRIBUTE_UNUSED,
void* reserved ATTRIBUTE_UNUSED) {
@@ -69,12 +112,52 @@ jint OnLoad(JavaVM* vm,
printf("Unexpected version number!\n");
return -1;
}
+
+ InstallVMEvents(env);
+ InstallVMEvents(env2);
+
CHECK_CALL_SUCCESS(env->DisposeEnvironment());
CHECK_CALL_SUCCESS(env2->DisposeEnvironment());
#undef CHECK_CALL_SUCCESS
+
+ if (vm->GetEnv(reinterpret_cast<void**>(&jvmti_env), JVMTI_VERSION_1_0)) {
+ printf("Unable to get jvmti env!\n");
+ return 1;
+ }
+ SetAllCapabilities(jvmti_env);
+
+ jvmtiPhase current_phase;
+ jvmtiError phase_result = jvmti_env->GetPhase(&current_phase);
+ if (phase_result != JVMTI_ERROR_NONE) {
+ printf("Could not get phase");
+ return 1;
+ }
+ if (current_phase != JVMTI_PHASE_ONLOAD) {
+ printf("Wrong phase");
+ return 1;
+ }
+
+ InstallVMEvents(jvmti_env);
+
return JNI_OK;
}
+extern "C" JNIEXPORT void JNICALL Java_Main_setVerboseFlag(
+ JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED, jint iflag, jboolean val) {
+ jvmtiVerboseFlag flag = static_cast<jvmtiVerboseFlag>(iflag);
+ jvmtiError result = jvmti_env->SetVerboseFlag(flag, val);
+ JvmtiErrorToException(env, result);
+}
+
+extern "C" JNIEXPORT jboolean JNICALL Java_Main_checkLivePhase(
+ JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED) {
+ jvmtiPhase current_phase;
+ jvmtiError phase_result = jvmti_env->GetPhase(&current_phase);
+ if (JvmtiErrorToException(env, phase_result)) {
+ return JNI_FALSE;
+ }
+ return (current_phase == JVMTI_PHASE_LIVE) ? JNI_TRUE : JNI_FALSE;
+}
} // namespace Test901HelloTi
} // namespace art
diff --git a/test/901-hello-ti-agent/expected.txt b/test/901-hello-ti-agent/expected.txt
index 414eb3b2ae..c4b24cba90 100644
--- a/test/901-hello-ti-agent/expected.txt
+++ b/test/901-hello-ti-agent/expected.txt
@@ -1,2 +1,12 @@
Loaded Agent for test 901-hello-ti-agent
+VMStart
+VMInit
Hello, world!
+Agent in live phase.
+0
+1
+2
+4
+8
+JVMTI_ERROR_ILLEGAL_ARGUMENT
+VMDeath
diff --git a/test/901-hello-ti-agent/src/Main.java b/test/901-hello-ti-agent/src/Main.java
index 1ef6289559..faf2dc2591 100644
--- a/test/901-hello-ti-agent/src/Main.java
+++ b/test/901-hello-ti-agent/src/Main.java
@@ -16,6 +16,31 @@
public class Main {
public static void main(String[] args) {
+ System.loadLibrary(args[1]);
+
System.out.println("Hello, world!");
+
+ if (checkLivePhase()) {
+ System.out.println("Agent in live phase.");
+ }
+
+ set(0); // OTHER
+ set(1); // GC
+ set(2); // CLASS
+ set(4); // JNI
+ set(8); // Error.
}
+
+ private static void set(int i) {
+ System.out.println(i);
+ try {
+ setVerboseFlag(i, true);
+ setVerboseFlag(i, false);
+ } catch (RuntimeException e) {
+ System.out.println(e.getMessage());
+ }
+ }
+
+ private static native boolean checkLivePhase();
+ private static native void setVerboseFlag(int flag, boolean value);
}
diff --git a/test/911-get-stack-trace/expected.txt b/test/911-get-stack-trace/expected.txt
index e40698acc5..dad08c9f97 100644
--- a/test/911-get-stack-trace/expected.txt
+++ b/test/911-get-stack-trace/expected.txt
@@ -4,72 +4,72 @@
From top
---------
getStackTrace (Ljava/lang/Thread;II)[[Ljava/lang/String; -1 -2
- print (Ljava/lang/Thread;II)V 0 183
- printOrWait (IILMain$ControlData;)V 6 246
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- doTest ()V 38 41
- main ([Ljava/lang/String;)V 6 27
----------
- print (Ljava/lang/Thread;II)V 0 183
- printOrWait (IILMain$ControlData;)V 6 246
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- doTest ()V 42 42
- main ([Ljava/lang/String;)V 6 27
+ print (Ljava/lang/Thread;II)V 0 34
+ printOrWait (IILControlData;)V 6 39
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ doTest ()V 38 23
+ main ([Ljava/lang/String;)V 6 21
+---------
+ print (Ljava/lang/Thread;II)V 0 34
+ printOrWait (IILControlData;)V 6 39
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ doTest ()V 42 24
+ main ([Ljava/lang/String;)V 6 21
---------
getStackTrace (Ljava/lang/Thread;II)[[Ljava/lang/String; -1 -2
- print (Ljava/lang/Thread;II)V 0 183
- printOrWait (IILMain$ControlData;)V 6 246
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
----------
- printOrWait (IILMain$ControlData;)V 6 246
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
+ print (Ljava/lang/Thread;II)V 0 34
+ printOrWait (IILControlData;)V 6 39
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+---------
+ printOrWait (IILControlData;)V 6 39
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
From bottom
---------
- main ([Ljava/lang/String;)V 6 27
+ main ([Ljava/lang/String;)V 6 21
---------
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- doTest ()V 65 48
- main ([Ljava/lang/String;)V 6 27
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ doTest ()V 65 30
+ main ([Ljava/lang/String;)V 6 21
---------
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
################################
### Other thread (suspended) ###
@@ -77,135 +77,135 @@ From bottom
From top
---------
wait ()V -1 -2
- printOrWait (IILMain$ControlData;)V 24 252
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- run ()V 4 61
----------
- printOrWait (IILMain$ControlData;)V 24 252
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- run ()V 4 61
----------
- wait ()V -1 -2
- printOrWait (IILMain$ControlData;)V 24 252
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
----------
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 26
+---------
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 26
+---------
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+---------
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
From bottom
---------
- run ()V 4 61
+ run ()V 4 26
---------
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- run ()V 4 61
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 26
---------
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
###########################
### Other thread (live) ###
###########################
From top
---------
- printOrWait (IILMain$ControlData;)V 44 259
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- run ()V 4 95
----------
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- run ()V 4 95
----------
- printOrWait (IILMain$ControlData;)V 44 259
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
----------
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
+ printOrWait (IILControlData;)V 44 52
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 59
+---------
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 59
+---------
+ printOrWait (IILControlData;)V 44 52
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+---------
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
From bottom
---------
- run ()V 4 95
+ run ()V 4 59
---------
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- run ()V 4 95
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 59
---------
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
################################
### Other threads (suspended) ###
@@ -276,89 +276,89 @@ Signal Catcher
---------
Thread-10
wait ()V -1 -2
- printOrWait (IILMain$ControlData;)V 24 252
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
---------
Thread-11
wait ()V -1 -2
- printOrWait (IILMain$ControlData;)V 24 252
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
---------
Thread-12
wait ()V -1 -2
- printOrWait (IILMain$ControlData;)V 24 252
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
---------
Thread-13
wait ()V -1 -2
- printOrWait (IILMain$ControlData;)V 24 252
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
---------
Thread-4
wait ()V -1 -2
- printOrWait (IILMain$ControlData;)V 24 252
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
---------
Thread-5
wait ()V -1 -2
- printOrWait (IILMain$ControlData;)V 24 252
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
---------
Thread-6
wait ()V -1 -2
- printOrWait (IILMain$ControlData;)V 24 252
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
---------
Thread-7
wait ()V -1 -2
- printOrWait (IILMain$ControlData;)V 24 252
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
---------
Thread-8
wait ()V -1 -2
- printOrWait (IILMain$ControlData;)V 24 252
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
---------
Thread-9
wait ()V -1 -2
- printOrWait (IILMain$ControlData;)V 24 252
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
---------
main
getAllStackTraces (I)[[Ljava/lang/Object; -1 -2
- printAll (I)V 0 219
- doTestAllStackTraces ()V 107 156
- main ([Ljava/lang/String;)V 15 31
+ printAll (I)V 0 73
+ doTest ()V 102 57
+ main ([Ljava/lang/String;)V 30 33
---------
FinalizerDaemon
@@ -378,218 +378,459 @@ Signal Catcher
---------
Thread-10
wait ()V -1 -2
- printOrWait (IILMain$ControlData;)V 24 252
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- run ()V 4 144
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 45
---------
Thread-11
wait ()V -1 -2
- printOrWait (IILMain$ControlData;)V 24 252
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- run ()V 4 144
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 45
---------
Thread-12
wait ()V -1 -2
- printOrWait (IILMain$ControlData;)V 24 252
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- run ()V 4 144
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 45
---------
Thread-13
wait ()V -1 -2
- printOrWait (IILMain$ControlData;)V 24 252
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- run ()V 4 144
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 45
---------
Thread-4
wait ()V -1 -2
- printOrWait (IILMain$ControlData;)V 24 252
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- run ()V 4 144
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 45
---------
Thread-5
wait ()V -1 -2
- printOrWait (IILMain$ControlData;)V 24 252
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- run ()V 4 144
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 45
---------
Thread-6
wait ()V -1 -2
- printOrWait (IILMain$ControlData;)V 24 252
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- run ()V 4 144
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 45
---------
Thread-7
wait ()V -1 -2
- printOrWait (IILMain$ControlData;)V 24 252
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- run ()V 4 144
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 45
---------
Thread-8
wait ()V -1 -2
- printOrWait (IILMain$ControlData;)V 24 252
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- run ()V 4 144
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 45
---------
Thread-9
wait ()V -1 -2
- printOrWait (IILMain$ControlData;)V 24 252
- baz (IIILMain$ControlData;)Ljava/lang/Object; 2 237
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- baz (IIILMain$ControlData;)Ljava/lang/Object; 9 239
- bar (IIILMain$ControlData;)J 0 231
- foo (IIILMain$ControlData;)I 0 226
- run ()V 4 144
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 45
---------
main
getAllStackTraces (I)[[Ljava/lang/Object; -1 -2
- printAll (I)V 0 219
- doTestAllStackTraces ()V 112 158
- main ([Ljava/lang/String;)V 15 31
+ printAll (I)V 0 73
+ doTest ()V 107 59
+ main ([Ljava/lang/String;)V 30 33
+
+
+########################################
+### Other select threads (suspended) ###
+########################################
+---------
+Thread-14
+
+---------
+Thread-16
+
+---------
+Thread-18
+
+---------
+Thread-20
+
+---------
+Thread-22
+
+---------
+main
+
+---------
+Thread-14
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+
+---------
+Thread-16
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+
+---------
+Thread-18
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+
+---------
+Thread-20
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+---------
+Thread-22
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+
+---------
+main
+ getThreadListStackTraces ([Ljava/lang/Thread;I)[[Ljava/lang/Object; -1 -2
+ printList ([Ljava/lang/Thread;I)V 0 66
+ doTest ()V 96 52
+ main ([Ljava/lang/String;)V 38 37
+
+---------
+Thread-14
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 35
+
+---------
+Thread-16
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 35
+
+---------
+Thread-18
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 35
+
+---------
+Thread-20
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 35
+
+---------
+Thread-22
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 35
+
+---------
+main
+ getThreadListStackTraces ([Ljava/lang/Thread;I)[[Ljava/lang/Object; -1 -2
+ printList ([Ljava/lang/Thread;I)V 0 66
+ doTest ()V 101 54
+ main ([Ljava/lang/String;)V 38 37
+
+
+###################
+### Same thread ###
+###################
+4
+JVMTI_ERROR_ILLEGAL_ARGUMENT
+[public static native java.lang.Object[] Frames.getFrameLocation(java.lang.Thread,int), ffffffff]
+[public static void Frames.doTestSameThread(), 38]
+[public static void Frames.doTest() throws java.lang.Exception, 0]
+[public static void Main.main(java.lang.String[]) throws java.lang.Exception, 2e]
+JVMTI_ERROR_NO_MORE_FRAMES
+
+################################
+### Other thread (suspended) ###
+################################
+18
+JVMTI_ERROR_ILLEGAL_ARGUMENT
+[public final native void java.lang.Object.wait() throws java.lang.InterruptedException, ffffffff]
+[private static void Recurse.printOrWait(int,int,ControlData), 18]
+[private static java.lang.Object Recurse.baz(int,int,int,ControlData), 2]
+[private static long Recurse.bar(int,int,int,ControlData), 0]
+[public static int Recurse.foo(int,int,int,ControlData), 0]
+[private static java.lang.Object Recurse.baz(int,int,int,ControlData), 9]
+[private static long Recurse.bar(int,int,int,ControlData), 0]
+[public static int Recurse.foo(int,int,int,ControlData), 0]
+[private static java.lang.Object Recurse.baz(int,int,int,ControlData), 9]
+[private static long Recurse.bar(int,int,int,ControlData), 0]
+[public static int Recurse.foo(int,int,int,ControlData), 0]
+[private static java.lang.Object Recurse.baz(int,int,int,ControlData), 9]
+[private static long Recurse.bar(int,int,int,ControlData), 0]
+[public static int Recurse.foo(int,int,int,ControlData), 0]
+[private static java.lang.Object Recurse.baz(int,int,int,ControlData), 9]
+[private static long Recurse.bar(int,int,int,ControlData), 0]
+[public static int Recurse.foo(int,int,int,ControlData), 0]
+[public void Frames$1.run(), 4]
+JVMTI_ERROR_NO_MORE_FRAMES
+
+###########################
+### Other thread (live) ###
+###########################
+17
+JVMTI_ERROR_ILLEGAL_ARGUMENT
+[private static void Recurse.printOrWait(int,int,ControlData), 2c]
+[private static java.lang.Object Recurse.baz(int,int,int,ControlData), 2]
+[private static long Recurse.bar(int,int,int,ControlData), 0]
+[public static int Recurse.foo(int,int,int,ControlData), 0]
+[private static java.lang.Object Recurse.baz(int,int,int,ControlData), 9]
+[private static long Recurse.bar(int,int,int,ControlData), 0]
+[public static int Recurse.foo(int,int,int,ControlData), 0]
+[private static java.lang.Object Recurse.baz(int,int,int,ControlData), 9]
+[private static long Recurse.bar(int,int,int,ControlData), 0]
+[public static int Recurse.foo(int,int,int,ControlData), 0]
+[private static java.lang.Object Recurse.baz(int,int,int,ControlData), 9]
+[private static long Recurse.bar(int,int,int,ControlData), 0]
+[public static int Recurse.foo(int,int,int,ControlData), 0]
+[private static java.lang.Object Recurse.baz(int,int,int,ControlData), 9]
+[private static long Recurse.bar(int,int,int,ControlData), 0]
+[public static int Recurse.foo(int,int,int,ControlData), 0]
+[public void Frames$2.run(), 4]
+JVMTI_ERROR_NO_MORE_FRAMES
Done
diff --git a/test/911-get-stack-trace/src/AllTraces.java b/test/911-get-stack-trace/src/AllTraces.java
new file mode 100644
index 0000000000..adf6f38f5a
--- /dev/null
+++ b/test/911-get-stack-trace/src/AllTraces.java
@@ -0,0 +1,80 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.ArrayList;
+import java.util.List;
+
+public class AllTraces {
+ private final static List<Object> RETAIN = new ArrayList<Object>();
+
+ public static void doTest() throws Exception {
+ System.out.println("################################");
+ System.out.println("### Other threads (suspended) ###");
+ System.out.println("################################");
+
+ // Also create an unstarted and a dead thread.
+ RETAIN.add(new Thread());
+ Thread deadThread = new Thread();
+ RETAIN.add(deadThread);
+ deadThread.start();
+ deadThread.join();
+
+ final int N = 10;
+
+ final ControlData data = new ControlData(N);
+ data.waitFor = new Object();
+
+ Thread threads[] = new Thread[N];
+
+ for (int i = 0; i < N; i++) {
+ Thread t = new Thread() {
+ public void run() {
+ Recurse.foo(4, 0, 0, data);
+ }
+ };
+ t.start();
+ threads[i] = t;
+ }
+ data.reached.await();
+ Thread.yield();
+ Thread.sleep(500); // A little bit of time...
+
+ printAll(0);
+
+ printAll(5);
+
+ printAll(25);
+
+ // Let the thread make progress and die.
+ synchronized(data.waitFor) {
+ data.waitFor.notifyAll();
+ }
+ for (int i = 0; i < N; i++) {
+ threads[i].join();
+ }
+
+ RETAIN.clear();
+ }
+
+ public static void printAll(int max) {
+ PrintThread.printAll(getAllStackTraces(max));
+ }
+
+ // Get all stack traces. This will return an array with an element for each thread. The element
+ // is an array itself with the first element being the thread, and the second element a nested
+ // String array as in getStackTrace.
+ public static native Object[][] getAllStackTraces(int max);
+}
diff --git a/test/911-get-stack-trace/src/ControlData.java b/test/911-get-stack-trace/src/ControlData.java
new file mode 100644
index 0000000000..76ac4b8caa
--- /dev/null
+++ b/test/911-get-stack-trace/src/ControlData.java
@@ -0,0 +1,31 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.concurrent.CountDownLatch;
+
+public class ControlData {
+ CountDownLatch reached;
+ Object waitFor = null;
+ volatile boolean stop = false;
+
+ public ControlData() {
+ this(1);
+ }
+
+ public ControlData(int latchCount) {
+ reached = new CountDownLatch(latchCount);
+ }
+}
diff --git a/test/911-get-stack-trace/src/Frames.java b/test/911-get-stack-trace/src/Frames.java
new file mode 100644
index 0000000000..a1a11c3785
--- /dev/null
+++ b/test/911-get-stack-trace/src/Frames.java
@@ -0,0 +1,133 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Arrays;
+
+public class Frames {
+ public static void doTest() throws Exception {
+ doTestSameThread();
+
+ System.out.println();
+
+ doTestOtherThreadWait();
+
+ System.out.println();
+
+ doTestOtherThreadBusyLoop();
+ }
+
+ public static void doTestSameThread() {
+ System.out.println("###################");
+ System.out.println("### Same thread ###");
+ System.out.println("###################");
+
+ Thread t = Thread.currentThread();
+
+ int count = getFrameCount(t);
+ System.out.println(count);
+ try {
+ System.out.println(Arrays.toString(getFrameLocation(t, -1)));
+ } catch (RuntimeException e) {
+ System.out.println(e.getMessage());
+ }
+ for (int i = 0; i < count; i++) {
+ System.out.println(Arrays.toString(getFrameLocation(t, i)));
+ }
+ try {
+ System.out.println(Arrays.toString(getFrameLocation(t, count)));
+ } catch (RuntimeException e) {
+ System.out.println(e.getMessage());
+ }
+ }
+
+ public static void doTestOtherThreadWait() throws Exception {
+ System.out.println("################################");
+ System.out.println("### Other thread (suspended) ###");
+ System.out.println("################################");
+ final ControlData data = new ControlData();
+ data.waitFor = new Object();
+ Thread t = new Thread() {
+ public void run() {
+ Recurse.foo(4, 0, 0, data);
+ }
+ };
+ t.start();
+ data.reached.await();
+ Thread.yield();
+ Thread.sleep(500); // A little bit of time...
+
+ int count = getFrameCount(t);
+ System.out.println(count);
+ try {
+ System.out.println(Arrays.toString(getFrameLocation(t, -1)));
+ } catch (RuntimeException e) {
+ System.out.println(e.getMessage());
+ }
+ for (int i = 0; i < count; i++) {
+ System.out.println(Arrays.toString(getFrameLocation(t, i)));
+ }
+ try {
+ System.out.println(Arrays.toString(getFrameLocation(t, count)));
+ } catch (RuntimeException e) {
+ System.out.println(e.getMessage());
+ }
+
+ // Let the thread make progress and die.
+ synchronized(data.waitFor) {
+ data.waitFor.notifyAll();
+ }
+ t.join();
+ }
+
+ public static void doTestOtherThreadBusyLoop() throws Exception {
+ System.out.println("###########################");
+ System.out.println("### Other thread (live) ###");
+ System.out.println("###########################");
+ final ControlData data = new ControlData();
+ Thread t = new Thread() {
+ public void run() {
+ Recurse.foo(4, 0, 0, data);
+ }
+ };
+ t.start();
+ data.reached.await();
+ Thread.yield();
+ Thread.sleep(500); // A little bit of time...
+
+ int count = getFrameCount(t);
+ System.out.println(count);
+ try {
+ System.out.println(Arrays.toString(getFrameLocation(t, -1)));
+ } catch (RuntimeException e) {
+ System.out.println(e.getMessage());
+ }
+ for (int i = 0; i < count; i++) {
+ System.out.println(Arrays.toString(getFrameLocation(t, i)));
+ }
+ try {
+ System.out.println(Arrays.toString(getFrameLocation(t, count)));
+ } catch (RuntimeException e) {
+ System.out.println(e.getMessage());
+ }
+
+ // Let the thread stop looping and die.
+ data.stop = true;
+ t.join();
+ }
+
+ public static native int getFrameCount(Thread thread);
+ public static native Object[] getFrameLocation(Thread thread, int depth);
+}
diff --git a/test/911-get-stack-trace/src/Main.java b/test/911-get-stack-trace/src/Main.java
index 3479abbeae..b199033c32 100644
--- a/test/911-get-stack-trace/src/Main.java
+++ b/test/911-get-stack-trace/src/Main.java
@@ -14,273 +14,32 @@
* limitations under the License.
*/
-import java.util.ArrayList;
-import java.util.Arrays;
-import java.util.Collections;
-import java.util.List;
-import java.util.concurrent.CountDownLatch;
-
public class Main {
public static void main(String[] args) throws Exception {
System.loadLibrary(args[1]);
- doTest();
- doTestOtherThreadWait();
- doTestOtherThreadBusyLoop();
-
- doTestAllStackTraces();
-
- System.out.println("Done");
- }
-
- public static void doTest() throws Exception {
- System.out.println("###################");
- System.out.println("### Same thread ###");
- System.out.println("###################");
- System.out.println("From top");
- Recurse.foo(4, 0, 25, null);
- Recurse.foo(4, 1, 25, null);
- Recurse.foo(4, 0, 5, null);
- Recurse.foo(4, 2, 5, null);
+ SameThread.doTest();
- System.out.println("From bottom");
- Recurse.foo(4, -1, 25, null);
- Recurse.foo(4, -5, 5, null);
- Recurse.foo(4, -7, 5, null);
- }
-
- public static void doTestOtherThreadWait() throws Exception {
System.out.println();
- System.out.println("################################");
- System.out.println("### Other thread (suspended) ###");
- System.out.println("################################");
- final ControlData data = new ControlData();
- data.waitFor = new Object();
- Thread t = new Thread() {
- public void run() {
- Recurse.foo(4, 0, 0, data);
- }
- };
- t.start();
- data.reached.await();
- Thread.yield();
- Thread.sleep(500); // A little bit of time...
-
- System.out.println("From top");
- print(t, 0, 25);
- print(t, 1, 25);
- print(t, 0, 5);
- print(t, 2, 5);
- System.out.println("From bottom");
- print(t, -1, 25);
- print(t, -5, 5);
- print(t, -7, 5);
-
- // Let the thread make progress and die.
- synchronized(data.waitFor) {
- data.waitFor.notifyAll();
- }
- t.join();
- }
+ OtherThread.doTestOtherThreadWait();
- public static void doTestOtherThreadBusyLoop() throws Exception {
System.out.println();
- System.out.println("###########################");
- System.out.println("### Other thread (live) ###");
- System.out.println("###########################");
- final ControlData data = new ControlData();
- Thread t = new Thread() {
- public void run() {
- Recurse.foo(4, 0, 0, data);
- }
- };
- t.start();
- data.reached.await();
- Thread.yield();
- Thread.sleep(500); // A little bit of time...
- System.out.println("From top");
- print(t, 0, 25);
- print(t, 1, 25);
- print(t, 0, 5);
- print(t, 2, 5);
+ OtherThread.doTestOtherThreadBusyLoop();
- System.out.println("From bottom");
- print(t, -1, 25);
- print(t, -5, 5);
- print(t, -7, 5);
-
- // Let the thread stop looping and die.
- data.stop = true;
- t.join();
- }
-
- private final static List<Object> RETAIN = new ArrayList<Object>();
-
- public static void doTestAllStackTraces() throws Exception {
System.out.println();
- System.out.println("################################");
- System.out.println("### Other threads (suspended) ###");
- System.out.println("################################");
-
- // Also create an unstarted and a dead thread.
- RETAIN.add(new Thread());
- Thread deadThread = new Thread();
- RETAIN.add(deadThread);
- deadThread.start();
- deadThread.join();
-
- final int N = 10;
-
- final ControlData data = new ControlData(N);
- data.waitFor = new Object();
-
- Thread threads[] = new Thread[N];
-
- for (int i = 0; i < N; i++) {
- Thread t = new Thread() {
- public void run() {
- Recurse.foo(4, 0, 0, data);
- }
- };
- t.start();
- threads[i] = t;
- }
- data.reached.await();
- Thread.yield();
- Thread.sleep(500); // A little bit of time...
