diff options
153 files changed, 4172 insertions, 2702 deletions
diff --git a/compiler/dex/verification_results.cc b/compiler/dex/verification_results.cc index 669d8cd991..9d39bf2c7a 100644 --- a/compiler/dex/verification_results.cc +++ b/compiler/dex/verification_results.cc @@ -103,6 +103,17 @@ const VerifiedMethod* VerificationResults::GetVerifiedMethod(MethodReference ref return (it != verified_methods_.end()) ? it->second : nullptr; } +void VerificationResults::CreateVerifiedMethodFor(MethodReference ref) { + // This method should only be called for classes verified at compile time, + // which have no verifier error, nor has methods that we know will throw + // at runtime. + AtomicMap::InsertResult result = atomic_verified_methods_.Insert( + ref, + /*expected*/ nullptr, + new VerifiedMethod(/* encountered_error_types */ 0, /* has_runtime_throw */ false)); + DCHECK_EQ(result, AtomicMap::kInsertResultSuccess); +} + void VerificationResults::AddRejectedClass(ClassReference ref) { { WriterMutexLock mu(Thread::Current(), rejected_classes_lock_); diff --git a/compiler/dex/verification_results.h b/compiler/dex/verification_results.h index ea38f4d537..ab735c1315 100644 --- a/compiler/dex/verification_results.h +++ b/compiler/dex/verification_results.h @@ -47,6 +47,9 @@ class VerificationResults { REQUIRES_SHARED(Locks::mutator_lock_) REQUIRES(!verified_methods_lock_); + void CreateVerifiedMethodFor(MethodReference ref) + REQUIRES(!verified_methods_lock_); + const VerifiedMethod* GetVerifiedMethod(MethodReference ref) REQUIRES(!verified_methods_lock_); diff --git a/compiler/dex/verified_method.h b/compiler/dex/verified_method.h index 04331e5aff..ce53417185 100644 --- a/compiler/dex/verified_method.h +++ b/compiler/dex/verified_method.h @@ -32,6 +32,8 @@ class MethodVerifier; class VerifiedMethod { public: + VerifiedMethod(uint32_t encountered_error_types, bool has_runtime_throw); + // Cast elision set type. // Since we're adding the dex PCs to the set in increasing order, a sorted vector // is better for performance (not just memory usage), especially for large sets. @@ -80,8 +82,6 @@ class VerifiedMethod { } private: - VerifiedMethod(uint32_t encountered_error_types, bool has_runtime_throw); - /* * Generate the GC map for a method that has just been verified (i.e. we're doing this as part of * verification). For type-precise determination we have all the data we need, so we just need to diff --git a/compiler/driver/compiler_driver.cc b/compiler/driver/compiler_driver.cc index 6b62110b91..a2bab80b85 100644 --- a/compiler/driver/compiler_driver.cc +++ b/compiler/driver/compiler_driver.cc @@ -2005,6 +2005,35 @@ void CompilerDriver::SetVerified(jobject class_loader, } } +static void PopulateVerifiedMethods(const DexFile& dex_file, + uint32_t class_def_index, + VerificationResults* verification_results) { + const DexFile::ClassDef& class_def = dex_file.GetClassDef(class_def_index); + const uint8_t* class_data = dex_file.GetClassData(class_def); + if (class_data == nullptr) { + return; + } + ClassDataItemIterator it(dex_file, class_data); + // Skip fields + while (it.HasNextStaticField()) { + it.Next(); + } + while (it.HasNextInstanceField()) { + it.Next(); + } + + while (it.HasNextDirectMethod()) { + verification_results->CreateVerifiedMethodFor(MethodReference(&dex_file, it.GetMemberIndex())); + it.Next(); + } + + while (it.HasNextVirtualMethod()) { + verification_results->CreateVerifiedMethodFor(MethodReference(&dex_file, it.GetMemberIndex())); + it.Next(); + } + DCHECK(!it.HasNext()); +} + void CompilerDriver::Verify(jobject jclass_loader, const std::vector<const DexFile*>& dex_files, TimingLogger* timings) { @@ -2041,6 +2070,13 @@ void CompilerDriver::Verify(jobject jclass_loader, } else if (set.find(class_def.class_idx_) == set.end()) { ObjectLock<mirror::Class> lock(soa.Self(), cls); mirror::Class::SetStatus(cls, mirror::Class::kStatusVerified, soa.Self()); + // Create `VerifiedMethod`s for each methods, the compiler expects one for + // quickening or compiling. + // Note that this means: + // - We're only going to compile methods that did verify. + // - Quickening will not do checkcast ellision. + // TODO(ngeoffray): Reconsider this once we refactor compiler filters. + PopulateVerifiedMethods(*dex_file, i, verification_results_); } } } diff --git a/compiler/image_test.cc b/compiler/image_test.cc index 5629dffce5..9bbe595fa9 100644 --- a/compiler/image_test.cc +++ b/compiler/image_test.cc @@ -29,6 +29,8 @@ #include "elf_writer_quick.h" #include "gc/space/image_space.h" #include "image_writer.h" +#include "linker/buffered_output_stream.h" +#include "linker/file_output_stream.h" #include "linker/multi_oat_relative_patcher.h" #include "lock_word.h" #include "mirror/object-inl.h" @@ -256,6 +258,16 @@ void CompilationHelper::Compile(CompilerDriver* driver, bool image_space_ok = writer->PrepareImageAddressSpace(); ASSERT_TRUE(image_space_ok); + if (kIsVdexEnabled) { + for (size_t i = 0, size = vdex_files.size(); i != size; ++i) { + std::unique_ptr<BufferedOutputStream> vdex_out( + MakeUnique<BufferedOutputStream>( + MakeUnique<FileOutputStream>(vdex_files[i].GetFile()))); + oat_writers[i]->WriteVerifierDeps(vdex_out.get(), nullptr); + oat_writers[i]->WriteChecksumsAndVdexHeader(vdex_out.get()); + } + } + for (size_t i = 0, size = oat_files.size(); i != size; ++i) { linker::MultiOatRelativePatcher patcher(driver->GetInstructionSet(), driver->GetInstructionSetFeatures()); diff --git a/compiler/image_writer.cc b/compiler/image_writer.cc index 6aa5642aa5..7bb2bb71a9 100644 --- a/compiler/image_writer.cc +++ b/compiler/image_writer.cc @@ -433,7 +433,7 @@ void ImageWriter::PrepareDexCacheArraySlots() { ClassLinker* class_linker = Runtime::Current()->GetClassLinker(); Thread* const self = Thread::Current(); - ReaderMutexLock mu(self, *class_linker->DexLock()); + ReaderMutexLock mu(self, *Locks::dex_lock_); for (const ClassLinker::DexCacheData& data : class_linker->GetDexCachesData()) { ObjPtr<mirror::DexCache> dex_cache = ObjPtr<mirror::DexCache>::DownCast(self->DecodeJObject(data.weak_root)); @@ -838,73 +838,21 @@ bool ImageWriter::KeepClass(Class* klass) { return true; } -class ImageWriter::PruneClassesVisitor : public ClassVisitor { +class ImageWriter::NonImageClassesVisitor : public ClassVisitor { public: - PruneClassesVisitor(ImageWriter* image_writer, ObjPtr<mirror::ClassLoader> class_loader) - : image_writer_(image_writer), - class_loader_(class_loader), - classes_to_prune_(), - defined_class_count_(0u) { } + explicit NonImageClassesVisitor(ImageWriter* image_writer) : image_writer_(image_writer) {} - bool operator()(ObjPtr<mirror::Class> klass) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_) { + bool operator()(ObjPtr<Class> klass) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_) { if (!image_writer_->KeepClass(klass.Ptr())) { classes_to_prune_.insert(klass.Ptr()); - if (klass->GetClassLoader() == class_loader_) { - ++defined_class_count_; - } } return true; } - size_t Prune() REQUIRES_SHARED(Locks::mutator_lock_) { - ClassTable* class_table = - Runtime::Current()->GetClassLinker()->ClassTableForClassLoader(class_loader_); - for (mirror::Class* klass : classes_to_prune_) { - std::string storage; - const char* descriptor = klass->GetDescriptor(&storage); - bool result = class_table->Remove(descriptor); - DCHECK(result); - DCHECK(!class_table->Remove(descriptor)) << descriptor; - } - return defined_class_count_; - } - - private: - ImageWriter* const image_writer_; - const ObjPtr<mirror::ClassLoader> class_loader_; std::unordered_set<mirror::Class*> classes_to_prune_; - size_t defined_class_count_; -}; - -class ImageWriter::PruneClassLoaderClassesVisitor : public ClassLoaderVisitor { - public: - explicit PruneClassLoaderClassesVisitor(ImageWriter* image_writer) - : image_writer_(image_writer), removed_class_count_(0) {} - - virtual void Visit(ObjPtr<mirror::ClassLoader> class_loader) OVERRIDE - REQUIRES_SHARED(Locks::mutator_lock_) { - PruneClassesVisitor classes_visitor(image_writer_, class_loader); - ClassTable* class_table = - Runtime::Current()->GetClassLinker()->ClassTableForClassLoader(class_loader); - class_table->Visit(classes_visitor); - removed_class_count_ += classes_visitor.Prune(); - } - - size_t GetRemovedClassCount() const { - return removed_class_count_; - } - - private: ImageWriter* const image_writer_; - size_t removed_class_count_; }; -void ImageWriter::VisitClassLoaders(ClassLoaderVisitor* visitor) { - ReaderMutexLock mu(Thread::Current(), *Locks::classlinker_classes_lock_); - visitor->Visit(nullptr); // Visit boot class loader. - Runtime::Current()->GetClassLinker()->VisitClassLoaders(visitor); -} - void ImageWriter::PruneNonImageClasses() { Runtime* runtime = Runtime::Current(); ClassLinker* class_linker = runtime->GetClassLinker(); @@ -914,11 +862,21 @@ void ImageWriter::PruneNonImageClasses() { // path dex caches. class_linker->ClearClassTableStrongRoots(); + // Make a list of classes we would like to prune. + NonImageClassesVisitor visitor(this); + class_linker->VisitClasses(&visitor); + // Remove the undesired classes from the class roots. - { - PruneClassLoaderClassesVisitor class_loader_visitor(this); - VisitClassLoaders(&class_loader_visitor); - VLOG(compiler) << "Pruned " << class_loader_visitor.GetRemovedClassCount() << " classes"; + VLOG(compiler) << "Pruning " << visitor.classes_to_prune_.size() << " classes"; + for (mirror::Class* klass : visitor.classes_to_prune_) { + std::string temp; + const char* name = klass->GetDescriptor(&temp); + VLOG(compiler) << "Pruning class " << name; + if (!compile_app_image_) { + DCHECK(IsBootClassLoaderClass(klass)); + } + bool result = class_linker->RemoveClass(name, klass->GetClassLoader()); + DCHECK(result); } // Clear references to removed classes from the DexCaches. @@ -926,7 +884,7 @@ void ImageWriter::PruneNonImageClasses() { ScopedAssertNoThreadSuspension sa(__FUNCTION__); ReaderMutexLock mu(self, *Locks::classlinker_classes_lock_); // For ClassInClassTable - ReaderMutexLock mu2(self, *class_linker->DexLock()); + ReaderMutexLock mu2(self, *Locks::dex_lock_); for (const ClassLinker::DexCacheData& data : class_linker->GetDexCachesData()) { if (self->IsJWeakCleared(data.weak_root)) { continue; @@ -974,8 +932,7 @@ void ImageWriter::PruneNonImageClasses() { class_linker->DropFindArrayClassCache(); // Clear to save RAM. - // FIXME: This has been temporarily removed to provide extra debugging output. Bug 33231647. - // prune_class_memo_.clear(); + prune_class_memo_.clear(); } void ImageWriter::CheckNonImageClassesRemoved() { @@ -1056,7 +1013,7 @@ ObjectArray<Object>* ImageWriter::CreateImageRoots(size_t oat_index) const { // caches. We check that the number of dex caches does not change. size_t dex_cache_count = 0; { - ReaderMutexLock mu(self, *class_linker->DexLock()); + ReaderMutexLock mu(self, *Locks::dex_lock_); // Count number of dex caches not in the boot image. for (const ClassLinker::DexCacheData& data : class_linker->GetDexCachesData()) { ObjPtr<mirror::DexCache> dex_cache = @@ -1074,7 +1031,7 @@ ObjectArray<Object>* ImageWriter::CreateImageRoots(size_t oat_index) const { hs.NewHandle(ObjectArray<Object>::Alloc(self, object_array_class.Get(), dex_cache_count))); CHECK(dex_caches.Get() != nullptr) << "Failed to allocate a dex cache array."; { - ReaderMutexLock mu(self, *class_linker->DexLock()); + ReaderMutexLock mu(self, *Locks::dex_lock_); size_t non_image_dex_caches = 0; // Re-count number of non image dex caches. for (const ClassLinker::DexCacheData& data : class_linker->GetDexCachesData()) { @@ -1147,69 +1104,7 @@ mirror::Object* ImageWriter::TryAssignBinSlot(WorkStack& work_stack, DCHECK_NE(as_klass->GetStatus(), mirror::Class::kStatusError); if (compile_app_image_) { // Extra sanity, no boot loader classes should be left! - // FIXME: Remove the extra logging. Bug 33231647. - struct Dumper { - std::string ImageRanges() const { - std::ostringstream oss; - const char* separator = ""; - gc::Heap* const heap = Runtime::Current()->GetHeap(); - for (gc::space::ImageSpace* boot_image_space : heap->GetBootImageSpaces()) { - const uint8_t* image_begin = boot_image_space->Begin(); - // Real image end including ArtMethods and ArtField sections. - const uint8_t* image_end = - image_begin + boot_image_space->GetImageHeader().GetImageSize(); - oss << separator << static_cast<const void*>(image_begin) - << "-" << static_cast<const void*>(image_end); - separator = ":"; - } - return oss.str(); - } - std::string PruneMemo(ImageWriter* writer, - mirror::Class* klass, - const std::unordered_map<mirror::Class*, bool>& map) const - REQUIRES_SHARED(Locks::mutator_lock_) { - auto it = map.find(klass); - if (it == map.end()) { - return writer->PruneAppImageClass(klass) ? "missing/true" : "missing/false"; - } else { - return it->second ? "true" : "false"; - } - } - std::string ClassLoaders(ImageWriter* writer, mirror::Class* klass) const - REQUIRES_SHARED(Locks::mutator_lock_) { - struct DumpVisitor : ClassLoaderVisitor { - explicit DumpVisitor(mirror::Class* the_klass) - : klass_(the_klass), - storage_(), - descriptor_(the_klass->GetDescriptor(&storage_)) { } - void Visit(ObjPtr<mirror::ClassLoader> class_loader) OVERRIDE - REQUIRES_SHARED(Locks::classlinker_classes_lock_, Locks::mutator_lock_) { - ClassTable* class_table = - Runtime::Current()->GetClassLinker()->ClassTableForClassLoader(class_loader); - if (class_table->Contains(klass_)) { - result_ << ";" << static_cast<const void*>(class_loader.Ptr()) << "/" - << (class_loader == klass_->GetClassLoader() ? "defining" : "initiating") - << "/" - << (class_table->LookupByDescriptor(klass_) == klass_ ? "ok" : "mismatch"); - } - } - mirror::Class* klass_; - std::string storage_; - const char* descriptor_; - std::ostringstream result_; - }; - DumpVisitor visitor(klass); - writer->VisitClassLoaders(&visitor); - std::string result = visitor.result_.str(); - return result.empty() ? "<none>" : /* drop leading ';' */ result.substr(1u); - } - }; - CHECK(!IsBootClassLoaderClass(as_klass)) << as_klass->PrettyClass() - << " status:" << as_klass->GetStatus() - << " " << static_cast<const void*>(as_klass) - << " " << Dumper().ImageRanges() - << " prune_memo:" << Dumper().PruneMemo(this, as_klass, prune_class_memo_) - << " loaders:" << Dumper().ClassLoaders(this, as_klass); + CHECK(!IsBootClassLoaderClass(as_klass)) << as_klass->PrettyClass(); } LengthPrefixedArray<ArtField>* fields[] = { as_klass->GetSFieldsPtr(), as_klass->GetIFieldsPtr(), @@ -1613,10 +1508,8 @@ void ImageWriter::CalculateNewObjectOffsets() { } // Calculate the size of the class table. ReaderMutexLock mu(self, *Locks::classlinker_classes_lock_); - CHECK_EQ(class_loaders_.size(), compile_app_image_ ? 1u : 0u); - mirror::ClassLoader* class_loader = compile_app_image_ ? *class_loaders_.begin() : nullptr; - DCHECK_EQ(image_info.class_table_->NumZygoteClasses(class_loader), 0u); - if (image_info.class_table_->NumNonZygoteClasses(class_loader) != 0u) { + DCHECK_EQ(image_info.class_table_->NumZygoteClasses(), 0u); + if (image_info.class_table_->NumNonZygoteClasses() != 0u) { image_info.class_table_bytes_ += image_info.class_table_->WriteToMemory(nullptr); } } @@ -1961,10 +1854,8 @@ void ImageWriter::CopyAndFixupNativeData(size_t oat_index) { // above comment for intern tables. ClassTable temp_class_table; temp_class_table.ReadFromMemory(class_table_memory_ptr); - CHECK_EQ(class_loaders_.size(), compile_app_image_ ? 1u : 0u); - mirror::ClassLoader* class_loader = compile_app_image_ ? *class_loaders_.begin() : nullptr; - CHECK_EQ(temp_class_table.NumZygoteClasses(class_loader), - table->NumNonZygoteClasses(class_loader) + table->NumZygoteClasses(class_loader)); + CHECK_EQ(temp_class_table.NumZygoteClasses(), table->NumNonZygoteClasses() + + table->NumZygoteClasses()); BufferedRootVisitor<kDefaultBufferedRootCount> buffered_visitor(&root_visitor, RootInfo(kRootUnknown)); temp_class_table.VisitRoots(buffered_visitor); diff --git a/compiler/image_writer.h b/compiler/image_writer.h index c5374838f6..24fad466e4 100644 --- a/compiler/image_writer.h +++ b/compiler/image_writer.h @@ -50,7 +50,6 @@ class ImageSpace; } // namespace space } // namespace gc -class ClassLoaderVisitor; class ClassTable; static constexpr int kInvalidFd = -1; @@ -374,9 +373,6 @@ class ImageWriter FINAL { void ComputeLazyFieldsForImageClasses() REQUIRES_SHARED(Locks::mutator_lock_); - // Visit all class loaders. - void VisitClassLoaders(ClassLoaderVisitor* visitor) REQUIRES_SHARED(Locks::mutator_lock_); - // Remove unwanted classes from various roots. void PruneNonImageClasses() REQUIRES_SHARED(Locks::mutator_lock_); @@ -592,8 +588,7 @@ class ImageWriter FINAL { class FixupVisitor; class GetRootsVisitor; class NativeLocationVisitor; - class PruneClassesVisitor; - class PruneClassLoaderClassesVisitor; + class NonImageClassesVisitor; class VisitReferencesVisitor; DISALLOW_COPY_AND_ASSIGN(ImageWriter); diff --git a/compiler/oat_test.cc b/compiler/oat_test.cc index 94585769b4..0a778b0954 100644 --- a/compiler/oat_test.cc +++ b/compiler/oat_test.cc @@ -30,6 +30,8 @@ #include "elf_writer.h" #include "elf_writer_quick.h" #include "entrypoints/quick/quick_entrypoints.h" +#include "linker/buffered_output_stream.h" +#include "linker/file_output_stream.h" #include "linker/multi_oat_relative_patcher.h" #include "linker/vector_output_stream.h" #include "mirror/class-inl.h" @@ -218,6 +220,17 @@ class OatTest : public CommonCompilerTest { oat_writer.GetBssSize(), oat_writer.GetBssRootsOffset()); + if (kIsVdexEnabled) { + std::unique_ptr<BufferedOutputStream> vdex_out( + MakeUnique<BufferedOutputStream>(MakeUnique<FileOutputStream>(vdex_file))); + if (!oat_writer.WriteVerifierDeps(vdex_out.get(), nullptr)) { + return false; + } + if (!oat_writer.WriteChecksumsAndVdexHeader(vdex_out.get())) { + return false; + } + } + if (!oat_writer.WriteRodata(oat_rodata)) { return false; } diff --git a/compiler/oat_writer.cc b/compiler/oat_writer.cc index 153aff40dc..bebd5f5ae2 100644 --- a/compiler/oat_writer.cc +++ b/compiler/oat_writer.cc @@ -300,6 +300,7 @@ OatWriter::OatWriter(bool compiling_boot_image, TimingLogger* timings, ProfileCo oat_data_offset_(0u), oat_header_(nullptr), size_vdex_header_(0), + size_vdex_checksums_(0), size_dex_file_alignment_(0), size_executable_offset_alignment_(0), size_oat_header_(0), @@ -409,10 +410,11 @@ bool OatWriter::AddVdexDexFilesSource(const VdexFile& vdex_file, CreateTypeLookupTable create_type_lookup_table) { DCHECK(write_state_ == WriteState::kAddingDexFileSources); const uint8_t* current_dex_data = nullptr; - for (size_t i = 0; ; ++i) { + for (size_t i = 0; i < vdex_file.GetHeader().GetNumberOfDexFiles(); ++i) { current_dex_data = vdex_file.GetNextDexFileData(current_dex_data); if (current_dex_data == nullptr) { - break; + LOG(ERROR) << "Unexpected number of dex files in vdex " << location; + return false; } if (!DexFile::IsMagicValid(current_dex_data)) { LOG(ERROR) << "Invalid magic in vdex file created from " << location; @@ -424,7 +426,14 @@ bool OatWriter::AddVdexDexFilesSource(const VdexFile& vdex_file, oat_dex_files_.emplace_back(full_location, DexFileSource(current_dex_data), create_type_lookup_table); + oat_dex_files_.back().dex_file_location_checksum_ = vdex_file.GetLocationChecksum(i); } + + if (vdex_file.GetNextDexFileData(current_dex_data) != nullptr) { + LOG(ERROR) << "Unexpected number of dex files in vdex " << location; + return false; + } + if (oat_dex_files_.empty()) { LOG(ERROR) << "No