-
- printAll(0);
-
- printAll(5);
- printAll(25);
+ AllTraces.doTest();
- // Let the thread make progress and die.
- synchronized(data.waitFor) {
- data.waitFor.notifyAll();
- }
- for (int i = 0; i < N; i++) {
- threads[i].join();
- }
-
- RETAIN.clear();
- }
-
- public static void print(String[][] stack) {
- System.out.println("---------");
- for (String[] stackElement : stack) {
- for (String part : stackElement) {
- System.out.print(' ');
- System.out.print(part);
- }
- System.out.println();
- }
- }
-
- public static void print(Thread t, int start, int max) {
- print(getStackTrace(t, start, max));
- }
-
- public static void printAll(Object[][] stacks) {
- List<String> stringified = new ArrayList<String>(stacks.length);
-
- for (Object[] stackInfo : stacks) {
- Thread t = (Thread)stackInfo[0];
- String name = (t != null) ? t.getName() : "null";
- String stackSerialization;
- if (name.contains("Daemon")) {
- // Do not print daemon stacks, as they're non-deterministic.
- stackSerialization = "<not printed>";
- } else {
- StringBuilder sb = new StringBuilder();
- for (String[] stackElement : (String[][])stackInfo[1]) {
- for (String part : stackElement) {
- sb.append(' ');
- sb.append(part);
- }
- sb.append('\n');
- }
- stackSerialization = sb.toString();
- }
- stringified.add(name + "\n" + stackSerialization);
- }
-
- Collections.sort(stringified);
-
- for (String s : stringified) {
- System.out.println("---------");
- System.out.println(s);
- }
- }
-
- public static void printAll(int max) {
- printAll(getAllStackTraces(max));
- }
-
- // Wrap generated stack traces into a class to separate them nicely.
- public static class Recurse {
-
- public static int foo(int x, int start, int max, ControlData data) {
- bar(x, start, max, data);
- return 0;
- }
-
- private static long bar(int x, int start, int max, ControlData data) {
- baz(x, start, max, data);
- return 0;
- }
-
- private static Object baz(int x, int start, int max, ControlData data) {
- if (x == 0) {
- printOrWait(start, max, data);
- } else {
- foo(x - 1, start, max, data);
- }
- return null;
- }
+ System.out.println();
- private static void printOrWait(int start, int max, ControlData data) {
- if (data == null) {
- print(Thread.currentThread(), start, max);
- } else {
- if (data.waitFor != null) {
- synchronized (data.waitFor) {
- data.reached.countDown();
- try {
- data.waitFor.wait(); // Use wait() as it doesn't have a "hidden" Java call-graph.
- } catch (Throwable t) {
- throw new RuntimeException(t);
- }
- }
- } else {
- data.reached.countDown();
- while (!data.stop) {
- // Busy-loop.
- }
- }
- }
- }
- }
+ ThreadListTraces.doTest();
- public static class ControlData {
- CountDownLatch reached;
- Object waitFor = null;
- volatile boolean stop = false;
+ System.out.println();
- public ControlData() {
- this(1);
- }
+ Frames.doTest();
- public ControlData(int latchCount) {
- reached = new CountDownLatch(latchCount);
- }
+ System.out.println("Done");
}
-
- public static native String[][] getStackTrace(Thread thread, int start, int max);
- // Get all stack traces. This will return an array with an element for each thread. The element
- // is an array itself with the first element being the thread, and the second element a nested
- // String array as in getStackTrace.
- public static native Object[][] getAllStackTraces(int max);
}
diff --git a/test/911-get-stack-trace/src/OtherThread.java b/test/911-get-stack-trace/src/OtherThread.java
new file mode 100644
index 0000000000..0748433a20
--- /dev/null
+++ b/test/911-get-stack-trace/src/OtherThread.java
@@ -0,0 +1,82 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class OtherThread {
+ public static void doTestOtherThreadWait() throws Exception {
+ System.out.println("################################");
+ System.out.println("### Other thread (suspended) ###");
+ System.out.println("################################");
+ final ControlData data = new ControlData();
+ data.waitFor = new Object();
+ Thread t = new Thread() {
+ public void run() {
+ Recurse.foo(4, 0, 0, data);
+ }
+ };
+ t.start();
+ data.reached.await();
+ Thread.yield();
+ Thread.sleep(500); // A little bit of time...
+
+ System.out.println("From top");
+ PrintThread.print(t, 0, 25);
+ PrintThread.print(t, 1, 25);
+ PrintThread.print(t, 0, 5);
+ PrintThread.print(t, 2, 5);
+
+ System.out.println("From bottom");
+ PrintThread.print(t, -1, 25);
+ PrintThread.print(t, -5, 5);
+ PrintThread.print(t, -7, 5);
+
+ // Let the thread make progress and die.
+ synchronized(data.waitFor) {
+ data.waitFor.notifyAll();
+ }
+ t.join();
+ }
+
+ public static void doTestOtherThreadBusyLoop() throws Exception {
+ System.out.println("###########################");
+ System.out.println("### Other thread (live) ###");
+ System.out.println("###########################");
+ final ControlData data = new ControlData();
+ Thread t = new Thread() {
+ public void run() {
+ Recurse.foo(4, 0, 0, data);
+ }
+ };
+ t.start();
+ data.reached.await();
+ Thread.yield();
+ Thread.sleep(500); // A little bit of time...
+
+ System.out.println("From top");
+ PrintThread.print(t, 0, 25);
+ PrintThread.print(t, 1, 25);
+ PrintThread.print(t, 0, 5);
+ PrintThread.print(t, 2, 5);
+
+ System.out.println("From bottom");
+ PrintThread.print(t, -1, 25);
+ PrintThread.print(t, -5, 5);
+ PrintThread.print(t, -7, 5);
+
+ // Let the thread stop looping and die.
+ data.stop = true;
+ t.join();
+ }
+}
diff --git a/test/911-get-stack-trace/src/PrintThread.java b/test/911-get-stack-trace/src/PrintThread.java
new file mode 100644
index 0000000000..97815ccad9
--- /dev/null
+++ b/test/911-get-stack-trace/src/PrintThread.java
@@ -0,0 +1,70 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.ArrayList;
+import java.util.Collections;
+import java.util.List;
+
+public class PrintThread {
+ public static void print(String[][] stack) {
+ System.out.println("---------");
+ for (String[] stackElement : stack) {
+ for (String part : stackElement) {
+ System.out.print(' ');
+ System.out.print(part);
+ }
+ System.out.println();
+ }
+ }
+
+ public static void print(Thread t, int start, int max) {
+ print(getStackTrace(t, start, max));
+ }
+
+ public static void printAll(Object[][] stacks) {
+ List<String> stringified = new ArrayList<String>(stacks.length);
+
+ for (Object[] stackInfo : stacks) {
+ Thread t = (Thread)stackInfo[0];
+ String name = (t != null) ? t.getName() : "null";
+ String stackSerialization;
+ if (name.contains("Daemon")) {
+ // Do not print daemon stacks, as they're non-deterministic.
+ stackSerialization = "<not printed>";
+ } else {
+ StringBuilder sb = new StringBuilder();
+ for (String[] stackElement : (String[][])stackInfo[1]) {
+ for (String part : stackElement) {
+ sb.append(' ');
+ sb.append(part);
+ }
+ sb.append('\n');
+ }
+ stackSerialization = sb.toString();
+ }
+ stringified.add(name + "\n" + stackSerialization);
+ }
+
+ Collections.sort(stringified);
+
+ for (String s : stringified) {
+ System.out.println("---------");
+ System.out.println(s);
+ }
+ }
+
+ public static native String[][] getStackTrace(Thread thread, int start, int max);
+} \ No newline at end of file
diff --git a/test/911-get-stack-trace/src/Recurse.java b/test/911-get-stack-trace/src/Recurse.java
new file mode 100644
index 0000000000..439fbaaf84
--- /dev/null
+++ b/test/911-get-stack-trace/src/Recurse.java
@@ -0,0 +1,58 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class Recurse {
+ public static int foo(int x, int start, int max, ControlData data) {
+ bar(x, start, max, data);
+ return 0;
+ }
+
+ private static long bar(int x, int start, int max, ControlData data) {
+ baz(x, start, max, data);
+ return 0;
+ }
+
+ private static Object baz(int x, int start, int max, ControlData data) {
+ if (x == 0) {
+ printOrWait(start, max, data);
+ } else {
+ foo(x - 1, start, max, data);
+ }
+ return null;
+ }
+
+ private static void printOrWait(int start, int max, ControlData data) {
+ if (data == null) {
+ PrintThread.print(Thread.currentThread(), start, max);
+ } else {
+ if (data.waitFor != null) {
+ synchronized (data.waitFor) {
+ data.reached.countDown();
+ try {
+ data.waitFor.wait(); // Use wait() as it doesn't have a "hidden" Java call-graph.
+ } catch (Throwable t) {
+ throw new RuntimeException(t);
+ }
+ }
+ } else {
+ data.reached.countDown();
+ while (!data.stop) {
+ // Busy-loop.
+ }
+ }
+ }
+ }
+} \ No newline at end of file
diff --git a/test/911-get-stack-trace/src/SameThread.java b/test/911-get-stack-trace/src/SameThread.java
new file mode 100644
index 0000000000..f1e19e367a
--- /dev/null
+++ b/test/911-get-stack-trace/src/SameThread.java
@@ -0,0 +1,33 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class SameThread {
+ public static void doTest() throws Exception {
+ System.out.println("###################");
+ System.out.println("### Same thread ###");
+ System.out.println("###################");
+ System.out.println("From top");
+ Recurse.foo(4, 0, 25, null);
+ Recurse.foo(4, 1, 25, null);
+ Recurse.foo(4, 0, 5, null);
+ Recurse.foo(4, 2, 5, null);
+
+ System.out.println("From bottom");
+ Recurse.foo(4, -1, 25, null);
+ Recurse.foo(4, -5, 5, null);
+ Recurse.foo(4, -7, 5, null);
+ }
+}
diff --git a/test/911-get-stack-trace/src/ThreadListTraces.java b/test/911-get-stack-trace/src/ThreadListTraces.java
new file mode 100644
index 0000000000..f66557f3bd
--- /dev/null
+++ b/test/911-get-stack-trace/src/ThreadListTraces.java
@@ -0,0 +1,71 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class ThreadListTraces {
+ public static void doTest() throws Exception {
+ System.out.println("########################################");
+ System.out.println("### Other select threads (suspended) ###");
+ System.out.println("########################################");
+
+ final int N = 10;
+
+ final ControlData data = new ControlData(N);
+ data.waitFor = new Object();
+
+ Thread threads[] = new Thread[N];
+
+ Thread list[] = new Thread[N/2 + 1];
+
+ for (int i = 0; i < N; i++) {
+ Thread t = new Thread() {
+ public void run() {
+ Recurse.foo(4, 0, 0, data);
+ }
+ };
+ t.start();
+ threads[i] = t;
+ if (i % 2 == 0) {
+ list[i/2] = t;
+ }
+ }
+ list[list.length - 1] = Thread.currentThread();
+
+ data.reached.await();
+ Thread.yield();
+ Thread.sleep(500); // A little bit of time...
+
+ printList(list, 0);
+
+ printList(list, 5);
+
+ printList(list, 25);
+
+ // Let the thread make progress and die.
+ synchronized(data.waitFor) {
+ data.waitFor.notifyAll();
+ }
+ for (int i = 0; i < N; i++) {
+ threads[i].join();
+ }
+ }
+
+ public static void printList(Thread[] threads, int max) {
+ PrintThread.printAll(getThreadListStackTraces(threads, max));
+ }
+
+ // Similar to getAllStackTraces, but restricted to the given threads.
+ public static native Object[][] getThreadListStackTraces(Thread threads[], int max);
+}
diff --git a/test/911-get-stack-trace/stack_trace.cc b/test/911-get-stack-trace/stack_trace.cc
index 57d4f6d2ee..d162e8a169 100644
--- a/test/911-get-stack-trace/stack_trace.cc
+++ b/test/911-get-stack-trace/stack_trace.cc
@@ -20,6 +20,7 @@
#include "android-base/stringprintf.h"
+#include "android-base/stringprintf.h"
#include "base/logging.h"
#include "base/macros.h"
#include "jni.h"
@@ -59,11 +60,7 @@ static jobjectArray TranslateJvmtiFrameInfoArray(JNIEnv* env,
char* gen;
{
jvmtiError result2 = jvmti_env->GetMethodName(frames[method_index].method, &name, &sig, &gen);
- if (result2 != JVMTI_ERROR_NONE) {
- char* err;
- jvmti_env->GetErrorName(result2, &err);
- printf("Failure running GetMethodName: %s\n", err);
- jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(err));
+ if (JvmtiErrorToException(env, result2)) {
return nullptr;
}
}
@@ -127,18 +124,14 @@ static jobjectArray TranslateJvmtiFrameInfoArray(JNIEnv* env,
return CreateObjectArray(env, count, "[Ljava/lang/String;", callback);
}
-extern "C" JNIEXPORT jobjectArray JNICALL Java_Main_getStackTrace(
+extern "C" JNIEXPORT jobjectArray JNICALL Java_PrintThread_getStackTrace(
JNIEnv* env, jclass klass ATTRIBUTE_UNUSED, jthread thread, jint start, jint max) {
std::unique_ptr<jvmtiFrameInfo[]> frames(new jvmtiFrameInfo[max]);
jint count;
{
jvmtiError result = jvmti_env->GetStackTrace(thread, start, max, frames.get(), &count);
- if (result != JVMTI_ERROR_NONE) {
- char* err;
- jvmti_env->GetErrorName(result, &err);
- printf("Failure running GetStackTrace: %s\n", err);
- jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(err));
+ if (JvmtiErrorToException(env, result)) {
return nullptr;
}
}
@@ -146,19 +139,13 @@ extern "C" JNIEXPORT jobjectArray JNICALL Java_Main_getStackTrace(
return TranslateJvmtiFrameInfoArray(env, frames.get(), count);
}
-extern "C" JNIEXPORT jobjectArray JNICALL Java_Main_getAllStackTraces(
+extern "C" JNIEXPORT jobjectArray JNICALL Java_AllTraces_getAllStackTraces(
JNIEnv* env, jclass klass ATTRIBUTE_UNUSED, jint max) {
- std::unique_ptr<jvmtiFrameInfo[]> frames(new jvmtiFrameInfo[max]);
-
jint thread_count;
jvmtiStackInfo* stack_infos;
{
jvmtiError result = jvmti_env->GetAllStackTraces(max, &stack_infos, &thread_count);
- if (result != JVMTI_ERROR_NONE) {
- char* err;
- jvmti_env->GetErrorName(result, &err);
- printf("Failure running GetAllStackTraces: %s\n", err);
- jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(err));
+ if (JvmtiErrorToException(env, result)) {
return nullptr;
}
}
@@ -180,5 +167,91 @@ extern "C" JNIEXPORT jobjectArray JNICALL Java_Main_getAllStackTraces(
return ret;
}
+extern "C" JNIEXPORT jobjectArray JNICALL Java_ThreadListTraces_getThreadListStackTraces(
+ JNIEnv* env, jclass klass ATTRIBUTE_UNUSED, jobjectArray jthreads, jint max) {
+ jint thread_count = env->GetArrayLength(jthreads);
+ std::unique_ptr<jthread[]> threads(new jthread[thread_count]);
+ for (jint i = 0; i != thread_count; ++i) {
+ threads[i] = env->GetObjectArrayElement(jthreads, i);
+ }
+
+ jvmtiStackInfo* stack_infos;
+ {
+ jvmtiError result = jvmti_env->GetThreadListStackTraces(thread_count,
+ threads.get(),
+ max,
+ &stack_infos);
+ if (JvmtiErrorToException(env, result)) {
+ return nullptr;
+ }
+ }
+
+ auto callback = [&](jint thread_index) -> jobject {
+ auto inner_callback = [&](jint index) -> jobject {
+ if (index == 0) {
+ return stack_infos[thread_index].thread;
+ } else {
+ return TranslateJvmtiFrameInfoArray(env,
+ stack_infos[thread_index].frame_buffer,
+ stack_infos[thread_index].frame_count);
+ }
+ };
+ return CreateObjectArray(env, 2, "java/lang/Object", inner_callback);
+ };
+ jobjectArray ret = CreateObjectArray(env, thread_count, "[Ljava/lang/Object;", callback);
+ jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(stack_infos));
+ return ret;
+}
+
+extern "C" JNIEXPORT jint JNICALL Java_Frames_getFrameCount(
+ JNIEnv* env, jclass klass ATTRIBUTE_UNUSED, jthread thread) {
+ jint count;
+ jvmtiError result = jvmti_env->GetFrameCount(thread, &count);
+ if (JvmtiErrorToException(env, result)) {
+ return -1;
+ }
+ return count;
+}
+
+extern "C" JNIEXPORT jobjectArray JNICALL Java_Frames_getFrameLocation(
+ JNIEnv* env, jclass klass ATTRIBUTE_UNUSED, jthread thread, jint depth) {
+ jmethodID method;
+ jlocation location;
+
+ jvmtiError result = jvmti_env->GetFrameLocation(thread, depth, &method, &location);
+ if (JvmtiErrorToException(env, result)) {
+ return nullptr;
+ }
+
+ auto callback = [&](jint index) -> jobject {
+ switch (index) {
+ case 0:
+ {
+ jclass decl_class;
+ jvmtiError class_result = jvmti_env->GetMethodDeclaringClass(method, &decl_class);
+ if (JvmtiErrorToException(env, class_result)) {
+ return nullptr;
+ }
+ jint modifiers;
+ jvmtiError mod_result = jvmti_env->GetMethodModifiers(method, &modifiers);
+ if (JvmtiErrorToException(env, mod_result)) {
+ return nullptr;
+ }
+ constexpr jint kStatic = 0x8;
+ return env->ToReflectedMethod(decl_class,
+ method,
+ (modifiers & kStatic) != 0 ? JNI_TRUE : JNI_FALSE);
+ }
+ case 1:
+ return env->NewStringUTF(
+ android::base::StringPrintf("%x", static_cast<uint32_t>(location)).c_str());
+ }
+ LOG(FATAL) << "Unreachable";
+ UNREACHABLE();
+ };
+ jobjectArray ret = CreateObjectArray(env, 2, "java/lang/Object", callback);
+ return ret;
+}
+
} // namespace Test911GetStackTrace
} // namespace art
diff --git a/test/912-classes/classes.cc b/test/912-classes/classes.cc
index 69301c7925..29eeff6694 100644
--- a/test/912-classes/classes.cc
+++ b/test/912-classes/classes.cc
@@ -222,5 +222,42 @@ extern "C" JNIEXPORT jobject JNICALL Java_Main_getClassLoader(
return classloader;
}
+extern "C" JNIEXPORT jobjectArray JNICALL Java_Main_getClassLoaderClasses(
+ JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED, jobject jclassloader) {
+ jint count = 0;
+ jclass* classes = nullptr;
+ jvmtiError result = jvmti_env->GetClassLoaderClasses(jclassloader, &count, &classes);
+ if (JvmtiErrorToException(env, result)) {
+ return nullptr;
+ }
+
+ auto callback = [&](jint i) {
+ return classes[i];
+ };
+ jobjectArray ret = CreateObjectArray(env, count, "java/lang/Class", callback);
+ if (classes != nullptr) {
+ jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(classes));
+ }
+ return ret;
+}
+
+extern "C" JNIEXPORT jintArray JNICALL Java_Main_getClassVersion(
+ JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED, jclass klass) {
+ jint major, minor;
+ jvmtiError result = jvmti_env->GetClassVersionNumbers(klass, &minor, &major);
+ if (JvmtiErrorToException(env, result)) {
+ return nullptr;
+ }
+
+ jintArray int_array = env->NewIntArray(2);
+ if (int_array == nullptr) {
+ return nullptr;
+ }
+ jint buf[2] = { major, minor };
+ env->SetIntArrayRegion(int_array, 0, 2, buf);
+
+ return int_array;
+}
+
} // namespace Test912Classes
} // namespace art
diff --git a/test/912-classes/expected.txt b/test/912-classes/expected.txt
index 44c861a3b7..f3cb261480 100644
--- a/test/912-classes/expected.txt
+++ b/test/912-classes/expected.txt
@@ -43,3 +43,21 @@ class java.lang.String null
class [Ljava.lang.String; null
interface Main$InfA dalvik.system.PathClassLoader
class $Proxy0 dalvik.system.PathClassLoader
+
+boot <- src <- src-ex (A,B)
+912-classes-ex.jar+ -> 912-classes.jar+ ->
+[class A, class B, class java.lang.Object]
+912-classes.jar+ ->
+[class B, class java.lang.Object]
+
+boot <- src (B) <- src-ex (A, List)
+912-classes-ex.jar+ -> 912-classes.jar+ ->
+[class A, class java.lang.Object, interface java.util.List]
+912-classes.jar+ ->
+[class B, class java.lang.Object]
+
+boot <- src+src-ex (A,B)
+912-classes.jar+ ->
+[class A, class B, class java.lang.Object]
+
+[37, 0]
diff --git a/test/912-classes/run b/test/912-classes/run
index 4379349cb2..20dfc4b767 100755
--- a/test/912-classes/run
+++ b/test/912-classes/run
@@ -14,6 +14,11 @@
# See the License for the specific language governing permissions and
# limitations under the License.
+# This test checks which classes are initiated by a classloader. App images preload classes.
+# In certain configurations, the app images may be valid even in a new classloader. Turn off
+# app images to avoid the issue.
+
./default-run "$@" --experimental agents \
--experimental runtime-plugins \
- --jvmti
+ --jvmti \
+ --no-app-image
diff --git a/test/912-classes/src-ex/A.java b/test/912-classes/src-ex/A.java
new file mode 100644
index 0000000000..64acb2fcfe
--- /dev/null
+++ b/test/912-classes/src-ex/A.java
@@ -0,0 +1,18 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class A {
+} \ No newline at end of file
diff --git a/test/912-classes/src/B.java b/test/912-classes/src/B.java
new file mode 100644
index 0000000000..f1458c3bca
--- /dev/null
+++ b/test/912-classes/src/B.java
@@ -0,0 +1,18 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class B {
+} \ No newline at end of file
diff --git a/test/912-classes/src/Main.java b/test/912-classes/src/Main.java
index e627d4227a..cbf2392a73 100644
--- a/test/912-classes/src/Main.java
+++ b/test/912-classes/src/Main.java
@@ -14,8 +14,10 @@
* limitations under the License.
*/
+import java.lang.reflect.Constructor;
import java.lang.reflect.Proxy;
import java.util.Arrays;
+import java.util.Comparator;
public class Main {
public static void main(String[] args) throws Exception {
@@ -76,6 +78,12 @@ public class Main {
testClassLoader(String[].class);
testClassLoader(InfA.class);
testClassLoader(getProxyClass());
+
+ testClassLoaderClasses();
+
+ System.out.println();
+
+ testClassVersion();
}
private static Class<?> proxyClass = null;
@@ -151,6 +159,99 @@ public class Main {
}
}
+ private static void testClassLoaderClasses() throws Exception {
+ ClassLoader boot = ClassLoader.getSystemClassLoader().getParent();
+ while (boot.getParent() != null) {
+ boot = boot.getParent();
+ }
+
+ System.out.println();
+ System.out.println("boot <- src <- src-ex (A,B)");
+ ClassLoader cl1 = create(create(boot, DEX1), DEX2);
+ Class.forName("B", false, cl1);
+ Class.forName("A", false, cl1);
+ printClassLoaderClasses(cl1);
+
+ System.out.println();
+ System.out.println("boot <- src (B) <- src-ex (A, List)");
+ ClassLoader cl2 = create(create(boot, DEX1), DEX2);
+ Class.forName("A", false, cl2);
+ Class.forName("java.util.List", false, cl2);
+ Class.forName("B", false, cl2.getParent());
+ printClassLoaderClasses(cl2);
+
+ System.out.println();
+ System.out.println("boot <- src+src-ex (A,B)");
+ ClassLoader cl3 = create(boot, DEX1, DEX2);
+ Class.forName("B", false, cl3);
+ Class.forName("A", false, cl3);
+ printClassLoaderClasses(cl3);
+
+ // Check that the boot classloader dumps something non-empty.
+ Class<?>[] bootClasses = getClassLoaderClasses(boot);
+ if (bootClasses.length == 0) {
+ throw new RuntimeException("No classes initiated by boot classloader.");
+ }
+ // Check that at least java.util.List is loaded.
+ boolean foundList = false;
+ for (Class<?> c : bootClasses) {
+ if (c == java.util.List.class) {
+ foundList = true;
+ break;
+ }
+ }
+ if (!foundList) {
+ System.out.println(Arrays.toString(bootClasses));
+ throw new RuntimeException("Could not find class java.util.List.");
+ }
+ }
+
+ private static void testClassVersion() {
+ System.out.println(Arrays.toString(getClassVersion(Main.class)));
+ }
+
+ private static void printClassLoaderClasses(ClassLoader cl) {
+ for (;;) {
+ if (cl == null || !cl.getClass().getName().startsWith("dalvik.system")) {
+ break;
+ }
+
+ ClassLoader saved = cl;
+ for (;;) {
+ if (cl == null || !cl.getClass().getName().startsWith("dalvik.system")) {
+ break;
+ }
+ String s = cl.toString();
+ int index1 = s.indexOf("zip file");
+ int index2 = s.indexOf(']', index1);
+ if (index2 < 0) {
+ throw new RuntimeException("Unexpected classloader " + s);
+ }
+ String zip_file = s.substring(index1, index2);
+ int index3 = zip_file.indexOf('"');
+ int index4 = zip_file.indexOf('"', index3 + 1);
+ if (index4 < 0) {
+ throw new RuntimeException("Unexpected classloader " + s);
+ }
+ String paths = zip_file.substring(index3 + 1, index4);
+ String pathArray[] = paths.split(":");
+ for (String path : pathArray) {
+ int index5 = path.lastIndexOf('/');
+ System.out.print(path.substring(index5 + 1));
+ System.out.print('+');
+ }
+ System.out.print(" -> ");
+ cl = cl.getParent();
+ }
+ System.out.println();
+ Class<?> classes[] = getClassLoaderClasses(saved);
+ Arrays.sort(classes, new ClassNameComparator());
+ System.out.println(Arrays.toString(classes));
+
+ cl = saved.getParent();
+ }
+ }
+
private static native boolean isModifiableClass(Class<?> c);
private static native String[] getClassSignature(Class<?> c);
@@ -161,12 +262,16 @@ public class Main {
private static native Object[] getClassFields(Class<?> c);
private static native Object[] getClassMethods(Class<?> c);
- private static native Class[] getImplementedInterfaces(Class<?> c);
+ private static native Class<?>[] getImplementedInterfaces(Class<?> c);
private static native int getClassStatus(Class<?> c);
private static native Object getClassLoader(Class<?> c);
+ private static native Class<?>[] getClassLoaderClasses(ClassLoader cl);
+
+ private static native int[] getClassVersion(Class<?> c);
+
private static class TestForNonInit {
public static double dummy = Math.random(); // So it can't be compile-time initialized.
}
@@ -188,4 +293,23 @@ public class Main {
}
public abstract static class ClassC implements InfA, InfC {
}
+
+ private static final String DEX1 = System.getenv("DEX_LOCATION") + "/912-classes.jar";
+ private static final String DEX2 = System.getenv("DEX_LOCATION") + "/912-classes-ex.jar";
+
+ private static ClassLoader create(ClassLoader parent, String... elements) throws Exception {
+ // Note: We use a PathClassLoader, as we do not care about code performance. We only load
+ // the classes, and they're empty.
+ Class<?> pathClassLoaderClass = Class.forName("dalvik.system.PathClassLoader");
+ Constructor<?> pathClassLoaderInit = pathClassLoaderClass.getConstructor(String.class,
+ ClassLoader.class);
+ String path = String.join(":", elements);
+ return (ClassLoader) pathClassLoaderInit.newInstance(path, parent);
+ }
+
+ private static class ClassNameComparator implements Comparator<Class<?>> {
+ public int compare(Class<?> c1, Class<?> c2) {
+ return c1.getName().compareTo(c2.getName());
+ }
+ }
}
diff --git a/test/916-obsolete-jit/src/Main.java b/test/916-obsolete-jit/src/Main.java
index 74eb003d5c..1e43f7ee9d 100644
--- a/test/916-obsolete-jit/src/Main.java
+++ b/test/916-obsolete-jit/src/Main.java
@@ -157,38 +157,13 @@ public class Main {
doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
}
};
- // This does nothing.
- Runnable noop = () -> {};
// This just prints something out to show we are running the Runnable.
Runnable say_nothing = () -> { w.accept("Not doing anything here"); };
- // This checks to see if we have jitted the methods we are testing.
- Runnable check_interpreting = () -> {
- // TODO remove the second check when we remove the doCall function. We need to check that
- // both of these functions aren't being interpreted because if sayHi is the test doesn't do
- // anything and if doCall is then there will be a runtime call right above the sayHi
- // function preventing sayHi from being deoptimized.
- interpreting = has_jit && (Main.isInterpretedFunction(say_hi_method, true) ||
- Main.isInterpretedFunction(do_call_method, false));
- };
do {
- w.clear();
- // Wait for the methods to be jitted
- long j = 0;
- do {
- for (int i = 0; i < 10000; i++) {
- t.sayHi(noop, w);
- j++;
- // Clear so that we won't OOM if we go around a few times.
- w.clear();
- }
- t.sayHi(check_interpreting, w);
- if (j >= 1000000) {
- System.out.println("FAIL: Could not make sayHi be Jitted!");
- return;
- }
- j++;
- } while(interpreting);
- // Clear output. Now we try for real.
+ // Run ensureJitCompiled here since it might get GCd
+ ensureJitCompiled(Transform.class, "sayHi");
+ ensureJitCompiled(Main.class, "doCall");
+ // Clear output.
w.clear();
// Try and redefine.
t.sayHi(say_nothing, w);
@@ -203,6 +178,8 @@ public class Main {
private static native boolean isInterpretedFunction(Method m, boolean require_deoptimizable);
+ private static native void ensureJitCompiled(Class c, String name);
+
// Transforms the class
private static native void doCommonClassRedefinition(Class<?> target,
byte[] classfile,
diff --git a/test/921-hello-failure/expected.txt b/test/921-hello-failure/expected.txt
index e2665ef30b..9615e6b33d 100644
--- a/test/921-hello-failure/expected.txt
+++ b/test/921-hello-failure/expected.txt
@@ -13,3 +13,19 @@ hello2 - MissingInterface
hello2 - ReorderInterface
Transformation error : java.lang.Exception(Failed to redefine class <LTransform2;> due to JVMTI_ERROR_UNSUPPORTED_REDEFINITION_HIERARCHY_CHANGED)
hello2 - ReorderInterface
+hello - MultiRedef
+hello2 - MultiRedef
+Transformation error : java.lang.Exception(Failed to redefine classes <LTransform2;, LTransform;> due to JVMTI_ERROR_NAMES_DONT_MATCH)
+hello - MultiRedef
+hello2 - MultiRedef
+Transformation error : java.lang.Exception(Failed to redefine classes <LTransform;, LTransform2;> due to JVMTI_ERROR_NAMES_DONT_MATCH)
+hello - MultiRedef
+hello2 - MultiRedef
+hello - MultiRetrans
+hello2 - MultiRetrans
+Transformation error : java.lang.Exception(Failed to retransform classes <LTransform2;, LTransform;> due to JVMTI_ERROR_NAMES_DONT_MATCH)
+hello - MultiRetrans
+hello2 - MultiRetrans
+Transformation error : java.lang.Exception(Failed to retransform classes <LTransform;, LTransform2;> due to JVMTI_ERROR_NAMES_DONT_MATCH)
+hello - MultiRetrans
+hello2 - MultiRetrans
diff --git a/test/921-hello-failure/src/CommonClassDefinition.java b/test/921-hello-failure/src/CommonClassDefinition.java
new file mode 100644
index 0000000000..62602a02e9
--- /dev/null
+++ b/test/921-hello-failure/src/CommonClassDefinition.java
@@ -0,0 +1,27 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+}
diff --git a/test/921-hello-failure/src/Main.java b/test/921-hello-failure/src/Main.java
index 69c48e26cc..43d6e9ed07 100644
--- a/test/921-hello-failure/src/Main.java
+++ b/test/921-hello-failure/src/Main.java
@@ -14,6 +14,7 @@
* limitations under the License.
*/
+import java.util.ArrayList;
public class Main {
public static void main(String[] args) {
@@ -23,10 +24,44 @@ public class Main {
NewInterface.doTest(new Transform2());
MissingInterface.doTest(new Transform2());
ReorderInterface.doTest(new Transform2());
+ MultiRedef.doTest(new Transform(), new Transform2());
+ MultiRetrans.doTest(new Transform(), new Transform2());
}
// Transforms the class. This throws an exception if something goes wrong.
public static native void doCommonClassRedefinition(Class<?> target,
byte[] classfile,
byte[] dexfile) throws Exception;
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) throws Exception {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) throws Exception {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles) throws Exception;
+ public static native void doCommonClassRetransformation(Class<?>... target) throws Exception;
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
}
diff --git a/test/921-hello-failure/src/MultiRedef.java b/test/921-hello-failure/src/MultiRedef.java
new file mode 100644
index 0000000000..c64342c8f8
--- /dev/null
+++ b/test/921-hello-failure/src/MultiRedef.java
@@ -0,0 +1,100 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+
+class MultiRedef {
+
+ // class NotTransform {
+ // public void sayHi(String name) {
+ // throw new Error("Should not be called!");
+ // }
+ // }
+ private static CommonClassDefinition INVALID_DEFINITION_T1 = new CommonClassDefinition(
+ Transform.class,
+ Base64.getDecoder().decode(
+ "yv66vgAAADQAFQoABgAPBwAQCAARCgACABIHABMHABQBAAY8aW5pdD4BAAMoKVYBAARDb2RlAQAP" +
+ "TGluZU51bWJlclRhYmxlAQAFc2F5SGkBABUoTGphdmEvbGFuZy9TdHJpbmc7KVYBAApTb3VyY2VG" +
+ "aWxlAQARTm90VHJhbnNmb3JtLmphdmEMAAcACAEAD2phdmEvbGFuZy9FcnJvcgEAFVNob3VsZCBu" +
+ "b3QgYmUgY2FsbGVkIQwABwAMAQAMTm90VHJhbnNmb3JtAQAQamF2YS9sYW5nL09iamVjdAAgAAUA" +
+ "BgAAAAAAAgAAAAcACAABAAkAAAAdAAEAAQAAAAUqtwABsQAAAAEACgAAAAYAAQAAAAEAAQALAAwA" +
+ "AQAJAAAAIgADAAIAAAAKuwACWRIDtwAEvwAAAAEACgAAAAYAAQAAAAMAAQANAAAAAgAO"),
+ Base64.getDecoder().decode(
+ "ZGV4CjAzNQDLV95i5xnv6iUi6uIeDoY5jP5Xe9NP1AiYAgAAcAAAAHhWNBIAAAAAAAAAAAQCAAAL" +
+ "AAAAcAAAAAUAAACcAAAAAgAAALAAAAAAAAAAAAAAAAQAAADIAAAAAQAAAOgAAACQAQAACAEAAEoB" +
+ "AABSAQAAYgEAAHUBAACJAQAAnQEAALABAADHAQAAygEAAM4BAADiAQAAAQAAAAIAAAADAAAABAAA" +
+ "AAcAAAAHAAAABAAAAAAAAAAIAAAABAAAAEQBAAAAAAAAAAAAAAAAAQAKAAAAAQABAAAAAAACAAAA" +
+ "AAAAAAAAAAAAAAAAAgAAAAAAAAAFAAAAAAAAAPQBAAAAAAAAAQABAAEAAADpAQAABAAAAHAQAwAA" +
+ "AA4ABAACAAIAAADuAQAACQAAACIAAQAbAQYAAABwIAIAEAAnAAAAAQAAAAMABjxpbml0PgAOTE5v" +
+ "dFRyYW5zZm9ybTsAEUxqYXZhL2xhbmcvRXJyb3I7ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZh" +
+ "L2xhbmcvU3RyaW5nOwARTm90VHJhbnNmb3JtLmphdmEAFVNob3VsZCBub3QgYmUgY2FsbGVkIQAB" +
+ "VgACVkwAEmVtaXR0ZXI6IGphY2stNC4yMAAFc2F5SGkAAQAHDgADAQAHDgAAAAEBAICABIgCAQGg" +
+ "AgAADAAAAAAAAAABAAAAAAAAAAEAAAALAAAAcAAAAAIAAAAFAAAAnAAAAAMAAAACAAAAsAAAAAUA" +
+ "AAAEAAAAyAAAAAYAAAABAAAA6AAAAAEgAAACAAAACAEAAAEQAAABAAAARAEAAAIgAAALAAAASgEA" +
+ "AAMgAAACAAAA6QEAAAAgAAABAAAA9AEAAAAQAAABAAAABAIAAA=="));
+
+ // Valid redefinition of Transform2
+ // class Transform2 implements Iface1, Iface2 {
+ // public void sayHi(String name) {
+ // throw new Error("Should not be called!");
+ // }
+ // }
+ private static CommonClassDefinition VALID_DEFINITION_T2 = new CommonClassDefinition(
+ Transform2.class,
+ Base64.getDecoder().decode(
+ "yv66vgAAADQAGQoABgARBwASCAATCgACABQHABUHABYHABcHABgBAAY8aW5pdD4BAAMoKVYBAARD" +
+ "b2RlAQAPTGluZU51bWJlclRhYmxlAQAFc2F5SGkBABUoTGphdmEvbGFuZy9TdHJpbmc7KVYBAApT" +
+ "b3VyY2VGaWxlAQAPVHJhbnNmb3JtMi5qYXZhDAAJAAoBAA9qYXZhL2xhbmcvRXJyb3IBABVTaG91" +
+ "bGQgbm90IGJlIGNhbGxlZCEMAAkADgEAClRyYW5zZm9ybTIBABBqYXZhL2xhbmcvT2JqZWN0AQAG" +
+ "SWZhY2UxAQAGSWZhY2UyACAABQAGAAIABwAIAAAAAgAAAAkACgABAAsAAAAdAAEAAQAAAAUqtwAB" +
+ "sQAAAAEADAAAAAYAAQAAAAEAAQANAA4AAQALAAAAIgADAAIAAAAKuwACWRIDtwAEvwAAAAEADAAA" +
+ "AAYAAQAAAAMAAQAPAAAAAgAQ"),
+ Base64.getDecoder().decode(
+ "ZGV4CjAzNQDSWls05CPkX+gbTGMVRvx9dc9vozzVbu7AAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAN" +
+ "AAAAcAAAAAcAAACkAAAAAgAAAMAAAAAAAAAAAAAAAAQAAADYAAAAAQAAAPgAAACoAQAAGAEAAGIB" +
+ "AABqAQAAdAEAAH4BAACMAQAAnwEAALMBAADHAQAA3gEAAO8BAADyAQAA9gEAAAoCAAABAAAAAgAA" +
+ "AAMAAAAEAAAABQAAAAYAAAAJAAAACQAAAAYAAAAAAAAACgAAAAYAAABcAQAAAgAAAAAAAAACAAEA" +
+ "DAAAAAMAAQAAAAAABAAAAAAAAAACAAAAAAAAAAQAAABUAQAACAAAAAAAAAAcAgAAAAAAAAEAAQAB" +
+ "AAAAEQIAAAQAAABwEAMAAAAOAAQAAgACAAAAFgIAAAkAAAAiAAMAGwEHAAAAcCACABAAJwAAAAIA" +
+ "AAAAAAEAAQAAAAUABjxpbml0PgAITElmYWNlMTsACExJZmFjZTI7AAxMVHJhbnNmb3JtMjsAEUxq" +
+ "YXZhL2xhbmcvRXJyb3I7ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwAV" +
+ "U2hvdWxkIG5vdCBiZSBjYWxsZWQhAA9UcmFuc2Zvcm0yLmphdmEAAVYAAlZMABJlbWl0dGVyOiBq" +
+ "YWNrLTQuMjAABXNheUhpAAEABw4AAwEABw4AAAABAQCAgASYAgEBsAIAAAwAAAAAAAAAAQAAAAAA" +
+ "AAABAAAADQAAAHAAAAACAAAABwAAAKQAAAADAAAAAgAAAMAAAAAFAAAABAAAANgAAAAGAAAAAQAA" +
+ "APgAAAABIAAAAgAAABgBAAABEAAAAgAAAFQBAAACIAAADQAAAGIBAAADIAAAAgAAABECAAAAIAAA" +
+ "AQAAABwCAAAAEAAAAQAAACwCAAA="));
+
+ public static void doTest(Transform t1, Transform2 t2) {
+ t1.sayHi("MultiRedef");
+ t2.sayHi("MultiRedef");
+ try {
+ Main.doMultiClassRedefinition(VALID_DEFINITION_T2, INVALID_DEFINITION_T1);
+ } catch (Exception e) {
+ System.out.println(
+ "Transformation error : " + e.getClass().getName() + "(" + e.getMessage() + ")");
+ }
+ t1.sayHi("MultiRedef");
+ t2.sayHi("MultiRedef");
+ try {
+ Main.doMultiClassRedefinition(INVALID_DEFINITION_T1, VALID_DEFINITION_T2);
+ } catch (Exception e) {
+ System.out.println(
+ "Transformation error : " + e.getClass().getName() + "(" + e.getMessage() + ")");
+ }
+ t1.sayHi("MultiRedef");
+ t2.sayHi("MultiRedef");
+ }
+}
diff --git a/test/921-hello-failure/src/MultiRetrans.java b/test/921-hello-failure/src/MultiRetrans.java
new file mode 100644
index 0000000000..95aaf074e9
--- /dev/null
+++ b/test/921-hello-failure/src/MultiRetrans.java
@@ -0,0 +1,108 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+
+class MultiRetrans {
+
+ // class NotTransform {
+ // public void sayHi(String name) {
+ // throw new Error("Should not be called!");
+ // }
+ // }
+ private static CommonClassDefinition INVALID_DEFINITION_T1 = new CommonClassDefinition(
+ Transform.class,
+ Base64.getDecoder().decode(
+ "yv66vgAAADQAFQoABgAPBwAQCAARCgACABIHABMHABQBAAY8aW5pdD4BAAMoKVYBAARDb2RlAQAP" +
+ "TGluZU51bWJlclRhYmxlAQAFc2F5SGkBABUoTGphdmEvbGFuZy9TdHJpbmc7KVYBAApTb3VyY2VG" +
+ "aWxlAQARTm90VHJhbnNmb3JtLmphdmEMAAcACAEAD2phdmEvbGFuZy9FcnJvcgEAFVNob3VsZCBu" +
+ "b3QgYmUgY2FsbGVkIQwABwAMAQAMTm90VHJhbnNmb3JtAQAQamF2YS9sYW5nL09iamVjdAAgAAUA" +
+ "BgAAAAAAAgAAAAcACAABAAkAAAAdAAEAAQAAAAUqtwABsQAAAAEACgAAAAYAAQAAAAEAAQALAAwA" +
+ "AQAJAAAAIgADAAIAAAAKuwACWRIDtwAEvwAAAAEACgAAAAYAAQAAAAMAAQANAAAAAgAO"),
+ Base64.getDecoder().decode(
+ "ZGV4CjAzNQDLV95i5xnv6iUi6uIeDoY5jP5Xe9NP1AiYAgAAcAAAAHhWNBIAAAAAAAAAAAQCAAAL" +
+ "AAAAcAAAAAUAAACcAAAAAgAAALAAAAAAAAAAAAAAAAQAAADIAAAAAQAAAOgAAACQAQAACAEAAEoB" +
+ "AABSAQAAYgEAAHUBAACJAQAAnQEAALABAADHAQAAygEAAM4BAADiAQAAAQAAAAIAAAADAAAABAAA" +
+ "AAcAAAAHAAAABAAAAAAAAAAIAAAABAAAAEQBAAAAAAAAAAAAAAAAAQAKAAAAAQABAAAAAAACAAAA" +
+ "AAAAAAAAAAAAAAAAAgAAAAAAAAAFAAAAAAAAAPQBAAAAAAAAAQABAAEAAADpAQAABAAAAHAQAwAA" +
+ "AA4ABAACAAIAAADuAQAACQAAACIAAQAbAQYAAABwIAIAEAAnAAAAAQAAAAMABjxpbml0PgAOTE5v" +
+ "dFRyYW5zZm9ybTsAEUxqYXZhL2xhbmcvRXJyb3I7ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZh" +
+ "L2xhbmcvU3RyaW5nOwARTm90VHJhbnNmb3JtLmphdmEAFVNob3VsZCBub3QgYmUgY2FsbGVkIQAB" +
+ "VgACVkwAEmVtaXR0ZXI6IGphY2stNC4yMAAFc2F5SGkAAQAHDgADAQAHDgAAAAEBAICABIgCAQGg" +
+ "AgAADAAAAAAAAAABAAAAAAAAAAEAAAALAAAAcAAAAAIAAAAFAAAAnAAAAAMAAAACAAAAsAAAAAUA" +
+ "AAAEAAAAyAAAAAYAAAABAAAA6AAAAAEgAAACAAAACAEAAAEQAAABAAAARAEAAAIgAAALAAAASgEA" +
+ "AAMgAAACAAAA6QEAAAAgAAABAAAA9AEAAAAQAAABAAAABAIAAA=="));
+
+ // Valid redefinition of Transform2
+ // class Transform2 implements Iface1, Iface2 {
+ // public void sayHi(String name) {
+ // throw new Error("Should not be called!");
+ // }
+ // }
+ private static CommonClassDefinition VALID_DEFINITION_T2 = new CommonClassDefinition(
+ Transform2.class,
+ Base64.getDecoder().decode(
+ "yv66vgAAADQAGQoABgARBwASCAATCgACABQHABUHABYHABcHABgBAAY8aW5pdD4BAAMoKVYBAARD" +
+ "b2RlAQAPTGluZU51bWJlclRhYmxlAQAFc2F5SGkBABUoTGphdmEvbGFuZy9TdHJpbmc7KVYBAApT" +
+ "b3VyY2VGaWxlAQAPVHJhbnNmb3JtMi5qYXZhDAAJAAoBAA9qYXZhL2xhbmcvRXJyb3IBABVTaG91" +
+ "bGQgbm90IGJlIGNhbGxlZCEMAAkADgEAClRyYW5zZm9ybTIBABBqYXZhL2xhbmcvT2JqZWN0AQAG" +
+ "SWZhY2UxAQAGSWZhY2UyACAABQAGAAIABwAIAAAAAgAAAAkACgABAAsAAAAdAAEAAQAAAAUqtwAB" +
+ "sQAAAAEADAAAAAYAAQAAAAEAAQANAA4AAQALAAAAIgADAAIAAAAKuwACWRIDtwAEvwAAAAEADAAA" +
+ "AAYAAQAAAAMAAQAPAAAAAgAQ"),
+ Base64.getDecoder().decode(
+ "ZGV4CjAzNQDSWls05CPkX+gbTGMVRvx9dc9vozzVbu7AAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAN" +
+ "AAAAcAAAAAcAAACkAAAAAgAAAMAAAAAAAAAAAAAAAAQAAADYAAAAAQAAAPgAAACoAQAAGAEAAGIB" +
+ "AABqAQAAdAEAAH4BAACMAQAAnwEAALMBAADHAQAA3gEAAO8BAADyAQAA9gEAAAoCAAABAAAAAgAA" +
+ "AAMAAAAEAAAABQAAAAYAAAAJAAAACQAAAAYAAAAAAAAACgAAAAYAAABcAQAAAgAAAAAAAAACAAEA" +
+ "DAAAAAMAAQAAAAAABAAAAAAAAAACAAAAAAAAAAQAAABUAQAACAAAAAAAAAAcAgAAAAAAAAEAAQAB" +
+ "AAAAEQIAAAQAAABwEAMAAAAOAAQAAgACAAAAFgIAAAkAAAAiAAMAGwEHAAAAcCACABAAJwAAAAIA" +
+ "AAAAAAEAAQAAAAUABjxpbml0PgAITElmYWNlMTsACExJZmFjZTI7AAxMVHJhbnNmb3JtMjsAEUxq" +
+ "YXZhL2xhbmcvRXJyb3I7ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwAV" +
+ "U2hvdWxkIG5vdCBiZSBjYWxsZWQhAA9UcmFuc2Zvcm0yLmphdmEAAVYAAlZMABJlbWl0dGVyOiBq" +
+ "YWNrLTQuMjAABXNheUhpAAEABw4AAwEABw4AAAABAQCAgASYAgEBsAIAAAwAAAAAAAAAAQAAAAAA" +
+ "AAABAAAADQAAAHAAAAACAAAABwAAAKQAAAADAAAAAgAAAMAAAAAFAAAABAAAANgAAAAGAAAAAQAA" +
+ "APgAAAABIAAAAgAAABgBAAABEAAAAgAAAFQBAAACIAAADQAAAGIBAAADIAAAAgAAABECAAAAIAAA" +
+ "AQAAABwCAAAAEAAAAQAAACwCAAA="));
+
+ public static void doTest(Transform t1, Transform2 t2) {
+ t1.sayHi("MultiRetrans");
+ t2.sayHi("MultiRetrans");
+ try {
+ Main.addMultiTransformationResults(VALID_DEFINITION_T2, INVALID_DEFINITION_T1);
+ Main.enableCommonRetransformation(true);
+ Main.doCommonClassRetransformation(Transform2.class, Transform.class);
+ } catch (Exception e) {
+ System.out.println(
+ "Transformation error : " + e.getClass().getName() + "(" + e.getMessage() + ")");
+ } finally {
+ Main.enableCommonRetransformation(false);
+ }
+ t1.sayHi("MultiRetrans");
+ t2.sayHi("MultiRetrans");
+ try {
+ Main.addMultiTransformationResults(VALID_DEFINITION_T2, INVALID_DEFINITION_T1);
+ Main.enableCommonRetransformation(true);
+ Main.doCommonClassRetransformation(Transform.class, Transform2.class);
+ } catch (Exception e) {
+ System.out.println(
+ "Transformation error : " + e.getClass().getName() + "(" + e.getMessage() + ")");
+ } finally {
+ Main.enableCommonRetransformation(false);
+ }
+ t1.sayHi("MultiRetrans");
+ t2.sayHi("MultiRetrans");
+ }
+}
diff --git a/test/924-threads/expected.txt b/test/924-threads/expected.txt
index 54065223cf..3b7fb2408f 100644
--- a/test/924-threads/expected.txt
+++ b/test/924-threads/expected.txt
@@ -28,3 +28,6 @@ class dalvik.system.PathClassLoader
e1 = ALIVE|WAITING_WITH_TIMEOUT|SLEEPING|WAITING
5 = ALIVE|RUNNABLE
2 = TERMINATED
+[Thread[FinalizerDaemon,5,system], Thread[FinalizerWatchdogDaemon,5,system], Thread[HeapTaskDaemon,5,system], Thread[ReferenceQueueDaemon,5,system], Thread[Signal Catcher,5,system], Thread[main,5,main]]
+JVMTI_ERROR_THREAD_NOT_ALIVE
+JVMTI_ERROR_THREAD_NOT_ALIVE
diff --git a/test/924-threads/src/Main.java b/test/924-threads/src/Main.java
index 048766604f..dec49a8320 100644
--- a/test/924-threads/src/Main.java
+++ b/test/924-threads/src/Main.java
@@ -17,6 +17,7 @@
import java.util.Arrays;
import java.util.ArrayList;
import java.util.Collections;
+import java.util.Comparator;
import java.util.concurrent.CountDownLatch;
import java.util.HashMap;
import java.util.List;
@@ -53,6 +54,10 @@ public class Main {
printThreadInfo(t3);
doStateTests();
+
+ doAllThreadsTests();
+
+ doTLSTests();
}
private static class Holder {
@@ -155,6 +160,80 @@ public class Main {
printThreadState(t);
}
+ private static void doAllThreadsTests() {
+ Thread[] threads = getAllThreads();
+ Arrays.sort(threads, THREAD_COMP);
+ System.out.println(Arrays.toString(threads));
+ }
+
+ private static void doTLSTests() throws Exception {
+ doTLSNonLiveTests();
+ doTLSLiveTests();
+ }
+
+ private static void doTLSNonLiveTests() throws Exception {
+ Thread t = new Thread();
+ try {
+ setTLS(t, 1);
+ System.out.println("Expected failure setting TLS for non-live thread");
+ } catch (Exception e) {
+ System.out.println(e.getMessage());
+ }
+ t.start();
+ t.join();
+ try {
+ setTLS(t, 1);
+ System.out.println("Expected failure setting TLS for non-live thread");
+ } catch (Exception e) {
+ System.out.println(e.getMessage());
+ }
+ }
+
+ private static void doTLSLiveTests() throws Exception {
+ setTLS(Thread.currentThread(), 1);
+
+ long l = getTLS(Thread.currentThread());
+ if (l != 1) {
+ throw new RuntimeException("Unexpected TLS value: " + l);
+ };
+
+ final CountDownLatch cdl1 = new CountDownLatch(1);
+ final CountDownLatch cdl2 = new CountDownLatch(1);
+
+ Runnable r = new Runnable() {
+ @Override
+ public void run() {
+ try {
+ cdl1.countDown();
+ cdl2.await();
+ setTLS(Thread.currentThread(), 2);
+ if (getTLS(Thread.currentThread()) != 2) {
+ throw new RuntimeException("Different thread issue");
+ }
+ } catch (Exception e) {
+ throw new RuntimeException(e);
+ }
+ }
+ };
+
+ Thread t = new Thread(r);
+ t.start();
+ cdl1.await();
+ setTLS(Thread.currentThread(), 1);
+ cdl2.countDown();
+
+ t.join();
+ if (getTLS(Thread.currentThread()) != 1) {
+ throw new RuntimeException("Got clobbered");
+ }
+ }
+
+ private final static Comparator<Thread> THREAD_COMP = new Comparator<Thread>() {
+ public int compare(Thread o1, Thread o2) {
+ return o1.getName().compareTo(o2.getName());
+ }
+ };
+
private final static Map<Integer, String> STATE_NAMES = new HashMap<Integer, String>();
private final static List<Integer> STATE_KEYS = new ArrayList<Integer>();
static {
@@ -213,4 +292,7 @@ public class Main {
private static native Thread getCurrentThread();
private static native Object[] getThreadInfo(Thread t);
private static native int getThreadState(Thread t);
+ private static native Thread[] getAllThreads();
+ private static native void setTLS(Thread t, long l);
+ private static native long getTLS(Thread t);
}
diff --git a/test/924-threads/threads.cc b/test/924-threads/threads.cc
index 4abf8fcf93..d35eaa8365 100644
--- a/test/924-threads/threads.cc
+++ b/test/924-threads/threads.cc
@@ -100,5 +100,42 @@ extern "C" JNIEXPORT jint JNICALL Java_Main_getThreadState(
return state;
}
+extern "C" JNIEXPORT jobjectArray JNICALL Java_Main_getAllThreads(
+ JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED) {
+ jint thread_count;
+ jthread* threads;
+
+ jvmtiError result = jvmti_env->GetAllThreads(&thread_count, &threads);
+ if (JvmtiErrorToException(env, result)) {
+ return nullptr;
+ }
+
+ auto callback = [&](jint index) {
+ return threads[index];
+ };
+ jobjectArray ret = CreateObjectArray(env, thread_count, "java/lang/Thread", callback);
+
+ jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(threads));
+
+ return ret;
+}
+
+extern "C" JNIEXPORT jlong JNICALL Java_Main_getTLS(
+ JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED, jthread thread) {
+ void* tls;
+ jvmtiError result = jvmti_env->GetThreadLocalStorage(thread, &tls);
+ if (JvmtiErrorToException(env, result)) {
+ return 0;
+ }
+ return static_cast<jlong>(reinterpret_cast<uintptr_t>(tls));
+}
+
+extern "C" JNIEXPORT void JNICALL Java_Main_setTLS(
+ JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED, jthread thread, jlong val) {
+ const void* tls = reinterpret_cast<void*>(static_cast<uintptr_t>(val));
+ jvmtiError result = jvmti_env->SetThreadLocalStorage(thread, tls);
+ JvmtiErrorToException(env, result);