dex files in vdex file created from " << location; return false; @@ -488,8 +497,8 @@ bool OatWriter::WriteAndOpenDexFiles( // Initialize VDEX and OAT headers. if (kIsVdexEnabled) { - size_vdex_header_ = sizeof(VdexFile::Header); - vdex_size_ = size_vdex_header_; + // Reserve space for Vdex header and checksums. + vdex_size_ = sizeof(VdexFile::Header) + oat_dex_files_.size() * sizeof(VdexFile::VdexChecksum); } size_t oat_data_offset = InitOatHeader(instruction_set, instruction_set_features, @@ -793,7 +802,7 @@ class OatWriter::InitCodeMethodVisitor : public OatDexMethodVisitor { // Update quick method header. DCHECK_LT(method_offsets_index_, oat_class->method_headers_.size()); OatQuickMethodHeader* method_header = &oat_class->method_headers_[method_offsets_index_]; - uint32_t vmap_table_offset = method_header->vmap_table_offset_; + uint32_t vmap_table_offset = method_header->GetVmapTableOffset(); // The code offset was 0 when the mapping/vmap table offset was set, so it's set // to 0-offset and we need to adjust it by code_offset. uint32_t code_offset = quick_code_offset - thumb_offset; @@ -935,7 +944,7 @@ class OatWriter::InitMapMethodVisitor : public OatDexMethodVisitor { // If vdex is enabled, we only emit the stack map of compiled code. The quickening info will // be in the vdex file. if (!compiled_method->GetQuickCode().empty() || !kIsVdexEnabled) { - DCHECK_EQ(oat_class->method_headers_[method_offsets_index_].vmap_table_offset_, 0u); + DCHECK_EQ(oat_class->method_headers_[method_offsets_index_].GetVmapTableOffset(), 0u); ArrayRef<const uint8_t> map = compiled_method->GetVmapTable(); uint32_t map_size = map.size() * sizeof(map[0]); @@ -949,7 +958,7 @@ class OatWriter::InitMapMethodVisitor : public OatDexMethodVisitor { }); // Code offset is not initialized yet, so set the map offset to 0u-offset. DCHECK_EQ(oat_class->method_offsets_[method_offsets_index_].code_offset_, 0u); - oat_class->method_headers_[method_offsets_index_].vmap_table_offset_ = 0u - offset; + oat_class->method_headers_[method_offsets_index_].SetVmapTableOffset(0u - offset); } } ++method_offsets_index_; @@ -1406,7 +1415,7 @@ class OatWriter::WriteMapMethodVisitor : public OatDexMethodVisitor { size_t file_offset = file_offset_; OutputStream* out = out_; - uint32_t map_offset = oat_class->method_headers_[method_offsets_index_].vmap_table_offset_; + uint32_t map_offset = oat_class->method_headers_[method_offsets_index_].GetVmapTableOffset(); uint32_t code_offset = oat_class->method_offsets_[method_offsets_index_].code_offset_; ++method_offsets_index_; @@ -1837,6 +1846,7 @@ bool OatWriter::WriteCode(OutputStream* out) { size_total += (x); DO_STAT(size_vdex_header_); + DO_STAT(size_vdex_checksums_); DO_STAT(size_dex_file_alignment_); DO_STAT(size_executable_offset_alignment_); DO_STAT(size_oat_header_); @@ -2383,6 +2393,7 @@ bool OatWriter::WriteDexFile(OutputStream* out, // Update dex file size and resize class offsets in the OatDexFile. // Note: For raw data, the checksum is passed directly to AddRawDexFileSource(). + // Note: For vdex, the checksum is copied from the existing vdex file. oat_dex_file->dex_file_size_ = header->file_size_; oat_dex_file->class_offsets_.resize(header->class_defs_size_); return true; @@ -2592,11 +2603,31 @@ bool OatWriter::WriteTypeLookupTables( return true; } -bool OatWriter::WriteVdexHeader(OutputStream* vdex_out) { +bool OatWriter::WriteChecksumsAndVdexHeader(OutputStream* vdex_out) { if (!kIsVdexEnabled) { return true; } - off_t actual_offset = vdex_out->Seek(0, kSeekSet); + // Write checksums + off_t actual_offset = vdex_out->Seek(sizeof(VdexFile::Header), kSeekSet); + if (actual_offset != sizeof(VdexFile::Header)) { + PLOG(ERROR) << "Failed to seek to the checksum location of vdex file. Actual: " << actual_offset + << " File: " << vdex_out->GetLocation(); + return false; + } + + for (size_t i = 0, size = oat_dex_files_.size(); i != size; ++i) { + OatDexFile* oat_dex_file = &oat_dex_files_[i]; + if (!vdex_out->WriteFully( + &oat_dex_file->dex_file_location_checksum_, sizeof(VdexFile::VdexChecksum))) { + PLOG(ERROR) << "Failed to write dex file location checksum. File: " + << vdex_out->GetLocation(); + return false; + } + size_vdex_checksums_ += sizeof(VdexFile::VdexChecksum); + } + + // Write header. + actual_offset = vdex_out->Seek(0, kSeekSet); if (actual_offset != 0) { PLOG(ERROR) << "Failed to seek to the beginning of vdex file. Actual: " << actual_offset << " File: " << vdex_out->GetLocation(); @@ -2610,12 +2641,15 @@ bool OatWriter::WriteVdexHeader(OutputStream* vdex_out) { size_t verifier_deps_section_size = vdex_quickening_info_offset_ - vdex_verifier_deps_offset_; size_t quickening_info_section_size = vdex_size_ - vdex_quickening_info_offset_; - VdexFile::Header vdex_header( - dex_section_size, verifier_deps_section_size, quickening_info_section_size); + VdexFile::Header vdex_header(oat_dex_files_.size(), + dex_section_size, + verifier_deps_section_size, + quickening_info_section_size); if (!vdex_out->WriteFully(&vdex_header, sizeof(VdexFile::Header))) { PLOG(ERROR) << "Failed to write vdex header. File: " << vdex_out->GetLocation(); return false; } + size_vdex_header_ = sizeof(VdexFile::Header); if (!vdex_out->Flush()) { PLOG(ERROR) << "Failed to flush stream after writing to vdex file." diff --git a/compiler/oat_writer.h b/compiler/oat_writer.h index 0dcf79e54e..da221d6029 100644 --- a/compiler/oat_writer.h +++ b/compiler/oat_writer.h @@ -124,7 +124,7 @@ class OatWriter { // - Initialize() // - WriteVerifierDeps() // - WriteQuickeningInfo() - // - WriteVdexHeader() + // - WriteChecksumsAndVdexHeader() // - PrepareLayout(), // - WriteRodata(), // - WriteCode(), @@ -168,7 +168,7 @@ class OatWriter { /*out*/ std::vector<std::unique_ptr<const DexFile>>* opened_dex_files); bool WriteQuickeningInfo(OutputStream* vdex_out); bool WriteVerifierDeps(OutputStream* vdex_out, verifier::VerifierDeps* verifier_deps); - bool WriteVdexHeader(OutputStream* vdex_out); + bool WriteChecksumsAndVdexHeader(OutputStream* vdex_out); // Initialize the writer with the given parameters. void Initialize(const CompilerDriver* compiler, ImageWriter* image_writer, @@ -387,6 +387,7 @@ class OatWriter { // output stats uint32_t size_vdex_header_; + uint32_t size_vdex_checksums_; uint32_t size_dex_file_alignment_; uint32_t size_executable_offset_alignment_; uint32_t size_oat_header_; diff --git a/compiler/optimizing/code_generator.cc b/compiler/optimizing/code_generator.cc index 9f6b78a82c..fa6a5225e7 100644 --- a/compiler/optimizing/code_generator.cc +++ b/compiler/optimizing/code_generator.cc @@ -304,6 +304,7 @@ void CodeGenerator::InitializeCodeGeneration(size_t number_of_spill_slots, SetFrameSize(RoundUp( first_register_slot_in_slow_path_ + maximum_safepoint_spill_size + + (GetGraph()->HasShouldDeoptimizeFlag() ? kShouldDeoptimizeFlagSize : 0) + FrameEntrySpillSize(), kStackAlignment)); } diff --git a/compiler/optimizing/code_generator.h b/compiler/optimizing/code_generator.h index a5d19abe92..4b11e7c699 100644 --- a/compiler/optimizing/code_generator.h +++ b/compiler/optimizing/code_generator.h @@ -307,6 +307,12 @@ class CodeGenerator : public DeletableArenaObject<kArenaAllocCodeGenerator> { return POPCOUNT(GetSlowPathSpills(locations, core_registers)); } + size_t GetStackOffsetOfShouldDeoptimizeFlag() const { + DCHECK(GetGraph()->HasShouldDeoptimizeFlag()); + DCHECK_GE(GetFrameSize(), FrameEntrySpillSize() + kShouldDeoptimizeFlagSize); + return GetFrameSize() - FrameEntrySpillSize() - kShouldDeoptimizeFlagSize; + } + // Record native to dex mapping for a suspend point. Required by runtime. void RecordPcInfo(HInstruction* instruction, uint32_t dex_pc, SlowPathCode* slow_path = nullptr); // Check whether we have already recorded mapping at this PC. diff --git a/compiler/optimizing/code_generator_arm.cc b/compiler/optimizing/code_generator_arm.cc index 1f5981682b..ed6eef1b55 100644 --- a/compiler/optimizing/code_generator_arm.cc +++ b/compiler/optimizing/code_generator_arm.cc @@ -1329,6 +1329,13 @@ void CodeGeneratorARM::GenerateFrameEntry() { __ cfi().AdjustCFAOffset(kArmWordSize * POPCOUNT(fpu_spill_mask_)); __ cfi().RelOffsetForMany(DWARFReg(S0), 0, fpu_spill_mask_, kArmWordSize); } + + if (GetGraph()->HasShouldDeoptimizeFlag()) { + // Initialize should_deoptimize flag to 0. + __ mov(IP, ShifterOperand(0)); + __ StoreToOffset(kStoreWord, IP, SP, -kShouldDeoptimizeFlagSize); + } + int adjust = GetFrameSize() - FrameEntrySpillSize(); __ AddConstant(SP, -adjust); __ cfi().AdjustCFAOffset(adjust); @@ -1944,6 +1951,19 @@ void InstructionCodeGeneratorARM::VisitDeoptimize(HDeoptimize* deoptimize) { /* false_target */ nullptr); } +void LocationsBuilderARM::VisitShouldDeoptimizeFlag(HShouldDeoptimizeFlag* flag) { + LocationSummary* locations = new (GetGraph()->GetArena()) + LocationSummary(flag, LocationSummary::kNoCall); + locations->SetOut(Location::RequiresRegister()); +} + +void InstructionCodeGeneratorARM::VisitShouldDeoptimizeFlag(HShouldDeoptimizeFlag* flag) { + __ LoadFromOffset(kLoadWord, + flag->GetLocations()->Out().AsRegister<Register>(), + SP, + codegen_->GetStackOffsetOfShouldDeoptimizeFlag()); +} + void LocationsBuilderARM::VisitSelect(HSelect* select) { LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(select); if (Primitive::IsFloatingPointType(select->GetType())) { diff --git a/compiler/optimizing/code_generator_arm64.cc b/compiler/optimizing/code_generator_arm64.cc index ab6a33fbd9..6eebd69a04 100644 --- a/compiler/optimizing/code_generator_arm64.cc +++ b/compiler/optimizing/code_generator_arm64.cc @@ -1273,6 +1273,12 @@ void CodeGeneratorARM64::GenerateFrameEntry() { frame_size - GetCoreSpillSize()); GetAssembler()->SpillRegisters(GetFramePreservedFPRegisters(), frame_size - FrameEntrySpillSize()); + + if (GetGraph()->HasShouldDeoptimizeFlag()) { + // Initialize should_deoptimize flag to 0. + Register wzr = Register(VIXLRegCodeFromART(WZR), kWRegSize); + __ Str(wzr, MemOperand(sp, GetStackOffsetOfShouldDeoptimizeFlag())); + } } } @@ -3235,6 +3241,17 @@ void InstructionCodeGeneratorARM64::VisitDeoptimize(HDeoptimize* deoptimize) { /* false_target */ nullptr); } +void LocationsBuilderARM64::VisitShouldDeoptimizeFlag(HShouldDeoptimizeFlag* flag) { + LocationSummary* locations = new (GetGraph()->GetArena()) + LocationSummary(flag, LocationSummary::kNoCall); + locations->SetOut(Location::RequiresRegister()); +} + +void InstructionCodeGeneratorARM64::VisitShouldDeoptimizeFlag(HShouldDeoptimizeFlag* flag) { + __ Ldr(OutputRegister(flag), + MemOperand(sp, codegen_->GetStackOffsetOfShouldDeoptimizeFlag())); +} + static inline bool IsConditionOnFloatingPointValues(HInstruction* condition) { return condition->IsCondition() && Primitive::IsFloatingPointType(condition->InputAt(0)->GetType()); diff --git a/compiler/optimizing/code_generator_arm_vixl.cc b/compiler/optimizing/code_generator_arm_vixl.cc index 1ca439e8cf..4b24ac3459 100644 --- a/compiler/optimizing/code_generator_arm_vixl.cc +++ b/compiler/optimizing/code_generator_arm_vixl.cc @@ -63,9 +63,10 @@ static bool ExpectedPairLayout(Location location) { // We expected this for both core and fpu register pairs. return ((location.low() & 1) == 0) && (location.low() + 1 == location.high()); } - +// Use a local definition to prevent copying mistakes. +static constexpr size_t kArmWordSize = static_cast<size_t>(kArmPointerSize); +static constexpr size_t kArmBitsPerWord = kArmWordSize * kBitsPerByte; static constexpr int kCurrentMethodStackOffset = 0; -static constexpr size_t kArmInstrMaxSizeInBytes = 4u; static constexpr uint32_t kPackedSwitchCompareJumpThreshold = 7; #ifdef __ @@ -438,6 +439,62 @@ class LoadClassSlowPathARMVIXL : public SlowPathCodeARMVIXL { DISALLOW_COPY_AND_ASSIGN(LoadClassSlowPathARMVIXL); }; +class LoadStringSlowPathARMVIXL : public SlowPathCodeARMVIXL { + public: + explicit LoadStringSlowPathARMVIXL(HLoadString* instruction) + : SlowPathCodeARMVIXL(instruction) {} + + void EmitNativeCode(CodeGenerator* codegen) OVERRIDE { + LocationSummary* locations = instruction_->GetLocations(); + DCHECK(!locations->GetLiveRegisters()->ContainsCoreRegister(locations->Out().reg())); + HLoadString* load = instruction_->AsLoadString(); + const uint32_t string_index = load->GetStringIndex().index_; + vixl32::Register out = OutputRegister(load); + vixl32::Register temp = RegisterFrom(locations->GetTemp(0)); + constexpr bool call_saves_everything_except_r0 = (!kUseReadBarrier || kUseBakerReadBarrier); + + CodeGeneratorARMVIXL* arm_codegen = down_cast<CodeGeneratorARMVIXL*>(codegen); + __ Bind(GetEntryLabel()); + SaveLiveRegisters(codegen, locations); + + InvokeRuntimeCallingConventionARMVIXL calling_convention; + // In the unlucky case that the `temp` is R0, we preserve the address in `out` across + // the kSaveEverything call (or use `out` for the address after non-kSaveEverything call). + bool temp_is_r0 = (temp.Is(calling_convention.GetRegisterAt(0))); + vixl32::Register entry_address = temp_is_r0 ? out : temp; + DCHECK(!entry_address.Is(calling_convention.GetRegisterAt(0))); + if (call_saves_everything_except_r0 && temp_is_r0) { + __ Mov(entry_address, temp); + } + + __ Mov(calling_convention.GetRegisterAt(0), string_index); + arm_codegen->InvokeRuntime(kQuickResolveString, instruction_, instruction_->GetDexPc(), this); + CheckEntrypointTypes<kQuickResolveString, void*, uint32_t>(); + + // Store the resolved String to the .bss entry. + if (call_saves_everything_except_r0) { + // The string entry address was preserved in `entry_address` thanks to kSaveEverything. + __ Str(r0, MemOperand(entry_address)); + } else { + // For non-Baker read barrier, we need to re-calculate the address of the string entry. + CodeGeneratorARMVIXL::PcRelativePatchInfo* labels = + arm_codegen->NewPcRelativeStringPatch(load->GetDexFile(), string_index); + arm_codegen->EmitMovwMovtPlaceholder(labels, out); + __ Str(r0, MemOperand(entry_address)); + } + + arm_codegen->Move32(locations->Out(), LocationFrom(r0)); + RestoreLiveRegisters(codegen, locations); + + __ B(GetExitLabel()); + } + + const char* GetDescription() const OVERRIDE { return "LoadStringSlowPathARMVIXL"; } + + private: + DISALLOW_COPY_AND_ASSIGN(LoadStringSlowPathARMVIXL); +}; + class TypeCheckSlowPathARMVIXL : public SlowPathCodeARMVIXL { public: TypeCheckSlowPathARMVIXL(HInstruction* instruction, bool is_fatal) @@ -630,9 +687,30 @@ static uint32_t ComputeSRegisterListMask(const SRegisterList& regs) { return mask; } -size_t CodeGeneratorARMVIXL::RestoreFloatingPointRegister(size_t stack_index, uint32_t reg_id) { - GetAssembler()->LoadSFromOffset(vixl32::SRegister(reg_id), sp, stack_index); - return kArmWordSize; +// Saves the register in the stack. Returns the size taken on stack. +size_t CodeGeneratorARMVIXL::SaveCoreRegister(size_t stack_index ATTRIBUTE_UNUSED, + uint32_t reg_id ATTRIBUTE_UNUSED) { + TODO_VIXL32(FATAL); + return 0; +} + +// Restores the register from the stack. Returns the size taken on stack. +size_t CodeGeneratorARMVIXL::RestoreCoreRegister(size_t stack_index ATTRIBUTE_UNUSED, + uint32_t reg_id ATTRIBUTE_UNUSED) { + TODO_VIXL32(FATAL); + return 0; +} + +size_t CodeGeneratorARMVIXL::SaveFloatingPointRegister(size_t stack_index ATTRIBUTE_UNUSED, + uint32_t reg_id ATTRIBUTE_UNUSED) { + TODO_VIXL32(FATAL); + return 0; +} + +size_t CodeGeneratorARMVIXL::RestoreFloatingPointRegister(size_t stack_index ATTRIBUTE_UNUSED, + uint32_t reg_id ATTRIBUTE_UNUSED) { + TODO_VIXL32(FATAL); + return 0; } #undef __ @@ -655,7 +733,11 @@ CodeGeneratorARMVIXL::CodeGeneratorARMVIXL(HGraph* graph, instruction_visitor_(graph, this), move_resolver_(graph->GetArena(), this), assembler_(graph->GetArena()), - isa_features_(isa_features) { + isa_features_(isa_features), + relative_call_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)), + pc_relative_dex_cache_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)), + pc_relative_string_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)), + pc_relative_type_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)) { // Always save the LR register to mimic Quick. AddAllocatedRegister(Location::RegisterLocation(LR)); // Give d14 and d15 as scratch registers to VIXL. @@ -793,7 +875,7 @@ void CodeGeneratorARMVIXL::GenerateFrameEntry() { __ Sub(temp, sp, static_cast<int32_t>(GetStackOverflowReservedBytes(kArm))); // The load must immediately precede RecordPcInfo. AssemblerAccurateScope aas(GetVIXLAssembler(), - kArmInstrMaxSizeInBytes, + vixl32::kMaxInstructionSizeInBytes, CodeBufferCheckScope::kMaximumSize); __ ldr(temp, MemOperand(temp)); RecordPcInfo(nullptr, 0); @@ -853,6 +935,116 @@ void CodeGeneratorARMVIXL::Bind(HBasicBlock* block) { __ Bind(GetLabelOf(block)); } +Location InvokeDexCallingConventionVisitorARMVIXL::GetNextLocation(Primitive::Type type) { + switch (type) { + case Primitive::kPrimBoolean: + case Primitive::kPrimByte: + case Primitive::kPrimChar: + case Primitive::kPrimShort: + case Primitive::kPrimInt: + case Primitive::kPrimNot: { + uint32_t index = gp_index_++; + uint32_t stack_index = stack_index_++; + if (index < calling_convention.GetNumberOfRegisters()) { + return LocationFrom(calling_convention.GetRegisterAt(index)); + } else { + return Location::StackSlot(calling_convention.GetStackOffsetOf(stack_index)); + } + } + + case Primitive::kPrimLong: { + uint32_t index = gp_index_; + uint32_t stack_index = stack_index_; + gp_index_ += 2; + stack_index_ += 2; + if (index + 1 < calling_convention.GetNumberOfRegisters()) { + if (calling_convention.GetRegisterAt(index).Is(r1)) { + // Skip R1, and use R2_R3 instead. + gp_index_++; + index++; + } + } + if (index + 1 < calling_convention.GetNumberOfRegisters()) { + DCHECK_EQ(calling_convention.GetRegisterAt(index).GetCode() + 1, + calling_convention.GetRegisterAt(index + 1).GetCode()); + + return LocationFrom(calling_convention.GetRegisterAt(index), + calling_convention.GetRegisterAt(index + 1)); + } else { + return Location::DoubleStackSlot(calling_convention.GetStackOffsetOf(stack_index)); + } + } + + case Primitive::kPrimFloat: { + uint32_t stack_index = stack_index_++; + if (float_index_ % 2 == 0) { + float_index_ = std::max(double_index_, float_index_); + } + if (float_index_ < calling_convention.GetNumberOfFpuRegisters()) { + return LocationFrom(calling_convention.GetFpuRegisterAt(float_index_++)); + } else { + return Location::StackSlot(calling_convention.GetStackOffsetOf(stack_index)); + } + } + + case Primitive::kPrimDouble: { + double_index_ = std::max(double_index_, RoundUp(float_index_, 2)); + uint32_t stack_index = stack_index_; + stack_index_ += 2; + if (double_index_ + 1 < calling_convention.GetNumberOfFpuRegisters()) { + uint32_t index = double_index_; + double_index_ += 2; + Location result = LocationFrom( + calling_convention.GetFpuRegisterAt(index), + calling_convention.GetFpuRegisterAt(index + 1)); + DCHECK(ExpectedPairLayout(result)); + return result; + } else { + return Location::DoubleStackSlot(calling_convention.GetStackOffsetOf(stack_index)); + } + } + + case Primitive::kPrimVoid: + LOG(FATAL) << "Unexpected parameter type " << type; + break; + } + return Location::NoLocation(); +} + +Location InvokeDexCallingConventionVisitorARMVIXL::GetReturnLocation(Primitive::Type type) const { + switch (type) { + case Primitive::kPrimBoolean: + case Primitive::kPrimByte: + case Primitive::kPrimChar: + case Primitive::kPrimShort: + case Primitive::kPrimInt: + case Primitive::kPrimNot: { + return