+}
+
} // namespace Test924Threads
} // namespace art
diff --git a/test/956-methodhandles/run b/test/925-threadgroups/build
index a9f182288c..898e2e54a2 100755
--- a/test/956-methodhandles/run
+++ b/test/925-threadgroups/build
@@ -14,7 +14,4 @@
# See the License for the specific language governing permissions and
# limitations under the License.
-# make us exit on a failure
-set -e
-
-./default-run "$@" --experimental method-handles
+./default-build "$@" --experimental agents
diff --git a/test/925-threadgroups/expected.txt b/test/925-threadgroups/expected.txt
new file mode 100644
index 0000000000..7d1a259c89
--- /dev/null
+++ b/test/925-threadgroups/expected.txt
@@ -0,0 +1,16 @@
+java.lang.ThreadGroup[name=main,maxpri=10]
+ java.lang.ThreadGroup[name=system,maxpri=10]
+ main
+ 10
+ false
+java.lang.ThreadGroup[name=system,maxpri=10]
+ null
+ system
+ 10
+ false
+main:
+ [Thread[main,5,main]]
+ []
+system:
+ [Thread[FinalizerDaemon,5,system], Thread[FinalizerWatchdogDaemon,5,system], Thread[HeapTaskDaemon,5,system], Thread[ReferenceQueueDaemon,5,system], Thread[Signal Catcher,5,system]]
+ [java.lang.ThreadGroup[name=main,maxpri=10]]
diff --git a/test/925-threadgroups/info.txt b/test/925-threadgroups/info.txt
new file mode 100644
index 0000000000..875a5f6ec1
--- /dev/null
+++ b/test/925-threadgroups/info.txt
@@ -0,0 +1 @@
+Tests basic functions in the jvmti plugin.
diff --git a/test/925-threadgroups/run b/test/925-threadgroups/run
new file mode 100755
index 0000000000..4379349cb2
--- /dev/null
+++ b/test/925-threadgroups/run
@@ -0,0 +1,19 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-run "$@" --experimental agents \
+ --experimental runtime-plugins \
+ --jvmti
diff --git a/test/925-threadgroups/src/Main.java b/test/925-threadgroups/src/Main.java
new file mode 100644
index 0000000000..c59efe2f7b
--- /dev/null
+++ b/test/925-threadgroups/src/Main.java
@@ -0,0 +1,113 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Arrays;
+import java.util.Comparator;
+
+public class Main {
+ public static void main(String[] args) throws Exception {
+ System.loadLibrary(args[1]);
+
+ doTest();
+ }
+
+ private static void doTest() throws Exception {
+ Thread t1 = Thread.currentThread();
+ ThreadGroup curGroup = t1.getThreadGroup();
+
+ ThreadGroup rootGroup = curGroup;
+ while (rootGroup.getParent() != null) {
+ rootGroup = rootGroup.getParent();
+ }
+
+ ThreadGroup topGroups[] = getTopThreadGroups();
+ if (topGroups == null || topGroups.length != 1 || topGroups[0] != rootGroup) {
+ System.out.println(Arrays.toString(topGroups));
+ throw new RuntimeException("Unexpected topGroups");
+ }
+
+ printThreadGroupInfo(curGroup);
+ printThreadGroupInfo(rootGroup);
+
+ waitGroupChildren(rootGroup, 5 /* # daemons */, 30 /* timeout in seconds */);
+
+ checkChildren(curGroup);
+ }
+
+ private static void printThreadGroupInfo(ThreadGroup tg) {
+ Object[] threadGroupInfo = getThreadGroupInfo(tg);
+ if (threadGroupInfo == null || threadGroupInfo.length != 4) {
+ System.out.println(Arrays.toString(threadGroupInfo));
+ throw new RuntimeException("threadGroupInfo length wrong");
+ }
+
+ System.out.println(tg);
+ System.out.println(" " + threadGroupInfo[0]); // Parent
+ System.out.println(" " + threadGroupInfo[1]); // Name
+ System.out.println(" " + threadGroupInfo[2]); // Priority
+ System.out.println(" " + threadGroupInfo[3]); // Daemon
+ }
+
+ private static void checkChildren(ThreadGroup tg) {
+ Object[] data = getThreadGroupChildren(tg);
+ Thread[] threads = (Thread[])data[0];
+ ThreadGroup[] groups = (ThreadGroup[])data[1];
+
+ Arrays.sort(threads, THREAD_COMP);
+ Arrays.sort(groups, THREADGROUP_COMP);
+ System.out.println(tg.getName() + ":");
+ System.out.println(" " + Arrays.toString(threads));
+ System.out.println(" " + Arrays.toString(groups));
+
+ if (tg.getParent() != null) {
+ checkChildren(tg.getParent());
+ }
+ }
+
+ private static void waitGroupChildren(ThreadGroup tg, int expectedChildCount, int timeoutS)
+ throws Exception {
+ for (int i = 0; i < timeoutS; i++) {
+ Object[] data = getThreadGroupChildren(tg);
+ Thread[] threads = (Thread[])data[0];
+ if (threads.length == expectedChildCount) {
+ return;
+ }
+ Thread.sleep(1000);
+ }
+
+ Object[] data = getThreadGroupChildren(tg);
+ Thread[] threads = (Thread[])data[0];
+ System.out.println(Arrays.toString(threads));
+ throw new RuntimeException("Waited unsuccessfully for " + expectedChildCount + " children.");
+ }
+
+ private final static Comparator<Thread> THREAD_COMP = new Comparator<Thread>() {
+ public int compare(Thread o1, Thread o2) {
+ return o1.getName().compareTo(o2.getName());
+ }
+ };
+
+ private final static Comparator<ThreadGroup> THREADGROUP_COMP = new Comparator<ThreadGroup>() {
+ public int compare(ThreadGroup o1, ThreadGroup o2) {
+ return o1.getName().compareTo(o2.getName());
+ }
+ };
+
+ private static native ThreadGroup[] getTopThreadGroups();
+ private static native Object[] getThreadGroupInfo(ThreadGroup tg);
+ // Returns an array where element 0 is an array of threads and element 1 is an array of groups.
+ private static native Object[] getThreadGroupChildren(ThreadGroup tg);
+}
diff --git a/test/925-threadgroups/threadgroups.cc b/test/925-threadgroups/threadgroups.cc
new file mode 100644
index 0000000000..6c6e835dd3
--- /dev/null
+++ b/test/925-threadgroups/threadgroups.cc
@@ -0,0 +1,127 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include <stdio.h>
+
+#include "android-base/stringprintf.h"
+#include "base/macros.h"
+#include "base/logging.h"
+#include "jni.h"
+#include "openjdkjvmti/jvmti.h"
+#include "ScopedLocalRef.h"
+
+#include "ti-agent/common_helper.h"
+#include "ti-agent/common_load.h"
+
+namespace art {
+namespace Test925ThreadGroups {
+
+// private static native Object[] getThreadGroupInfo();
+// // Returns an array where element 0 is an array of threads and element 1 is an array of groups.
+// private static native Object[] getThreadGroupChildren();
+
+extern "C" JNIEXPORT jobjectArray JNICALL Java_Main_getTopThreadGroups(
+ JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED) {
+ jthreadGroup* groups;
+ jint group_count;
+ jvmtiError result = jvmti_env->GetTopThreadGroups(&group_count, &groups);
+ if (JvmtiErrorToException(env, result)) {
+ return nullptr;
+ }
+
+ auto callback = [&](jint index) -> jobject {
+ return groups[index];
+ };
+ jobjectArray ret = CreateObjectArray(env, group_count, "java/lang/ThreadGroup", callback);
+
+ jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(groups));
+
+ return ret;
+}
+
+extern "C" JNIEXPORT jobjectArray JNICALL Java_Main_getThreadGroupInfo(
+ JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED, jthreadGroup group) {
+ jvmtiThreadGroupInfo info;
+ jvmtiError result = jvmti_env->GetThreadGroupInfo(group, &info);
+ if (JvmtiErrorToException(env, result)) {
+ return nullptr;
+ }
+
+ auto callback = [&](jint index) -> jobject {
+ switch (index) {
+ // The parent.
+ case 0:
+ return info.parent;
+
+ // The name.
+ case 1:
+ return (info.name == nullptr) ? nullptr : env->NewStringUTF(info.name);
+
+ // The priority. Use a string for simplicity of construction.
+ case 2:
+ return env->NewStringUTF(android::base::StringPrintf("%d", info.max_priority).c_str());
+
+ // Whether it's a daemon. Use a string for simplicity of construction.
+ case 3:
+ return env->NewStringUTF(info.is_daemon == JNI_TRUE ? "true" : "false");
+ }
+ LOG(FATAL) << "Should not reach here";
+ UNREACHABLE();
+ };
+ return CreateObjectArray(env, 4, "java/lang/Object", callback);
+}
+
+extern "C" JNIEXPORT jobjectArray JNICALL Java_Main_getThreadGroupChildren(
+ JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED, jthreadGroup group) {
+ jint thread_count;
+ jthread* threads;
+ jint threadgroup_count;
+ jthreadGroup* groups;
+
+ jvmtiError result = jvmti_env->GetThreadGroupChildren(group,
+ &thread_count,
+ &threads,
+ &threadgroup_count,
+ &groups);
+ if (JvmtiErrorToException(env, result)) {
+ return nullptr;
+ }
+
+ auto callback = [&](jint component_index) -> jobject {
+ if (component_index == 0) {
+ // Threads.
+ auto inner_callback = [&](jint index) {
+ return threads[index];
+ };
+ return CreateObjectArray(env, thread_count, "java/lang/Thread", inner_callback);
+ } else {
+ // Groups.
+ auto inner_callback = [&](jint index) {
+ return groups[index];
+ };
+ return CreateObjectArray(env, threadgroup_count, "java/lang/ThreadGroup", inner_callback);
+ }
+ };
+ jobjectArray ret = CreateObjectArray(env, 2, "java/lang/Object", callback);
+
+ jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(threads));
+ jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(groups));
+
+ return ret;
+}
+
+} // namespace Test925ThreadGroups
+} // namespace art
diff --git a/test/957-methodhandle-transforms/run b/test/926-multi-obsolescence/build
index a9f182288c..898e2e54a2 100755
--- a/test/957-methodhandle-transforms/run
+++ b/test/926-multi-obsolescence/build
@@ -14,7 +14,4 @@
# See the License for the specific language governing permissions and
# limitations under the License.
-# make us exit on a failure
-set -e
-
-./default-run "$@" --experimental method-handles
+./default-build "$@" --experimental agents
diff --git a/test/926-multi-obsolescence/expected.txt b/test/926-multi-obsolescence/expected.txt
new file mode 100644
index 0000000000..0546490c44
--- /dev/null
+++ b/test/926-multi-obsolescence/expected.txt
@@ -0,0 +1,15 @@
+hello
+hello - 2
+Not doing anything here
+goodbye - 2
+goodbye
+hello
+hello - 2
+transforming calling functions
+goodbye - 2
+goodbye
+Hello - Transformed
+Hello 2 - Transformed
+Not doing anything here
+Goodbye 2 - Transformed
+Goodbye - Transformed
diff --git a/test/926-multi-obsolescence/info.txt b/test/926-multi-obsolescence/info.txt
new file mode 100644
index 0000000000..1399b966f1
--- /dev/null
+++ b/test/926-multi-obsolescence/info.txt
@@ -0,0 +1,2 @@
+Tests that we can redefine multiple classes at once using the RedefineClasses
+function.
diff --git a/test/926-multi-obsolescence/run b/test/926-multi-obsolescence/run
new file mode 100755
index 0000000000..4379349cb2
--- /dev/null
+++ b/test/926-multi-obsolescence/run
@@ -0,0 +1,19 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-run "$@" --experimental agents \
+ --experimental runtime-plugins \
+ --jvmti
diff --git a/test/926-multi-obsolescence/src/CommonClassDefinition.java b/test/926-multi-obsolescence/src/CommonClassDefinition.java
new file mode 100644
index 0000000000..62602a02e9
--- /dev/null
+++ b/test/926-multi-obsolescence/src/CommonClassDefinition.java
@@ -0,0 +1,27 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+}
diff --git a/test/926-multi-obsolescence/src/Main.java b/test/926-multi-obsolescence/src/Main.java
new file mode 100644
index 0000000000..8a6cf84b8b
--- /dev/null
+++ b/test/926-multi-obsolescence/src/Main.java
@@ -0,0 +1,128 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.ArrayList;
+import java.util.Base64;
+
+public class Main {
+ // class Transform {
+ // public void sayHi(Runnable r) {
+ // System.out.println("Hello - Transformed");
+ // r.run();
+ // System.out.println("Goodbye - Transformed");
+ // }
+ // }
+ private static CommonClassDefinition VALID_DEFINITION_T1 = new CommonClassDefinition(
+ Transform.class,
+ Base64.getDecoder().decode(
+ "yv66vgAAADQAJAoACAARCQASABMIABQKABUAFgsAFwAYCAAZBwAaBwAbAQAGPGluaXQ+AQADKClW" +
+ "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
+ "KVYBAApTb3VyY2VGaWxlAQAOVHJhbnNmb3JtLmphdmEMAAkACgcAHAwAHQAeAQATSGVsbG8gLSBU" +
+ "cmFuc2Zvcm1lZAcAHwwAIAAhBwAiDAAjAAoBABVHb29kYnllIC0gVHJhbnNmb3JtZWQBAAlUcmFu" +
+ "c2Zvcm0BABBqYXZhL2xhbmcvT2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZh" +
+ "L2lvL1ByaW50U3RyZWFtOwEAE2phdmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZh" +
+ "L2xhbmcvU3RyaW5nOylWAQASamF2YS9sYW5nL1J1bm5hYmxlAQADcnVuACAABwAIAAAAAAACAAAA" +
+ "CQAKAAEACwAAAB0AAQABAAAABSq3AAGxAAAAAQAMAAAABgABAAAAAQABAA0ADgABAAsAAAA7AAIA" +
+ "AgAAABeyAAISA7YABCu5AAUBALIAAhIGtgAEsQAAAAEADAAAABIABAAAAAMACAAEAA4ABQAWAAYA" +
+ "AQAPAAAAAgAQ"),
+ Base64.getDecoder().decode(
+ "ZGV4CjAzNQAYeAMMXgYWxoeSHAS9EWKCCtVRSAGpqZVQAwAAcAAAAHhWNBIAAAAAAAAAALACAAAR" +
+ "AAAAcAAAAAcAAAC0AAAAAwAAANAAAAABAAAA9AAAAAUAAAD8AAAAAQAAACQBAAAMAgAARAEAAKIB" +
+ "AACqAQAAwQEAANYBAADjAQAA+gEAAA4CAAAkAgAAOAIAAEwCAABcAgAAXwIAAGMCAAB3AgAAfAIA" +
+ "AIUCAACKAgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACgAAAAoAAAAGAAAAAAAAAAsAAAAGAAAA" +
+ "lAEAAAsAAAAGAAAAnAEAAAUAAQANAAAAAAAAAAAAAAAAAAEAEAAAAAEAAgAOAAAAAgAAAAAAAAAD" +
+ "AAAADwAAAAAAAAAAAAAAAgAAAAAAAAAJAAAAAAAAAJ8CAAAAAAAAAQABAAEAAACRAgAABAAAAHAQ" +
+ "AwAAAA4ABAACAAIAAACWAgAAFAAAAGIAAAAbAQIAAABuIAIAEAByEAQAAwBiAAAAGwEBAAAAbiAC" +
+ "ABAADgABAAAAAwAAAAEAAAAEAAY8aW5pdD4AFUdvb2RieWUgLSBUcmFuc2Zvcm1lZAATSGVsbG8g" +
+ "LSBUcmFuc2Zvcm1lZAALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwASTGphdmEv" +
+ "bGFuZy9PYmplY3Q7ABRMamF2YS9sYW5nL1J1bm5hYmxlOwASTGphdmEvbGFuZy9TdHJpbmc7ABJM" +
+ "amF2YS9sYW5nL1N5c3RlbTsADlRyYW5zZm9ybS5qYXZhAAFWAAJWTAASZW1pdHRlcjogamFjay00" +
+ "LjEzAANvdXQAB3ByaW50bG4AA3J1bgAFc2F5SGkAAQAHDgADAQAHDoc8hwAAAAEBAICABMQCAQHc" +
+ "AgAAAA0AAAAAAAAAAQAAAAAAAAABAAAAEQAAAHAAAAACAAAABwAAALQAAAADAAAAAwAAANAAAAAE" +
+ "AAAAAQAAAPQAAAAFAAAABQAAAPwAAAAGAAAAAQAAACQBAAABIAAAAgAAAEQBAAABEAAAAgAAAJQB" +
+ "AAACIAAAEQAAAKIBAAADIAAAAgAAAJECAAAAIAAAAQAAAJ8CAAAAEAAAAQAAALACAAA="));
+ // class Transform2 {
+ // public void sayHi(Runnable r) {
+ // System.out.println("Hello 2 - Transformed");
+ // r.run();
+ // System.out.println("Goodbye 2 - Transformed");
+ // }
+ // }
+ private static CommonClassDefinition VALID_DEFINITION_T2 = new CommonClassDefinition(
+ Transform2.class,
+ Base64.getDecoder().decode(
+ "yv66vgAAADQAJAoACAARCQASABMIABQKABUAFgsAFwAYCAAZBwAaBwAbAQAGPGluaXQ+AQADKClW" +
+ "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
+ "KVYBAApTb3VyY2VGaWxlAQAPVHJhbnNmb3JtMi5qYXZhDAAJAAoHABwMAB0AHgEAFUhlbGxvIDIg" +
+ "LSBUcmFuc2Zvcm1lZAcAHwwAIAAhBwAiDAAjAAoBABdHb29kYnllIDIgLSBUcmFuc2Zvcm1lZAEA" +
+ "ClRyYW5zZm9ybTIBABBqYXZhL2xhbmcvT2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEA" +
+ "FUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2phdmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAV" +
+ "KExqYXZhL2xhbmcvU3RyaW5nOylWAQASamF2YS9sYW5nL1J1bm5hYmxlAQADcnVuACAABwAIAAAA" +
+ "AAACAAAACQAKAAEACwAAAB0AAQABAAAABSq3AAGxAAAAAQAMAAAABgABAAAAAQABAA0ADgABAAsA" +
+ "AAA7AAIAAgAAABeyAAISA7YABCu5AAUBALIAAhIGtgAEsQAAAAEADAAAABIABAAAAAMACAAEAA4A" +
+ "BQAWAAYAAQAPAAAAAgAQ"),
+ Base64.getDecoder().decode(
+ "ZGV4CjAzNQCee5Z6+AuFcjnPjjn7QYgZmKSmFQCO4nxUAwAAcAAAAHhWNBIAAAAAAAAAALQCAAAR" +
+ "AAAAcAAAAAcAAAC0AAAAAwAAANAAAAABAAAA9AAAAAUAAAD8AAAAAQAAACQBAAAQAgAARAEAAKIB" +
+ "AACqAQAAwwEAANoBAADoAQAA/wEAABMCAAApAgAAPQIAAFECAABiAgAAZQIAAGkCAAB9AgAAggIA" +
+ "AIsCAACQAgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACgAAAAoAAAAGAAAAAAAAAAsAAAAGAAAA" +
+ "lAEAAAsAAAAGAAAAnAEAAAUAAQANAAAAAAAAAAAAAAAAAAEAEAAAAAEAAgAOAAAAAgAAAAAAAAAD" +
+ "AAAADwAAAAAAAAAAAAAAAgAAAAAAAAAJAAAAAAAAAKUCAAAAAAAAAQABAAEAAACXAgAABAAAAHAQ" +
+ "AwAAAA4ABAACAAIAAACcAgAAFAAAAGIAAAAbAQIAAABuIAIAEAByEAQAAwBiAAAAGwEBAAAAbiAC" +
+ "ABAADgABAAAAAwAAAAEAAAAEAAY8aW5pdD4AF0dvb2RieWUgMiAtIFRyYW5zZm9ybWVkABVIZWxs" +
+ "byAyIC0gVHJhbnNmb3JtZWQADExUcmFuc2Zvcm0yOwAVTGphdmEvaW8vUHJpbnRTdHJlYW07ABJM" +
+ "amF2YS9sYW5nL09iamVjdDsAFExqYXZhL2xhbmcvUnVubmFibGU7ABJMamF2YS9sYW5nL1N0cmlu" +
+ "ZzsAEkxqYXZhL2xhbmcvU3lzdGVtOwAPVHJhbnNmb3JtMi5qYXZhAAFWAAJWTAASZW1pdHRlcjog" +
+ "amFjay00LjIwAANvdXQAB3ByaW50bG4AA3J1bgAFc2F5SGkAAQAHDgADAQAHDoc8hwAAAAEBAICA" +
+ "BMQCAQHcAgANAAAAAAAAAAEAAAAAAAAAAQAAABEAAABwAAAAAgAAAAcAAAC0AAAAAwAAAAMAAADQ" +
+ "AAAABAAAAAEAAAD0AAAABQAAAAUAAAD8AAAABgAAAAEAAAAkAQAAASAAAAIAAABEAQAAARAAAAIA" +
+ "AACUAQAAAiAAABEAAACiAQAAAyAAAAIAAACXAgAAACAAAAEAAAClAgAAABAAAAEAAAC0AgAA"));
+
+ public static void main(String[] args) {
+ System.loadLibrary(args[1]);
+ doTest(new Transform(), new Transform2());
+ }
+
+ public static void doTest(final Transform t1, final Transform2 t2) {
+ t1.sayHi(() -> { t2.sayHi(() -> { System.out.println("Not doing anything here"); }); });
+ t1.sayHi(() -> {
+ t2.sayHi(() -> {
+ System.out.println("transforming calling functions");
+ doMultiClassRedefinition(VALID_DEFINITION_T1, VALID_DEFINITION_T2);
+ });
+ });
+ t1.sayHi(() -> { t2.sayHi(() -> { System.out.println("Not doing anything here"); }); });
+ }
+
+ public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+}
diff --git a/test/926-multi-obsolescence/src/Transform.java b/test/926-multi-obsolescence/src/Transform.java
new file mode 100644
index 0000000000..8cda6cdf53
--- /dev/null
+++ b/test/926-multi-obsolescence/src/Transform.java
@@ -0,0 +1,30 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Transform {
+ public void sayHi(Runnable r) {
+ // Use lower 'h' to make sure the string will have a different string id
+ // than the transformation (the transformation code is the same except
+ // the actual printed String, which was making the test inacurately passing
+ // in JIT mode when loading the string from the dex cache, as the string ids
+ // of the two different strings were the same).
+ // We know the string ids will be different because lexicographically:
+ // "Hello" < "LTransform;" < "hello".
+ System.out.println("hello");
+ r.run();
+ System.out.println("goodbye");
+ }
+}
diff --git a/test/926-multi-obsolescence/src/Transform2.java b/test/926-multi-obsolescence/src/Transform2.java
new file mode 100644
index 0000000000..4877f8455b
--- /dev/null
+++ b/test/926-multi-obsolescence/src/Transform2.java
@@ -0,0 +1,23 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Transform2 {
+ public void sayHi(Runnable r) {
+ System.out.println("hello - 2");
+ r.run();
+ System.out.println("goodbye - 2");
+ }
+}
diff --git a/test/954-invoke-polymorphic-verifier/run b/test/927-timers/build
index a9f182288c..898e2e54a2 100755
--- a/test/954-invoke-polymorphic-verifier/run
+++ b/test/927-timers/build
@@ -14,7 +14,4 @@
# See the License for the specific language governing permissions and
# limitations under the License.
-# make us exit on a failure
-set -e
-
-./default-run "$@" --experimental method-handles
+./default-build "$@" --experimental agents
diff --git a/test/927-timers/expected.txt b/test/927-timers/expected.txt
new file mode 100644
index 0000000000..a4ef4424b6
--- /dev/null
+++ b/test/927-timers/expected.txt
@@ -0,0 +1,3 @@
+availableProcessors OK
+[-1, true, true, 32]
+Time OK
diff --git a/test/927-timers/info.txt b/test/927-timers/info.txt
new file mode 100644
index 0000000000..875a5f6ec1
--- /dev/null
+++ b/test/927-timers/info.txt
@@ -0,0 +1 @@
+Tests basic functions in the jvmti plugin.
diff --git a/test/927-timers/run b/test/927-timers/run
new file mode 100755
index 0000000000..4379349cb2
--- /dev/null
+++ b/test/927-timers/run
@@ -0,0 +1,19 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-run "$@" --experimental agents \
+ --experimental runtime-plugins \
+ --jvmti
diff --git a/test/927-timers/src/Main.java b/test/927-timers/src/Main.java
new file mode 100644
index 0000000000..2f5c85cab5
--- /dev/null
+++ b/test/927-timers/src/Main.java
@@ -0,0 +1,62 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Arrays;
+
+public class Main {
+ public static void main(String[] args) throws Exception {
+ System.loadLibrary(args[1]);
+
+ doTest();
+ }
+
+ private static void doTest() {
+ int all1 = Runtime.getRuntime().availableProcessors();
+ int all2 = getAvailableProcessors();
+ if (all1 != all2) {
+ throw new RuntimeException("Available processors doesn't match: " + all1 + " vs " + all2);
+ }
+ System.out.println("availableProcessors OK");
+
+ Object info[] = getTimerInfo();
+ System.out.println(Arrays.toString(info));
+
+ // getTime checks.
+ // Note: there isn't really much to check independent from the implementation. So we check
+ // a few details of the ART implementation. This may fail on other runtimes.
+ long time1 = getTime();
+ long time2 = getTime();
+
+ // Under normal circumstances, time1 <= time2.
+ if (time2 < time1) {
+ throw new RuntimeException("Time unexpectedly decreased: " + time1 + " vs " + time2);
+ }
+
+ long time3 = System.nanoTime();
+ long time4 = getTime();
+
+ final long MINUTE = 60l * 1000 * 1000 * 1000;
+ if (time4 < time3 || (time4 - time3 > MINUTE)) {
+ throw new RuntimeException("Time unexpectedly divergent: " + time3 + " vs " + time4);
+ }
+
+ System.out.println("Time OK");
+ }
+
+ private static native int getAvailableProcessors();
+ private static native Object[] getTimerInfo();
+ private static native long getTime();
+}
diff --git a/test/927-timers/timers.cc b/test/927-timers/timers.cc
new file mode 100644
index 0000000000..58d5c271e6
--- /dev/null
+++ b/test/927-timers/timers.cc
@@ -0,0 +1,84 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include <inttypes.h>
+
+#include "android-base/stringprintf.h"
+#include "base/logging.h"
+#include "base/macros.h"
+#include "jni.h"
+#include "openjdkjvmti/jvmti.h"
+
+#include "ti-agent/common_helper.h"
+#include "ti-agent/common_load.h"
+
+namespace art {
+namespace Test926Timers {
+
+extern "C" JNIEXPORT jint JNICALL Java_Main_getAvailableProcessors(
+ JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED) {
+ jint count;
+ jvmtiError result = jvmti_env->GetAvailableProcessors(&count);
+ if (JvmtiErrorToException(env, result)) {
+ return -1;
+ }
+ return count;
+}
+
+extern "C" JNIEXPORT jlong JNICALL Java_Main_getTime(
+ JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED) {
+ jlong time;
+ jvmtiError result = jvmti_env->GetTime(&time);
+ if (JvmtiErrorToException(env, result)) {
+ return -1;
+ }
+ return time;
+}
+
+extern "C" JNIEXPORT jobjectArray JNICALL Java_Main_getTimerInfo(
+ JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED) {
+ jvmtiTimerInfo info;
+ jvmtiError result = jvmti_env->GetTimerInfo(&info);
+ if (JvmtiErrorToException(env, result)) {
+ return nullptr;
+ }
+
+ auto callback = [&](jint index) -> jobject {
+ switch (index) {
+ // Max value.
+ case 0:
+ return env->NewStringUTF(android::base::StringPrintf("%" PRId64, info.max_value).c_str());
+
+ // Skip forward.
+ case 1:
+ return env->NewStringUTF(info.may_skip_forward == JNI_TRUE ? "true" : "false");
+ // Skip backward.
+ case 2:
+ return env->NewStringUTF(info.may_skip_forward == JNI_TRUE ? "true" : "false");
+
+ // The kind.
+ case 3:
+ return env->NewStringUTF(
+ android::base::StringPrintf("%d", static_cast<jint>(info.kind)).c_str());
+ }
+ LOG(FATAL) << "Should not reach here";
+ UNREACHABLE();
+ };
+ return CreateObjectArray(env, 4, "java/lang/Object", callback);
+}
+
+} // namespace Test926Timers
+} // namespace art
diff --git a/test/955-methodhandles-smali/run b/test/928-jni-table/build
index a9f182288c..898e2e54a2 100755
--- a/test/955-methodhandles-smali/run
+++ b/test/928-jni-table/build
@@ -14,7 +14,4 @@
# See the License for the specific language governing permissions and
# limitations under the License.
-# make us exit on a failure
-set -e
-
-./default-run "$@" --experimental method-handles
+./default-build "$@" --experimental agents
diff --git a/test/928-jni-table/expected.txt b/test/928-jni-table/expected.txt
new file mode 100644
index 0000000000..a965a70ed4
--- /dev/null
+++ b/test/928-jni-table/expected.txt
@@ -0,0 +1 @@
+Done
diff --git a/test/928-jni-table/info.txt b/test/928-jni-table/info.txt
new file mode 100644
index 0000000000..875a5f6ec1
--- /dev/null
+++ b/test/928-jni-table/info.txt
@@ -0,0 +1 @@
+Tests basic functions in the jvmti plugin.
diff --git a/test/928-jni-table/jni_table.cc b/test/928-jni-table/jni_table.cc
new file mode 100644
index 0000000000..5123d3a43f
--- /dev/null
+++ b/test/928-jni-table/jni_table.cc
@@ -0,0 +1,89 @@
+/*
+ * Copyright (C) 2013 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include <stdio.h>
+
+#include "jni.h"
+#include "openjdkjvmti/jvmti.h"
+
+#include "base/logging.h"
+#include "base/macros.h"
+
+#include "ti-agent/common_helper.h"
+#include "ti-agent/common_load.h"
+
+namespace art {
+namespace Test927JNITable {
+
+// This test is equivalent to the jni_internal_test JNIEnvExtTableOverride.
+
+static size_t gGlobalRefCount = 0;
+static JNINativeInterface* gOriginalEnv = nullptr;
+
+static jobject CountNewGlobalRef(JNIEnv* env, jobject o) {
+ ++gGlobalRefCount;
+ return gOriginalEnv->NewGlobalRef(env, o);
+}
+
+extern "C" JNIEXPORT void JNICALL Java_Main_doJNITableTest(
+ JNIEnv* env, jclass klass) {
+ // Get the current table, as the delegate.
+ jvmtiError getorig_result = jvmti_env->GetJNIFunctionTable(&gOriginalEnv);
+ if (JvmtiErrorToException(env, getorig_result)) {
+ return;
+ }
+
+ // Get the current table, as the override we'll install.
+ JNINativeInterface* env_override;
+ jvmtiError getoverride_result = jvmti_env->GetJNIFunctionTable(&env_override);
+ if (JvmtiErrorToException(env, getoverride_result)) {
+ return;
+ }
+
+ env_override->NewGlobalRef = CountNewGlobalRef;
+ gGlobalRefCount = 0;
+
+ // Install the override.
+ jvmtiError setoverride_result = jvmti_env->SetJNIFunctionTable(env_override);
+ if (JvmtiErrorToException(env, setoverride_result)) {
+ return;
+ }
+
+ jobject global = env->NewGlobalRef(klass);
+ CHECK_EQ(1u, gGlobalRefCount);
+ env->DeleteGlobalRef(global);
+
+ // Install the "original." There is no real reset.
+ jvmtiError setoverride2_result = jvmti_env->SetJNIFunctionTable(gOriginalEnv);
+ if (JvmtiErrorToException(env, setoverride2_result)) {
+ return;
+ }
+
+ jobject global2 = env->NewGlobalRef(klass);
+ CHECK_EQ(1u, gGlobalRefCount);
+ env->DeleteGlobalRef(global2);
+
+ // Try to install null. Should return NULL_POINTER error.
+ jvmtiError setoverride3_result = jvmti_env->SetJNIFunctionTable(nullptr);
+ if (setoverride3_result != JVMTI_ERROR_NULL_POINTER) {
+ LOG(FATAL) << "Didn't receive NULL_POINTER";
+ }
+
+ jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(env_override));
+}
+
+} // namespace Test927JNITable
+} // namespace art
diff --git a/test/928-jni-table/run b/test/928-jni-table/run
new file mode 100755
index 0000000000..4379349cb2
--- /dev/null
+++ b/test/928-jni-table/run
@@ -0,0 +1,19 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-run "$@" --experimental agents \
+ --experimental runtime-plugins \
+ --jvmti
diff --git a/test/928-jni-table/src/Main.java b/test/928-jni-table/src/Main.java
new file mode 100644
index 0000000000..b0baea1f9d
--- /dev/null
+++ b/test/928-jni-table/src/Main.java
@@ -0,0 +1,27 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class Main {
+ public static void main(String[] args) throws Exception {
+ System.loadLibrary(args[1]);
+
+ doJNITableTest();
+
+ System.out.println("Done");
+ }
+
+ public static native void doJNITableTest();
+}
diff --git a/test/929-search/build b/test/929-search/build
new file mode 100755
index 0000000000..898e2e54a2
--- /dev/null
+++ b/test/929-search/build
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-build "$@" --experimental agents
diff --git a/test/929-search/expected.txt b/test/929-search/expected.txt
new file mode 100644
index 0000000000..a965a70ed4
--- /dev/null
+++ b/test/929-search/expected.txt
@@ -0,0 +1 @@
+Done
diff --git a/test/929-search/info.txt b/test/929-search/info.txt
new file mode 100644
index 0000000000..875a5f6ec1
--- /dev/null
+++ b/test/929-search/info.txt
@@ -0,0 +1 @@
+Tests basic functions in the jvmti plugin.
diff --git a/test/929-search/run b/test/929-search/run
new file mode 100755
index 0000000000..0a8d0672f6
--- /dev/null
+++ b/test/929-search/run
@@ -0,0 +1,23 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+# This test checks whether dex files can be injected into parent classloaders. App images preload
+# classes, which will make the injection moot. Turn off app images to avoid the issue.
+
+./default-run "$@" --experimental agents \
+ --experimental runtime-plugins \
+ --jvmti \
+ --no-app-image
diff --git a/test/929-search/search.cc b/test/929-search/search.cc
new file mode 100644
index 0000000000..d1c698491e
--- /dev/null
+++ b/test/929-search/search.cc
@@ -0,0 +1,53 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include <inttypes.h>
+
+#include "android-base/stringprintf.h"
+#include "base/logging.h"
+#include "base/macros.h"
+#include "jni.h"
+#include "openjdkjvmti/jvmti.h"
+#include "ScopedUtfChars.h"
+
+#include "ti-agent/common_helper.h"
+#include "ti-agent/common_load.h"
+
+namespace art {
+namespace Test929Search {
+
+extern "C" JNIEXPORT void JNICALL Java_Main_addToBootClassLoader(
+ JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED, jstring segment) {
+ ScopedUtfChars utf(env, segment);
+ if (utf.c_str() == nullptr) {
+ return;
+ }
+ jvmtiError result = jvmti_env->AddToBootstrapClassLoaderSearch(utf.c_str());
+ JvmtiErrorToException(env, result);
+}
+
+extern "C" JNIEXPORT void JNICALL Java_Main_addToSystemClassLoader(
+ JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED, jstring segment) {
+ ScopedUtfChars utf(env, segment);
+ if (utf.c_str() == nullptr) {
+ return;
+ }
+ jvmtiError result = jvmti_env->AddToSystemClassLoaderSearch(utf.c_str());
+ JvmtiErrorToException(env, result);
+}
+
+} // namespace Test929Search
+} // namespace art
diff --git a/test/929-search/src-ex/A.java b/test/929-search/src-ex/A.java
new file mode 100644
index 0000000000..64acb2fcfe
--- /dev/null
+++ b/test/929-search/src-ex/A.java
@@ -0,0 +1,18 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class A {
+} \ No newline at end of file
diff --git a/test/929-search/src/B.java b/test/929-search/src/B.java
new file mode 100644
index 0000000000..f1458c3bca
--- /dev/null
+++ b/test/929-search/src/B.java
@@ -0,0 +1,18 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class B {
+} \ No newline at end of file
diff --git a/test/929-search/src/Main.java b/test/929-search/src/Main.java
new file mode 100644
index 0000000000..d253e6fdf6
--- /dev/null
+++ b/test/929-search/src/Main.java
@@ -0,0 +1,54 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Arrays;
+
+public class Main {
+ public static void main(String[] args) throws Exception {
+ System.loadLibrary(args[1]);
+
+ doTest();
+ }
+
+ private static void doTest() throws Exception {
+ doTest(true, DEX1, "B");
+ doTest(false, DEX2, "A");
+ System.out.println("Done");
+ }
+
+ private static void doTest(boolean boot, String segment, String className) throws Exception {
+ ClassLoader expectedClassLoader;
+ if (boot) {
+ expectedClassLoader = Object.class.getClassLoader();
+ addToBootClassLoader(segment);
+ } else {
+ expectedClassLoader = ClassLoader.getSystemClassLoader();
+ addToSystemClassLoader(segment);
+ }
+
+ Class<?> c = Class.forName(className);
+ if (c.getClassLoader() != expectedClassLoader) {
+ throw new RuntimeException(className + "(" + boot + "/" + segment + "): " +
+ c.getClassLoader() + " vs " + expectedClassLoader);
+ }
+ }
+
+ private static native void addToBootClassLoader(String s);
+ private static native void addToSystemClassLoader(String s);
+
+ private static final String DEX1 = System.getenv("DEX_LOCATION") + "/929-search.jar";
+ private static final String DEX2 = System.getenv("DEX_LOCATION") + "/929-search-ex.jar";
+}
diff --git a/test/930-hello-retransform/build b/test/930-hello-retransform/build
new file mode 100755
index 0000000000..898e2e54a2
--- /dev/null
+++ b/test/930-hello-retransform/build
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-build "$@" --experimental agents
diff --git a/test/930-hello-retransform/expected.txt b/test/930-hello-retransform/expected.txt
new file mode 100644
index 0000000000..4774b81b49
--- /dev/null
+++ b/test/930-hello-retransform/expected.txt
@@ -0,0 +1,2 @@
+hello
+Goodbye
diff --git a/test/930-hello-retransform/info.txt b/test/930-hello-retransform/info.txt
new file mode 100644
index 0000000000..875a5f6ec1
--- /dev/null
+++ b/test/930-hello-retransform/info.txt
@@ -0,0 +1 @@
+Tests basic functions in the jvmti plugin.
diff --git a/test/930-hello-retransform/run b/test/930-hello-retransform/run
new file mode 100755
index 0000000000..4379349cb2
--- /dev/null
+++ b/test/930-hello-retransform/run
@@ -0,0 +1,19 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-run "$@" --experimental agents \
+ --experimental runtime-plugins \
+ --jvmti
diff --git a/test/930-hello-retransform/src/Main.java b/test/930-hello-retransform/src/Main.java
new file mode 100644
index 0000000000..12194c3235
--- /dev/null
+++ b/test/930-hello-retransform/src/Main.java
@@ -0,0 +1,70 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+public class Main {
+
+ /**
+ * base64 encoded class/dex file for
+ * class Transform {
+ * public void sayHi() {
+ * System.out.println("Goodbye");
+ * }
+ * }
+ */
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+ "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
+ "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
+ "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
+ "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" +
+ "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
+ "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0=");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+ "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+ "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
+ "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+ "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
+ "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
+ "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
+ "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
+ "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
+ "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
+ "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+ "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+ "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
+
+ public static void main(String[] args) {
+ System.loadLibrary(args[1]);
+ doTest(new Transform());
+ }
+
+ public static void doTest(Transform t) {
+ t.sayHi();
+ addCommonTransformationResult("Transform", CLASS_BYTES, DEX_BYTES);
+ enableCommonRetransformation(true);
+ doCommonClassRetransformation(Transform.class);
+ t.sayHi();
+ }
+
+ // Transforms the class
+ private static native void doCommonClassRetransformation(Class<?>... target);
+ private static native void enableCommonRetransformation(boolean enable);
+ private static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/930-hello-retransform/src/Transform.java b/test/930-hello-retransform/src/Transform.java
new file mode 100644
index 0000000000..8e8af355da
--- /dev/null
+++ b/test/930-hello-retransform/src/Transform.java
@@ -0,0 +1,28 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Transform {
+ public void sayHi() {
+ // Use lower 'h' to make sure the string will have a different string id
+ // than the transformation (the transformation code is the same except
+ // the actual printed String, which was making the test inacurately passing
+ // in JIT mode when loading the string from the dex cache, as the string ids
+ // of the two different strings were the same).
+ // We know the string ids will be different because lexicographically:
+ // "Goodbye" < "LTransform;" < "hello".
+ System.out.println("hello");
+ }
+}
diff --git a/test/931-agent-thread/agent_thread.cc b/test/931-agent-thread/agent_thread.cc
new file mode 100644
index 0000000000..6ace4cea68
--- /dev/null
+++ b/test/931-agent-thread/agent_thread.cc
@@ -0,0 +1,132 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include <inttypes.h>
+
+#include "barrier.h"
+#include "base/logging.h"
+#include "base/macros.h"
+#include "jni.h"
+#include "openjdkjvmti/jvmti.h"
+#include "runtime.h"
+#include "ScopedLocalRef.h"
+#include "thread-inl.h"
+#include "well_known_classes.h"
+
+#include "ti-agent/common_helper.h"
+#include "ti-agent/common_load.h"
+
+namespace art {
+namespace Test930AgentThread {
+
+struct AgentData {
+ AgentData() : main_thread(nullptr),
+ jvmti_env(nullptr),
+ b(2) {
+ }
+
+ jthread main_thread;
+ jvmtiEnv* jvmti_env;
+ Barrier b;
+ jint priority;
+};
+
+static void AgentMain(jvmtiEnv* jenv, JNIEnv* env, void* arg) {
+ AgentData* data = reinterpret_cast<AgentData*>(arg);
+
+ // Check some basics.
+ // This thread is not the main thread.
+ jthread this_thread;
+ jvmtiError this_thread_result = jenv->GetCurrentThread(&this_thread);
+ CHECK(!JvmtiErrorToException(env, this_thread_result));
+ CHECK(!env->IsSameObject(this_thread, data->main_thread));
+
+ // The thread is a daemon.
+ jvmtiThreadInfo info;
+ jvmtiError info_result = jenv->GetThreadInfo(this_thread, &info);
+ CHECK(!JvmtiErrorToException(env, info_result));
+ CHECK(info.is_daemon);
+
+ // The thread has the requested priority.
+ // TODO: Our thread priorities do not work on the host.
+ // CHECK_EQ(info.priority, data->priority);
+
+ // Check further parts of the thread:
+ jint thread_count;
+ jthread* threads;
+ jvmtiError threads_result = jenv->GetAllThreads(&thread_count, &threads);
+ CHECK(!JvmtiErrorToException(env, threads_result));
+ bool found = false;
+ for (jint i = 0; i != thread_count; ++i) {
+ if (env->IsSameObject(threads[i], this_thread)) {
+ found = true;
+ break;
+ }
+ }
+ CHECK(found);
+
+ // Done, let the main thread progress.
+ data->b.Pass(Thread::Current());
+}
+
+extern "C" JNIEXPORT void JNICALL Java_Main_testAgentThread(
+ JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED) {
+ // Create a Thread object.