LocationFrom(r0); + } + + case Primitive::kPrimFloat: { + return LocationFrom(s0); + } + + case Primitive::kPrimLong: { + return LocationFrom(r0, r1); + } + + case Primitive::kPrimDouble: { + return LocationFrom(s0, s1); + } + + case Primitive::kPrimVoid: + return Location::NoLocation(); + } + + UNREACHABLE(); +} + +Location InvokeDexCallingConventionVisitorARMVIXL::GetMethodLocation() const { + return LocationFrom(kMethodRegister); +} + void CodeGeneratorARMVIXL::Move32(Location destination, Location source) { if (source.Equals(destination)) { return; @@ -924,10 +1116,14 @@ void CodeGeneratorARMVIXL::InvokeRuntime(QuickEntrypointEnum entrypoint, uint32_t dex_pc, SlowPathCode* slow_path) { ValidateInvokeRuntime(entrypoint, instruction, slow_path); - GenerateInvokeRuntime(GetThreadOffset<kArmPointerSize>(entrypoint).Int32Value()); + __ Ldr(lr, MemOperand(tr, GetThreadOffset<kArmPointerSize>(entrypoint).Int32Value())); + // Ensure the pc position is recorded immediately after the `blx` instruction. + // blx in T32 has only 16bit encoding that's why a stricter check for the scope is used. + AssemblerAccurateScope aas(GetVIXLAssembler(), + vixl32::k16BitT32InstructionSizeInBytes, + CodeBufferCheckScope::kExactSize); + __ blx(lr); if (EntrypointRequiresStackMap(entrypoint)) { - // TODO(VIXL): If necessary, use a scope to ensure we record the pc info immediately after the - // previous instruction. RecordPcInfo(instruction, dex_pc, slow_path); } } @@ -936,11 +1132,7 @@ void CodeGeneratorARMVIXL::InvokeRuntimeWithoutRecordingPcInfo(int32_t entry_poi HInstruction* instruction, SlowPathCode* slow_path) { ValidateInvokeRuntimeWithoutRecordingPcInfo(instruction, slow_path); - GenerateInvokeRuntime(entry_point_offset); -} - -void CodeGeneratorARMVIXL::GenerateInvokeRuntime(int32_t entry_point_offset) { - GetAssembler()->LoadFromOffset(kLoadWord, lr, tr, entry_point_offset); + __ Ldr(lr, MemOperand(tr, entry_point_offset)); __ Blx(lr); } @@ -1270,6 +1462,19 @@ void InstructionCodeGeneratorARMVIXL::VisitDeoptimize(HDeoptimize* deoptimize) { /* false_target */ nullptr); } +void LocationsBuilderARMVIXL::VisitShouldDeoptimizeFlag(HShouldDeoptimizeFlag* flag) { + LocationSummary* locations = new (GetGraph()->GetArena()) + LocationSummary(flag, LocationSummary::kNoCall); + locations->SetOut(Location::RequiresRegister()); +} + +void InstructionCodeGeneratorARMVIXL::VisitShouldDeoptimizeFlag(HShouldDeoptimizeFlag* flag) { + GetAssembler()->LoadFromOffset(kLoadWord, + OutputRegister(flag), + sp, + codegen_->GetStackOffsetOfShouldDeoptimizeFlag()); +} + void LocationsBuilderARMVIXL::VisitSelect(HSelect* select) { LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(select); if (Primitive::IsFloatingPointType(select->GetType())) { @@ -1360,7 +1565,7 @@ void InstructionCodeGeneratorARMVIXL::HandleCondition(HCondition* cond) { CodeGenerator::GetInt32ValueOf(right.GetConstant())); } AssemblerAccurateScope aas(GetVIXLAssembler(), - kArmInstrMaxSizeInBytes * 3u, + 3 * vixl32::kMaxInstructionSizeInBytes, CodeBufferCheckScope::kMaximumSize); __ ite(ARMCondition(cond->GetCondition())); __ mov(ARMCondition(cond->GetCondition()), OutputRegister(cond), 1); @@ -1575,7 +1780,10 @@ void LocationsBuilderARMVIXL::VisitInvokeStaticOrDirect(HInvokeStaticOrDirect* i HandleInvoke(invoke); - // TODO(VIXL): invoke->HasPcRelativeDexCache() + // For PC-relative dex cache the invoke has an extra input, the PC-relative address base. + if (invoke->HasPcRelativeDexCache()) { + invoke->GetLocations()->SetInAt(invoke->GetSpecialInputIndex(), Location::RequiresRegister()); + } } static bool TryGenerateIntrinsicCode(HInvoke* invoke, CodeGeneratorARMVIXL* codegen) { @@ -1597,15 +1805,13 @@ void InstructionCodeGeneratorARMVIXL::VisitInvokeStaticOrDirect(HInvokeStaticOrD } LocationSummary* locations = invoke->GetLocations(); - DCHECK(locations->HasTemps()); - codegen_->GenerateStaticOrDirectCall(invoke, locations->GetTemp(0)); - // TODO(VIXL): If necessary, use a scope to ensure we record the pc info immediately after the - // previous instruction. + codegen_->GenerateStaticOrDirectCall( + invoke, locations->HasTemps() ? locations->GetTemp(0) : Location::NoLocation()); codegen_->RecordPcInfo(invoke, invoke->GetDexPc()); } void LocationsBuilderARMVIXL::HandleInvoke(HInvoke* invoke) { - InvokeDexCallingConventionVisitorARM calling_convention_visitor; + InvokeDexCallingConventionVisitorARMVIXL calling_convention_visitor; CodeGenerator::CreateCommonInvokeLocationSummary(invoke, &calling_convention_visitor); } @@ -1624,10 +1830,8 @@ void InstructionCodeGeneratorARMVIXL::VisitInvokeVirtual(HInvokeVirtual* invoke) } codegen_->GenerateVirtualCall(invoke, invoke->GetLocations()->GetTemp(0)); - DCHECK(!codegen_->IsLeafMethod()); - // TODO(VIXL): If necessary, use a scope to ensure we record the pc info immediately after the - // previous instruction. codegen_->RecordPcInfo(invoke, invoke->GetDexPc()); + DCHECK(!codegen_->IsLeafMethod()); } void LocationsBuilderARMVIXL::VisitInvokeInterface(HInvokeInterface* invoke) { @@ -1646,10 +1850,15 @@ void InstructionCodeGeneratorARMVIXL::VisitInvokeInterface(HInvokeInterface* inv DCHECK(!receiver.IsStackSlot()); - // /* HeapReference<Class> */ temp = receiver->klass_ - GetAssembler()->LoadFromOffset(kLoadWord, temp, RegisterFrom(receiver), class_offset); - - codegen_->MaybeRecordImplicitNullCheck(invoke); + // Ensure the pc position is recorded immediately after the `ldr` instruction. + { + AssemblerAccurateScope aas(GetVIXLAssembler(), + vixl32::kMaxInstructionSizeInBytes, + CodeBufferCheckScope::kMaximumSize); + // /* HeapReference<Class> */ temp = receiver->klass_ + __ ldr(temp, MemOperand(RegisterFrom(receiver), class_offset)); + codegen_->MaybeRecordImplicitNullCheck(invoke); + } // Instead of simply (possibly) unpoisoning `temp` here, we should // emit a read barrier for the previous class reference load. // However this is not required in practice, as this is an @@ -1688,15 +1897,16 @@ void InstructionCodeGeneratorARMVIXL::VisitInvokeInterface(HInvokeInterface* inv temps.Exclude(hidden_reg); __ Mov(hidden_reg, invoke->GetDexMethodIndex()); } - { + // Ensure the pc position is recorded immediately after the `blx` instruction. + // blx in T32 has only 16bit encoding that's why a stricter check for the scope is used. AssemblerAccurateScope aas(GetVIXLAssembler(), - kArmInstrMaxSizeInBytes, - CodeBufferCheckScope::kMaximumSize); + vixl32::k16BitT32InstructionSizeInBytes, + CodeBufferCheckScope::kExactSize); // LR(); __ blx(lr); - DCHECK(!codegen_->IsLeafMethod()); codegen_->RecordPcInfo(invoke, invoke->GetDexPc()); + DCHECK(!codegen_->IsLeafMethod()); } } @@ -3067,7 +3277,7 @@ void InstructionCodeGeneratorARMVIXL::HandleShift(HBinaryOperation* op) { __ Subs(temp, o_l, Operand::From(kArmBitsPerWord)); { AssemblerAccurateScope guard(GetVIXLAssembler(), - 3 * kArmInstrMaxSizeInBytes, + 2 * vixl32::kMaxInstructionSizeInBytes, CodeBufferCheckScope::kMaximumSize); __ it(pl); __ lsl(pl, o_h, low, temp); @@ -3086,7 +3296,7 @@ void InstructionCodeGeneratorARMVIXL::HandleShift(HBinaryOperation* op) { __ Subs(temp, o_h, Operand::From(kArmBitsPerWord)); { AssemblerAccurateScope guard(GetVIXLAssembler(), - 3 * kArmInstrMaxSizeInBytes, + 2 * vixl32::kMaxInstructionSizeInBytes, CodeBufferCheckScope::kMaximumSize); __ it(pl); __ asr(pl, o_l, high, temp); @@ -3103,7 +3313,7 @@ void InstructionCodeGeneratorARMVIXL::HandleShift(HBinaryOperation* op) { __ Subs(temp, o_h, Operand::From(kArmBitsPerWord)); { AssemblerAccurateScope guard(GetVIXLAssembler(), - 3 * kArmInstrMaxSizeInBytes, + 2 * vixl32::kMaxInstructionSizeInBytes, CodeBufferCheckScope::kMaximumSize); __ it(pl); __ lsr(pl, o_l, high, temp); @@ -3220,9 +3430,10 @@ void InstructionCodeGeneratorARMVIXL::VisitNewInstance(HNewInstance* instruction MemberOffset code_offset = ArtMethod::EntryPointFromQuickCompiledCodeOffset(kArmPointerSize); GetAssembler()->LoadFromOffset(kLoadWord, temp, tr, QUICK_ENTRY_POINT(pNewEmptyString)); GetAssembler()->LoadFromOffset(kLoadWord, lr, temp, code_offset.Int32Value()); + // blx in T32 has only 16bit encoding that's why a stricter check for the scope is used. AssemblerAccurateScope aas(GetVIXLAssembler(), - kArmInstrMaxSizeInBytes, - CodeBufferCheckScope::kMaximumSize); + vixl32::k16BitT32InstructionSizeInBytes, + CodeBufferCheckScope::kExactSize); __ blx(lr); codegen_->RecordPcInfo(instruction, instruction->GetDexPc()); } else { @@ -3462,10 +3673,16 @@ void InstructionCodeGeneratorARMVIXL::GenerateWideAtomicStore(vixl32::Register a addr = temp; } __ Bind(&fail); - // We need a load followed by store. (The address used in a STREX instruction must - // be the same as the address in the most recently executed LDREX instruction.) - __ Ldrexd(temp1, temp2, MemOperand(addr)); - codegen_->MaybeRecordImplicitNullCheck(instruction); + { + // Ensure the pc position is recorded immediately after the `ldrexd` instruction. + AssemblerAccurateScope aas(GetVIXLAssembler(), + vixl32::kMaxInstructionSizeInBytes, + CodeBufferCheckScope::kMaximumSize); + // We need a load followed by store. (The address used in a STREX instruction must + // be the same as the address in the most recently executed LDREX instruction.) + __ ldrexd(temp1, temp2, MemOperand(addr)); + codegen_->MaybeRecordImplicitNullCheck(instruction); + } __ Strexd(temp1, value_lo, value_hi, MemOperand(addr)); __ CompareAndBranchIfNonZero(temp1, &fail); } @@ -3614,6 +3831,11 @@ void InstructionCodeGeneratorARMVIXL::HandleFieldSet(HInstruction* instruction, // Longs and doubles are handled in the switch. if (field_type != Primitive::kPrimLong && field_type != Primitive::kPrimDouble) { + // TODO(VIXL): Here and for other calls to `MaybeRecordImplicitNullCheck` in this method, we + // should use a scope and the assembler to emit the store instruction to guarantee that we + // record the pc at the correct position. But the `Assembler` does not automatically handle + // unencodable offsets. Practically, everything is fine because the helper and VIXL, at the time + // of writing, do generate the store instruction last. codegen_->MaybeRecordImplicitNullCheck(instruction); } @@ -3788,7 +4010,6 @@ void InstructionCodeGeneratorARMVIXL::HandleFieldGet(HInstruction* instruction, TODO_VIXL32(FATAL); } else { GetAssembler()->LoadFromOffset(kLoadWord, RegisterFrom(out), base, offset); - // TODO(VIXL): Scope to guarantee the position immediately after the load. codegen_->MaybeRecordImplicitNullCheck(instruction); if (is_volatile) { codegen_->GenerateMemoryBarrier(MemBarrierKind::kLoadAny); @@ -3825,7 +4046,6 @@ void InstructionCodeGeneratorARMVIXL::HandleFieldGet(HInstruction* instruction, __ Vmov(out_dreg, lo, hi); } else { GetAssembler()->LoadDFromOffset(out_dreg, base, offset); - // TODO(VIXL): Scope to guarantee the position immediately after the load. codegen_->MaybeRecordImplicitNullCheck(instruction); } break; @@ -3841,6 +4061,11 @@ void InstructionCodeGeneratorARMVIXL::HandleFieldGet(HInstruction* instruction, // double fields, are handled in the previous switch statement. } else { // Address cases other than reference and double that may require an implicit null check. + // TODO(VIXL): Here and for other calls to `MaybeRecordImplicitNullCheck` in this method, we + // should use a scope and the assembler to emit the load instruction to guarantee that we + // record the pc at the correct position. But the `Assembler` does not automatically handle + // unencodable offsets. Practically, everything is fine because the helper and VIXL, at the time + // of writing, do generate the store instruction last. codegen_->MaybeRecordImplicitNullCheck(instruction); } @@ -3965,8 +4190,9 @@ void CodeGeneratorARMVIXL::GenerateImplicitNullCheck(HNullCheck* instruction) { } UseScratchRegisterScope temps(GetVIXLAssembler()); + // Ensure the pc position is recorded immediately after the `ldr` instruction. AssemblerAccurateScope aas(GetVIXLAssembler(), - kArmInstrMaxSizeInBytes, + vixl32::kMaxInstructionSizeInBytes, CodeBufferCheckScope::kMaximumSize); __ ldr(temps.Acquire(), MemOperand(InputRegisterAt(instruction, 0))); RecordPcInfo(instruction, instruction->GetDexPc()); @@ -4233,6 +4459,11 @@ void InstructionCodeGeneratorARMVIXL::VisitArrayGet(HArrayGet* instruction) { size_t offset = (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4) + data_offset; GetAssembler()->LoadFromOffset(kLoadWord, out, obj, offset); + // TODO(VIXL): Here and for other calls to `MaybeRecordImplicitNullCheck` in this method, + // we should use a scope and the assembler to emit the load instruction to guarantee that + // we record the pc at the correct position. But the `Assembler` does not automatically + // handle unencodable offsets. Practically, everything is fine because the helper and + // VIXL, at the time of writing, do generate the store instruction last. codegen_->MaybeRecordImplicitNullCheck(instruction); // If read barriers are enabled, emit read barriers other than // Baker's using a slow path (and also unpoison the loaded @@ -4255,7 +4486,9 @@ void InstructionCodeGeneratorARMVIXL::VisitArrayGet(HArrayGet* instruction) { } codegen_->LoadFromShiftedRegOffset(type, out_loc, temp, RegisterFrom(index)); temps.Release(temp); - + // TODO(VIXL): Use a scope to ensure that we record the pc position immediately after the + // load instruction. Practically, everything is fine because the helper and VIXL, at the + // time of writing, do generate the store instruction last. codegen_->MaybeRecordImplicitNullCheck(instruction); // If read barriers are enabled, emit read barriers other than // Baker's using a slow path (and also unpoison the loaded @@ -4317,6 +4550,8 @@ void InstructionCodeGeneratorARMVIXL::VisitArrayGet(HArrayGet* instruction) { // Potential implicit null checks, in the case of reference // arrays, are handled in the previous switch statement. } else if (!maybe_compressed_char_at) { + // TODO(VIXL): Use a scope to ensure we record the pc info immediately after + // the preceding load instruction. codegen_->MaybeRecordImplicitNullCheck(instruction); } } @@ -4417,6 +4652,8 @@ void InstructionCodeGeneratorARMVIXL::VisitArraySet(HArraySet* instruction) { codegen_->StoreToShiftedRegOffset(value_type, value_loc, temp, RegisterFrom(index)); temps.Release(temp); } + // TODO(VIXL): Use a scope to ensure we record the pc info immediately after the preceding + // store instruction. codegen_->MaybeRecordImplicitNullCheck(instruction); DCHECK(!needs_write_barrier); DCHECK(!may_need_runtime_call_for_type_check); @@ -4451,6 +4688,8 @@ void InstructionCodeGeneratorARMVIXL::VisitArraySet(HArraySet* instruction) { codegen_->StoreToShiftedRegOffset(value_type, value_loc, temp, RegisterFrom(index)); temps.Release(temp); } + // TODO(VIXL): Use a scope to ensure we record the pc info immediately after the preceding + // store instruction. codegen_->MaybeRecordImplicitNullCheck(instruction); __ B(&done); __ Bind(&non_zero); @@ -4464,9 +4703,15 @@ void InstructionCodeGeneratorARMVIXL::VisitArraySet(HArraySet* instruction) { // negative, in which case we would take the ArraySet slow // path. - // /* HeapReference<Class> */ temp1 = array->klass_ - GetAssembler()->LoadFromOffset(kLoadWord, temp1, array, class_offset); - codegen_->MaybeRecordImplicitNullCheck(instruction); + { + // Ensure we record the pc position immediately after the `ldr` instruction. + AssemblerAccurateScope aas(GetVIXLAssembler(), + vixl32::kMaxInstructionSizeInBytes, + CodeBufferCheckScope::kMaximumSize); + // /* HeapReference<Class> */ temp1 = array->klass_ + __ ldr(temp1, MemOperand(array, class_offset)); + codegen_->MaybeRecordImplicitNullCheck(instruction); + } GetAssembler()->MaybeUnpoisonHeapReference(temp1); // /* HeapReference<Class> */ temp1 = temp1->component_type_ @@ -4523,6 +4768,8 @@ void InstructionCodeGeneratorARMVIXL::VisitArraySet(HArraySet* instruction) { } if (!may_need_runtime_call_for_type_check) { + // TODO(VIXL): Ensure we record the pc position immediately after the preceding store + // instruction. codegen_->MaybeRecordImplicitNullCheck(instruction); } @@ -4591,6 +4838,8 @@ void InstructionCodeGeneratorARMVIXL::VisitArraySet(HArraySet* instruction) { // Objects are handled in the switch. if (value_type != Primitive::kPrimNot) { + // TODO(VIXL): Ensure we record the pc position immediately after the preceding store + // instruction. codegen_->MaybeRecordImplicitNullCheck(instruction); } } @@ -4606,8 +4855,13 @@ void InstructionCodeGeneratorARMVIXL::VisitArrayLength(HArrayLength* instruction uint32_t offset = CodeGenerator::GetArrayLengthOffset(instruction); vixl32::Register obj = InputRegisterAt(instruction, 0); vixl32::Register out = OutputRegister(instruction); - GetAssembler()->LoadFromOffset(kLoadWord, out, obj, offset); - codegen_->MaybeRecordImplicitNullCheck(instruction); + { + AssemblerAccurateScope aas(GetVIXLAssembler(), + vixl32::kMaxInstructionSizeInBytes, + CodeBufferCheckScope::kMaximumSize); + __ ldr(out, MemOperand(obj, offset)); + codegen_->MaybeRecordImplicitNullCheck(instruction); + } // Mask out compression flag from String's array length. if (mirror::kUseStringCompression && instruction->IsStringLength()) { __ Lsr(out, out, 1u); @@ -4985,12 +5239,37 @@ void ParallelMoveResolverARMVIXL::RestoreScratch(int reg ATTRIBUTE_UNUSED) { TODO_VIXL32(FATAL); } -// Check if the desired_class_load_kind is supported. If it is, return it, -// otherwise return a fall-back kind that should be used instead. HLoadClass::LoadKind CodeGeneratorARMVIXL::GetSupportedLoadClassKind( - HLoadClass::LoadKind desired_class_load_kind ATTRIBUTE_UNUSED) { - // TODO(VIXL): Implement optimized code paths. - return HLoadClass::LoadKind::kDexCacheViaMethod; + HLoadClass::LoadKind desired_class_load_kind) { + switch (desired_class_load_kind) { + case HLoadClass::LoadKind::kReferrersClass: + break; + case HLoadClass::LoadKind::kBootImageLinkTimeAddress: + // TODO(VIXL): Enable it back when literal pools are fixed in VIXL. + return HLoadClass::LoadKind::kDexCacheViaMethod; + case HLoadClass::LoadKind::kBootImageLinkTimePcRelative: + DCHECK(GetCompilerOptions().GetCompilePic()); + break; + case HLoadClass::LoadKind::kBootImageAddress: + // TODO(VIXL): Enable it back when literal pools are fixed in VIXL. + return HLoadClass::LoadKind::kDexCacheViaMethod; + case HLoadClass::LoadKind::kDexCacheAddress: + // TODO(VIXL): Enable it back when literal pools are fixed in VIXL. + return HLoadClass::LoadKind::kDexCacheViaMethod; + case HLoadClass::LoadKind::kDexCachePcRelative: + DCHECK(!Runtime::Current()->UseJitCompilation()); + // We disable pc-relative load when there is an irreducible loop, as the optimization + // is incompatible with it. + // TODO: Create as many ArmDexCacheArraysBase instructions as needed for methods + // with irreducible loops. + if (GetGraph()->HasIrreducibleLoops()) { + return HLoadClass::LoadKind::kDexCacheViaMethod; + } + break; + case HLoadClass::LoadKind::kDexCacheViaMethod: + break; + } + return desired_class_load_kind; } void LocationsBuilderARMVIXL::VisitLoadClass(HLoadClass* cls) { @@ -5004,11 +5283,15 @@ void LocationsBuilderARMVIXL::VisitLoadClass(HLoadClass* cls) { return; } - // TODO(VIXL): read barrier code. - LocationSummary::CallKind call_kind = (cls->NeedsEnvironment() || kEmitCompilerReadBarrier) + const bool requires_read_barrier = kEmitCompilerReadBarrier && !cls->IsInBootImage(); + LocationSummary::CallKind call_kind = (cls->NeedsEnvironment() || requires_read_barrier) ? LocationSummary::kCallOnSlowPath : LocationSummary::kNoCall; LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(cls, call_kind); + if (kUseBakerReadBarrier && requires_read_barrier && !cls->NeedsEnvironment()) { + TODO_VIXL32(FATAL); + } + HLoadClass::LoadKind load_kind = cls->GetLoadKind(); if (load_kind == HLoadClass::LoadKind::kReferrersClass || load_kind == HLoadClass::LoadKind::kDexCacheViaMethod || @@ -5030,7 +5313,9 @@ void InstructionCodeGeneratorARMVIXL::VisitLoadClass(HLoadClass* cls) { Location out_loc = locations->Out(); vixl32::Register out = OutputRegister(cls); - // TODO(VIXL): read barrier code. + const ReadBarrierOption read_barrier_option = cls->IsInBootImage() + ? kWithoutReadBarrier + : kCompilerReadBarrierOption; bool generate_null_check = false; switch (cls->GetLoadKind()) { case HLoadClass::LoadKind::kReferrersClass: { @@ -5042,7 +5327,35 @@ void InstructionCodeGeneratorARMVIXL::VisitLoadClass(HLoadClass* cls) { out_loc, current_method, ArtMethod::DeclaringClassOffset().Int32Value(), - kEmitCompilerReadBarrier); + read_barrier_option); + break; + } + case HLoadClass::LoadKind::kBootImageLinkTimeAddress: { + TODO_VIXL32(FATAL); + break; + } + case HLoadClass::LoadKind::kBootImageLinkTimePcRelative: { + DCHECK_EQ(read_barrier_option, kWithoutReadBarrier); + CodeGeneratorARMVIXL::PcRelativePatchInfo* labels = + codegen_->NewPcRelativeTypePatch(cls->GetDexFile(), cls->GetTypeIndex()); + codegen_->EmitMovwMovtPlaceholder(labels, out); + break; + } + case HLoadClass::LoadKind::kBootImageAddress: { + TODO_VIXL32(FATAL); + break; + } + case HLoadClass::LoadKind::kDexCacheAddress: { + TODO_VIXL32(FATAL); + break; + } + case HLoadClass::LoadKind::kDexCachePcRelative: { + vixl32::Register base_reg = InputRegisterAt(cls, 0); + HArmDexCacheArraysBase* base = cls->InputAt(0)->AsArmDexCacheArraysBase(); + int32_t offset = cls->GetDexCacheElementOffset() - base->GetElementOffset(); + // /* GcRoot<mirror::Class> */ out = *(dex_cache_arrays_base + offset) + GenerateGcRootFieldLoad(cls, out_loc, base_reg, offset, read_barrier_option); + generate_null_check = !cls->IsInDexCache(); break; } case HLoadClass::LoadKind::kDexCacheViaMethod: { @@ -5054,7 +5367,7 @@ void InstructionCodeGeneratorARMVIXL::VisitLoadClass(HLoadClass* cls) { GetAssembler()->LoadFromOffset(kLoadWord, out, current_method, resolved_types_offset); // /* GcRoot<mirror::Class> */ out = out[type_index] size_t offset = CodeGenerator::GetCacheOffset(cls->GetTypeIndex().index_); - GenerateGcRootFieldLoad(cls, out_loc, out, offset, kEmitCompilerReadBarrier); + GenerateGcRootFieldLoad(cls, out_loc, out, offset, read_barrier_option); generate_null_check = !cls->IsInDexCache(); break; } @@ -5114,37 +5427,101 @@ void InstructionCodeGeneratorARMVIXL::GenerateClassInitializationCheck( __ Bind(slow_path->GetExitLabel()); } -// Check if the desired_string_load_kind is supported. If it is, return it, -// otherwise return a fall-back kind that should be used instead. HLoadString::LoadKind CodeGeneratorARMVIXL::GetSupportedLoadStringKind( - HLoadString::LoadKind desired_string_load_kind ATTRIBUTE_UNUSED) { - // TODO(VIXL): Implement optimized code paths. For now we always use the simpler fallback code. - return HLoadString::LoadKind::kDexCacheViaMethod; + HLoadString::LoadKind desired_string_load_kind) { + switch (desired_string_load_kind) { + case HLoadString::LoadKind::kBootImageLinkTimeAddress: + // TODO(VIXL): Implement missing optimization. + return HLoadString::LoadKind::kDexCacheViaMethod; + case HLoadString::LoadKind::kBootImageLinkTimePcRelative: + DCHECK(GetCompilerOptions().GetCompilePic()); + break; + case HLoadString::LoadKind::kBootImageAddress: + // TODO(VIXL): Implement missing optimization. + return HLoadString::LoadKind::kDexCacheViaMethod; + case HLoadString::LoadKind::kBssEntry: + DCHECK(!Runtime::Current()->UseJitCompilation()); + break; + case HLoadString::LoadKind::kJitTableAddress: + DCHECK(Runtime::Current()->UseJitCompilation()); + // TODO(VIXL): Implement missing optimization. + return HLoadString::LoadKind::kDexCacheViaMethod; + case HLoadString::LoadKind::kDexCacheViaMethod: + break; + } + return desired_string_load_kind; } void LocationsBuilderARMVIXL::VisitLoadString(HLoadString* load) { - LocationSummary::CallKind call_kind = load->NeedsEnvironment() - ? LocationSummary::kCallOnMainOnly - : LocationSummary::kNoCall; + LocationSummary::CallKind call_kind = CodeGenerator::GetLoadStringCallKind(load); LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(load, call_kind); - - // TODO(VIXL): Implement optimized code paths. - // See InstructionCodeGeneratorARMVIXL::VisitLoadString. HLoadString::LoadKind load_kind = load->GetLoadKind(); if (load_kind == HLoadString::LoadKind::kDexCacheViaMethod) { - locations->SetInAt(0, Location::RequiresRegister()); - // TODO(VIXL): Use InvokeRuntimeCallingConventionARMVIXL instead. locations->SetOut(LocationFrom(r0)); } else { locations->SetOut(Location::RequiresRegister()); + if (load_kind == HLoadString::LoadKind::kBssEntry) { + if (!kUseReadBarrier || kUseBakerReadBarrier) { + // Rely on the pResolveString and/or marking to save everything, including temps. + // Note that IP may theoretically be clobbered by saving/restoring the live register + // (only one thanks to the custom calling convention), so we request a different temp. + locations->AddTemp(Location::RequiresRegister()); + RegisterSet caller_saves = RegisterSet::Empty(); + InvokeRuntimeCallingConventionARMVIXL calling_convention; + caller_saves.Add(LocationFrom(calling_convention.GetRegisterAt(0))); + // TODO: Add GetReturnLocation() to the calling convention so that we can DCHECK() + // that the the kPrimNot result register is the same as the first argument register. + locations->SetCustomSlowPathCallerSaves(caller_saves); + } else { + // For non-Baker read barrier we have a temp-clobbering call. + } + } } } void InstructionCodeGeneratorARMVIXL::VisitLoadString(HLoadString* load) { - // TODO(VIXL): Implement optimized code paths. - // We implemented the simplest solution to get first ART tests passing, we deferred the - // optimized path until later, we should implement it using ARM64 implementation as a - // reference. The same related to LocationsBuilderARMVIXL::VisitLoadString. + LocationSummary* locations = load->GetLocations(); + Location out_loc = locations->Out(); + vixl32::Register out = OutputRegister(load); + HLoadString::LoadKind load_kind = load->GetLoadKind(); + + switch (load_kind) { + case HLoadString::LoadKind::kBootImageLinkTimeAddress: { + TODO_VIXL32(FATAL); + break; + } + case HLoadString::LoadKind::kBootImageLinkTimePcRelative: { + DCHECK(codegen_->GetCompilerOptions().IsBootImage()); + CodeGeneratorARMVIXL::PcRelativePatchInfo* labels = + codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex().index_); + codegen_->EmitMovwMovtPlaceholder(labels, out); + return; // No dex cache slow path. + } + case HLoadString::LoadKind::kBootImageAddress: { + TODO_VIXL32(FATAL); + break; + } + case HLoadString::LoadKind::kBssEntry: { + DCHECK(!codegen_->GetCompilerOptions().IsBootImage()); + vixl32::Register temp = RegisterFrom(locations->GetTemp(0)); + CodeGeneratorARMVIXL::PcRelativePatchInfo* labels = + codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex().index_); + codegen_->EmitMovwMovtPlaceholder(labels, temp); + GenerateGcRootFieldLoad(load, out_loc, temp, /* offset */ 0, kCompilerReadBarrierOption); + LoadStringSlowPathARMVIXL* slow_path = + new (GetGraph()->GetArena()) LoadStringSlowPathARMVIXL(load); + codegen_->AddSlowPath(slow_path); + __ CompareAndBranchIfZero(out, slow_path->GetEntryLabel()); + __ Bind(slow_path->GetExitLabel()); + return; + } + case HLoadString::LoadKind::kJitTableAddress: { + TODO_VIXL32(FATAL); + break; + } + default: + break; + } // TODO: Re-add the compiler code to do string dex cache lookup again. DCHECK_EQ(load->GetLoadKind(), HLoadString::LoadKind::kDexCacheViaMethod); @@ -5999,9 +6376,9 @@ void InstructionCodeGeneratorARMVIXL::GenerateGcRootFieldLoad( Location root, vixl32::Register obj, uint32_t offset, - bool requires_read_barrier) { + ReadBarrierOption read_barrier_option) { vixl32::Register root_reg = RegisterFrom(root); - if (requires_read_barrier) { + if (read_barrier_option == kWithReadBarrier) { TODO_VIXL32(FATAL); } else { // Plain GC root load with no read barrier. @@ -6062,15 +6439,51 @@ void CodeGeneratorARMVIXL::MaybeGenerateReadBarrierSlow(HInstruction* instructio // Check if the desired_dispatch_info is supported. If it is, return it, // otherwise return a fall-back info that should be used instead. HInvokeStaticOrDirect::DispatchInfo CodeGeneratorARMVIXL::GetSupportedInvokeStaticOrDirectDispatch( - const HInvokeStaticOrDirect::DispatchInfo& desired_dispatch_info ATTRIBUTE_UNUSED, - HInvokeStaticOrDirect* invoke ATTRIBUTE_UNUSED) { + const HInvokeStaticOrDirect::DispatchInfo& desired_dispatch_info, + HInvokeStaticOrDirect* invoke) { // TODO(VIXL): Implement optimized code paths. - return { - HInvokeStaticOrDirect::MethodLoadKind::kDexCacheViaMethod, - HInvokeStaticOrDirect::CodePtrLocation::kCallArtMethod, - 0u, - 0u - }; + if (desired_dispatch_info.method_load_kind == + HInvokeStaticOrDirect::MethodLoadKind::kDirectAddressWithFixup || + desired_dispatch_info.code_ptr_location == + HInvokeStaticOrDirect::CodePtrLocation::kCallDirectWithFixup) { + return { + HInvokeStaticOrDirect::MethodLoadKind::kDexCacheViaMethod, + HInvokeStaticOrDirect::CodePtrLocation::kCallArtMethod, + 0u, + 0u + }; + } + + HInvokeStaticOrDirect::DispatchInfo dispatch_info = desired_dispatch_info; + // We disable pc-relative load when there is an irreducible loop, as the optimization + // is incompatible with it. + // TODO: Create as many ArmDexCacheArraysBase instructions as needed for methods + // with irreducible loops. + if (GetGraph()->HasIrreducibleLoops() && + (dispatch_info.method_load_kind == + HInvokeStaticOrDirect::MethodLoadKind::kDexCachePcRelative)) { + dispatch_info.method_load_kind = HInvokeStaticOrDirect::MethodLoadKind::kDexCacheViaMethod; + } + + if (dispatch_info.code_ptr_location == HInvokeStaticOrDirect::CodePtrLocation::kCallPCRelative) { + const DexFile& outer_dex_file = GetGraph()->GetDexFile(); + if (&outer_dex_file != invoke->GetTargetMethod().dex_file) { + // Calls across dex files are more likely to exceed the available BL range, + // so use absolute patch with fixup if available and kCallArtMethod otherwise. + HInvokeStaticOrDirect::CodePtrLocation code_ptr_location = + (desired_dispatch_info.method_load_kind == + HInvokeStaticOrDirect::MethodLoadKind::kDirectAddressWithFixup) + ? HInvokeStaticOrDirect::CodePtrLocation::kCallDirectWithFixup + : HInvokeStaticOrDirect::CodePtrLocation::kCallArtMethod; + return HInvokeStaticOrDirect::DispatchInfo { + dispatch_info.method_load_kind, + code_ptr_location, + dispatch_info.method_load_data, + 0u + }; + } + } + return dispatch_info; } vixl32::Register CodeGeneratorARMVIXL::GetInvokeStaticOrDirectExtraParameter( @@ -6101,59 +6514,119 @@ vixl32::Register CodeGeneratorARMVIXL::GetInvokeStaticOrDirectExtraParameter( void CodeGeneratorARMVIXL::GenerateStaticOrDirectCall( HInvokeStaticOrDirect* invoke, Location temp) { - Location callee_method = temp; // For all kinds except kRecursive, callee will be in temp. - vixl32::Register temp_reg = RegisterFrom(temp); + // For better instruction scheduling we load the direct code pointer before the method pointer. + switch (invoke->GetCodePtrLocation()) { + case HInvokeStaticOrDirect::CodePtrLocation::kCallDirectWithFixup: + // LR = code address from literal pool with link-time patch. + TODO_VIXL32(FATAL); + break; + case HInvokeStaticOrDirect::CodePtrLocation::kCallDirect: + // LR = invoke->GetDirectCodePtr(); + __ Mov(lr, Operand::From(invoke->GetDirectCodePtr())); + break; + default: + break; + } + Location callee_method = temp; // For all kinds except kRecursive, callee will be in temp. switch (invoke->GetMethodLoadKind()) { case HInvokeStaticOrDirect::MethodLoadKind::kStringInit: { uint32_t offset = GetThreadOffset<kArmPointerSize>(invoke->GetStringInitEntryPoint()).Int32Value(); // temp = thread->string_init_entrypoint - GetAssembler()->LoadFromOffset(kLoadWord, temp_reg, tr, offset); + GetAssembler()->LoadFromOffset(kLoadWord, RegisterFrom(temp), tr, offset); + break; + } + case HInvokeStaticOrDirect::MethodLoadKind::kRecursive: + callee_method = invoke->GetLocations()->InAt(invoke->GetSpecialInputIndex()); + break; + case HInvokeStaticOrDirect::MethodLoadKind::kDirectAddress: + __ Mov(RegisterFrom(temp), Operand::From(invoke->GetMethodAddress())); + break; + case HInvokeStaticOrDirect::MethodLoadKind::kDirectAddressWithFixup: + TODO_VIXL32(FATAL); + break; + case HInvokeStaticOrDirect::MethodLoadKind::kDexCachePcRelative: { + HArmDexCacheArraysBase* base = + invoke->InputAt(invoke->GetSpecialInputIndex())->AsArmDexCacheArraysBase(); + vixl32::Register base_reg = GetInvokeStaticOrDirectExtraParameter(invoke, RegisterFrom(temp)); + int32_t offset = invoke->GetDexCacheArrayOffset() - base->GetElementOffset(); + GetAssembler()->LoadFromOffset(kLoadWord, RegisterFrom(temp), base_reg, offset); break; } case HInvokeStaticOrDirect::MethodLoadKind::kDexCacheViaMethod: { Location current_method = invoke->GetLocations()->InAt(invoke->GetSpecialInputIndex()); vixl32::Register method_reg; + vixl32::Register reg = RegisterFrom(temp); if (current_method.IsRegister()) { method_reg = RegisterFrom(current_method); } else { DCHECK(invoke->GetLocations()->Intrinsified()); DCHECK(!current_method.IsValid()); - method_reg = temp_reg; - GetAssembler()->LoadFromOffset(kLoadWord, temp_reg, sp, kCurrentMethodStackOffset); + method_reg = reg; + GetAssembler()->LoadFromOffset(kLoadWord, reg, sp, kCurrentMethodStackOffset); } // /* ArtMethod*[] */ temp = temp.ptr_sized_fields_->dex_cache_resolved_methods_; GetAssembler()->LoadFromOffset( kLoadWord, - temp_reg, + reg, method_reg, ArtMethod::DexCacheResolvedMethodsOffset(kArmPointerSize).Int32Value()); // temp = temp[index_in_cache]; // Note: Don't use invoke->GetTargetMethod() as it may point to a different dex file. uint32_t index_in_cache = invoke->GetDexMethodIndex(); GetAssembler()->LoadFromOffset( - kLoadWord, temp_reg, temp_reg, CodeGenerator::GetCachePointerOffset(index_in_cache)); + kLoadWord, reg, reg, CodeGenerator::GetCachePointerOffset(index_in_cache)); break; } - default: - TODO_VIXL32(FATAL); } - // TODO(VIXL): Support `CodePtrLocation` values other than `kCallArtMethod`. - if (invoke->GetCodePtrLocation() != HInvokeStaticOrDirect::CodePtrLocation::kCallArtMethod) { - TODO_VIXL32(FATAL); + switch (invoke->GetCodePtrLocation()) { + case HInvokeStaticOrDirect::CodePtrLocation::kCallSelf: + __ Bl(GetFrameEntryLabel()); + break; + case HInvokeStaticOrDirect::CodePtrLocation::kCallPCRelative: + relative_call_patches_.emplace_back(*invoke->GetTargetMethod().dex_file, + invoke->GetTargetMethod().dex_method_index); + { + AssemblerAccurateScope aas(GetVIXLAssembler(), + vixl32::kMaxInstructionSizeInBytes, + CodeBufferCheckScope::kMaximumSize); + __ bind(&relative_call_patches_.back().label); + // Arbitrarily branch to the BL itself, override at link time. + __ bl(&relative_call_patches_.back().label); + } + break; + case HInvokeStaticOrDirect::CodePtrLocation::kCallDirectWithFixup: + case HInvokeStaticOrDirect::CodePtrLocation::kCallDirect: + // LR prepared above for better instruction scheduling. + // LR() + { + // blx in T32 has only 16bit encoding that's why a stricter check for the scope is used. + AssemblerAccurateScope aas(GetVIXLAssembler(), + vixl32::k16BitT32InstructionSizeInBytes, + CodeBufferCheckScope::kExactSize); + __ blx(lr); + } + break; + case HInvokeStaticOrDirect::CodePtrLocation::kCallArtMethod: + // LR = callee_method->entry_point_from_quick_compiled_code_ + GetAssembler()->LoadFromOffset( + kLoadWord, + lr, + RegisterFrom(callee_method), + ArtMethod::EntryPointFromQuickCompiledCodeOffset(kArmPointerSize).Int32Value()); + { + // blx in T32 has only 16bit encoding that's why a stricter check for the scope is used. + AssemblerAccurateScope aas(GetVIXLAssembler(), + vixl32::k16BitT32InstructionSizeInBytes, + CodeBufferCheckScope::kExactSize); + // LR() + __ blx(lr); + } + break; } - // LR = callee_method->entry_point_from_quick_compiled_code_ - GetAssembler()->LoadFromOffset( - kLoadWord, - lr, - RegisterFrom(callee_method), - ArtMethod::EntryPointFromQuickCompiledCodeOffset(kArmPointerSize).Int32Value()); - // LR() - __ Blx(lr); - DCHECK(!IsLeafMethod()); } @@ -6169,9 +6642,15 @@ void CodeGeneratorARMVIXL::GenerateVirtualCall(HInvokeVirtual* invoke, Location InvokeDexCallingConventionARMVIXL calling_convention; vixl32::Register receiver = calling_convention.GetRegisterAt(0); uint32_t class_offset = mirror::Object::ClassOffset().Int32Value(); - // /* HeapReference<Class> */ temp = receiver->klass_ - GetAssembler()->LoadFromOffset(kLoadWord, temp, receiver, class_offset); - MaybeRecordImplicitNullCheck(invoke); + { + // Make sure the pc is recorded immediately after the `ldr` instruction. + AssemblerAccurateScope aas(GetVIXLAssembler(), + vixl32::kMaxInstructionSizeInBytes, + CodeBufferCheckScope::kMaximumSize); + // /* HeapReference<Class> */ temp = receiver->klass_ + __ ldr(temp, MemOperand(receiver, class_offset)); + MaybeRecordImplicitNullCheck(invoke); + } // Instead of simply (possibly) unpoisoning `temp` here, we should // emit a read barrier for the previous class reference load. // However this is not required in practice, as this is an @@ -6188,7 +6667,81 @@ void CodeGeneratorARMVIXL::GenerateVirtualCall(HInvokeVirtual* invoke, Location // LR = temp->GetEntryPoint(); GetAssembler()->LoadFromOffset(kLoadWord, lr, temp, entry_point); // LR(); - __ Blx(lr); + // This `blx` *must* be the *last* instruction generated by this stub, so that calls to + // `RecordPcInfo()` immediately following record the correct pc. Use a scope to help guarantee + // that. + // blx in T32 has only 16bit encoding that's why a stricter check for the scope is used. + AssemblerAccurateScope aas(GetVIXLAssembler(), + vixl32::k16BitT32InstructionSizeInBytes, + CodeBufferCheckScope::kExactSize); + __ blx(lr); +} + +CodeGeneratorARMVIXL::PcRelativePatchInfo* CodeGeneratorARMVIXL::NewPcRelativeStringPatch( + const DexFile& dex_file, uint32_t string_index) { + return NewPcRelativePatch(dex_file, string_index, &pc_relative_string_patches_); +} + +CodeGeneratorARMVIXL::PcRelativePatchInfo* CodeGeneratorARMVIXL::NewPcRelativeTypePatch( + const DexFile& dex_file, dex::TypeIndex type_index) { + return NewPcRelativePatch(dex_file, type_index.index_, &pc_relative_type_patches_); +} + +CodeGeneratorARMVIXL::PcRelativePatchInfo* CodeGeneratorARMVIXL::NewPcRelativeDexCacheArrayPatch( + const DexFile& dex_file, uint32_t element_offset) { + return NewPcRelativePatch(dex_file, element_offset, &pc_relative_dex_cache_patches_); +} + +CodeGeneratorARMVIXL::PcRelativePatchInfo* CodeGeneratorARMVIXL::NewPcRelativePatch( + const DexFile& dex_file, uint32_t offset_or_index, ArenaDeque<PcRelativePatchInfo>* patches) { + patches->emplace_back(dex_file, offset_or_index); + return &patches->back(); +} + +template <LinkerPatch (*Factory)(size_t, const DexFile*, uint32_t, uint32_t)> +inline void CodeGeneratorARMVIXL::EmitPcRelativeLinkerPatches( + const ArenaDeque<PcRelativePatchInfo>& infos, + ArenaVector<LinkerPatch>* linker_patches) { + for (const PcRelativePatchInfo& info : infos) { + const