+ ScopedLocalRef<jobject> thread_name(env,
+ env->NewStringUTF("Agent Thread"));
+ if (thread_name.get() == nullptr) {
+ return;
+ }
+
+ ScopedLocalRef<jobject> thread(env, env->AllocObject(WellKnownClasses::java_lang_Thread));
+ if (thread.get() == nullptr) {
+ return;
+ }
+
+ env->CallNonvirtualVoidMethod(thread.get(),
+ WellKnownClasses::java_lang_Thread,
+ WellKnownClasses::java_lang_Thread_init,
+ Runtime::Current()->GetMainThreadGroup(),
+ thread_name.get(),
+ kMinThreadPriority,
+ JNI_FALSE);
+ if (env->ExceptionCheck()) {
+ return;
+ }
+
+ jthread main_thread;
+ jvmtiError main_thread_result = jvmti_env->GetCurrentThread(&main_thread);
+ if (JvmtiErrorToException(env, main_thread_result)) {
+ return;
+ }
+
+ AgentData data;
+ data.main_thread = env->NewGlobalRef(main_thread);
+ data.jvmti_env = jvmti_env;
+ data.priority = JVMTI_THREAD_MIN_PRIORITY;
+
+ jvmtiError result = jvmti_env->RunAgentThread(thread.get(), AgentMain, &data, data.priority);
+ if (JvmtiErrorToException(env, result)) {
+ return;
+ }
+
+ data.b.Wait(Thread::Current());
+
+ env->DeleteGlobalRef(data.main_thread);
+}
+
+} // namespace Test930AgentThread
+} // namespace art
diff --git a/test/931-agent-thread/build b/test/931-agent-thread/build
new file mode 100755
index 0000000000..898e2e54a2
--- /dev/null
+++ b/test/931-agent-thread/build
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-build "$@" --experimental agents
diff --git a/test/931-agent-thread/expected.txt b/test/931-agent-thread/expected.txt
new file mode 100644
index 0000000000..a965a70ed4
--- /dev/null
+++ b/test/931-agent-thread/expected.txt
@@ -0,0 +1 @@
+Done
diff --git a/test/931-agent-thread/info.txt b/test/931-agent-thread/info.txt
new file mode 100644
index 0000000000..875a5f6ec1
--- /dev/null
+++ b/test/931-agent-thread/info.txt
@@ -0,0 +1 @@
+Tests basic functions in the jvmti plugin.
diff --git a/test/931-agent-thread/run b/test/931-agent-thread/run
new file mode 100755
index 0000000000..0a8d0672f6
--- /dev/null
+++ b/test/931-agent-thread/run
@@ -0,0 +1,23 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+# This test checks whether dex files can be injected into parent classloaders. App images preload
+# classes, which will make the injection moot. Turn off app images to avoid the issue.
+
+./default-run "$@" --experimental agents \
+ --experimental runtime-plugins \
+ --jvmti \
+ --no-app-image
diff --git a/test/931-agent-thread/src/Main.java b/test/931-agent-thread/src/Main.java
new file mode 100644
index 0000000000..6471bc8437
--- /dev/null
+++ b/test/931-agent-thread/src/Main.java
@@ -0,0 +1,29 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Arrays;
+
+public class Main {
+ public static void main(String[] args) throws Exception {
+ System.loadLibrary(args[1]);
+
+ testAgentThread();
+
+ System.out.println("Done");
+ }
+
+ private static native void testAgentThread();
+}
diff --git a/test/932-transform-saves/build b/test/932-transform-saves/build
new file mode 100755
index 0000000000..898e2e54a2
--- /dev/null
+++ b/test/932-transform-saves/build
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-build "$@" --experimental agents
diff --git a/test/932-transform-saves/expected.txt b/test/932-transform-saves/expected.txt
new file mode 100644
index 0000000000..5097771994
--- /dev/null
+++ b/test/932-transform-saves/expected.txt
@@ -0,0 +1,3 @@
+hello
+Goodbye
+hello
diff --git a/test/932-transform-saves/info.txt b/test/932-transform-saves/info.txt
new file mode 100644
index 0000000000..875a5f6ec1
--- /dev/null
+++ b/test/932-transform-saves/info.txt
@@ -0,0 +1 @@
+Tests basic functions in the jvmti plugin.
diff --git a/test/932-transform-saves/run b/test/932-transform-saves/run
new file mode 100755
index 0000000000..4379349cb2
--- /dev/null
+++ b/test/932-transform-saves/run
@@ -0,0 +1,19 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-run "$@" --experimental agents \
+ --experimental runtime-plugins \
+ --jvmti
diff --git a/test/932-transform-saves/src/Main.java b/test/932-transform-saves/src/Main.java
new file mode 100644
index 0000000000..d98ba6dbff
--- /dev/null
+++ b/test/932-transform-saves/src/Main.java
@@ -0,0 +1,116 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+public class Main {
+ /**
+ * base64 encoded class/dex file for
+ * class Transform {
+ * public void sayHi() {
+ * System.out.println("hello");
+ * }
+ * }
+ */
+ private static final byte[] CLASS_BYTES_A = Base64.getDecoder().decode(
+ "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+ "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
+ "BwAIBwAWDAAXABgBAAVoZWxsbwcAGQwAGgAbAQAJVHJhbnNmb3JtAQAQamF2YS9sYW5nL09iamVj" +
+ "dAEAEGphdmEvbGFuZy9TeXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsBABNqYXZh" +
+ "L2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgAgAAUABgAA" +
+ "AAAAAgAAAAcACAABAAkAAAAdAAEAAQAAAAUqtwABsQAAAAEACgAAAAYAAQAAABEAAQALAAgAAQAJ" +
+ "AAAAJQACAAEAAAAJsgACEgO2AASxAAAAAQAKAAAACgACAAAAGgAIABsAAQAMAAAAAgAN");
+ private static final byte[] DEX_BYTES_A = Base64.getDecoder().decode(
+ "ZGV4CjAzNQC6XWInnnDd1H4NdQ3P3inH8eCVmQI6W7LMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+ "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+ "AABqAQAAdwEAAI4BAACiAQAAtgEAAMoBAADaAQAA3QEAAOEBAAD1AQAA/AEAAAECAAAKAgAAAQAA" +
+ "AAIAAAADAAAABAAAAAUAAAAHAAAABwAAAAUAAAAAAAAACAAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+ "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAGAAAAAAAAABwCAAAA" +
+ "AAAAAQABAAEAAAARAgAABAAAAHAQAwAAAA4AAwABAAIAAAAWAgAACQAAAGIAAAAbAQoAAABuIAIA" +
+ "EAAOAAAAAQAAAAMABjxpbml0PgALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwAS" +
+ "TGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xhbmcvU3lzdGVt" +
+ "OwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTQuMjIABWhlbGxvAANvdXQA" +
+ "B3ByaW50bG4ABXNheUhpABEABw4AGgAHDocAAAABAQCAgASgAgEBuAIAAA0AAAAAAAAAAQAAAAAA" +
+ "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+ "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+ "AgAAABECAAAAIAAAAQAAABwCAAAAEAAAAQAAACwCAAA=");
+
+ /**
+ * base64 encoded class/dex file for
+ * class Transform {
+ * public void sayHi() {
+ * System.out.println("Goodbye");
+ * }
+ * }
+ */
+ private static final byte[] CLASS_BYTES_B = Base64.getDecoder().decode(
+ "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+ "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
+ "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
+ "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
+ "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" +
+ "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
+ "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0=");
+ private static final byte[] DEX_BYTES_B = Base64.getDecoder().decode(
+ "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+ "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+ "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
+ "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+ "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
+ "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
+ "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
+ "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
+ "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
+ "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
+ "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+ "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+ "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
+
+ public static void main(String[] args) {
+ System.loadLibrary(args[1]);
+ doTest(new Transform());
+ }
+
+ public static void doTest(Transform t) {
+ // TODO We currently need to do this transform call since we don't have any way to make the
+ // original-dex-file a single-class dex-file letting us restore it easily. We should use the
+ // manipulation library that is being made when we store the original dex file.
+ // TODO REMOVE this theoretically does nothing but it ensures the original-dex-file we have set
+ // is one we can return to unaltered.
+ doCommonClassRedefinition(Transform.class, CLASS_BYTES_A, DEX_BYTES_A);
+ t.sayHi();
+
+ // Now turn it into DEX_BYTES_B so it says 'Goodbye'
+ addCommonTransformationResult("Transform", CLASS_BYTES_B, DEX_BYTES_B);
+ enableCommonRetransformation(true);
+ doCommonClassRetransformation(Transform.class);
+ t.sayHi();
+
+ // Now turn it back to normal by removing the load-hook and transforming again.
+ enableCommonRetransformation(false);
+ doCommonClassRetransformation(Transform.class);
+ t.sayHi();
+ }
+
+ // Transforms the class
+ private static native void doCommonClassRedefinition(Class<?> target,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+ private static native void doCommonClassRetransformation(Class<?>... target);
+ private static native void enableCommonRetransformation(boolean enable);
+ private static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/932-transform-saves/src/Transform.java b/test/932-transform-saves/src/Transform.java
new file mode 100644
index 0000000000..8e8af355da
--- /dev/null
+++ b/test/932-transform-saves/src/Transform.java
@@ -0,0 +1,28 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Transform {
+ public void sayHi() {
+ // Use lower 'h' to make sure the string will have a different string id
+ // than the transformation (the transformation code is the same except
+ // the actual printed String, which was making the test inacurately passing
+ // in JIT mode when loading the string from the dex cache, as the string ids
+ // of the two different strings were the same).
+ // We know the string ids will be different because lexicographically:
+ // "Goodbye" < "LTransform;" < "hello".
+ System.out.println("hello");
+ }
+}
diff --git a/test/953-invoke-polymorphic-compiler/build b/test/953-invoke-polymorphic-compiler/build
new file mode 100755
index 0000000000..a423ca6b4e
--- /dev/null
+++ b/test/953-invoke-polymorphic-compiler/build
@@ -0,0 +1,25 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+# make us exit on a failure
+set -e
+
+if [[ $@ != *"--jvm"* ]]; then
+ # Don't do anything with jvm.
+ export USE_JACK=true
+fi
+
+./default-build "$@" --experimental method-handles
diff --git a/test/953-invoke-polymorphic-compiler/expected.txt b/test/953-invoke-polymorphic-compiler/expected.txt
new file mode 100644
index 0000000000..f47ee23fd8
--- /dev/null
+++ b/test/953-invoke-polymorphic-compiler/expected.txt
@@ -0,0 +1,25 @@
+Running Main.Min2Print2([33, -4])
+Running Main.Min2Print2([-4, 33])
+Running Main.Min2Print3([33, -4, 17])
+Running Main.Min2Print3([-4, 17, 33])
+Running Main.Min2Print3([17, 33, -4])
+Running Main.Min2Print6([33, -4, 77, 88, 99, 111])
+Running Main.Min2Print6([-4, 77, 88, 99, 111, 33])
+Running Main.Min2Print6([77, 88, 99, 111, 33, -4])
+Running Main.Min2Print6([88, 99, 111, 33, -4, 77])
+Running Main.Min2Print6([99, 111, 33, -4, 77, 88])
+Running Main.Min2Print6([111, 33, -4, 77, 88, 99])
+Running Main.Min2Print26([0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25])
+Running Main.Min2Print26([25, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24])
+Running Main.Min2Print26([24, 25, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23])
+BasicTest done.
+$opt$ReturnBooleanTest done.
+$opt$ReturnCharTest done.
+$opt$ReturnByteTest done.
+$opt$ReturnShortTest done.
+$opt$ReturnIntTest done.
+$opt$ReturnLongTest done.
+$opt$ReturnFloatTest done.
+$opt$ReturnDoubleTest done.
+$opt$ReturnStringTest done.
+ReturnValuesTest done.
diff --git a/test/953-invoke-polymorphic-compiler/info.txt b/test/953-invoke-polymorphic-compiler/info.txt
new file mode 100644
index 0000000000..f1dbb61640
--- /dev/null
+++ b/test/953-invoke-polymorphic-compiler/info.txt
@@ -0,0 +1,3 @@
+Tests for method handle invocations.
+
+NOTE: needs to run under ART or a Java 8 Language runtime and compiler.
diff --git a/test/953-invoke-polymorphic-compiler/src/Main.java b/test/953-invoke-polymorphic-compiler/src/Main.java
new file mode 100644
index 0000000000..20a8fec112
--- /dev/null
+++ b/test/953-invoke-polymorphic-compiler/src/Main.java
@@ -0,0 +1,374 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.lang.invoke.MethodHandle;
+import java.lang.invoke.MethodHandles;
+import java.lang.invoke.MethodHandles.Lookup;
+import java.lang.invoke.MethodType;
+import java.lang.invoke.WrongMethodTypeException;
+import java.lang.reflect.Constructor;
+import java.lang.reflect.Field;
+import java.lang.reflect.Method;
+import java.nio.charset.Charset;
+import java.nio.charset.StandardCharsets;
+import java.util.ArrayList;
+import java.util.Arrays;
+import java.util.List;
+
+public class Main {
+ public static void assertTrue(boolean value) {
+ if (!value) {
+ throw new AssertionError("assertTrue value: " + value);
+ }
+ }
+
+ public static void assertFalse(boolean value) {
+ if (value) {
+ throw new AssertionError("assertTrue value: " + value);
+ }
+ }
+
+ public static void assertEquals(int i1, int i2) {
+ if (i1 == i2) { return; }
+ throw new AssertionError("assertEquals i1: " + i1 + ", i2: " + i2);
+ }
+
+ public static void assertEquals(long i1, long i2) {
+ if (i1 == i2) { return; }
+ throw new AssertionError("assertEquals l1: " + i1 + ", l2: " + i2);
+ }
+
+ public static void assertEquals(Object o, Object p) {
+ if (o == p) { return; }
+ if (o != null && p != null && o.equals(p)) { return; }
+ throw new AssertionError("assertEquals: o1: " + o + ", o2: " + p);
+ }
+
+ public static void assertEquals(String s1, String s2) {
+ if (s1 == s2) {
+ return;
+ }
+
+ if (s1 != null && s2 != null && s1.equals(s2)) {
+ return;
+ }
+
+ throw new AssertionError("assertEquals s1: " + s1 + ", s2: " + s2);
+ }
+
+ public static void fail() {
+ System.err.println("fail");
+ Thread.dumpStack();
+ }
+
+ public static void fail(String message) {
+ System.err.println("fail: " + message);
+ Thread.dumpStack();
+ }
+
+ public static int Min2Print2(int a, int b) {
+ int[] values = new int[] { a, b };
+ System.err.println("Running Main.Min2Print2(" + Arrays.toString(values) + ")");
+ return a > b ? a : b;
+ }
+
+ public static int Min2Print3(int a, int b, int c) {
+ int[] values = new int[] { a, b, c };
+ System.err.println("Running Main.Min2Print3(" + Arrays.toString(values) + ")");
+ return a > b ? a : b;
+ }
+
+ public static int Min2Print6(int a, int b, int c, int d, int e, int f) {
+ int[] values = new int[] { a, b, c, d, e, f };
+ System.err.println("Running Main.Min2Print6(" + Arrays.toString(values) + ")");
+ return a > b ? a : b;
+ }
+
+ public static int Min2Print26(int a, int b, int c, int d,
+ int e, int f, int g, int h,
+ int i, int j, int k, int l,
+ int m, int n, int o, int p,
+ int q, int r, int s, int t,
+ int u, int v, int w, int x,
+ int y, int z) {
+ int[] values = new int[] { a, b, c, d, e, f, g, h, i, j, k, l, m,
+ n, o, p, q, r, s, t, u, v, w, x, y, z };
+ System.err.println("Running Main.Min2Print26(" + Arrays.toString(values) + ")");
+ return a > b ? a : b;
+ }
+
+ public static void $opt$BasicTest() throws Throwable {
+ MethodHandle mh;
+ mh = MethodHandles.lookup().findStatic(
+ Main.class, "Min2Print2", MethodType.methodType(int.class, int.class, int.class));
+ assertEquals((int) mh.invokeExact(33, -4), 33);
+ assertEquals((int) mh.invokeExact(-4, 33), 33);
+
+ mh = MethodHandles.lookup().findStatic(
+ Main.class, "Min2Print3",
+ MethodType.methodType(int.class, int.class, int.class, int.class));
+ assertEquals((int) mh.invokeExact(33, -4, 17), 33);
+ assertEquals((int) mh.invokeExact(-4, 17, 33), 17);
+ assertEquals((int) mh.invokeExact(17, 33, -4), 33);
+
+ mh = MethodHandles.lookup().findStatic(
+ Main.class, "Min2Print6",
+ MethodType.methodType(
+ int.class, int.class, int.class, int.class, int.class, int.class, int.class));
+ assertEquals((int) mh.invokeExact(33, -4, 77, 88, 99, 111), 33);
+ try {
+ // Too few arguments
+ assertEquals((int) mh.invokeExact(33, -4, 77, 88), 33);
+ fail("No WMTE for too few arguments");
+ } catch (WrongMethodTypeException e) {}
+ try {
+ // Too many arguments
+ assertEquals((int) mh.invokeExact(33, -4, 77, 88, 89, 90, 91), 33);
+ fail("No WMTE for too many arguments");
+ } catch (WrongMethodTypeException e) {}
+ assertEquals((int) mh.invokeExact(-4, 77, 88, 99, 111, 33), 77);
+ assertEquals((int) mh.invokeExact(77, 88, 99, 111, 33, -4), 88);
+ assertEquals((int) mh.invokeExact(88, 99, 111, 33, -4, 77), 99);
+ assertEquals((int) mh.invokeExact(99, 111, 33, -4, 77, 88), 111);
+ assertEquals((int) mh.invokeExact(111, 33, -4, 77, 88, 99), 111);
+
+ // A preposterous number of arguments.
+ mh = MethodHandles.lookup().findStatic(
+ Main.class, "Min2Print26",
+ MethodType.methodType(
+ // Return-type
+ int.class,
+ // Arguments
+ int.class, int.class, int.class, int.class, int.class, int.class, int.class, int.class,
+ int.class, int.class, int.class, int.class, int.class, int.class, int.class, int.class,
+ int.class, int.class, int.class, int.class, int.class, int.class, int.class, int.class,
+ int.class, int.class));
+ assertEquals(1, (int) mh.invokeExact(0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
+ 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25));
+ assertEquals(25, (int) mh.invokeExact(25, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
+ 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24));
+ assertEquals(25, (int) mh.invokeExact(24, 25, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
+ 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23));
+
+ try {
+ // Wrong argument type
+ mh.invokeExact("a");
+ fail("No WMTE for wrong arguments");
+ } catch (WrongMethodTypeException wmte) {}
+
+ try {
+ // Invoke on null handle.
+ MethodHandle mh0 = null;
+ mh0.invokeExact("bad");
+ fail("No NPE for you");
+ } catch (NullPointerException npe) {}
+
+ System.err.println("BasicTest done.");
+ }
+
+ private static boolean And(boolean lhs, boolean rhs) {
+ return lhs & rhs;
+ }
+
+ private static boolean Xor(boolean lhs, boolean rhs) {
+ return lhs ^ rhs;
+ }
+
+ private static String Multiply(String value, int n) {
+ String result = "";
+ for (int i = 0; i < n; ++i) {
+ result = value + result;
+ }
+ return result;
+ }
+
+ private static byte Multiply(byte value, byte n) {
+ return (byte)(value * n);
+ }
+
+ private static short Multiply(short value, short n) {
+ return (short)(value * n);
+ }
+
+ private static int Multiply(int value, int n) {
+ return value * n;
+ }
+
+ private static long Multiply(long value, long n) {
+ return value * n;
+ }
+
+ private static float Multiply(float value, float n) {
+ return value * n;
+ }
+
+ private static double Multiply(double value, double n) {
+ return value * n;
+ }
+
+ private static char Next(char c) {
+ return (char)(c + 1);
+ }
+
+ public static void $opt$ReturnBooleanTest() throws Throwable {
+ MethodHandles.Lookup lookup = MethodHandles.lookup();
+ MethodHandle mh =
+ lookup.findStatic(Main.class, "And",
+ MethodType.methodType(boolean.class, boolean.class, boolean.class));
+ assertEquals(true, (boolean) mh.invokeExact(true, true));
+ assertEquals(false, (boolean) mh.invokeExact(true, false));
+ assertEquals(false, (boolean) mh.invokeExact(false, true));
+ assertEquals(false, (boolean) mh.invokeExact(false, false));
+ assertEquals(true, (boolean) mh.invoke(true, true));
+ assertEquals(false, (boolean) mh.invoke(true, false));
+ assertEquals(false, (boolean) mh.invoke(false, true));
+ assertEquals(false, (boolean) mh.invoke(false, false));
+
+ mh = lookup.findStatic(Main.class, "Xor",
+ MethodType.methodType(boolean.class, boolean.class, boolean.class));
+ assertEquals(false, (boolean) mh.invokeExact(true, true));
+ assertEquals(true, (boolean) mh.invokeExact(true, false));
+ assertEquals(true, (boolean) mh.invokeExact(false, true));
+ assertEquals(false, (boolean) mh.invokeExact(false, false));
+ assertEquals(false, (boolean) mh.invoke(true, true));
+ assertEquals(true, (boolean) mh.invoke(true, false));
+ assertEquals(true, (boolean) mh.invoke(false, true));
+ assertEquals(false, (boolean) mh.invoke(false, false));
+
+ System.err.println("$opt$ReturnBooleanTest done.");
+ }
+
+ public static void $opt$ReturnCharTest() throws Throwable {
+ MethodHandles.Lookup lookup = MethodHandles.lookup();
+ MethodHandle mh = lookup.findStatic(Main.class, "Next",
+ MethodType.methodType(char.class, char.class));
+ assertEquals('B', (char) mh.invokeExact('A'));
+ assertEquals((char) -55, (char) mh.invokeExact((char) -56));
+ System.err.println("$opt$ReturnCharTest done.");
+ }
+
+ public static void $opt$ReturnByteTest() throws Throwable {
+ MethodHandles.Lookup lookup = MethodHandles.lookup();
+ MethodHandle mh = lookup.findStatic(Main.class, "Multiply",
+ MethodType.methodType(byte.class, byte.class, byte.class));
+ assertEquals((byte) 30, (byte) mh.invokeExact((byte) 10, (byte) 3));
+ assertEquals((byte) -90, (byte) mh.invoke((byte) -10, (byte) 9));
+ System.err.println("$opt$ReturnByteTest done.");
+ }
+
+ public static void $opt$ReturnShortTest() throws Throwable {
+ MethodHandles.Lookup lookup = MethodHandles.lookup();
+ MethodHandle mh = lookup.findStatic(Main.class, "Multiply",
+ MethodType.methodType(short.class, short.class, short.class));
+ assertEquals((short) 3000, (short) mh.invokeExact((short) 1000, (short) 3));
+ assertEquals((short) -3000, (short) mh.invoke((short) -1000, (short) 3));
+ System.err.println("$opt$ReturnShortTest done.");
+ }
+
+ public static void $opt$ReturnIntTest() throws Throwable {
+ MethodHandles.Lookup lookup = MethodHandles.lookup();
+ MethodHandle mh = lookup.findStatic(Main.class, "Multiply",
+ MethodType.methodType(int.class, int.class, int.class));
+ assertEquals(3_000_000, (int) mh.invokeExact(1_000_000, 3));
+ assertEquals(-3_000_000, (int) mh.invoke(-1_000, 3_000));
+ System.err.println("$opt$ReturnIntTest done.");
+ }
+
+ public static void $opt$ReturnLongTest() throws Throwable {
+ MethodHandles.Lookup lookup = MethodHandles.lookup();
+ MethodHandle mh = lookup.findStatic(Main.class, "Multiply",
+ MethodType.methodType(long.class, long.class, long.class));
+ assertEquals(4_294_967_295_000L, (long) mh.invokeExact(1000L, 4_294_967_295L));
+ assertEquals(-4_294_967_295_000L, (long) mh.invoke(-1000L, 4_294_967_295L));
+ System.err.println("$opt$ReturnLongTest done.");
+ }
+
+ public static void $opt$ReturnFloatTest() throws Throwable {
+ MethodHandles.Lookup lookup = MethodHandles.lookup();
+ MethodHandle mh = lookup.findStatic(Main.class, "Multiply",
+ MethodType.methodType(float.class, float.class, float.class));
+ assertEquals(3.0F, (float) mh.invokeExact(1000.0F, 3e-3F));
+ assertEquals(-3.0F, (float) mh.invoke(-1000.0F, 3e-3F));
+ System.err.println("$opt$ReturnFloatTest done.");
+ }
+
+ public static void $opt$ReturnDoubleTest() throws Throwable {
+ MethodHandles.Lookup lookup = MethodHandles.lookup();
+ MethodHandle mh = lookup.findStatic(Main.class, "Multiply",
+ MethodType.methodType(double.class, double.class, double.class));
+ assertEquals(3033000.0, (double) mh.invokeExact(1000.0, 3.033e3));
+ assertEquals(-3033000.0, (double) mh.invoke(-1000.0, 3.033e3));
+ System.err.println("$opt$ReturnDoubleTest done.");
+ }
+
+ public static void $opt$ReturnStringTest() throws Throwable {
+ MethodHandles.Lookup lookup = MethodHandles.lookup();
+ MethodHandle mh = lookup.findStatic(Main.class, "Multiply",
+ MethodType.methodType(String.class, String.class, int.class));
+ assertEquals("100010001000", (String) mh.invokeExact("1000", 3));
+ assertEquals("100010001000", (String) mh.invoke("1000", 3));
+ System.err.println("$opt$ReturnStringTest done.");
+ }
+
+ public static void ReturnValuesTest() throws Throwable {
+ $opt$ReturnBooleanTest();
+ $opt$ReturnCharTest();
+ $opt$ReturnByteTest();
+ $opt$ReturnShortTest();
+ $opt$ReturnIntTest();
+ $opt$ReturnLongTest();
+ $opt$ReturnFloatTest();
+ $opt$ReturnDoubleTest();
+ $opt$ReturnStringTest();
+ System.err.println("ReturnValuesTest done.");
+ }
+
+ static class ValueHolder {
+ public boolean m_z;
+ public static boolean s_z;
+ }
+
+ public static void $opt$AccessorsTest() throws Throwable {
+ ValueHolder valueHolder = new ValueHolder();
+ MethodHandles.Lookup lookup = MethodHandles.lookup();
+
+ MethodHandle setMember = lookup.findSetter(ValueHolder.class, "m_z", boolean.class);
+ MethodHandle getMember = lookup.findGetter(ValueHolder.class, "m_z", boolean.class);
+ MethodHandle setStatic = lookup.findStaticSetter(ValueHolder.class, "s_z", boolean.class);
+ MethodHandle getStatic = lookup.findStaticGetter(ValueHolder.class, "s_z", boolean.class);
+
+ boolean [] values = { false, true, false, true, false };
+ for (boolean value : values) {
+ assertEquals((boolean) getStatic.invoke(), ValueHolder.s_z);
+ setStatic.invoke(value);
+ ValueHolder.s_z = value;
+ assertEquals(ValueHolder.s_z, value);
+ assertEquals((boolean) getStatic.invoke(), value);
+
+ assertEquals((boolean) getMember.invoke(valueHolder), valueHolder.m_z);
+ setMember.invoke(valueHolder, value);
+ valueHolder.m_z = value;
+ assertEquals(valueHolder.m_z, value);
+ assertEquals((boolean) getMember.invoke(valueHolder), value);
+ }
+ }
+
+ public static void main(String[] args) throws Throwable {
+ $opt$BasicTest();
+ ReturnValuesTest();
+ $opt$AccessorsTest();
+ }
+}
diff --git a/test/956-methodhandles/src/Main.java b/test/956-methodhandles/src/Main.java
index 17b56b4fd9..f8daba6239 100644
--- a/test/956-methodhandles/src/Main.java
+++ b/test/956-methodhandles/src/Main.java
@@ -76,6 +76,7 @@ public class Main {
testStringConstructors();
testReturnValueConversions();
testVariableArity();
+ testVariableArity_MethodHandles_bind();
}
public static void testfindSpecial_invokeSuperBehaviour() throws Throwable {
@@ -1466,4 +1467,23 @@ public class Main {
fail();
} catch (WrongMethodTypeException e) {}
}
+
+ // The same tests as the above, except that we use use MethodHandles.bind instead of
+ // MethodHandle.bindTo.