DexFile& dex_file = info.target_dex_file; + size_t offset_or_index = info.offset_or_index; + DCHECK(info.add_pc_label.IsBound()); + uint32_t add_pc_offset = dchecked_integral_cast<uint32_t>(info.add_pc_label.GetLocation()); + // Add MOVW patch. + DCHECK(info.movw_label.IsBound()); + uint32_t movw_offset = dchecked_integral_cast<uint32_t>(info.movw_label.GetLocation()); + linker_patches->push_back(Factory(movw_offset, &dex_file, add_pc_offset, offset_or_index)); + // Add MOVT patch. + DCHECK(info.movt_label.IsBound()); + uint32_t movt_offset = dchecked_integral_cast<uint32_t>(info.movt_label.GetLocation()); + linker_patches->push_back(Factory(movt_offset, &dex_file, add_pc_offset, offset_or_index)); + } +} + +void CodeGeneratorARMVIXL::EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_patches) { + DCHECK(linker_patches->empty()); + size_t size = + relative_call_patches_.size() + + /* MOVW+MOVT for each entry */ 2u * pc_relative_dex_cache_patches_.size() + + /* MOVW+MOVT for each entry */ 2u * pc_relative_string_patches_.size() + + /* MOVW+MOVT for each entry */ 2u * pc_relative_type_patches_.size(); + linker_patches->reserve(size); + for (const PatchInfo<vixl32::Label>& info : relative_call_patches_) { + uint32_t literal_offset = info.label.GetLocation(); + linker_patches->push_back( + LinkerPatch::RelativeCodePatch(literal_offset, &info.dex_file, info.index)); + } + EmitPcRelativeLinkerPatches<LinkerPatch::DexCacheArrayPatch>(pc_relative_dex_cache_patches_, + linker_patches); + if (!GetCompilerOptions().IsBootImage()) { + EmitPcRelativeLinkerPatches<LinkerPatch::StringBssEntryPatch>(pc_relative_string_patches_, + linker_patches); + } else { + EmitPcRelativeLinkerPatches<LinkerPatch::RelativeStringPatch>(pc_relative_string_patches_, + linker_patches); + } + EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(pc_relative_type_patches_, + linker_patches); } void LocationsBuilderARMVIXL::VisitMultiplyAccumulate(HMultiplyAccumulate* instr) { @@ -6315,6 +6868,17 @@ void InstructionCodeGeneratorARMVIXL::VisitPackedSwitch(HPackedSwitch* switch_in jump_table->EmitTable(codegen_); } } +void LocationsBuilderARMVIXL::VisitArmDexCacheArraysBase(HArmDexCacheArraysBase* base) { + LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(base); + locations->SetOut(Location::RequiresRegister()); +} + +void InstructionCodeGeneratorARMVIXL::VisitArmDexCacheArraysBase(HArmDexCacheArraysBase* base) { + vixl32::Register base_reg = OutputRegister(base); + CodeGeneratorARMVIXL::PcRelativePatchInfo* labels = + codegen_->NewPcRelativeDexCacheArrayPatch(base->GetDexFile(), base->GetElementOffset()); + codegen_->EmitMovwMovtPlaceholder(labels, base_reg); +} // Copy the result of a call into the given target. void CodeGeneratorARMVIXL::MoveFromReturnRegister(Location trg, Primitive::Type type) { @@ -6325,7 +6889,7 @@ void CodeGeneratorARMVIXL::MoveFromReturnRegister(Location trg, Primitive::Type DCHECK_NE(type, Primitive::kPrimVoid); - Location return_loc = InvokeDexCallingConventionVisitorARM().GetReturnLocation(type); + Location return_loc = InvokeDexCallingConventionVisitorARMVIXL().GetReturnLocation(type); if (return_loc.Equals(trg)) { return; } @@ -6373,6 +6937,21 @@ void InstructionCodeGeneratorARMVIXL::VisitClassTableGet(HClassTableGet* instruc } } +void CodeGeneratorARMVIXL::EmitMovwMovtPlaceholder( + CodeGeneratorARMVIXL::PcRelativePatchInfo* labels, + vixl32::Register out) { + AssemblerAccurateScope aas(GetVIXLAssembler(), + 3 * vixl32::kMaxInstructionSizeInBytes, + CodeBufferCheckScope::kMaximumSize); + // TODO(VIXL): Think about using mov instead of movw. + __ bind(&labels->movw_label); + __ movw(out, /* placeholder */ 0u); + __ bind(&labels->movt_label); + __ movt(out, /* placeholder */ 0u); + __ bind(&labels->add_pc_label); + __ add(out, out, pc); +} + #undef __ #undef QUICK_ENTRY_POINT #undef TODO_VIXL32 diff --git a/compiler/optimizing/code_generator_arm_vixl.h b/compiler/optimizing/code_generator_arm_vixl.h index bd91127121..b7ba8ddf0d 100644 --- a/compiler/optimizing/code_generator_arm_vixl.h +++ b/compiler/optimizing/code_generator_arm_vixl.h @@ -17,9 +17,15 @@ #ifndef ART_COMPILER_OPTIMIZING_CODE_GENERATOR_ARM_VIXL_H_ #define ART_COMPILER_OPTIMIZING_CODE_GENERATOR_ARM_VIXL_H_ -#include "code_generator_arm.h" +#include "base/enums.h" +#include "code_generator.h" #include "common_arm.h" +#include "driver/compiler_options.h" +#include "nodes.h" +#include "string_reference.h" +#include "parallel_move_resolver.h" #include "utils/arm/assembler_arm_vixl.h" +#include "utils/type_reference.h" // TODO(VIXL): make vixl clean wrt -Wshadow. #pragma GCC diagnostic push @@ -44,7 +50,7 @@ static const vixl::aarch32::Register kParameterCoreRegistersVIXL[] = { vixl::aarch32::r2, vixl::aarch32::r3 }; -static const size_t kParameterCoreRegistersLengthVIXL = arraysize(kParameterCoreRegisters); +static const size_t kParameterCoreRegistersLengthVIXL = arraysize(kParameterCoreRegistersVIXL); static const vixl::aarch32::SRegister kParameterFpuRegistersVIXL[] = { vixl::aarch32::s0, vixl::aarch32::s1, @@ -63,7 +69,7 @@ static const vixl::aarch32::SRegister kParameterFpuRegistersVIXL[] = { vixl::aarch32::s14, vixl::aarch32::s15 }; -static const size_t kParameterFpuRegistersLengthVIXL = arraysize(kParameterFpuRegisters); +static const size_t kParameterFpuRegistersLengthVIXL = arraysize(kParameterFpuRegistersVIXL); static const vixl::aarch32::Register kMethodRegister = vixl::aarch32::r0; @@ -90,7 +96,7 @@ static const vixl::aarch32::Register kRuntimeParameterCoreRegistersVIXL[] = { vixl::aarch32::r3 }; static const size_t kRuntimeParameterCoreRegistersLengthVIXL = - arraysize(kRuntimeParameterCoreRegisters); + arraysize(kRuntimeParameterCoreRegistersVIXL); static const vixl::aarch32::SRegister kRuntimeParameterFpuRegistersVIXL[] = { vixl::aarch32::s0, vixl::aarch32::s1, @@ -98,98 +104,10 @@ static const vixl::aarch32::SRegister kRuntimeParameterFpuRegistersVIXL[] = { vixl::aarch32::s3 }; static const size_t kRuntimeParameterFpuRegistersLengthVIXL = - arraysize(kRuntimeParameterFpuRegisters); + arraysize(kRuntimeParameterFpuRegistersVIXL); class LoadClassSlowPathARMVIXL; -#define FOR_EACH_IMPLEMENTED_INSTRUCTION(M) \ - M(Above) \ - M(AboveOrEqual) \ - M(Add) \ - M(And) \ - M(ArrayGet) \ - M(ArrayLength) \ - M(ArraySet) \ - M(Below) \ - M(BelowOrEqual) \ - M(BitwiseNegatedRight) \ - M(BooleanNot) \ - M(BoundsCheck) \ - M(BoundType) \ - M(CheckCast) \ - M(ClassTableGet) \ - M(ClearException) \ - M(ClinitCheck) \ - M(Compare) \ - M(CurrentMethod) \ - M(Deoptimize) \ - M(Div) \ - M(DivZeroCheck) \ - M(DoubleConstant) \ - M(Equal) \ - M(Exit) \ - M(FloatConstant) \ - M(Goto) \ - M(GreaterThan) \ - M(GreaterThanOrEqual) \ - M(If) \ - M(InstanceFieldGet) \ - M(InstanceFieldSet) \ - M(InstanceOf) \ - M(IntConstant) \ - M(IntermediateAddress) \ - M(InvokeInterface) \ - M(InvokeStaticOrDirect) \ - M(InvokeUnresolved) \ - M(InvokeVirtual) \ - M(LessThan) \ - M(LessThanOrEqual) \ - M(LoadClass) \ - M(LoadException) \ - M(LoadString) \ - M(LongConstant) \ - M(MemoryBarrier) \ - M(MonitorOperation) \ - M(Mul) \ - M(MultiplyAccumulate) \ - M(NativeDebugInfo) \ - M(Neg) \ - M(NewArray) \ - M(NewInstance) \ - M(Not) \ - M(NotEqual) \ - M(NullCheck) \ - M(NullConstant) \ - M(Or) \ - M(PackedSwitch) \ - M(ParallelMove) \ - M(ParameterValue) \ - M(Phi) \ - M(Rem) \ - M(Return) \ - M(ReturnVoid) \ - M(Ror) \ - M(Select) \ - M(Shl) \ - M(Shr) \ - M(StaticFieldGet) \ - M(StaticFieldSet) \ - M(Sub) \ - M(SuspendCheck) \ - M(Throw) \ - M(TryBoundary) \ - M(TypeConversion) \ - M(UnresolvedInstanceFieldGet) \ - M(UnresolvedInstanceFieldSet) \ - M(UnresolvedStaticFieldGet) \ - M(UnresolvedStaticFieldSet) \ - M(UShr) \ - M(Xor) \ - -// TODO: Remove once the VIXL32 backend is implemented completely. -#define FOR_EACH_UNIMPLEMENTED_INSTRUCTION(M) \ - M(ArmDexCacheArraysBase) \ - class CodeGeneratorARMVIXL; class JumpTableARMVIXL : public DeletableArenaObject<kArenaAllocSwitchTable> { @@ -248,6 +166,22 @@ class InvokeDexCallingConventionARMVIXL DISALLOW_COPY_AND_ASSIGN(InvokeDexCallingConventionARMVIXL); }; +class InvokeDexCallingConventionVisitorARMVIXL : public InvokeDexCallingConventionVisitor { + public: + InvokeDexCallingConventionVisitorARMVIXL() {} + virtual ~InvokeDexCallingConventionVisitorARMVIXL() {} + + Location GetNextLocation(Primitive::Type type) OVERRIDE; + Location GetReturnLocation(Primitive::Type type) const OVERRIDE; + Location GetMethodLocation() const OVERRIDE; + + private: + InvokeDexCallingConventionARMVIXL calling_convention; + uint32_t double_index_ = 0; + + DISALLOW_COPY_AND_ASSIGN(InvokeDexCallingConventionVisitorARMVIXL); +}; + class FieldAccessCallingConventionARMVIXL : public FieldAccessCallingConvention { public: FieldAccessCallingConventionARMVIXL() {} @@ -319,27 +253,26 @@ class ParallelMoveResolverARMVIXL : public ParallelMoveResolverWithSwap { DISALLOW_COPY_AND_ASSIGN(ParallelMoveResolverARMVIXL); }; -#define DEFINE_IMPLEMENTED_INSTRUCTION_VISITOR(Name) \ - void Visit##Name(H##Name*) OVERRIDE; - -#define DEFINE_UNIMPLEMENTED_INSTRUCTION_VISITOR(Name) \ - void Visit##Name(H##Name* instr) OVERRIDE { \ - VisitUnimplemementedInstruction(instr); } - class LocationsBuilderARMVIXL : public HGraphVisitor { public: LocationsBuilderARMVIXL(HGraph* graph, CodeGeneratorARMVIXL* codegen) : HGraphVisitor(graph), codegen_(codegen) {} - FOR_EACH_IMPLEMENTED_INSTRUCTION(DEFINE_IMPLEMENTED_INSTRUCTION_VISITOR) +#define DECLARE_VISIT_INSTRUCTION(name, super) \ + void Visit##name(H##name* instr) OVERRIDE; - FOR_EACH_UNIMPLEMENTED_INSTRUCTION(DEFINE_UNIMPLEMENTED_INSTRUCTION_VISITOR) + FOR_EACH_CONCRETE_INSTRUCTION_COMMON(DECLARE_VISIT_INSTRUCTION) + FOR_EACH_CONCRETE_INSTRUCTION_ARM(DECLARE_VISIT_INSTRUCTION) + FOR_EACH_CONCRETE_INSTRUCTION_SHARED(DECLARE_VISIT_INSTRUCTION) - private: - void VisitUnimplemementedInstruction(HInstruction* instruction) { - LOG(FATAL) << "Unimplemented Instruction: " << instruction->DebugName(); +#undef DECLARE_VISIT_INSTRUCTION + + void VisitInstruction(HInstruction* instruction) OVERRIDE { + LOG(FATAL) << "Unreachable instruction " << instruction->DebugName() + << " (id " << instruction->GetId() << ")"; } + private: void HandleInvoke(HInvoke* invoke); void HandleBitwiseOperation(HBinaryOperation* operation, Opcode opcode); void HandleCondition(HCondition* condition); @@ -355,7 +288,7 @@ class LocationsBuilderARMVIXL : public HGraphVisitor { bool CanEncodeConstantAsImmediate(uint32_t value, Opcode opcode, SetCc set_cc = kCcDontCare); CodeGeneratorARMVIXL* const codegen_; - InvokeDexCallingConventionVisitorARM parameter_visitor_; + InvokeDexCallingConventionVisitorARMVIXL parameter_visitor_; DISALLOW_COPY_AND_ASSIGN(LocationsBuilderARMVIXL); }; @@ -364,25 +297,30 @@ class InstructionCodeGeneratorARMVIXL : public InstructionCodeGenerator { public: InstructionCodeGeneratorARMVIXL(HGraph* graph, CodeGeneratorARMVIXL* codegen); - FOR_EACH_IMPLEMENTED_INSTRUCTION(DEFINE_IMPLEMENTED_INSTRUCTION_VISITOR) +#define DECLARE_VISIT_INSTRUCTION(name, super) \ + void Visit##name(H##name* instr) OVERRIDE; - FOR_EACH_UNIMPLEMENTED_INSTRUCTION(DEFINE_UNIMPLEMENTED_INSTRUCTION_VISITOR) + FOR_EACH_CONCRETE_INSTRUCTION_COMMON(DECLARE_VISIT_INSTRUCTION) + FOR_EACH_CONCRETE_INSTRUCTION_ARM(DECLARE_VISIT_INSTRUCTION) + FOR_EACH_CONCRETE_INSTRUCTION_SHARED(DECLARE_VISIT_INSTRUCTION) + +#undef DECLARE_VISIT_INSTRUCTION + + void VisitInstruction(HInstruction* instruction) OVERRIDE { + LOG(FATAL) << "Unreachable instruction " << instruction->DebugName() + << " (id " << instruction->GetId() << ")"; + } ArmVIXLAssembler* GetAssembler() const { return assembler_; } ArmVIXLMacroAssembler* GetVIXLAssembler() { return GetAssembler()->GetVIXLAssembler(); } private: - void VisitUnimplemementedInstruction(HInstruction* instruction) { - LOG(FATAL) << "Unimplemented Instruction: " << instruction->DebugName(); - } - // Generate code for the given suspend check. If not null, `successor` // is the block to branch to if the suspend check is not needed, and after // the suspend call. void GenerateSuspendCheck(HSuspendCheck* instruction, HBasicBlock* successor); void GenerateClassInitializationCheck(LoadClassSlowPathARMVIXL* slow_path, vixl32::Register class_reg); - void HandleGoto(HInstruction* got, HBasicBlock* successor); void GenerateAndConst(vixl::aarch32::Register out, vixl::aarch32::Register first, uint32_t value); void GenerateOrrConst(vixl::aarch32::Register out, vixl::aarch32::Register first, uint32_t value); void GenerateEorConst(vixl::aarch32::Register out, vixl::aarch32::Register first, uint32_t value); @@ -440,17 +378,16 @@ class InstructionCodeGeneratorARMVIXL : public InstructionCodeGenerator { uint32_t offset, Location maybe_temp, ReadBarrierOption read_barrier_option); - // Generate a GC root reference load: // // root <- *(obj + offset) // - // while honoring read barriers if `requires_read_barrier` is true. + // while honoring read barriers based on read_barrier_option. void GenerateGcRootFieldLoad(HInstruction* instruction, Location root, vixl::aarch32::Register obj, uint32_t offset, - bool requires_read_barrier); + ReadBarrierOption read_barrier_option); void GenerateTestAndBranch(HInstruction* instruction, size_t condition_input_index, vixl::aarch32::Label* true_target, @@ -470,6 +407,7 @@ class InstructionCodeGeneratorARMVIXL : public InstructionCodeGenerator { void DivRemByPowerOfTwo(HBinaryOperation* instruction); void GenerateDivRemWithAnyConstant(HBinaryOperation* instruction); void GenerateDivRemConstantIntegral(HBinaryOperation* instruction); + void HandleGoto(HInstruction* got, HBasicBlock* successor); ArmVIXLAssembler* const assembler_; CodeGeneratorARMVIXL* const codegen_; @@ -483,62 +421,50 @@ class CodeGeneratorARMVIXL : public CodeGenerator { const ArmInstructionSetFeatures& isa_features, const CompilerOptions& compiler_options, OptimizingCompilerStats* stats = nullptr); - virtual ~CodeGeneratorARMVIXL() {} - void Initialize() OVERRIDE { - block_labels_.resize(GetGraph()->GetBlocks().size()); - } - void GenerateFrameEntry() OVERRIDE; void GenerateFrameExit() OVERRIDE; - void Bind(HBasicBlock* block) OVERRIDE; - - vixl::aarch32::Label* GetLabelOf(HBasicBlock* block) { - block = FirstNonEmptyBlock(block); - return &(block_labels_[block->GetBlockId()]); - } - void MoveConstant(Location destination, int32_t value) OVERRIDE; void MoveLocation(Location dst, Location src, Primitive::Type dst_type) OVERRIDE; void AddLocationAsTemp(Location location, LocationSummary* locations) OVERRIDE; + size_t SaveCoreRegister(size_t stack_index, uint32_t reg_id) OVERRIDE; + size_t RestoreCoreRegister(size_t stack_index, uint32_t reg_id) OVERRIDE; + size_t SaveFloatingPointRegister(size_t stack_index, uint32_t reg_id) OVERRIDE; + size_t RestoreFloatingPointRegister(size_t stack_index, uint32_t reg_id) OVERRIDE; + + size_t GetWordSize() const OVERRIDE { + return static_cast<size_t>(kArmPointerSize); + } + + size_t GetFloatingPointSpillSlotSize() const OVERRIDE { return vixl::aarch32::kRegSizeInBytes; } + + HGraphVisitor* GetLocationBuilder() OVERRIDE { return &location_builder_; } + + HGraphVisitor* GetInstructionVisitor() OVERRIDE { return &instruction_visitor_; } + ArmVIXLAssembler* GetAssembler() OVERRIDE { return &assembler_; } const ArmVIXLAssembler& GetAssembler() const OVERRIDE { return assembler_; } ArmVIXLMacroAssembler* GetVIXLAssembler() { return GetAssembler()->GetVIXLAssembler(); } - size_t GetWordSize() const OVERRIDE { return kArmWordSize; } - - size_t GetFloatingPointSpillSlotSize() const OVERRIDE { return vixl::aarch32::kRegSizeInBytes; } - uintptr_t GetAddressOf(HBasicBlock* block) OVERRIDE { vixl::aarch32::Label* block_entry_label = GetLabelOf(block); DCHECK(block_entry_label->IsBound()); return block_entry_label->GetLocation(); } - JumpTableARMVIXL* CreateJumpTable(HPackedSwitch* switch_instr) { - jump_tables_.emplace_back(new (GetGraph()->GetArena()) JumpTableARMVIXL(switch_instr)); - return jump_tables_.back().get(); - } - - HGraphVisitor* GetLocationBuilder() OVERRIDE { return &location_builder_; } - - HGraphVisitor* GetInstructionVisitor() OVERRIDE { return &instruction_visitor_; } - void FixJumpTables(); - void GenerateMemoryBarrier(MemBarrierKind kind); - void Finalize(CodeAllocator* allocator) OVERRIDE; void SetupBlockedRegisters() const OVERRIDE; void DumpCoreRegister(std::ostream& stream, int reg) const OVERRIDE; void DumpFloatingPointRegister(std::ostream& stream, int reg) const OVERRIDE; + ParallelMoveResolver* GetMoveResolver() OVERRIDE { return &move_resolver_; } InstructionSet GetInstructionSet() const OVERRIDE { return InstructionSet::kThumb2; } - // Helper method to move a 32-bit value between two locations. void Move32(Location destination, Location source); @@ -553,31 +479,39 @@ class CodeGeneratorARMVIXL : public CodeGenerator { vixl::aarch32::Register reg_index, vixl::aarch32::Condition cond = vixl::aarch32::al); - const ArmInstructionSetFeatures& GetInstructionSetFeatures() const { return isa_features_; } + // Generate code to invoke a runtime entry point. + void InvokeRuntime(QuickEntrypointEnum entrypoint, + HInstruction* instruction, + uint32_t dex_pc, + SlowPathCode* slow_path = nullptr) OVERRIDE; - vixl::aarch32::Label* GetFrameEntryLabel() { return &frame_entry_label_; } + // Generate code to invoke a runtime entry point, but do not record + // PC-related information in a stack map. + void InvokeRuntimeWithoutRecordingPcInfo(int32_t entry_point_offset, + HInstruction* instruction, + SlowPathCode* slow_path); - // Saves the register in the stack. Returns the size taken on stack. - size_t SaveCoreRegister(size_t stack_index ATTRIBUTE_UNUSED, - uint32_t reg_id ATTRIBUTE_UNUSED) OVERRIDE { - UNIMPLEMENTED(INFO) << "TODO: SaveCoreRegister"; - return 0; - } + // Emit a write barrier. + void MarkGCCard(vixl::aarch32::Register temp, + vixl::aarch32::Register card, + vixl::aarch32::Register object, + vixl::aarch32::Register value, + bool can_be_null); + + void GenerateMemoryBarrier(MemBarrierKind kind); - // Restores the register from the stack. Returns the size taken on stack. - size_t RestoreCoreRegister(size_t stack_index ATTRIBUTE_UNUSED, - uint32_t reg_id ATTRIBUTE_UNUSED) OVERRIDE { - UNIMPLEMENTED(INFO) << "TODO: RestoreCoreRegister"; - return 0; + vixl::aarch32::Label* GetLabelOf(HBasicBlock* block) { + block = FirstNonEmptyBlock(block); + return &(block_labels_[block->GetBlockId()]); } - size_t SaveFloatingPointRegister(size_t stack_index ATTRIBUTE_UNUSED, - uint32_t reg_id ATTRIBUTE_UNUSED) OVERRIDE { - UNIMPLEMENTED(INFO) << "TODO: SaveFloatingPointRegister"; - return 0; + void Initialize() OVERRIDE { + block_labels_.resize(GetGraph()->GetBlocks().size()); } - size_t RestoreFloatingPointRegister(size_t stack_index, uint32_t reg_id) OVERRIDE; + void Finalize(CodeAllocator* allocator) OVERRIDE; + + const ArmInstructionSetFeatures& GetInstructionSetFeatures() const { return isa_features_; } bool NeedsTwoRegisters(Primitive::Type type) const OVERRIDE { return type == Primitive::kPrimDouble || type == Primitive::kPrimLong; @@ -585,33 +519,54 @@ class CodeGeneratorARMVIXL : public CodeGenerator { void ComputeSpillMask() OVERRIDE; - void GenerateImplicitNullCheck(HNullCheck* null_check) OVERRIDE; - void GenerateExplicitNullCheck(HNullCheck* null_check) OVERRIDE; + vixl::aarch32::Label* GetFrameEntryLabel() { return &frame_entry_label_; } - ParallelMoveResolver* GetMoveResolver() OVERRIDE { - return &move_resolver_; - } + // Check if the