+ public static void testVariableArity_MethodHandles_bind() throws Throwable {
+ VariableArityTester vat = new VariableArityTester();
+ MethodHandle mh = MethodHandles.lookup().bind(vat, "update",
+ MethodType.methodType(String.class, boolean[].class));
+ assertTrue(mh.isVarargsCollector());
+
+ assertEquals("[]", mh.invoke());
+ assertEquals("[true, false, true]", mh.invoke(true, false, true));
+ assertEquals("[true, false, true]", mh.invoke(new boolean[] { true, false, true}));
+ assertEquals("[false, true]", mh.invoke(Boolean.valueOf(false), Boolean.valueOf(true)));
+
+ try {
+ mh.invoke(true, true, 0);
+ fail();
+ } catch (WrongMethodTypeException e) {}
+ }
}
diff --git a/test/957-methodhandle-transforms/src/Main.java b/test/957-methodhandle-transforms/src/Main.java
index 5806509fc3..eebf55fb61 100644
--- a/test/957-methodhandle-transforms/src/Main.java
+++ b/test/957-methodhandle-transforms/src/Main.java
@@ -33,6 +33,7 @@ public class Main {
testBindTo();
testFilterReturnValue();
testPermuteArguments();
+ testInvokers();
}
public static void testThrowException() throws Throwable {
@@ -40,17 +41,17 @@ public class Main {
IllegalArgumentException.class);
if (handle.type().returnType() != String.class) {
- System.out.println("Unexpected return type for handle: " + handle +
+ fail("Unexpected return type for handle: " + handle +
" [ " + handle.type() + "]");
}
final IllegalArgumentException iae = new IllegalArgumentException("boo!");
try {
handle.invoke(iae);
- System.out.println("Expected an exception of type: java.lang.IllegalArgumentException");
+ fail("Expected an exception of type: java.lang.IllegalArgumentException");
} catch (IllegalArgumentException expected) {
if (expected != iae) {
- System.out.println("Wrong exception: expected " + iae + " but was " + expected);
+ fail("Wrong exception: expected " + iae + " but was " + expected);
}
}
}
@@ -262,7 +263,7 @@ public class Main {
array[0] = 42;
int value = (int) getter.invoke(array, 0);
if (value != 42) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
try {
@@ -284,7 +285,7 @@ public class Main {
array[0] = 42;
long value = (long) getter.invoke(array, 0);
if (value != 42l) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
}
@@ -294,7 +295,7 @@ public class Main {
array[0] = 42;
short value = (short) getter.invoke(array, 0);
if (value != 42l) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
}
@@ -304,7 +305,7 @@ public class Main {
array[0] = 42;
char value = (char) getter.invoke(array, 0);
if (value != 42l) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
}
@@ -314,7 +315,7 @@ public class Main {
array[0] = (byte) 0x8;
byte value = (byte) getter.invoke(array, 0);
if (value != (byte) 0x8) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
}
@@ -324,7 +325,7 @@ public class Main {
array[0] = true;
boolean value = (boolean) getter.invoke(array, 0);
if (!value) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
}
@@ -334,7 +335,7 @@ public class Main {
array[0] = 42.0f;
float value = (float) getter.invoke(array, 0);
if (value != 42.0f) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
}
@@ -344,7 +345,7 @@ public class Main {
array[0] = 42.0;
double value = (double) getter.invoke(array, 0);
if (value != 42.0) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
}
@@ -372,10 +373,10 @@ public class Main {
setter.invoke(array, 1, 43);
if (array[0] != 42) {
- System.out.println("Unexpected value: " + array[0]);
+ fail("Unexpected value: " + array[0]);
}
if (array[1] != 43) {
- System.out.println("Unexpected value: " + array[1]);
+ fail("Unexpected value: " + array[1]);
}
try {
@@ -396,7 +397,7 @@ public class Main {
long[] array = new long[1];
setter.invoke(array, 0, 42l);
if (array[0] != 42l) {
- System.out.println("Unexpected value: " + array[0]);
+ fail("Unexpected value: " + array[0]);
}
}
@@ -405,7 +406,7 @@ public class Main {
short[] array = new short[1];
setter.invoke(array, 0, (short) 42);
if (array[0] != 42l) {
- System.out.println("Unexpected value: " + array[0]);
+ fail("Unexpected value: " + array[0]);
}
}
@@ -414,7 +415,7 @@ public class Main {
char[] array = new char[1];
setter.invoke(array, 0, (char) 42);
if (array[0] != 42) {
- System.out.println("Unexpected value: " + array[0]);
+ fail("Unexpected value: " + array[0]);
}
}
@@ -423,7 +424,7 @@ public class Main {
byte[] array = new byte[1];
setter.invoke(array, 0, (byte) 0x8);
if (array[0] != (byte) 0x8) {
- System.out.println("Unexpected value: " + array[0]);
+ fail("Unexpected value: " + array[0]);
}
}
@@ -432,7 +433,7 @@ public class Main {
boolean[] array = new boolean[1];
setter.invoke(array, 0, true);
if (!array[0]) {
- System.out.println("Unexpected value: " + array[0]);
+ fail("Unexpected value: " + array[0]);
}
}
@@ -441,7 +442,7 @@ public class Main {
float[] array = new float[1];
setter.invoke(array, 0, 42.0f);
if (array[0] != 42.0f) {
- System.out.println("Unexpected value: " + array[0]);
+ fail("Unexpected value: " + array[0]);
}
}
@@ -450,7 +451,7 @@ public class Main {
double[] array = new double[1];
setter.invoke(array, 0, 42.0);
if (array[0] != 42.0) {
- System.out.println("Unexpected value: " + array[0]);
+ fail("Unexpected value: " + array[0]);
}
}
@@ -471,7 +472,7 @@ public class Main {
MethodHandle identity = MethodHandles.identity(boolean.class);
boolean value = (boolean) identity.invoke(false);
if (value) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
}
@@ -479,7 +480,7 @@ public class Main {
MethodHandle identity = MethodHandles.identity(byte.class);
byte value = (byte) identity.invoke((byte) 0x8);
if (value != (byte) 0x8) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
}
@@ -487,7 +488,7 @@ public class Main {
MethodHandle identity = MethodHandles.identity(char.class);
char value = (char) identity.invoke((char) -56);
if (value != (char) -56) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
}
@@ -495,7 +496,7 @@ public class Main {
MethodHandle identity = MethodHandles.identity(short.class);
short value = (short) identity.invoke((short) -59);
if (value != (short) -59) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + Short.toString(value));
}
}
@@ -503,7 +504,7 @@ public class Main {
MethodHandle identity = MethodHandles.identity(int.class);
int value = (int) identity.invoke(52);
if (value != 52) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
}
@@ -511,7 +512,7 @@ public class Main {
MethodHandle identity = MethodHandles.identity(long.class);
long value = (long) identity.invoke(-76l);
if (value != (long) -76) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
}
@@ -519,7 +520,7 @@ public class Main {
MethodHandle identity = MethodHandles.identity(float.class);
float value = (float) identity.invoke(56.0f);
if (value != (float) 56.0f) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
}
@@ -527,7 +528,7 @@ public class Main {
MethodHandle identity = MethodHandles.identity(double.class);
double value = (double) identity.invoke((double) 72.0);
if (value != (double) 72.0) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
}
@@ -544,28 +545,28 @@ public class Main {
MethodHandle constant = MethodHandles.constant(int.class, 56);
int value = (int) constant.invoke();
if (value != 56) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
// short constant values are converted to int.
constant = MethodHandles.constant(int.class, (short) 52);
value = (int) constant.invoke();
if (value != 52) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
// char constant values are converted to int.
constant = MethodHandles.constant(int.class, (char) 'b');
value = (int) constant.invoke();
if (value != (int) 'b') {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
// int constant values are converted to int.
constant = MethodHandles.constant(int.class, (byte) 0x1);
value = (int) constant.invoke();
if (value != 1) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
// boolean, float, double and long primitive constants are not convertible
@@ -600,13 +601,13 @@ public class Main {
MethodHandle constant = MethodHandles.constant(long.class, 56l);
long value = (long) constant.invoke();
if (value != 56l) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
constant = MethodHandles.constant(long.class, (int) 56);
value = (long) constant.invoke();
if (value != 56l) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
}
@@ -615,7 +616,7 @@ public class Main {
MethodHandle constant = MethodHandles.constant(byte.class, (byte) 0x12);
byte value = (byte) constant.invoke();
if (value != (byte) 0x12) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
}
@@ -624,7 +625,7 @@ public class Main {
MethodHandle constant = MethodHandles.constant(boolean.class, true);
boolean value = (boolean) constant.invoke();
if (!value) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
}
@@ -633,7 +634,7 @@ public class Main {
MethodHandle constant = MethodHandles.constant(char.class, 'f');
char value = (char) constant.invoke();
if (value != 'f') {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
}
@@ -642,7 +643,7 @@ public class Main {
MethodHandle constant = MethodHandles.constant(short.class, (short) 123);
short value = (short) constant.invoke();
if (value != (short) 123) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
}
@@ -651,7 +652,7 @@ public class Main {
MethodHandle constant = MethodHandles.constant(float.class, 56.0f);
float value = (float) constant.invoke();
if (value != 56.0f) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
}
@@ -660,7 +661,7 @@ public class Main {
MethodHandle constant = MethodHandles.constant(double.class, 256.0);
double value = (double) constant.invoke();
if (value != 256.0) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
}
@@ -678,13 +679,13 @@ public class Main {
char value = (char) stringCharAt.invoke("foo", 0);
if (value != 'f') {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
MethodHandle bound = stringCharAt.bindTo("foo");
value = (char) bound.invoke(0);
if (value != 'f') {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
try {
@@ -706,7 +707,7 @@ public class Main {
bound = integerParseInt.bindTo("78452");
int intValue = (int) bound.invoke();
if (intValue != 78452) {
- System.out.println("Unexpected value: " + intValue);
+ fail("Unexpected value: " + intValue);
}
}
@@ -745,11 +746,11 @@ public class Main {
boolean value = (boolean) adapter.invoke((int) 42);
if (!value) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
value = (boolean) adapter.invoke((int) 43);
if (value) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
}
@@ -764,7 +765,7 @@ public class Main {
int value = (int) adapter.invoke("56");
if (value != 57) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
}
@@ -779,7 +780,7 @@ public class Main {
int value = (int) adapter.invoke();
if (value != 42) {
- System.out.println("Unexpected value: " + value);
+ fail("Unexpected value: " + value);
}
}
}
@@ -791,7 +792,7 @@ public class Main {
return;
}
- System.out.println("Unexpected arguments: " + a + ", " + b + ", " + c
+ fail("Unexpected arguments: " + a + ", " + b + ", " + c
+ ", " + d + ", " + e + ", " + f + ", " + g + ", " + h);
}
@@ -800,7 +801,7 @@ public class Main {
return;
}
- System.out.println("Unexpected arguments: " + a + ", " + b);
+ fail("Unexpected arguments: " + a + ", " + b);
}
public static void testPermuteArguments() throws Throwable {
@@ -888,11 +889,48 @@ public class Main {
}
}
+ private static Object returnBar() {
+ return "bar";
+ }
+
+ public static void testInvokers() throws Throwable {
+ final MethodType targetType = MethodType.methodType(String.class, String.class);
+ final MethodHandle target = MethodHandles.lookup().findVirtual(
+ String.class, "concat", targetType);
+
+ MethodHandle invoker = MethodHandles.invoker(target.type());
+ assertEquals("barbar", (String) invoker.invoke(target, "bar", "bar"));
+ assertEquals("barbar", (String) invoker.invoke(target, (Object) returnBar(), "bar"));
+ try {
+ String foo = (String) invoker.invoke(target, "bar", "bar", 24);
+ fail();
+ } catch (WrongMethodTypeException expected) {
+ }
+
+ MethodHandle exactInvoker = MethodHandles.exactInvoker(target.type());
+ assertEquals("barbar", (String) exactInvoker.invoke(target, "bar", "bar"));
+ try {
+ String foo = (String) exactInvoker.invoke(target, (Object) returnBar(), "bar");
+ fail();
+ } catch (WrongMethodTypeException expected) {
+ }
+ try {
+ String foo = (String) exactInvoker.invoke(target, "bar", "bar", 24);
+ fail();
+ } catch (WrongMethodTypeException expected) {
+ }
+ }
+
public static void fail() {
System.out.println("FAIL");
Thread.dumpStack();
}
+ public static void fail(String message) {
+ System.out.println("fail: " + message);
+ Thread.dumpStack();
+ }
+
public static void assertEquals(String s1, String s2) {
if (s1 == s2) {
return;
diff --git a/test/958-methodhandle-emulated-stackframe/run b/test/958-methodhandle-emulated-stackframe/run
deleted file mode 100755
index a9f182288c..0000000000
--- a/test/958-methodhandle-emulated-stackframe/run
+++ /dev/null
@@ -1,20 +0,0 @@
-#!/bin/bash
-#
-# Copyright 2016 The Android Open Source Project
-#
-# Licensed under the Apache License, Version 2.0 (the "License");
-# you may not use this file except in compliance with the License.
-# You may obtain a copy of the License at
-#
-# http://www.apache.org/licenses/LICENSE-2.0
-#
-# Unless required by applicable law or agreed to in writing, software
-# distributed under the License is distributed on an "AS IS" BASIS,
-# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
-# See the License for the specific language governing permissions and
-# limitations under the License.
-
-# make us exit on a failure
-set -e
-
-./default-run "$@" --experimental method-handles
diff --git a/test/959-invoke-polymorphic-accessors/run b/test/959-invoke-polymorphic-accessors/run
deleted file mode 100644
index a9f182288c..0000000000
--- a/test/959-invoke-polymorphic-accessors/run
+++ /dev/null
@@ -1,20 +0,0 @@
-#!/bin/bash
-#
-# Copyright 2016 The Android Open Source Project
-#
-# Licensed under the Apache License, Version 2.0 (the "License");
-# you may not use this file except in compliance with the License.
-# You may obtain a copy of the License at
-#
-# http://www.apache.org/licenses/LICENSE-2.0
-#
-# Unless required by applicable law or agreed to in writing, software
-# distributed under the License is distributed on an "AS IS" BASIS,
-# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
-# See the License for the specific language governing permissions and
-# limitations under the License.
-
-# make us exit on a failure
-set -e
-
-./default-run "$@" --experimental method-handles
diff --git a/test/Android.bp b/test/Android.bp
index b0f0e5a98d..be5bc59e5c 100644
--- a/test/Android.bp
+++ b/test/Android.bp
@@ -265,6 +265,11 @@ art_cc_defaults {
"922-properties/properties.cc",
"923-monitors/monitors.cc",
"924-threads/threads.cc",
+ "925-threadgroups/threadgroups.cc",
+ "927-timers/timers.cc",
+ "928-jni-table/jni_table.cc",
+ "929-search/search.cc",
+ "931-agent-thread/agent_thread.cc",
],
shared_libs: [
"libbase",
diff --git a/test/Android.run-test.mk b/test/Android.run-test.mk
index dd7876f09d..639996ee7f 100644
--- a/test/Android.run-test.mk
+++ b/test/Android.run-test.mk
@@ -228,9 +228,15 @@ endef # name-to-var
# Disable 153-reference-stress temporarily until a fix arrives. b/33389022.
# Disable 080-oom-fragmentation due to flakes. b/33795328
+# Disable 497-inlining-and-class-loader and 542-unresolved-access-check until
+# they are rewritten. These tests use a broken class loader that tries to
+# register a dex file that's already registered with a different loader.
+# b/34193123
ART_TEST_RUN_TEST_SKIP += \
153-reference-stress \
- 080-oom-fragmentation
+ 080-oom-fragmentation \
+ 497-inlining-and-class-loader \
+ 542-unresolved-access-check
ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,$(TARGET_TYPES),$(RUN_TYPES),$(PREBUILD_TYPES), \
$(COMPILER_TYPES),$(RELOCATE_TYPES),$(TRACE_TYPES),$(GC_TYPES),$(JNI_TYPES), \
@@ -274,6 +280,7 @@ TEST_ART_BROKEN_TARGET_TESTS := \
# These 9** tests are not supported in current form due to linker
# restrictions. See b/31681198
TEST_ART_BROKEN_TARGET_TESTS += \
+ 901-hello-ti-agent \
902-hello-transformation \
903-hello-tagging \
904-object-allocation \
@@ -297,6 +304,14 @@ TEST_ART_BROKEN_TARGET_TESTS += \
922-properties \
923-monitors \
924-threads \
+ 925-threadgroups \
+ 926-multi-obsolescence \
+ 927-timers \
+ 928-jni-table \
+ 929-search \
+ 930-hello-retransform \
+ 931-agent-thread \
+ 932-transform-saves \
ifneq (,$(filter target,$(TARGET_TYPES)))
ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,target,$(RUN_TYPES),$(PREBUILD_TYPES), \
@@ -457,10 +472,12 @@ TEST_ART_BROKEN_FALLBACK_RUN_TESTS := \
629-vdex-speed
# This test fails without an image.
-# 964 often times out due to the large number of classes it tries to compile.
+# 018, 961, 964 often time out. b/34369284
TEST_ART_BROKEN_NO_IMAGE_RUN_TESTS := \
137-cfi \
138-duplicate-classes-check \
+ 018-stack-overflow \
+ 961-default-iface-resolution-gen \
964-default-iface-init
ifneq (,$(filter no-dex2oat,$(PREBUILD_TYPES)))
@@ -565,6 +582,7 @@ TEST_ART_BROKEN_JIT_RUN_TESTS := \
915-obsolete-2 \
917-fields-transformation \
919-obsolete-fields \
+ 926-multi-obsolescence \
ifneq (,$(filter jit,$(COMPILER_TYPES)))
ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,$(TARGET_TYPES),$(RUN_TYPES),$(PREBUILD_TYPES), \
diff --git a/test/XandY/Y.java b/test/XandY/Y.java
index ecead6e35f..2a1f03698c 100644
--- a/test/XandY/Y.java
+++ b/test/XandY/Y.java
@@ -14,4 +14,8 @@
* limitations under the License.
*/
-class Y extends X {}
+class Y extends X {
+ static Z z = new Z();
+ static class Z {
+ }
+}
diff --git a/test/common/runtime_state.cc b/test/common/runtime_state.cc
index 1b6fc7033a..a841f9e6a2 100644
--- a/test/common/runtime_state.cc
+++ b/test/common/runtime_state.cc
@@ -33,12 +33,18 @@ namespace art {
// public static native boolean hasJit();
-extern "C" JNIEXPORT jboolean JNICALL Java_Main_hasJit(JNIEnv*, jclass) {
+static jit::Jit* GetJitIfEnabled() {
Runtime* runtime = Runtime::Current();
- return runtime != nullptr
+ bool can_jit =
+ runtime != nullptr
&& runtime->GetJit() != nullptr
&& runtime->GetInstrumentation()->GetCurrentInstrumentationLevel() !=
instrumentation::Instrumentation::InstrumentationLevel::kInstrumentWithInterpreter;
+ return can_jit ? runtime->GetJit() : nullptr;
+}
+
+extern "C" JNIEXPORT jboolean JNICALL Java_Main_hasJit(JNIEnv*, jclass) {
+ return GetJitIfEnabled() != nullptr;
}
// public static native boolean hasOatFile();
@@ -152,7 +158,7 @@ extern "C" JNIEXPORT void JNICALL Java_Main_ensureJitCompiled(JNIEnv* env,
jclass,
jclass cls,
jstring method_name) {
- jit::Jit* jit = Runtime::Current()->GetJit();
+ jit::Jit* jit = GetJitIfEnabled();
if (jit == nullptr) {
return;
}
@@ -166,6 +172,11 @@ extern "C" JNIEXPORT void JNICALL Java_Main_ensureJitCompiled(JNIEnv* env,
CHECK(chars.c_str() != nullptr);
method = soa.Decode<mirror::Class>(cls)->FindDeclaredDirectMethodByName(
chars.c_str(), kRuntimePointerSize);
+ if (method == nullptr) {
+ method = soa.Decode<mirror::Class>(cls)->FindDeclaredVirtualMethodByName(
+ chars.c_str(), kRuntimePointerSize);
+ }
+ DCHECK(method != nullptr) << "Unable to find method called " << chars.c_str();
}
jit::JitCodeCache* code_cache = jit->GetCodeCache();
diff --git a/test/etc/run-test-jar b/test/etc/run-test-jar
index 8245947251..28fa130443 100755
--- a/test/etc/run-test-jar
+++ b/test/etc/run-test-jar
@@ -44,7 +44,7 @@ STRIP_DEX="n"
SECONDARY_DEX=""
TIME_OUT="gdb" # "n" (disabled), "timeout" (use timeout), "gdb" (use gdb)
# Value in seconds
-if [ "$ART_USE_READ_BARRIER" = "true" ]; then
+if [ "$ART_USE_READ_BARRIER" != "false" ]; then
TIME_OUT_VALUE=2400 # 40 minutes.
else
TIME_OUT_VALUE=1200 # 20 minutes.
@@ -62,6 +62,7 @@ DRY_RUN="n" # if y prepare to run the test but don't run it.
TEST_VDEX="n"
TEST_IS_NDEBUG="n"
APP_IMAGE="y"
+VDEX_FILTER=""
while true; do
if [ "x$1" = "x--quiet" ]; then
@@ -256,6 +257,11 @@ while true; do
elif [ "x$1" = "x--vdex" ]; then
TEST_VDEX="y"
shift
+ elif [ "x$1" = "x--vdex-filter" ]; then
+ shift
+ option="$1"
+ VDEX_FILTER="--compiler-filter=$option"
+ shift
elif expr "x$1" : "x--" >/dev/null 2>&1; then
echo "unknown $0 option: $1" 1>&2
exit 1
@@ -322,6 +328,28 @@ if [ "$DEBUGGER" = "y" ]; then
DEBUGGER_OPTS="-agentlib:jdwp=transport=dt_socket,address=$PORT,server=y,suspend=y"
fi
+if [ "$IS_JVMTI_TEST" = "y" ]; then
+ plugin=libopenjdkjvmtid.so
+ agent=libtiagentd.so
+ lib=tiagentd
+ if [[ "$TEST_IS_NDEBUG" = "y" ]]; then
+ agent=libtiagent.so
+ plugin=libopenjdkjvmti.so
+ lib=tiagent
+ fi
+
+ ARGS="${ARGS} ${lib}"
+ if [[ "$USE_JVM" = "y" ]]; then
+ FLAGS="${FLAGS} -agentpath:${ANDROID_HOST_OUT}/nativetest64/${agent}=${TEST_NAME},jvm"
+ else
+ FLAGS="${FLAGS} -agentpath:${agent}=${TEST_NAME},art"
+ FLAGS="${FLAGS} -Xplugin:${plugin}"
+ FLAGS="${FLAGS} -Xfully-deoptable"
+ # Always make the compilation be debuggable.
+ COMPILE_FLAGS="${COMPILE_FLAGS} --debuggable"
+ fi
+fi
+
if [ "$USE_JVM" = "y" ]; then
export LD_LIBRARY_PATH=${ANDROID_HOST_OUT}/lib64
# Xmx is necessary since we don't pass down the ART flags to JVM.
@@ -387,28 +415,6 @@ if [ "$JIT" = "y" ]; then
fi
fi
-if [ "$IS_JVMTI_TEST" = "y" ]; then
- plugin=libopenjdkjvmtid.so
- agent=libtiagentd.so
- lib=tiagentd
- if [[ "$TEST_IS_NDEBUG" = "y" ]]; then
- agent=libtiagent.so
- plugin=libopenjdkjvmti.so
- lib=tiagent
- fi
-
- ARGS="${ARGS} ${lib}"
- if [[ "$USE_JVM" = "y" ]]; then
- FLAGS="${FLAGS} -agentpath:${agent}=${TEST_NAME},jvm"
- else
- FLAGS="${FLAGS} -agentpath:${agent}=${TEST_NAME},art"
- FLAGS="${FLAGS} -Xplugin:${plugin}"
- FLAGS="${FLAGS} -Xfully-deoptable"
- # Always make the compilation be debuggable.
- COMPILE_FLAGS="${COMPILE_FLAGS} --debuggable"
- fi
-fi
-
JNI_OPTS="-Xjnigreflimit:512 -Xcheck:jni"
if [ "$RELOCATE" = "y" ]; then
@@ -514,7 +520,7 @@ if [ "$PREBUILD" = "y" ]; then
dex2oat_cmdline="timeout -k 1m -s SIGRTMIN+2 1m ${dex2oat_cmdline}"
fi
if [ "$TEST_VDEX" = "y" ]; then
- vdex_cmdline="${dex2oat_cmdline} --input-vdex=$DEX_LOCATION/oat/$ISA/$TEST_NAME.vdex"
+ vdex_cmdline="${dex2oat_cmdline} ${VDEX_FILTER} --input-vdex=$DEX_LOCATION/oat/$ISA/$TEST_NAME.vdex"
fi
fi
diff --git a/test/run-test b/test/run-test
index ea9622aa69..9b178021ff 100755
--- a/test/run-test
+++ b/test/run-test
@@ -354,6 +354,11 @@ while true; do
elif [ "x$1" = "x--vdex" ]; then
run_args="${run_args} --vdex"
shift
+ elif [ "x$1" = "x--vdex-filter" ]; then
+ shift
+ filter=$1
+ run_args="${run_args} --vdex-filter $filter"
+ shift
elif expr "x$1" : "x--" >/dev/null 2>&1; then
echo "unknown $0 option: $1" 1>&2
usage="yes"
@@ -489,7 +494,7 @@ elif [ "$runtime" = "art" ]; then
fi
elif [ "$runtime" = "jvm" ]; then
# TODO: Detect whether the host is 32-bit or 64-bit.
- run_args="${run_args} --runtime-option -Djava.library.path=${ANDROID_HOST_OUT}/lib64"
+ run_args="${run_args} --runtime-option -Djava.library.path=${ANDROID_HOST_OUT}/lib64:${ANDROID_HOST_OUT}/nativetest64"
fi
if [ "$have_image" = "no" ]; then
@@ -717,7 +722,7 @@ if [[ "$TEST_NAME" =~ ^[0-9]+-checker- ]]; then
#
# TODO: Enable Checker when read barrier support is added to more
# architectures (b/12687968).
- if [ "x$ART_USE_READ_BARRIER" = xtrue ] \
+ if [ "x$ART_USE_READ_BARRIER" != xfalse ] \
&& (([ "x$host_mode" = "xyes" ] \
&& ! arch_supports_read_barrier "$host_arch_name") \
|| ([ "x$target_mode" = "xyes" ] \
diff --git a/test/ti-agent/common_helper.cc b/test/ti-agent/common_helper.cc
index 6f98f10072..4bceef53bb 100644
--- a/test/ti-agent/common_helper.cc
+++ b/test/ti-agent/common_helper.cc
@@ -18,6 +18,7 @@
#include <stdio.h>
#include <sstream>
+#include <deque>
#include "art_method.h"
#include "jni.h"
@@ -60,50 +61,76 @@ bool JvmtiErrorToException(JNIEnv* env, jvmtiError error) {
return true;
}
-namespace common_redefine {
-static void throwRedefinitionError(jvmtiEnv* jvmti, JNIEnv* env, jclass target, jvmtiError res) {
+template <bool is_redefine>
+static void throwCommonRedefinitionError(jvmtiEnv* jvmti,
+ JNIEnv* env,
+ jint num_targets,
+ jclass* target,
+ jvmtiError res) {
std::stringstream err;
- char* signature = nullptr;
- char* generic = nullptr;
- jvmti->GetClassSignature(target, &signature, &generic);
char* error = nullptr;
jvmti->GetErrorName(res, &error);
- err << "Failed to redefine class <" << signature << "> due to " << error;
+ err << "Failed to " << (is_redefine ? "redefine" : "retransform") << " class";
+ if (num_targets > 1) {
+ err << "es";
+ }
+ err << " <";
+ for (jint i = 0; i < num_targets; i++) {
+ char* signature = nullptr;
+ char* generic = nullptr;
+ jvmti->GetClassSignature(target[i], &signature, &generic);
+ if (i != 0) {
+ err << ", ";
+ }
+ err << signature;
+ jvmti->Deallocate(reinterpret_cast<unsigned char*>(signature));
+ jvmti->Deallocate(reinterpret_cast<unsigned char*>(generic));
+ }
+ err << "> due to " << error;
std::string message = err.str();
- jvmti->Deallocate(reinterpret_cast<unsigned char*>(signature));
- jvmti->Deallocate(reinterpret_cast<unsigned char*>(generic));
jvmti->Deallocate(reinterpret_cast<unsigned char*>(error));
env->ThrowNew(env->FindClass("java/lang/Exception"), message.c_str());
}
-using RedefineDirectFunction = jvmtiError (*)(jvmtiEnv*, jclass, jint, const unsigned char*);
-static void DoClassTransformation(jvmtiEnv* jvmti_env,
- JNIEnv* env,
- jclass target,
- jbyteArray class_file_bytes,
- jbyteArray dex_file_bytes) {
- jbyteArray desired_array = IsJVM() ? class_file_bytes : dex_file_bytes;
- jint len = static_cast<jint>(env->GetArrayLength(desired_array));
- const unsigned char* redef_bytes = reinterpret_cast<const unsigned char*>(
- env->GetByteArrayElements(desired_array, nullptr));
- jvmtiError res;
- if (IsJVM()) {
- jvmtiClassDefinition def;
- def.klass = target;
- def.class_byte_count = static_cast<jint>(len);
- def.class_bytes = redef_bytes;
- res = jvmti_env->RedefineClasses(1, &def);
- } else {
- RedefineDirectFunction f =
- reinterpret_cast<RedefineDirectFunction>(jvmti_env->functions->reserved3);
- res = f(jvmti_env, target, len, redef_bytes);
+namespace common_redefine {
+
+static void throwRedefinitionError(jvmtiEnv* jvmti,
+ JNIEnv* env,
+ jint num_targets,
+ jclass* target,
+ jvmtiError res) {
+ return throwCommonRedefinitionError<true>(jvmti, env, num_targets, target, res);
+}
+
+static void DoMultiClassRedefine(jvmtiEnv* jvmti_env,
+ JNIEnv* env,
+ jint num_redefines,
+ jclass* targets,
+ jbyteArray* class_file_bytes,
+ jbyteArray* dex_file_bytes) {
+ std::vector<jvmtiClassDefinition> defs;
+ for (jint i = 0; i < num_redefines; i++) {
+ jbyteArray desired_array = IsJVM() ? class_file_bytes[i] : dex_file_bytes[i];
+ jint len = static_cast<jint>(env->GetArrayLength(desired_array));
+ const unsigned char* redef_bytes = reinterpret_cast<const unsigned char*>(
+ env->GetByteArrayElements(desired_array, nullptr));
+ defs.push_back({targets[i], static_cast<jint>(len), redef_bytes});
}
+ jvmtiError res = jvmti_env->RedefineClasses(num_redefines, defs.data());
if (res != JVMTI_ERROR_NONE) {
- throwRedefinitionError(jvmti_env, env, target, res);
+ throwRedefinitionError(jvmti_env, env, num_redefines, targets, res);
}
}
+static void DoClassRedefine(jvmtiEnv* jvmti_env,
+ JNIEnv* env,
+ jclass target,
+ jbyteArray class_file_bytes,
+ jbyteArray dex_file_bytes) {
+ return DoMultiClassRedefine(jvmti_env, env, 1, &target, &class_file_bytes, &dex_file_bytes);
+}
+
// Magic JNI export that classes can use for redefining classes.
// To use classes should declare this as a native function with signature (Ljava/lang/Class;[B[B)V
extern "C" JNIEXPORT void JNICALL Java_Main_doCommonClassRedefinition(JNIEnv* env,
@@ -111,10 +138,41 @@ extern "C" JNIEXPORT void JNICALL Java_Main_doCommonClassRedefinition(JNIEnv* en
jclass target,
jbyteArray class_file_bytes,
jbyteArray dex_file_bytes) {
- DoClassTransformation(jvmti_env, env, target, class_file_bytes, dex_file_bytes);
+ DoClassRedefine(jvmti_env, env, target, class_file_bytes, dex_file_bytes);
}
-// Don't do anything
+// Magic JNI export that classes can use for redefining classes.
+// To use classes should declare this as a native function with signature
+// ([Ljava/lang/Class;[[B[[B)V
+extern "C" JNIEXPORT void JNICALL Java_Main_doCommonMultiClassRedefinition(
+ JNIEnv* env,
+ jclass,
+ jobjectArray targets,
+ jobjectArray class_file_bytes,
+ jobjectArray dex_file_bytes) {
+ std::vector<jclass> classes;
+ std::vector<jbyteArray> class_files;
+ std::vector<jbyteArray> dex_files;
+ jint len = env->GetArrayLength(targets);
+ if (len != env->GetArrayLength(class_file_bytes) || len != env->GetArrayLength(dex_file_bytes)) {
+ env->ThrowNew(env->FindClass("java/lang/IllegalArgumentException"),
+ "the three array arguments passed to this function have different lengths!");
+ return;
+ }
+ for (jint i = 0; i < len; i++) {
+ classes.push_back(static_cast<jclass>(env->GetObjectArrayElement(targets, i)));
+ dex_files.push_back(static_cast<jbyteArray>(env->GetObjectArrayElement(dex_file_bytes, i)));
+ class_files.push_back(static_cast<jbyteArray>(env->GetObjectArrayElement(class_file_bytes, i)));
+ }
+ return DoMultiClassRedefine(jvmti_env,
+ env,
+ len,
+ classes.data(),
+ class_files.data(),
+ dex_files.data());
+}
+
+// Get all capabilities except those related to retransformation.
jint OnLoad(JavaVM* vm,
char* options ATTRIBUTE_UNUSED,
void* reserved ATTRIBUTE_UNUSED) {
@@ -122,10 +180,149 @@ jint OnLoad(JavaVM* vm,
printf("Unable to get jvmti env!\n");
return 1;
}
- SetAllCapabilities(jvmti_env);
+ jvmtiCapabilities caps;
+ jvmti_env->GetPotentialCapabilities(&caps);
+ caps.can_retransform_classes = 0;
+ caps.can_retransform_any_class = 0;
+ jvmti_env->AddCapabilities(&caps);
return 0;
}
} // namespace common_redefine
+namespace common_retransform {
+
+struct CommonTransformationResult {
+ std::vector<unsigned char> class_bytes;
+ std::vector<unsigned char> dex_bytes;
+
+ CommonTransformationResult(size_t class_size, size_t dex_size)
+ : class_bytes(class_size), dex_bytes(dex_size) {}
+
+ CommonTransformationResult() = default;
+ CommonTransformationResult(CommonTransformationResult&&) = default;
+ CommonTransformationResult(CommonTransformationResult&) = default;
+};
+
+// Map from class name to transformation result.
+std::map<std::string, std::deque<CommonTransformationResult>> gTransformations;
+
+extern "C" JNIEXPORT void JNICALL Java_Main_addCommonTransformationResult(JNIEnv* env,
+ jclass,
+ jstring class_name,
+ jbyteArray class_array,
+ jbyteArray dex_array) {
+ const char* name_chrs = env->GetStringUTFChars(class_name, nullptr);
+ std::string name_str(name_chrs);
+ env->ReleaseStringUTFChars(class_name, name_chrs);
+ CommonTransformationResult trans(env->GetArrayLength(class_array),
+ env->GetArrayLength(dex_array));
+ if (env->ExceptionOccurred()) {
+ return;
+ }
+ env->GetByteArrayRegion(class_array,
+ 0,
+ env->GetArrayLength(class_array),
+ reinterpret_cast<jbyte*>(trans.class_bytes.data()));
+ if (env->ExceptionOccurred()) {
+ return;
+ }
+ env->GetByteArrayRegion(dex_array,
+ 0,
+ env->GetArrayLength(dex_array),
+ reinterpret_cast<jbyte*>(trans.dex_bytes.data()));
+ if (env->ExceptionOccurred()) {
+ return;
+ }
+ if (gTransformations.find(name_str) == gTransformations.end()) {
+ std::deque<CommonTransformationResult> list;
+ gTransformations[name_str] = std::move(list);
+ }
+ gTransformations[name_str].push_back(std::move(trans));
+}
+
+// The hook we are using.
+void JNICALL CommonClassFileLoadHookRetransformable(jvmtiEnv* jvmti_env,
+ JNIEnv* jni_env ATTRIBUTE_UNUSED,
+ jclass class_being_redefined ATTRIBUTE_UNUSED,
+ jobject loader ATTRIBUTE_UNUSED,
+ const char* name,
+ jobject protection_domain ATTRIBUTE_UNUSED,
+ jint class_data_len ATTRIBUTE_UNUSED,
+ const unsigned char* class_dat ATTRIBUTE_UNUSED,
+ jint* new_class_data_len,
+ unsigned char** new_class_data) {
+ std::string name_str(name);
+ if (gTransformations.find(name_str) != gTransformations.end() &&
+ gTransformations[name_str].size() > 0) {
+ CommonTransformationResult& res = gTransformations[name_str][0];
+ const std::vector<unsigned char>& desired_array = IsJVM() ? res.class_bytes : res.dex_bytes;
+ unsigned char* new_data;
+ CHECK_EQ(JVMTI_ERROR_NONE, jvmti_env->Allocate(desired_array.size(), &new_data));
+ memcpy(new_data, desired_array.data(), desired_array.size());
+ *new_class_data = new_data;
+ *new_class_data_len = desired_array.size();
+ gTransformations[name_str].pop_front();
+ }
+}
+
+extern "C" JNIEXPORT void Java_Main_enableCommonRetransformation(JNIEnv* env,
+ jclass,
+ jboolean enable) {
+ jvmtiError res = jvmti_env->SetEventNotificationMode(enable ? JVMTI_ENABLE : JVMTI_DISABLE,
+ JVMTI_EVENT_CLASS_FILE_LOAD_HOOK,
+ nullptr);
+ if (res != JVMTI_ERROR_NONE) {
+ JvmtiErrorToException(env, res);
+ }
+}
+
+static void throwRetransformationError(jvmtiEnv* jvmti,
+ JNIEnv* env,
+ jint num_targets,
+ jclass* targets,
+ jvmtiError res) {
+ return throwCommonRedefinitionError<false>(jvmti, env, num_targets, targets, res);
+}
+
+static void DoClassRetransformation(jvmtiEnv* jvmti_env, JNIEnv* env, jobjectArray targets) {
+ std::vector<jclass> classes;
+ jint len = env->GetArrayLength(targets);
+ for (jint i = 0; i < len; i++) {
+ classes.push_back(static_cast<jclass>(env->GetObjectArrayElement(targets, i)));
+ }
+ jvmtiError res = jvmti_env->RetransformClasses(len, classes.data());
+ if (res != JVMTI_ERROR_NONE) {
+ throwRetransformationError(jvmti_env, env, len, classes.data(), res);
+ }
+}
+
+// TODO Write something useful.
+extern "C" JNIEXPORT void JNICALL Java_Main_doCommonClassRetransformation(JNIEnv* env,
+ jclass,
+ jobjectArray targets) {
+ DoClassRetransformation(jvmti_env, env, targets);
+}
+
+// Get all capabilities except those related to retransformation.
+jint OnLoad(JavaVM* vm,
+ char* options ATTRIBUTE_UNUSED,
+ void* reserved ATTRIBUTE_UNUSED) {
+ if (vm->GetEnv(reinterpret_cast<void**>(&jvmti_env), JVMTI_VERSION_1_0)) {
+ printf("Unable to get jvmti env!\n");
+ return 1;
+ }
+ SetAllCapabilities(jvmti_env);
+ jvmtiEventCallbacks cb;
+ memset(&cb, 0, sizeof(cb));
+ cb.ClassFileLoadHook = CommonClassFileLoadHookRetransformable;
+ if (jvmti_env->SetEventCallbacks(&cb, sizeof(cb)) != JVMTI_ERROR_NONE) {
+ printf("Unable to set class file load hook cb!\n");
+ return 1;
+ }
+ return 0;
+}
+
+} // namespace common_retransform
+
} // namespace art
diff --git a/test/ti-agent/common_helper.h b/test/ti-agent/common_helper.h
index 642ca03274..8599fc4d6c 100644
--- a/test/ti-agent/common_helper.h
+++ b/test/ti-agent/common_helper.h
@@ -27,6 +27,10 @@ namespace common_redefine {
jint OnLoad(JavaVM* vm, char* options, void* reserved);
} // namespace common_redefine
+namespace common_retransform {
+jint OnLoad(JavaVM* vm, char* options, void* reserved);
+} // namespace common_retransform
+
extern bool RuntimeIsJVM;
diff --git a/test/ti-agent/common_load.cc b/test/ti-agent/common_load.cc
index 8abd063a01..f4ce4c381e 100644
--- a/test/ti-agent/common_load.cc
+++ b/test/ti-agent/common_load.cc
@@ -64,7 +64,10 @@ AgentLib agents[] = {
{ "916-obsolete-jit", common_redefine::OnLoad, nullptr },
{ "917-fields-transformation", common_redefine::OnLoad, nullptr },
{ "919-obsolete-fields", common_redefine::OnLoad, nullptr },
- { "921-hello-failure", common_redefine::OnLoad, nullptr },
+ { "921-hello-failure", common_retransform::OnLoad, nullptr },
+ { "926-multi-obsolescence", common_redefine::OnLoad, nullptr },
+ { "930-hello-retransform", common_retransform::OnLoad, nullptr },
+ { "932-transform-saves", common_retransform::OnLoad, nullptr },
};
static AgentLib* FindAgent(char* name) {
diff --git a/test/valgrind-suppressions.txt b/test/valgrind-suppressions.txt
index fd3c3318ce..c775f98b70 100644
--- a/test/valgrind-suppressions.txt
+++ b/test/valgrind-suppressions.txt
@@ -22,3 +22,50 @@
...
fun:_ZN3art7Runtime17InitNativeMethodsEv
}
+
+# SigQuit runs libbacktrace
+{
+ BackTraceReading64
+ Memcheck:Addr8
+ fun:access_mem_unrestricted
+ fun:_Uelf64_memory_read
+ fun:_Uelf64_valid_object_memory
+ fun:map_create_list
+ fun:unw_map_local_create
+ fun:_ZN14UnwindMapLocal5BuildEv
+ fun:_ZN12BacktraceMap6CreateEib
+}
+{
+ BackTraceReading32
+ Memcheck:Addr4
+ fun:access_mem_unrestricted
+ fun:_Uelf32_memory_read
+ fun:_Uelf32_valid_object_memory
+ fun:map_create_list
+ fun:unw_map_local_create
+ fun:_ZN14UnwindMapLocal5BuildEv
+ fun:_ZN12BacktraceMap6CreateEib
+}
+{
+ BackTraceReading64
+ Memcheck:Addr8
+ fun:access_mem_unrestricted
+ fun:_Uelf64_memory_read
+ fun:_Uelf64_get_load_base
+ fun:map_create_list
+ fun:unw_map_local_create
+ fun:_ZN14UnwindMapLocal5BuildEv
+ fun:_ZN12BacktraceMap6CreateEib
+}
+{
+ BackTraceReading32
+ Memcheck:Addr4
+ fun:access_mem_unrestricted
+ fun:_Uelf32_memory_read
+ fun:_Uelf32_get_load_base
+ fun:map_create_list
+ fun:unw_map_local_create
+ fun:_ZN14UnwindMapLocal5BuildEv
+ fun:_ZN12BacktraceMap6CreateEib
+}
+
diff --git a/tools/cpp-define-generator/offset_dexcache.def b/tools/cpp-define-generator/offset_dexcache.def
index abb5e1ecac..43f94344cc 100644
--- a/tools/cpp-define-generator/offset_dexcache.def
+++ b/tools/cpp-define-generator/offset_dexcache.def
@@ -34,7 +34,6 @@
// New macro suffix Method Name (of the Offset method)
DEFINE_ART_METHOD_OFFSET_SIZED(DEX_CACHE_METHODS, DexCacheResolvedMethods)
-DEFINE_ART_METHOD_OFFSET_SIZED(DEX_CACHE_TYPES, DexCacheResolvedTypes)
DEFINE_ART_METHOD_OFFSET_SIZED(JNI, EntryPointFromJni)
DEFINE_ART_METHOD_OFFSET_SIZED(QUICK_CODE, EntryPointFromQuickCompiledCode)
DEFINE_ART_METHOD_OFFSET(DECLARING_CLASS, DeclaringClass)
diff --git a/tools/dexfuzz/src/dexfuzz/Options.java b/tools/dexfuzz/src/dexfuzz/Options.java
index 99e03e8ea7..af8a05cdbc 100644
--- a/tools/dexfuzz/src/dexfuzz/Options.java
+++ b/tools/dexfuzz/src/dexfuzz/Options.java
@@ -50,6 +50,7 @@ public class Options {
public static String deviceName = "";
public static boolean usingSpecificDevice = false;
public static int repeat = 1;
+ public static int divergenceRetry = 10;
public static String executeDirectory = "/data/art-test";
public static String androidRoot = "";
public static String dumpMutationsFile = "mutations.dump";
@@ -118,6 +119,8 @@ public class Options {
Log.always(" --repeat=<n> : Fuzz N programs, executing each one.");
Log.always(" --short-timeouts : Shorten timeouts (faster; use if");
Log.always(" you want to focus on output divergences)");
+ Log.always(" --divergence-retry=<n> : Number of retries when checking if test is");
+ Log.always(" self-divergent. (Default: 10)");
Log.always(" --seed=<seed> : RNG seed to use");
Log.always(" --method-mutations=<n> : Maximum number of mutations to perform on each method.");
Log.always(" (Default: 3)");
@@ -239,6 +242,8 @@ public class Options {
maxMethods = Integer.parseInt(value);
} else if (key.equals("repeat")) {
repeat = Integer.parseInt(value);
+ } else if (key.equals("divergence-retry")) {
+ divergenceRetry = Integer.parseInt(value);
} else if (key.equals("log")) {
Log.setLoggingLevel(LogTag.valueOf(value.toUpperCase()));
} else if (key.equals("likelihoods")) {
@@ -360,6 +365,10 @@ public class Options {
Log.error("--repeat must be at least 1!");
return false;
}
+ if (divergenceRetry < 0) {
+ Log.error("--divergence-retry cannot be negative!");
+ return false;
+ }
if (usingProvidedSeed && repeat > 1) {
Log.error("Cannot use --repeat with --seed");
return false;
diff --git a/tools/dexfuzz/src/dexfuzz/fuzzers/Fuzzer.java b/tools/dexfuzz/src/dexfuzz/fuzzers/Fuzzer.java
index 1797d90141..ccc426c5e4 100644
--- a/tools/dexfuzz/src/dexfuzz/fuzzers/Fuzzer.java
+++ b/tools/dexfuzz/src/dexfuzz/fuzzers/Fuzzer.java
@@ -298,13 +298,13 @@ public abstract class Fuzzer {
}
private boolean checkGoldenExecutorForSelfDivergence(String programName) {
- // Run golden executor 5 times, make sure it always produces
+ // Run golden executor multiple times, make sure it always produces
// the same output, otherwise report that it is self-divergent.
// TODO: Instead, produce a list of acceptable outputs, and see if the divergent
// outputs of the backends fall within this set of outputs.
String seenOutput = null;
- for (int i = 0; i < 5; i++) {
+ for (int i = 0; i < Options.divergenceRetry + 1; i++) {
goldenExecutor.reset();
goldenExecutor.execute(programName);
String output = goldenExecutor.getResult().getFlattenedOutput();