desired_string_load_kind is supported. If it is, return it, + // otherwise return a fall-back kind that should be used instead. + HLoadString::LoadKind GetSupportedLoadStringKind( + HLoadString::LoadKind desired_string_load_kind) OVERRIDE; - // Generate code to invoke a runtime entry point. - void InvokeRuntime(QuickEntrypointEnum entrypoint, - HInstruction* instruction, - uint32_t dex_pc, - SlowPathCode* slow_path = nullptr) OVERRIDE; + // Check if the desired_class_load_kind is supported. If it is, return it, + // otherwise return a fall-back kind that should be used instead. + HLoadClass::LoadKind GetSupportedLoadClassKind( + HLoadClass::LoadKind desired_class_load_kind) OVERRIDE; - // Generate code to invoke a runtime entry point, but do not record - // PC-related information in a stack map. - void InvokeRuntimeWithoutRecordingPcInfo(int32_t entry_point_offset, - HInstruction* instruction, - SlowPathCode* slow_path); + // Check if the desired_dispatch_info is supported. If it is, return it, + // otherwise return a fall-back info that should be used instead. + HInvokeStaticOrDirect::DispatchInfo GetSupportedInvokeStaticOrDirectDispatch( + const HInvokeStaticOrDirect::DispatchInfo& desired_dispatch_info, + HInvokeStaticOrDirect* invoke) OVERRIDE; + + void GenerateStaticOrDirectCall(HInvokeStaticOrDirect* invoke, Location temp) OVERRIDE; + void GenerateVirtualCall(HInvokeVirtual* invoke, Location temp) OVERRIDE; - void GenerateInvokeRuntime(int32_t entry_point_offset); + void MoveFromReturnRegister(Location trg, Primitive::Type type) OVERRIDE; - // Emit a write barrier. - void MarkGCCard(vixl::aarch32::Register temp, - vixl::aarch32::Register card, - vixl::aarch32::Register object, - vixl::aarch32::Register value, - bool can_be_null); + // The PcRelativePatchInfo is used for PC-relative addressing of dex cache arrays + // and boot image strings/types. The only difference is the interpretation of the + // offset_or_index. The PC-relative address is loaded with three instructions, + // MOVW+MOVT to load the offset to base_reg and then ADD base_reg, PC. The offset + // is calculated from the ADD's effective PC, i.e. PC+4 on Thumb2. Though we + // currently emit these 3 instructions together, instruction scheduling could + // split this sequence apart, so we keep separate labels for each of them. + struct PcRelativePatchInfo { + PcRelativePatchInfo(const DexFile& dex_file, uint32_t off_or_idx) + : target_dex_file(dex_file), offset_or_index(off_or_idx) { } + PcRelativePatchInfo(PcRelativePatchInfo&& other) = default; + + const DexFile& target_dex_file; + // Either the dex cache array element offset or the string/type index. + uint32_t offset_or_index; + vixl::aarch32::Label movw_label; + vixl::aarch32::Label movt_label; + vixl::aarch32::Label add_pc_label; + }; + + PcRelativePatchInfo* NewPcRelativeStringPatch(const DexFile& dex_file, uint32_t string_index); + PcRelativePatchInfo* NewPcRelativeTypePatch(const DexFile& dex_file, dex::TypeIndex type_index); + PcRelativePatchInfo* NewPcRelativeDexCacheArrayPatch(const DexFile& dex_file, + uint32_t element_offset); + void EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_patches) OVERRIDE; // Fast path implementation of ReadBarrier::Barrier for a heap // reference field load when Baker's read barriers are used. @@ -679,33 +634,35 @@ class CodeGeneratorARMVIXL : public CodeGenerator { uint32_t offset, Location index = Location::NoLocation()); - // Check if the desired_string_load_kind is supported. If it is, return it, - // otherwise return a fall-back kind that should be used instead. - HLoadString::LoadKind GetSupportedLoadStringKind( - HLoadString::LoadKind desired_string_load_kind) OVERRIDE; - - // Check if the desired_class_load_kind is supported. If it is, return it, - // otherwise return a fall-back kind that should be used instead. - HLoadClass::LoadKind GetSupportedLoadClassKind( - HLoadClass::LoadKind desired_class_load_kind) OVERRIDE; - - // Check if the desired_dispatch_info is supported. If it is, return it, - // otherwise return a fall-back info that should be used instead. - HInvokeStaticOrDirect::DispatchInfo GetSupportedInvokeStaticOrDirectDispatch( - const HInvokeStaticOrDirect::DispatchInfo& desired_dispatch_info, - HInvokeStaticOrDirect* invoke) OVERRIDE; + void GenerateNop() OVERRIDE; - void GenerateStaticOrDirectCall(HInvokeStaticOrDirect* invoke, Location temp) OVERRIDE; - void GenerateVirtualCall(HInvokeVirtual* invoke, Location temp) OVERRIDE; + void GenerateImplicitNullCheck(HNullCheck* instruction) OVERRIDE; + void GenerateExplicitNullCheck(HNullCheck* instruction) OVERRIDE; - void MoveFromReturnRegister(Location trg, Primitive::Type type) OVERRIDE; + JumpTableARMVIXL* CreateJumpTable(HPackedSwitch* switch_instr) { + jump_tables_.emplace_back(new (GetGraph()->GetArena()) JumpTableARMVIXL(switch_instr)); + return jump_tables_.back().get(); + } + void EmitJumpTables(); - void GenerateNop() OVERRIDE; + void EmitMovwMovtPlaceholder(CodeGeneratorARMVIXL::PcRelativePatchInfo* labels, + vixl::aarch32::Register out); private: vixl::aarch32::Register GetInvokeStaticOrDirectExtraParameter(HInvokeStaticOrDirect* invoke, vixl::aarch32::Register temp); + using Uint32ToLiteralMap = ArenaSafeMap<uint32_t, vixl::aarch32::Literal<uint32_t>*>; + using MethodToLiteralMap = + ArenaSafeMap<MethodReference, vixl::aarch32::Literal<uint32_t>*, MethodReferenceComparator>; + + PcRelativePatchInfo* NewPcRelativePatch(const DexFile& dex_file, + uint32_t offset_or_index, + ArenaDeque<PcRelativePatchInfo>* patches); + template <LinkerPatch (*Factory)(size_t, const DexFile*, uint32_t, uint32_t)> + static void EmitPcRelativeLinkerPatches(const ArenaDeque<PcRelativePatchInfo>& infos, + ArenaVector<LinkerPatch>* linker_patches); + // Labels for each block that will be compiled. // We use a deque so that the `vixl::aarch32::Label` objects do not move in memory. ArenaDeque<vixl::aarch32::Label> block_labels_; // Indexed by block id. @@ -719,15 +676,19 @@ class CodeGeneratorARMVIXL : public CodeGenerator { ArmVIXLAssembler assembler_; const ArmInstructionSetFeatures& isa_features_; + // Relative call patch info. + // Using ArenaDeque<> which retains element addresses on push/emplace_back(). + ArenaDeque<PatchInfo<vixl::aarch32::Label>> relative_call_patches_; + // PC-relative patch info for each HArmDexCacheArraysBase. + ArenaDeque<PcRelativePatchInfo> pc_relative_dex_cache_patches_; + // PC-relative String patch info; type depends on configuration (app .bss or boot image PIC). + ArenaDeque<PcRelativePatchInfo> pc_relative_string_patches_; + // PC-relative type patch info. + ArenaDeque<PcRelativePatchInfo> pc_relative_type_patches_; + DISALLOW_COPY_AND_ASSIGN(CodeGeneratorARMVIXL); }; -#undef FOR_EACH_IMPLEMENTED_INSTRUCTION -#undef FOR_EACH_UNIMPLEMENTED_INSTRUCTION -#undef DEFINE_IMPLEMENTED_INSTRUCTION_VISITOR -#undef DEFINE_UNIMPLEMENTED_INSTRUCTION_VISITOR - - } // namespace arm } // namespace art diff --git a/compiler/optimizing/code_generator_mips.cc b/compiler/optimizing/code_generator_mips.cc index 572d900909..61dabfabaa 100644 --- a/compiler/optimizing/code_generator_mips.cc +++ b/compiler/optimizing/code_generator_mips.cc @@ -4688,6 +4688,16 @@ void InstructionCodeGeneratorMIPS::GenConditionalMoveR6(HSelect* select) { } } +void LocationsBuilderMIPS::VisitShouldDeoptimizeFlag( + HShouldDeoptimizeFlag* flag ATTRIBUTE_UNUSED) { + // TODO: to be implemented. +} + +void InstructionCodeGeneratorMIPS::VisitShouldDeoptimizeFlag( + HShouldDeoptimizeFlag* flag ATTRIBUTE_UNUSED) { + // TODO: to be implemented. +} + void LocationsBuilderMIPS::VisitSelect(HSelect* select) { LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(select); CanMoveConditionally(select, codegen_->GetInstructionSetFeatures().IsR6(), locations); diff --git a/compiler/optimizing/code_generator_mips64.cc b/compiler/optimizing/code_generator_mips64.cc index b5e98714e6..b1f9b1db53 100644 --- a/compiler/optimizing/code_generator_mips64.cc +++ b/compiler/optimizing/code_generator_mips64.cc @@ -2636,6 +2636,16 @@ void InstructionCodeGeneratorMIPS64::VisitDeoptimize(HDeoptimize* deoptimize) { /* false_target */ nullptr); } +void LocationsBuilderMIPS64::VisitShouldDeoptimizeFlag( + HShouldDeoptimizeFlag* flag ATTRIBUTE_UNUSED) { + // TODO: to be implemented. +} + +void InstructionCodeGeneratorMIPS64::VisitShouldDeoptimizeFlag( + HShouldDeoptimizeFlag* flag ATTRIBUTE_UNUSED) { + // TODO: to be implemented. +} + void LocationsBuilderMIPS64::VisitSelect(HSelect* select) { LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(select); if (Primitive::IsFloatingPointType(select->GetType())) { diff --git a/compiler/optimizing/code_generator_x86.cc b/compiler/optimizing/code_generator_x86.cc index 12aa03c4af..d6e92ccb81 100644 --- a/compiler/optimizing/code_generator_x86.cc +++ b/compiler/optimizing/code_generator_x86.cc @@ -1059,6 +1059,11 @@ void CodeGeneratorX86::GenerateFrameEntry() { } } + if (GetGraph()->HasShouldDeoptimizeFlag()) { + // Initialize should_deoptimize flag to 0. + __ movl(Address(ESP, -kShouldDeoptimizeFlagSize), Immediate(0)); + } + int adjust = GetFrameSize() - FrameEntrySpillSize(); __ subl(ESP, Immediate(adjust)); __ cfi().AdjustCFAOffset(adjust); @@ -1676,6 +1681,17 @@ void InstructionCodeGeneratorX86::VisitDeoptimize(HDeoptimize* deoptimize) { /* false_target */ nullptr); } +void LocationsBuilderX86::VisitShouldDeoptimizeFlag(HShouldDeoptimizeFlag* flag) { + LocationSummary* locations = new (GetGraph()->GetArena()) + LocationSummary(flag, LocationSummary::kNoCall); + locations->SetOut(Location::RequiresRegister()); +} + +void InstructionCodeGeneratorX86::VisitShouldDeoptimizeFlag(HShouldDeoptimizeFlag* flag) { + __ movl(flag->GetLocations()->Out().AsRegister<Register>(), + Address(ESP, codegen_->GetStackOffsetOfShouldDeoptimizeFlag())); +} + static bool SelectCanUseCMOV(HSelect* select) { // There are no conditional move instructions for XMMs. if (Primitive::IsFloatingPointType(select->GetType())) { diff --git a/compiler/optimizing/code_generator_x86_64.cc b/compiler/optimizing/code_generator_x86_64.cc index 22f7f6b52b..4474decf59 100644 --- a/compiler/optimizing/code_generator_x86_64.cc +++ b/compiler/optimizing/code_generator_x86_64.cc @@ -1326,6 +1326,12 @@ void CodeGeneratorX86_64::GenerateFrameEntry() { } } + if (GetGraph()->HasShouldDeoptimizeFlag()) { + // Initialize should_deoptimize flag to 0. + __ movl(Address(CpuRegister(RSP), xmm_spill_location - kShouldDeoptimizeFlagSize), + Immediate(0)); + } + // Save the current method if we need it. Note that we do not // do this in HCurrentMethod, as the instruction might have been removed // in the SSA graph. @@ -1747,6 +1753,17 @@ void InstructionCodeGeneratorX86_64::VisitDeoptimize(HDeoptimize* deoptimize) { /* false_target */ nullptr); } +void LocationsBuilderX86_64::VisitShouldDeoptimizeFlag(HShouldDeoptimizeFlag* flag) { + LocationSummary* locations = new (GetGraph()->GetArena()) + LocationSummary(flag, LocationSummary::kNoCall); + locations->SetOut(Location::RequiresRegister()); +} + +void InstructionCodeGeneratorX86_64::VisitShouldDeoptimizeFlag(HShouldDeoptimizeFlag* flag) { + __ movl(flag->GetLocations()->Out().AsRegister<CpuRegister>(), + Address(CpuRegister(RSP), codegen_->GetStackOffsetOfShouldDeoptimizeFlag())); +} + static bool SelectCanUseCMOV(HSelect* select) { // There are no conditional move instructions for XMMs. if (Primitive::IsFloatingPointType(select->GetType())) { diff --git a/compiler/optimizing/common_arm.h b/compiler/optimizing/common_arm.h index d3623f17d1..eabdbad13c 100644 --- a/compiler/optimizing/common_arm.h +++ b/compiler/optimizing/common_arm.h @@ -17,6 +17,11 @@ #ifndef ART_COMPILER_OPTIMIZING_COMMON_ARM_H_ #define ART_COMPILER_OPTIMIZING_COMMON_ARM_H_ +#include "debug/dwarf/register.h" +#include "locations.h" +#include "nodes.h" +#include "utils/arm/constants_arm.h" + // TODO(VIXL): Make VIXL compile with -Wshadow. #pragma GCC diagnostic push #pragma GCC diagnostic ignored "-Wshadow" diff --git a/compiler/optimizing/dex_cache_array_fixups_arm.cc b/compiler/optimizing/dex_cache_array_fixups_arm.cc index 82b81238ab..10a36c6ff4 100644 --- a/compiler/optimizing/dex_cache_array_fixups_arm.cc +++ b/compiler/optimizing/dex_cache_array_fixups_arm.cc @@ -17,12 +17,24 @@ #include "dex_cache_array_fixups_arm.h" #include "base/arena_containers.h" +#ifdef ART_USE_VIXL_ARM_BACKEND +#include "code_generator_arm_vixl.h" +#include "intrinsics_arm_vixl.h" +#else #include "code_generator_arm.h" #include "intrinsics_arm.h" +#endif #include "utils/dex_cache_arrays_layout-inl.h" namespace art { namespace arm { +#ifdef ART_USE_VIXL_ARM_BACKEND +typedef CodeGeneratorARMVIXL CodeGeneratorARMType; +typedef IntrinsicLocationsBuilderARMVIXL IntrinsicLocationsBuilderARMType; +#else +typedef CodeGeneratorARM CodeGeneratorARMType; +typedef IntrinsicLocationsBuilderARM IntrinsicLocationsBuilderARMType; +#endif /** * Finds instructions that need the dex cache arrays base as an input. @@ -31,7 +43,7 @@ class DexCacheArrayFixupsVisitor : public HGraphVisitor { public: DexCacheArrayFixupsVisitor(HGraph* graph, CodeGenerator* codegen) : HGraphVisitor(graph), - codegen_(down_cast<CodeGeneratorARM*>(codegen)), + codegen_(down_cast<CodeGeneratorARMType*>(codegen)), dex_cache_array_bases_(std::less<const DexFile*>(), // Attribute memory use to code generator. graph->GetArena()->Adapter(kArenaAllocCodeGenerator)) {} @@ -66,7 +78,7 @@ class DexCacheArrayFixupsVisitor : public HGraphVisitor { // If this is an invoke with PC-relative access to the dex cache methods array, // we need to add the dex cache arrays base as the special input. if (invoke->HasPcRelativeDexCache() && - !IsCallFreeIntrinsic<IntrinsicLocationsBuilderARM>(invoke, codegen_)) { + !IsCallFreeIntrinsic<IntrinsicLocationsBuilderARMType>(invoke, codegen_)) { HArmDexCacheArraysBase* base = GetOrCreateDexCacheArrayBase(invoke->GetDexFile()); // Update the element offset in base. DexCacheArraysLayout layout(kArmPointerSize, &invoke->GetDexFile()); @@ -94,7 +106,7 @@ class DexCacheArrayFixupsVisitor : public HGraphVisitor { return base; } - CodeGeneratorARM* codegen_; + CodeGeneratorARMType* codegen_; using DexCacheArraysBaseMap = ArenaSafeMap<const DexFile*, HArmDexCacheArraysBase*, std::less<const DexFile*>>; diff --git a/compiler/optimizing/graph_checker.cc b/compiler/optimizing/graph_checker.cc index c8cba205fd..188ee3a8d1 100644 --- a/compiler/optimizing/graph_checker.cc +++ b/compiler/optimizing/graph_checker.cc @@ -23,7 +23,6 @@ #include "base/arena_containers.h" #include "base/bit_vector-inl.h" #include "base/stringprintf.h" -#include "handle_scope-inl.h" namespace art { @@ -448,7 +447,6 @@ void GraphChecker::VisitInstruction(HInstruction* instruction) { // Ensure that reference type instructions have reference type info. if (instruction->GetType() == Primitive::kPrimNot) { - ScopedObjectAccess soa(Thread::Current()); if (!instruction->GetReferenceTypeInfo().IsValid()) { AddError(StringPrintf("Reference type instruction %s:%d does not have " "valid reference type information.", @@ -1011,7 +1009,6 @@ void GraphChecker::VisitConstant(HConstant* instruction) { void GraphChecker::VisitBoundType(HBoundType* instruction) { VisitInstruction(instruction); - ScopedObjectAccess soa(Thread::Current()); if (!instruction->GetUpperBound().IsValid()) { AddError(StringPrintf( "%s %d does not have a valid upper bound RTI.", diff --git a/compiler/optimizing/inliner.cc b/compiler/optimizing/inliner.cc index 01e89bb304..8d93867230 100644 --- a/compiler/optimizing/inliner.cc +++ b/compiler/optimizing/inliner.cc @@ -292,6 +292,21 @@ static bool IsPolymorphic(Handle<mirror::ObjectArray<mirror::Class>> classes) classes->Get(InlineCache::kIndividualCacheSize - 1) == nullptr; } +ArtMethod* HInliner::TryCHADevirtualization(ArtMethod* resolved_method) { + if (!resolved_method->HasSingleImplementation()) { + return nullptr; + } + if (Runtime::Current()->IsAotCompiler()) { + // No CHA-based devirtulization for AOT compiler (yet). + return nullptr; + } + if (outermost_graph_->IsCompilingOsr()) { + // We do not support HDeoptimize in OSR methods. + return nullptr; + } + return resolved_method->GetSingleImplementation(); +} + bool HInliner::TryInline(HInvoke* invoke_instruction) { if (invoke_instruction->IsInvokeUnresolved()) { return false; // Don't bother to move further if we know the method is unresolved. @@ -317,10 +332,29 @@ bool HInliner::TryInline(HInvoke* invoke_instruction) { actual_method = FindVirtualOrInterfaceTarget(invoke_instruction, resolved_method); } + bool cha_devirtualize = false; + if (actual_method == nullptr) { + ArtMethod* method = TryCHADevirtualization(resolved_method); + if (method != nullptr) { + cha_devirtualize = true; + actual_method = method; + } + } + if (actual_method != nullptr) { - bool result = TryInlineAndReplace(invoke_instruction, actual_method, /* do_rtp */ true); + bool result = TryInlineAndReplace(invoke_instruction, + actual_method, + /* do_rtp */ true, + cha_devirtualize); if (result && !invoke_instruction->IsInvokeStaticOrDirect()) { - MaybeRecordStat(kInlinedInvokeVirtualOrInterface); + if (cha_devirtualize) { + // Add dependency due to devirtulization. We've assumed resolved_method + // has single implementation. + outermost_graph_->AddCHASingleImplementationDependency(resolved_method); + MaybeRecordStat(kCHAInline); + } else { + MaybeRecordStat(kInlinedInvokeVirtualOrInterface); + } } return result; } @@ -438,7 +472,10 @@ bool HInliner::TryInlineMonomorphicCall(HInvoke* invoke_instruction, HInstruction* cursor = invoke_instruction->GetPrevious(); HBasicBlock* bb_cursor = invoke_instruction->GetBlock(); - if (!TryInlineAndReplace(invoke_instruction, resolved_method, /* do_rtp */ false)) { + if (!TryInlineAndReplace(invoke_instruction, + resolved_method, + /* do_rtp */ false, + /* cha_devirtualize */ false)) { return false; } @@ -465,6 +502,25 @@ bool HInliner::TryInlineMonomorphicCall(HInvoke* invoke_instruction, return true; } +void HInliner::AddCHAGuard(HInstruction* invoke_instruction, + uint32_t dex_pc, + HInstruction* cursor, + HBasicBlock* bb_cursor) { + HInstruction* deopt_flag = new (graph_->GetArena()) HShouldDeoptimizeFlag(dex_pc); + HInstruction* should_deopt = new (graph_->GetArena()) HNotEqual( + deopt_flag, graph_->GetIntConstant(0, dex_pc)); + HInstruction* deopt = new (graph_->GetArena()) HDeoptimize(should_deopt, dex_pc); + + if (cursor != nullptr) { + bb_cursor->InsertInstructionAfter(deopt_flag, cursor); + } else { + bb_cursor->InsertInstructionBefore(deopt_flag, bb_cursor->GetFirstInstruction()); + } + bb_cursor->InsertInstructionAfter(should_deopt, deopt_flag); + bb_cursor->InsertInstructionAfter(deopt, should_deopt); + deopt->CopyEnvironmentFrom(invoke_instruction->GetEnvironment()); +} + HInstruction* HInliner::AddTypeGuard(HInstruction* receiver, HInstruction* cursor, HBasicBlock* bb_cursor, @@ -787,8 +843,14 @@ bool HInliner::TryInlinePolymorphicCallToSameTarget( return true; } -bool HInliner::TryInlineAndReplace(HInvoke* invoke_instruction, ArtMethod* method, bool do_rtp) { +bool HInliner::TryInlineAndReplace(HInvoke* invoke_instruction, + ArtMethod* method, + bool do_rtp, + bool cha_devirtualize) { HInstruction* return_replacement = nullptr; + uint32_t dex_pc = invoke_instruction->GetDexPc(); + HInstruction* cursor = invoke_instruction->GetPrevious(); + HBasicBlock* bb_cursor = invoke_instruction->GetBlock(); if (!TryBuildAndInline(invoke_instruction, method, &return_replacement)) { if (invoke_instruction->IsInvokeInterface()) { // Turn an invoke-interface into an invoke-virtual. An invoke-virtual is always @@ -826,6 +888,9 @@ bool HInliner::TryInlineAndReplace(HInvoke* invoke_instruction, ArtMethod* metho return false; } } + if (cha_devirtualize) { + AddCHAGuard(invoke_instruction, dex_pc, cursor, bb_cursor); + } if (return_replacement != nullptr) { invoke_instruction->ReplaceWith(return_replacement); } diff --git a/compiler/optimizing/inliner.h b/compiler/optimizing/inliner.h index a2b4fc96c4..ffebd97cb8 100644 --- a/compiler/optimizing/inliner.h +++ b/compiler/optimizing/inliner.h @@ -62,8 +62,12 @@ class HInliner : public HOptimization { // Try to inline `resolved_method` in place of `invoke_instruction`. `do_rtp` is whether // reference type propagation can run after the inlining. If the inlining is successful, this - // method will replace and remove the `invoke_instruction`. - bool TryInlineAndReplace(HInvoke* invoke_instruction, ArtMethod* resolved_method, bool do_rtp) + // method will replace and remove the `invoke_instruction`. If `cha_devirtualize` is true, + // a CHA guard needs to be added for the inlining. + bool TryInlineAndReplace(HInvoke* invoke_instruction, + ArtMethod* resolved_method, + bool do_rtp, + bool cha_devirtualize) REQUIRES_SHARED(Locks::mutator_lock_); bool TryBuildAndInline(HInvoke* invoke_instruction, @@ -118,6 +122,18 @@ class HInliner : public HOptimization { Handle<mirror::ObjectArray<mirror::Class>> classes) REQUIRES_SHARED(Locks::mutator_lock_); + // Try CHA-based devirtualization to change virtual method calls into + // direct calls. + // Returns the actual method that resolved_method can be devirtualized to. + ArtMethod* TryCHADevirtualization(ArtMethod* resolved_method) + REQUIRES_SHARED(Locks::mutator_lock_); + + // Add a CHA guard for a CHA-based devirtualized call. A CHA guard checks a + // should_deoptimize flag and if it's true, does deoptimization. + void AddCHAGuard(HInstruction* invoke_instruction, + uint32_t dex_pc, + HInstruction* cursor, + HBasicBlock* bb_cursor); HInstanceFieldGet* BuildGetReceiverClass(ClassLinker* class_linker, HInstruction* receiver, diff --git a/compiler/optimizing/intrinsics_arm_vixl.cc b/compiler/optimizing/intrinsics_arm_vixl.cc index 9e724474d0..433dced9d7 100644 --- a/compiler/optimizing/intrinsics_arm_vixl.cc +++ b/compiler/optimizing/intrinsics_arm_vixl.cc @@ -71,7 +71,7 @@ class IntrinsicSlowPathARMVIXL : public SlowPathCodeARMVIXL { : SlowPathCodeARMVIXL(invoke), invoke_(invoke) {} Location MoveArguments(CodeGenerator* codegen) { - InvokeDexCallingConventionVisitorARM calling_convention_visitor; + InvokeDexCallingConventionVisitorARMVIXL calling_convention_visitor; IntrinsicVisitor::MoveArguments(invoke_, codegen, &calling_convention_visitor); return calling_convention_visitor.GetMethodLocation(); } diff --git a/compiler/optimizing/nodes.cc b/compiler/optimizing/nodes.cc index 680381a548..594255c625 100644 --- a/compiler/optimizing/nodes.cc +++ b/compiler/optimizing/nodes.cc @@ -2543,6 +2543,8 @@ std::ostream& operator<<(std::ostream& os, HLoadString::LoadKind rhs) { return os << "BssEntry"; case HLoadString::LoadKind::kDexCacheViaMethod: return os << "DexCacheViaMethod"; + case HLoadString::LoadKind::kJitTableAddress: + return os << "JitTableAddress"; default: LOG(FATAL) << "Unknown HLoadString::LoadKind: " << static_cast<int>(rhs); UNREACHABLE(); diff --git a/compiler/optimizing/nodes.h b/compiler/optimizing/nodes.h index 7ab04e15fc..e3f4d8f035 100644 --- a/compiler/optimizing/nodes.h +++ b/compiler/optimizing/nodes.h @@ -333,7 +333,8 @@ class HGraph : public ArenaObject<kArenaAllocGraph> { cached_double_constants_(std::less<int64_t>(), arena->Adapter(kArenaAllocConstantsMap)), cached_current_method_(nullptr), inexact_object_rti_(ReferenceTypeInfo::CreateInvalid()), - osr_(osr) { + osr_(osr), + cha_single_implementation_list_(arena->Adapter(kArenaAllocCHA)) { blocks_.reserve(kDefaultNumberOfBlocks); } @@ -536,6 +537,20 @@ class HGraph : public ArenaObject<kArenaAllocGraph> { bool IsCompilingOsr() const { return osr_; } + ArenaSet<ArtMethod*>& GetCHASingleImplementationList() { + return cha_single_implementation_list_; + } + + void AddCHASingleImplementationDependency(ArtMethod* method) { + cha_single_implementation_list_.insert(method); + } + + bool HasShouldDeoptimizeFlag() const { + // TODO: if all CHA guards can be eliminated, there is no need for the flag + // even if cha_single_implementation_list_ is not empty. + return !cha_single_implementation_list_.empty(); + } + bool HasTryCatch() const { return has_try_catch_; } void SetHasTryCatch(bool value) { has_try_catch_ = value; } @@ -672,6 +687,9 @@ class HGraph : public ArenaObject<kArenaAllocGraph> { // compiled code entries which the interpreter can directly jump to. const bool osr_; + // List of methods that are assumed to have single implementation. + ArenaSet<ArtMethod*> cha_single_implementation_list_; + friend class SsaBuilder; // For caching constants. friend class SsaLivenessAnalysis; // For the linear order. friend class HInliner; // For the reverse post order. @@ -1240,6 +1258,7 @@ class HLoopInformationOutwardIterator : public ValueObject { M(ClinitCheck, Instruction) \ M(Compare, BinaryOperation) \ M(CurrentMethod, Instruction) \ + M(ShouldDeoptimizeFlag, Instruction) \ M(Deoptimize, Instruction) \ M(Div, BinaryOperation) \ M(DivZeroCheck, Instruction) \ @@ -2875,6 +2894,27 @@ class HDeoptimize FINAL : public HTemplateInstruction<1> { DISALLOW_COPY_AND_ASSIGN(HDeoptimize); }; +// Represents a should_deoptimize flag. Currently used for CHA-based devirtualization. +// The compiled code checks this flag value in a guard before devirtualized call and +// if it's true, starts to do deoptimization. +// It has a 4-byte slot on stack. +// TODO: allocate a register for this flag. +class HShouldDeoptimizeFlag FINAL : public HExpression<0> { + public: + // TODO: use SideEffects to aid eliminating some CHA guards. + explicit HShouldDeoptimizeFlag(uint32_t dex_pc) + : HExpression(Primitive::kPrimInt, SideEffects::None(), dex_pc) { + } + + // We don't eliminate CHA guards yet. + bool CanBeMoved() const OVERRIDE { return false; } + + DECLARE_INSTRUCTION(ShouldDeoptimizeFlag); + + private: + DISALLOW_COPY_AND_ASSIGN(HShouldDeoptimizeFlag); +}; + // Represents the ArtMethod that was passed as a first argument to // the method. It is used by instructions that depend on it, like // instructions that work with the dex cache. diff --git a/compiler/optimizing/optimizing_compiler.cc b/compiler/optimizing/optimizing_compiler.cc index 2382b728df..8ea2b06530 100644 --- a/compiler/optimizing/optimizing_compiler.cc +++ b/compiler/optimizing/optimizing_compiler.cc @@ -630,10 +630,8 @@ void OptimizingCompiler::RunArchOptimizations(InstructionSet instruction_set, #if defined(ART_ENABLE_CODEGEN_arm) case kThumb2: case kArm: { -#ifndef ART_USE_VIXL_ARM_BACKEND arm::DexCacheArrayFixups* fixups = new (arena) arm::DexCacheArrayFixups(graph, codegen, stats); -#endif arm::InstructionSimplifierArm* simplifier = new (arena) arm::InstructionSimplifierArm(graph, stats); SideEffectsAnalysis* side_effects = new (arena) SideEffectsAnalysis(graph); @@ -642,9 +640,7 @@ void OptimizingCompiler::RunArchOptimizations(InstructionSet instruction_set, simplifier, side_effects, gvn, -#ifndef ART_USE_VIXL_ARM_BACKEND fixups -#endif }; RunOptimizations(arm_optimizations, arraysize(arm_optimizations), pass_observer); break; @@ -1208,7 +1204,9 @@ bool OptimizingCompiler::JitCompile(Thread* self, code_allocator.GetMemory().data(), code_allocator.GetSize(), osr, - roots); + roots, + codegen->GetGraph()->HasShouldDeoptimizeFlag(), + codegen->GetGraph()->GetCHASingleImplementationList()); if (code == nullptr) { code_cache->ClearData(self, stack_map_data, roots_data); diff --git a/compiler/optimizing/optimizing_compiler_stats.h b/compiler/optimizing/optimizing_compiler_stats.h index c8d1ce0bd5..203b1ec7ec 100644 --- a/compiler/optimizing/optimizing_compiler_stats.h +++ b/compiler/optimizing/optimizing_compiler_stats.h @@ -27,6 +27,7 @@ namespace art { enum MethodCompilationStat { kAttemptCompilation = 0, + kCHAInline, kCompiled, kInlinedInvoke, kReplacedInvokeWithSimplePattern, @@ -106,6 +107,7 @@ class OptimizingCompilerStats { std::string name; switch (stat) { case kAttemptCompilation : name = "AttemptCompilation"; break; + case kCHAInline : name = "CHAInline"; break; case kCompiled : name = "Compiled"; break; case kInlinedInvoke : name = "InlinedInvoke"; break; case kReplacedInvokeWithSimplePattern: name = "ReplacedInvokeWithSimplePattern"; break; diff --git a/compiler/optimizing/register_allocation_resolver.cc b/compiler/optimizing/register_allocation_resolver.cc index 5991791a15..59523a93a0 100644 --- a/compiler/optimizing/register_allocation_resolver.cc +++ b/compiler/optimizing/register_allocation_resolver.cc @@ -87,6 +87,10 @@ void RegisterAllocationResolver::Resolve(ArrayRef<HInstruction* const> safepoint // Adjust the stack slot, now that we know the number of them for each type. // The way this implementation lays out the stack is the following: // [parameter slots ] + // [art method (caller) ] + // [entry spill (core) ] + // [entry spill (float) ] + // [should_deoptimize flag] (this is optional) // [catch phi spill slots ] // [double spill slots ] // [long spill slots ] diff --git a/compiler/optimizing/register_allocator_graph_color.cc b/compiler/optimizing/register_allocator_graph_color.cc index aa0d3710fa..9064f865c3 100644 --- a/compiler/optimizing/register_allocator_graph_color.cc +++ b/compiler/optimizing/register_allocator_graph_color.cc @@ -1749,7 +1749,7 @@ static std::bitset<kMaxNumRegs> BuildConflictMask(Container& intervals) { bool RegisterAllocatorGraphColor::IsCallerSave(size_t reg, bool processing_core_regs) { return processing_core_regs ? !codegen_->IsCoreCalleeSaveRegister(reg) - : !codegen_->IsCoreCalleeSaveRegister(reg); + : !codegen_->IsFloatingPointCalleeSaveRegister(reg); } static bool RegisterIsAligned(size_t reg) { diff --git a/compiler/utils/arm/jni_macro_assembler_arm_vixl.cc b/compiler/utils/arm/jni_macro_assembler_arm_vixl.cc index fb6f172cb0..2d026b83f9 100644 --- a/compiler/utils/arm/jni_macro_assembler_arm_vixl.cc +++ b/compiler/utils/arm/jni_macro_assembler_arm_vixl.cc @@ -428,8 +428,6 @@ void ArmVIXLJNIMacroAssembler::Copy(FrameOffset dst ATTRIBUTE_UNUSED, UNIMPLEMENTED(FATAL); } -static constexpr uint32_t kArmInstrMaxSizeInBytes = 4; - void ArmVIXLJNIMacroAssembler::CreateHandleScopeEntry(ManagedRegister mout_reg, FrameOffset handle_scope_offset, ManagedRegister min_reg, @@ -458,14 +456,14 @@ void ArmVIXLJNIMacroAssembler::CreateHandleScopeEntry(ManagedRegister mout_reg, if (asm_.ShifterOperandCanHold(ADD, handle_scope_offset.Int32Value(), kCcDontCare)) { if (!out_reg.Equals(in_reg)) { AssemblerAccurateScope guard(asm_.GetVIXLAssembler(), - 3 * kArmInstrMaxSizeInBytes, + 3 * vixl32::kMaxInstructionSizeInBytes, CodeBufferCheckScope::kMaximumSize); ___ it(eq, 0xc); ___ mov(eq, out_reg.AsVIXLRegister(), 0); asm_.AddConstantInIt(out_reg.AsVIXLRegister(), sp, handle_scope_offset.Int32Value(), ne); } else { AssemblerAccurateScope guard(asm_.GetVIXLAssembler(), - 2 * kArmInstrMaxSizeInBytes, + 2 * vixl32::kMaxInstructionSizeInBytes, CodeBufferCheckScope::kMaximumSize); ___ it(ne, 0x8); asm_.AddConstantInIt(out_reg.AsVIXLRegister(), sp, handle_scope_offset.Int32Value(), ne); @@ -496,7 +494,7 @@ void ArmVIXLJNIMacroAssembler::CreateHandleScopeEntry(FrameOffset out_off, if (asm_.ShifterOperandCanHold(ADD, handle_scope_offset.Int32Value(), kCcDontCare)) { AssemblerAccurateScope guard(asm_.GetVIXLAssembler(), - 2 * kArmInstrMaxSizeInBytes, + 2 * vixl32::kMaxInstructionSizeInBytes, CodeBufferCheckScope::kMaximumSize); ___ it(ne, 0x8); asm_.AddConstantInIt(scratch.AsVIXLRegister(), sp, handle_scope_offset.Int32Value(), ne); @@ -589,7 +587,7 @@ void ArmVIXLJNIMacroAssembler::ExceptionPoll(ManagedRegister m_scratch, size_t s ___ Cmp(scratch.AsVIXLRegister(), 0); { AssemblerAccurateScope guard(asm_.GetVIXLAssembler(), - kArmInstrMaxSizeInBytes, + vixl32::kMaxInstructionSizeInBytes, CodeBufferCheckScope::kMaximumSize); ___ b(ne, Narrow, exception_blocks_.back()->Entry()); } diff --git a/dex2oat/dex2oat.cc b/dex2oat/dex2oat.cc index 91a32f9353..264be99fcf 100644 --- a/dex2oat/dex2oat.cc +++ b/dex2oat/dex2oat.cc @@ -1855,8 +1855,8 @@ class Dex2Oat FINAL { return false; } - // VDEX finalized, seek back to the beginning and write the header. - if (!oat_writers_[i]->WriteVdexHeader(vdex_out.get())) { + // VDEX finalized, seek back to the beginning and write checksums and the header. + if (!oat_writers_[i]->WriteChecksumsAndVdexHeader(vdex_out.get())) { LOG(ERROR) << "Failed to write vdex header into VDEX " << vdex_file->GetPath(); return false; } diff --git a/dex2oat/dex2oat_test.cc b/dex2oat/dex2oat_test.cc index 714a58c8e5..b6b62a80dc 100644 --- a/dex2oat/dex2oat_test.cc +++ b/dex2oat/dex2oat_test.cc @@ -26,6 +26,7 @@ #include "base/stringprintf.h" #include "dex_file-inl.h" #include "dex2oat_environment_test.h" +#include "jit/offline_profiling_info.h" #include "oat.h" #include "oat_file.h" #include "utils.h" @@ -552,26 +553,6 @@ TEST_F(Dex2oatVeryLargeTest, UseVeryLarge) { RunTest(CompilerFilter::kSpeed, true, { "--very-large-app-threshold=100" }); } -static const char kDexFileLayoutInputProfile[] = "cHJvADAwMgABAAwAAQABAOqMEeFEZXhOb09hdC5qYXIBAAEA"; - -static void WriteFileBase64(const char* base64, const char* location) { - // Decode base64. - CHECK(base64 != nullptr); - size_t length; - std::unique_ptr<uint8_t[]> bytes(DecodeBase64(base64, &length)); - CHECK(bytes.get() != nullptr); - - // Write to provided file. - std::unique_ptr<File> file(OS::CreateEmptyFile(location)); - CHECK(file.get() != nullptr); - if (!file->WriteFully(bytes.get(), length)) { - PLOG(FATAL) << "Failed to write base64 as file"; - } - if (file->FlushCloseOrErase() != 0) { - PLOG(FATAL) << "Could not flush and close test file."; - } -} - class Dex2oatLayoutTest : public Dex2oatTest { protected: void CheckFilter(CompilerFilter::Filter input ATTRIBUTE_UNUSED, @@ -579,13 +560,34 @@ class Dex2oatLayoutTest : public Dex2oatTest { // Ignore, we'll do our own checks. } + // Emits a profile with a single dex file with the given location and a single class index of 1. + void GenerateProfile(const std::string& test_profile, + const std::string& dex_location, + uint32_t checksum) { + int profile_test_fd = open(test_profile.c_str(), O_CREAT | O_TRUNC | O_WRONLY, 0644); + CHECK_GE(profile_test_fd, 0); + + ProfileCompilationInfo info; + std::string profile_key = ProfileCompilationInfo::GetProfileDexFileKey(dex_location); + info.AddClassIndex(profile_key, checksum, dex::TypeIndex(1)); + bool result = info.Save(profile_test_fd); + close(profile_test_fd); + ASSERT_TRUE(result); + } + void RunTest() { std::string dex_location = GetScratchDir() + "/DexNoOat.jar"; std::string profile_location = GetScratchDir() + "/primary.prof"; std::string odex_location = GetOdexDir() + "/DexOdexNoOat.odex"; Copy(GetDexSrc2(), dex_location); - WriteFileBase64(kDexFileLayoutInputProfile, profile_location.c_str()); + const char* location = dex_location.c_str(); + std::string error_msg; + std::vector<std::unique_ptr<const DexFile>> dex_files; + ASSERT_TRUE(DexFile::Open(location, location, true, &error_msg, &dex_files)); + EXPECT_EQ(dex_files.size(), 1U); + std::unique_ptr<const DexFile>& dex_file = dex_files[0]; + GenerateProfile(profile_location, dex_location, dex_file->GetLocationChecksum()); const std::vector<std::string>& extra_args = { "--profile-file=" + profile_location }; GenerateOdexForTest(dex_location, odex_location, CompilerFilter::kLayoutProfile, extra_args); diff --git a/oatdump/oatdump.cc b/oatdump/oatdump.cc index a1984a7d9f..80c7113175 100644 --- a/oatdump/oatdump.cc +++ b/oatdump/oatdump.cc @@ -1053,7 +1053,8 @@ class OatDumper { if (options_.absolute_addresses_) { vios->Stream() << StringPrintf("%p ", oat_method.GetVmapTable()); } - uint32_t vmap_table_offset = method_header == nullptr ? 0 : method_header->vmap_table_offset_; + uint32_t vmap_table_offset = method_header == + nullptr ? 0 : method_header->GetVmapTableOffset(); vios->Stream() << StringPrintf("(offset=0x%08x)\n", vmap_table_offset); size_t vmap_table_offset_limit = @@ -1603,7 +1604,7 @@ class ImageDumper { // Mark dex caches. dex_caches_.clear(); { - ReaderMutexLock mu(self, *class_linker->DexLock()); + ReaderMutexLock mu(self, *Locks::dex_lock_); for (const ClassLinker::DexCacheData& data : class_linker->GetDexCachesData()) { ObjPtr<mirror::DexCache> dex_cache = ObjPtr<mirror::DexCache>::DownCast(self->DecodeJObject(data.weak_root)); diff --git a/runtime/Android.bp b/runtime/Android.bp index c6f479ff40..08be5b2979 100644 --- a/runtime/Android.bp +++ b/runtime/Android.bp @@ -45,6 +45,7 @@ cc_defaults { "base/timing_logger.cc", "base/unix_file/fd_file.cc", "base/unix_file/random_access_file_utils.cc", + "cha.cc", "check_jni.cc", "class_linker.cc", "class_table.cc", @@ -514,6 +515,7 @@ art_cc_test { "base/transform_iterator_test.cc", "base/variant_map_test.cc", "base/unix_file/fd_file_test.cc", + "cha_test.cc", "class_linker_test.cc", "compiler_filter_test.cc", "dex_file_test.cc", diff --git a/runtime/art_method-inl.h b/runtime/art_method-inl.h index 730a9c32fd..ef03bb3dd4 100644 --- a/runtime/art_method-inl.h +++ b/runtime/art_method-inl.h @@ -105,7 +105,7 @@ inline uint32_t ArtMethod::GetAccessFlags() { DoGetAccessFlagsHelper<kReadBarrierOption>(this); } } - return access_flags_; + return access_flags_.load(std::memory_order_relaxed); } inline uint16_t ArtMethod::GetMethodIndex() { @@ -452,6 +452,53 @@ inline mirror::Class* ArtMethod::GetReturnType(bool resolve, PointerSize pointer return type; } +inline bool ArtMethod::HasSingleImplementation() { + if (IsFinal() || GetDeclaringClass()->IsFinal()) { + // We don't set kAccSingleImplementation for these cases since intrinsic + // can use the flag also. + return true; + } + return (GetAccessFlags() & kAccSingleImplementation) != 0; +} + +inline void ArtMethod::SetIntrinsic(uint32_t intrinsic) { + DCHECK(IsUint<8>(intrinsic)); + // Currently we only do intrinsics for static/final methods or methods of final + // classes. We don't set kHasSingleImplementation for those methods. + DCHECK(IsStatic() || IsFinal() || GetDeclaringClass()->IsFinal()) << + "Potential conflict with kAccSingleImplementation"; + uint32_t new_value = (GetAccessFlags() & kAccFlagsNotUsedByIntrinsic) | + kAccIntrinsic | + (intrinsic << POPCOUNT(kAccFlagsNotUsedByIntrinsic)); + if (kIsDebugBuild) { + uint32_t java_flags = (GetAccessFlags() & kAccJavaFlagsMask); + bool is_constructor = IsConstructor(); + bool is_synchronized = IsSynchronized(); + bool skip_access_checks = SkipAccessChecks(); + bool is_fast_native = IsFastNative(); + bool is_copied = IsCopied(); + bool is_miranda = IsMiranda(); + bool is_default = IsDefault(); + bool is_default_conflict = IsDefaultConflicting(); + bool is_compilable = IsCompilable(); + bool must_count_locks = MustCountLocks(); + SetAccessFlags(new_value); + DCHECK_EQ(java_flags, (GetAccessFlags() & kAccJavaFlagsMask)); + DCHECK_EQ(is_constructor, IsConstructor()); + DCHECK_EQ(is_synchronized, IsSynchronized()); + DCHECK_EQ(skip_access_checks, SkipAccessChecks()); + DCHECK_EQ(is_fast_native, IsFastNative()); + DCHECK_EQ(is_copied, IsCopied()); + DCHECK_EQ(is_miranda, IsMiranda()); + DCHECK_EQ(is_default, IsDefault()); + DCHECK_EQ(is_default_conflict, IsDefaultConflicting()); + DCHECK_EQ(is_compilable, IsCompilable()); + DCHECK_EQ(must_count_locks, MustCountLocks()); + } else { + SetAccessFlags(new_value); + } +} + template<ReadBarrierOption kReadBarrierOption, typename RootVisitorType> void ArtMethod::VisitRoots(RootVisitorType& visitor, PointerSize pointer_size) { if (LIKELY(!declaring_class_.IsNull())) { diff --git a/runtime/art_method.cc b/runtime/art_method.cc index eeece90be5..96b6f18403 100644 --- a/runtime/art_method.cc +++ b/runtime/art_method.cc @@ -51,6 +51,17 @@ extern "C" void art_quick_invoke_stub(ArtMethod*, uint32_t*, uint32_t, Thread*, extern "C" void art_quick_invoke_static_stub(ArtMethod*, uint32_t*, uint32_t, Thread*, JValue*, const char*); +ArtMethod* ArtMethod::GetSingleImplementation() { + DCHECK(!IsNative()); + if (!IsAbstract()) { + // A non-abstract's single implementation is itself. + return this; + } + // TODO: add single-implementation logic for abstract method by storing it + // in ptr_sized_fields_. + return nullptr; +} + ArtMethod* ArtMethod::FromReflectedMethod(const ScopedObjectAccessAlreadyRunnable& soa, jobject jlr_method) { ObjPtr<mirror::Executable> executable = soa.Decode<mirror::Executable>(jlr_method); @@ -68,7 +79,8 @@ mirror::DexCache* ArtMethod::GetObsoleteDexCache() { DCHECK(ext->GetObsoleteDexCaches() != nullptr); int32_t len = obsolete_methods->GetLength(); DCHECK_EQ(len, ext->GetObsoleteDexCaches()->GetLength()); - // TODO I think this is fine since images should never have obsolete methods in them. + // Using kRuntimePointerSize (instead of using the image's pointer size) is fine since images + // should never have obsolete methods in them so they should always be the same. PointerSize pointer_size = kRuntimePointerSize; DCHECK_EQ(kRuntimePointerSize, Runtime::Current()->GetClassLinker()->GetImagePointerSize()); for (int32_t i = 0; i < len; i++) { @@ -345,7 +357,7 @@ void ArtMethod::RegisterNative(const void* native_method, bool is_fast) { CHECK(!IsFastNative()) << PrettyMethod(); CHECK(native_method != nullptr) << PrettyMethod(); if (is_fast) { - SetAccessFlags(GetAccessFlags() | kAccFastNative); + AddAccessFlags(kAccFastNative); } SetEntryPointFromJni(native_method); } @@ -503,7 +515,7 @@ const uint8_t* ArtMethod::GetQuickenedInfo(PointerSize pointer_size) { if (oat_file == nullptr) { return nullptr; } - return oat_file->DexBegin() + header->vmap_table_offset_; + return oat_file->DexBegin() + header->GetVmapTableOffset(); } else { return oat_method.GetVmapTable(); } @@ -601,7 +613,7 @@ const OatQuickMethodHeader* ArtMethod::GetOatQuickMethodHeader(uintptr_t pc) { DCHECK(method_header->Contains(pc)) << PrettyMethod() << " " << std::hex << pc << " " << oat_entry_point - << " " << (uintptr_t)(method_header->code_ + method_header->code_size_); + << " " << (uintptr_t)(method_header->GetCode() + method_header->GetCodeSize()); return method_header; } diff --git a/runtime/art_method.h b/runtime/art_method.h index 00fab65241..3bc6f5d4fd 100644 --- a/runtime/art_method.h +++ b/runtime/art_method.h @@ -85,9 +85,29 @@ class ArtMethod FINAL { template <ReadBarrierOption kReadBarrierOption = kWithReadBarrier> ALWAYS_INLINE uint32_t GetAccessFlags(); + // This version should only be called when it's certain there is no + // concurrency so there is no need to guarantee atomicity. For example, + // before the method is linked. void SetAccessFlags(uint32_t new_access_flags) { - // Not called within a transaction. - access_flags_ = new_access_flags; + access_flags_.store(new_access_flags, std::memory_order_relaxed); + } + + // This setter guarantees atomicity. + void AddAccessFlags(uint32_t flag) { + uint32_t old_access_flags = access_flags_.load(std::memory_order_relaxed); + uint32_t new_access_flags; + do { + new_access_flags = old_access_flags | flag; + } while (!access_flags_.compare_exchange_weak(old_access_flags, new_access_flags)); + } + + // This setter guarantees atomicity. + void ClearAccessFlags(uint32_t flag) { + uint32_t old_access_flags = access_flags_.load(std::memory_order_relaxed); + uint32_t new_access_flags; + do { + new_access_flags = old_access_flags & ~flag; + } while (!access_flags_.compare_exchange_weak(old_access_flags, new_access_flags)); } // Approximate what kind of method call would be used for this method. @@ -142,39 +162,7 @@ class ArtMethod FINAL { return (GetAccessFlags() & kAccIntrinsic) != 0; } - void SetIntrinsic(uint32_t intrinsic) { - DCHECK(IsUint<8>(intrinsic)); - uint32_t new_value = (GetAccessFlags() & kAccFlagsNotUsedByIntrinsic) | - kAccIntrinsic | - (intrinsic << POPCOUNT(kAccFlagsNotUsedByIntrinsic)); - if (kIsDebugBuild) { - uint32_t java_flags = (GetAccessFlags() & kAccJavaFlagsMask); - bool is_constructor = IsConstructor(); - bool is_synchronized = IsSynchronized(); - bool skip_access_checks = SkipAccessChecks(); - bool is_fast_native = IsFastNative(); - bool is_copied = IsCopied(); - bool is_miranda = IsMiranda(); - bool is_default = IsDefault(); - bool is_default_conflict = IsDefaultConflicting(); - bool is_compilable = IsCompilable(); - bool must_count_locks = MustCountLocks(); - SetAccessFlags(new_value); - DCHECK_EQ(java_flags, (GetAccessFlags() & kAccJavaFlagsMask)); - DCHECK_EQ(is_constructor, IsConstructor()); - DCHECK_EQ(is_synchronized, IsSynchronized()); - DCHECK_EQ(skip_access_checks, SkipAccessChecks()); - DCHECK_EQ(is_fast_native, IsFastNative()); - DCHECK_EQ(is_copied, IsCopied()); - DCHECK_EQ(is_miranda, IsMiranda()); - DCHECK_EQ(is_default, IsDefault()); - DCHECK_EQ(is_default_conflict, IsDefaultConflicting()); - DCHECK_EQ(is_compilable, IsCompilable()); - DCHECK_EQ(must_count_locks, MustCountLocks()); - } else { - SetAccessFlags(new_value); - } - } + ALWAYS_INLINE void SetIntrinsic(uint32_t intrinsic) REQUIRES_SHARED(Locks::mutator_lock_); uint32_t GetIntrinsic() { DCHECK(IsIntrinsic()); @@ -250,6 +238,10 @@ class ArtMethod FINAL { return (GetAccessFlags() & kAccSynthetic) != 0; } + bool IsVarargs() { + return (GetAccessFlags() & kAccVarargs) != 0; + } + template<ReadBarrierOption kReadBarrierOption = kWithReadBarrier> bool IsProxyMethod() REQUIRES_SHARED(Locks::mutator_lock_); @@ -259,7 +251,7 @@ class ArtMethod FINAL { void SetSkipAccessChecks() { DCHECK(!SkipAccessChecks()); - SetAccessFlags(GetAccessFlags() | kAccSkipAccessChecks); + AddAccessFlags(kAccSkipAccessChecks); } // Should this method be run in the interpreter and count locks (e.g., failed structured- @@ -461,6 +453,26 @@ class ArtMethod FINAL { return DataOffset(kRuntimePointerSize); } + ALWAYS_INLINE bool HasSingleImplementation() REQUIRES_SHARED(Locks::mutator_lock_); + + ALWAYS_INLINE void SetHasSingleImplementation(bool single_impl) { + DCHECK(!IsIntrinsic()) << "conflict with intrinsic bits"; + if (single_impl) { + AddAccessFlags(kAccSingleImplementation); + } else { + ClearAccessFlags(kAccSingleImplementation); + } + } + + ArtMethod* GetSingleImplementation() + REQUIRES_SHARED(Locks::mutator_lock_); + + ALWAYS_INLINE void SetSingleImplementation(ArtMethod* method, PointerSize pointer_size) { + DCHECK(!IsNative()); + DCHECK(IsAbstract()); // Non-abstract method's single implementation is just itself. + SetDataPtrSize(method, pointer_size); + } + void* GetEntryPointFromJni() { DCHECK(IsNative()); return GetEntryPointFromJniPtrSize(kRuntimePointerSize); @@ -655,7 +667,10 @@ class ArtMethod FINAL { GcRoot<mirror::Class> declaring_class_; // Access flags; low 16 bits are defined by spec. - uint32_t access_flags_; + // Getting and setting this flag needs to be atomic when concurrency is + // possible, e.g. after this method's class is linked. Such as when setting + // verifier flags and single-implementation flag. + std::atomic<std::uint32_t> access_flags_; /* Dex file fields. The defining dex file is available via declaring_class_->dex_cache_ */ diff --git a/runtime/barrier.cc b/runtime/barrier.cc index 0d842cc261..9bcda35a9d 100644 --- a/runtime/barrier.cc +++ b/runtime/barrier.cc @@ -80,6 +80,11 @@ bool Barrier::Increment(Thread* self, int delta, uint32_t timeout_ms) { return timed_out; } +int Barrier::GetCount(Thread* self) { + MutexLock mu(self, lock_); + return count_; +} + void Barrier::SetCountLocked(Thread* self, int count) { count_ = count; if (count == 0) { diff --git a/runtime/barrier.h b/runtime/barrier.h index 94977fb741..d7c4661b99 100644 --- a/runtime/barrier.h +++ b/runtime/barrier.h @@ -61,6 +61,8 @@ class Barrier { // another thread is still in Wait(). See above. void Init(Thread* self, int count) REQUIRES(!lock_); + int GetCount(Thread* self) REQUIRES(!lock_); + private: void SetCountLocked(Thread* self, int count) REQUIRES(lock_); diff --git a/runtime/base/arena_allocator.h b/runtime/base/arena_allocator.h index 62cd2a7561..2feb28a778 100644 --- a/runtime/base/arena_allocator.h +++ b/runtime/base/arena_allocator.h @@ -94,6 +94,7 @@ enum ArenaAllocKind { kArenaAllocGraphChecker, kArenaAllocVerifier, kArenaAllocCallingConvention, + kArenaAllocCHA, kNumArenaAllocKinds }; diff --git a/runtime/base/mutex.cc b/runtime/base/mutex.cc index e8ef69f778..ce452cbcf6 100644 --- a/runtime/base/mutex.cc +++ b/runtime/base/mutex.cc @@ -58,6 +58,7 @@ Mutex* Locks::reference_queue_phantom_references_lock_ = nullptr; Mutex* Locks::reference_queue_soft_references_lock_ = nullptr; Mutex* Locks::reference_queue_weak_references_lock_ = nullptr; Mutex* Locks::runtime_shutdown_lock_ = nullptr; +Mutex* Locks::cha_lock_ = nullptr; Mutex* Locks::thread_list_lock_ = nullptr; ConditionVariable* Locks::thread_exit_cond_ = nullptr; Mutex* Locks::thread_suspend_count_lock_ = nullptr; @@ -66,6 +67,7 @@ Mutex* Locks::unexpected_signal_lock_ = nullptr; Uninterruptible Roles::uninterruptible_; ReaderWriterMutex* Locks::jni_globals_lock_ = nullptr; Mutex* Locks::jni_weak_globals_lock_ = nullptr; +ReaderWriterMutex* Locks::dex_lock_ = nullptr; struct AllMutexData { // A guard for all_mutexes_ that's not a mutex (Mutexes must CAS to acquire and busy wait). @@ -955,10 +957,12 @@ void Locks::Init() { DCHECK(logging_lock_ != nullptr); DCHECK(mutator_lock_ != nullptr); DCHECK(profiler_lock_ != nullptr); + DCHECK(cha_lock_ != nullptr); DCHECK(thread_list_lock_ != nullptr); DCHECK(thread_suspend_count_lock_ != nullptr); DCHECK(trace_lock_ != nullptr); DCHECK(unexpected_signal_lock_ != nullptr); + DCHECK(dex_lock_ != nullptr); } else { // Create global locks in level order from highest lock level to lowest. LockLevel current_lock_level = kInstrumentEntrypointsLock; @@ -1014,6 +1018,10 @@ void Locks::Init() { DCHECK(breakpoint_lock_ == nullptr); breakpoint_lock_ = new ReaderWriterMutex("breakpoint lock", current_lock_level); + UPDATE_CURRENT_LOCK_LEVEL(kCHALock); + DCHECK(cha_lock_ == nullptr); + cha_lock_ = new Mutex("CHA lock", current_lock_level); + UPDATE_CURRENT_LOCK_LEVEL(kClassLinkerClassesLock); DCHECK(classlinker_classes_lock_ == nullptr); classlinker_classes_lock_ = new ReaderWriterMutex("ClassLinker classes lock", @@ -1033,6 +1041,10 @@ void Locks::Init() { modify_ldt_lock_ = new Mutex("modify_ldt lock", current_lock_level); } + UPDATE_CURRENT_LOCK_LEVEL(kDexLock); + DCHECK(dex_lock_ == nullptr); + dex_lock_ = new ReaderWriterMutex("ClassLinker dex lock", current_lock_level); + UPDATE_CURRENT_LOCK_LEVEL(kOatFileManagerLock); DCHECK(oat_file_manager_lock_ == nullptr); oat_file_manager_lock_ = new ReaderWriterMutex("OatFile manager lock", current_lock_level); diff --git a/runtime/base/mutex.h b/runtime/base/mutex.h index 7e73e0dbd9..255ad714f2 100644 --- a/runtime/base/mutex.h +++ b/runtime/base/mutex.h @@ -97,6 +97,7 @@ enum LockLevel { kMonitorPoolLock, kClassLinkerClassesLock, // TODO rename. kJitCodeCacheLock, + kCHALock, kBreakpointLock, kMonitorLock, kMonitorListLock, @@ -627,9 +628,12 @@ class Locks { // TODO: improve name, perhaps instrumentation_update_lock_. static Mutex* deoptimization_lock_ ACQUIRED_AFTER(alloc_tracker_lock_); + // Guards Class Hierarchy Analysis (CHA). + static Mutex* cha_lock_ ACQUIRED_AFTER(deoptimization_lock_); + // The thread_list_lock_ guards ThreadList::list_. It is also commonly held to stop threads // attaching and detaching. - static Mutex* thread_list_lock_ ACQUIRED_AFTER(deoptimization_lock_); + static Mutex* thread_list_lock_ ACQUIRED_AFTER(cha_lock_); // Signaled when threads terminate. Used to determine when all non-daemons have terminated. static ConditionVariable* thread_exit_cond_ GUARDED_BY(Locks::thread_list_lock_); @@ -655,8 +659,10 @@ class Locks { // Guards modification of the LDT on x86. static Mutex* modify_ldt_lock_ ACQUIRED_AFTER(allocated_thread_ids_lock_); + static ReaderWriterMutex* dex_lock_ ACQUIRED_AFTER(modify_ldt_lock_); + // Guards opened oat files in OatFileManager. - static ReaderWriterMutex* oat_file_manager_lock_ ACQUIRED_AFTER(modify_ldt_lock_); + static ReaderWriterMutex* oat_file_manager_lock_ ACQUIRED_AFTER(dex_lock_); // Guards extra string entries for VerifierDeps. static ReaderWriterMutex* verifier_deps_lock_ ACQUIRED_AFTER(oat_file_manager_lock_); diff --git a/runtime/cha.cc b/runtime/cha.cc new file mode 100644 index 0000000000..be675a82c8 --- /dev/null +++ b/runtime/cha.cc @@ -0,0 +1,356 @@ +/* + * Copyright (C) 2016 The Android Open Source Project + * + * Licensed under the Apache License, Version 2.0 (the "License"); + * you may not use this file except in compliance with the License. + * You may obtain a copy of the License at + * + * http://www.apache.org/licenses/LICENSE-2.0 + * + * Unless required by applicable law or agreed to in writing, software + * distributed under the License is distributed on an "AS IS" BASIS, + * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. + * See the License for the specific language governing permissions and + * limitations under the License. + */ + +#include "cha.h" + +#include "jit/jit.h" +#include "jit/jit_code_cache.h" +#include "runtime.h" +#include "scoped_thread_state_change-inl.h" +#include "stack.h" +#include "thread.h" +#include "thread_list.h" +#include "thread_pool.h" + +namespace art { + +void ClassHierarchyAnalysis::AddDependency(ArtMethod* method, + ArtMethod* dependent_method, + OatQuickMethodHeader* dependent_header) { + auto it = cha_dependency_map_.find(method); + if (it == cha_dependency_map_.end()) { + cha_dependency_map_[method] = + new std::vector<std::pair<art::ArtMethod*, art::OatQuickMethodHeader*>>(); + it = cha_dependency_map_.find(method); + } else { + DCHECK(it->second != nullptr); + } + it->second->push_back(std::make_pair(dependent_method, dependent_header)); +} + +std::vector<std::pair<ArtMethod*, OatQuickMethodHeader*>>* + ClassHierarchyAnalysis::GetDependents(ArtMethod* method) { + auto it = cha_dependency_map_.find(method); + if (it != cha_dependency_map_.end()) { + DCHECK(it->second != nullptr); + return it->second; + } + return nullptr; +} + +void ClassHierarchyAnalysis::RemoveDependencyFor(ArtMethod* method) { + auto it = cha_dependency_map_.find(method); + if (it != cha_dependency_map_.end()) { + auto dependents = it->second; + cha_dependency_map_.erase(it); + delete dependents; + } +} + +void ClassHierarchyAnalysis::RemoveDependentsWithMethodHeaders( + const std::unordered_set<OatQuickMethodHeader*>& method_headers) { + // Iterate through all entries in the dependency map and remove any entry that + // contains one of those in method_headers. + for (auto map_it = cha_dependency_map_.begin(); map_it != cha_dependency_map_.end(); ) { + auto dependents = map_it->second; + for (auto vec_it = dependents->begin(); vec_it != dependents->end(); ) { + OatQuickMethodHeader* method_header = vec_it->second; + auto it = std::find(method_headers.begin(), method_headers.end(), method_header); + if (it != method_headers.end()) { + vec_it = dependents->erase(vec_it); + } else { + vec_it++; + } + } + // Remove the map entry if there are no more dependents. + if (dependents->empty()) { + map_it = cha_dependency_map_.erase(map_it); + delete dependents; + } else { + map_it++; + } + } +} + +// This stack visitor walks the stack and for compiled code with certain method +// headers, sets the should_deoptimize flag on stack to 1. +// TODO: also set the register value to 1 when should_deoptimize is allocated in +// a register. +class CHAStackVisitor FINAL : public StackVisitor { + public: + CHAStackVisitor(Thread* thread_in, + Context* context, + const std::unordered_set<OatQuickMethodHeader*>& method_headers) + : StackVisitor(thread_in, context, StackVisitor::StackWalkKind::kSkipInlinedFrames), + method_headers_(method_headers) { + } + + bool VisitFrame() OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_) { + ArtMethod* method = GetMethod(); + if (method == nullptr || method->IsRuntimeMethod() || method->IsNative()) { + return true; + } + if (GetCurrentQuickFrame() == nullptr) { + // Not compiled code. + return true; + } + // Method may have multiple versions of compiled code. Check + // the method header to see if it has should_deoptimize flag. + const OatQuickMethodHeader* method_header = GetCurrentOatQuickMethodHeader(); + if (!method_header->HasShouldDeoptimizeFlag()) { + // This compiled version doesn't have should_deoptimize flag. Skip. + return true; + } + auto it = std::find(method_headers_.begin(), method_headers_.end(), method_header); + if (it == method_headers_.end()) { + // Not in the list of method headers that should be deoptimized. + return true; + } + + // The compiled code on stack is not valid anymore. Need to deoptimize. + SetShouldDeoptimizeFlag(); + + return true; + } + + private: + void SetShouldDeoptimizeFlag() REQUIRES_SHARED(Locks::mutator_lock_) { + QuickMethodFrameInfo frame_info = GetCurrentQuickFrameInfo(); + size_t frame_size = frame_info.FrameSizeInBytes(); + uint8_t* sp = reinterpret_cast<uint8_t*>(GetCurrentQuickFrame()); + size_t core_spill_size = POPCOUNT(frame_info.CoreSpillMask()) * + GetBytesPerGprSpillLocation(kRuntimeISA); + size_t fpu_spill_size = POPCOUNT(frame_info.FpSpillMask()) * + GetBytesPerFprSpillLocation(kRuntimeISA); + size_t offset = frame_size - core_spill_size - fpu_spill_size - kShouldDeoptimizeFlagSize; + uint8_t* should_deoptimize_addr = sp + offset; + // Set deoptimization flag to 1. + DCHECK(*should_deoptimize_addr == 0 || *should_deoptimize_addr == 1); + *should_deoptimize_addr = 1; + } + + // Set of method headers for compiled code that should be deoptimized. + const std::unordered_set<OatQuickMethodHeader*>& method_headers_; + + DISALLOW_COPY_AND_ASSIGN(CHAStackVisitor); +}; + +class CHACheckpoint FINAL : public Closure { + public: + explicit CHACheckpoint(const std::unordered_set<OatQuickMethodHeader*>& method_headers) + : barrier_(0), + method_headers_(method_headers) {} + + void Run(Thread* thread) OVERRIDE { + // Note thread and self may not be equal if thread was already suspended at + // the point of the request. + Thread* self = Thread::Current(); + ScopedObjectAccess soa(self); + CHAStackVisitor visitor(thread, nullptr, method_headers_); + visitor.WalkStack(); + barrier_.Pass(self); + } + + void WaitForThreadsToRunThroughCheckpoint(size_t threads_running_checkpoint) { + Thread* self = Thread::Current(); + ScopedThreadStateChange tsc(self, kWaitingForCheckPointsToRun); + barrier_.Increment(self, threads_running_checkpoint); + } + + private: + // The barrier to be passed through and for the requestor to wait upon. + Barrier barrier_; + // List of method headers for invalidated compiled code. + const std::unordered_set<OatQuickMethodHeader*>& method_headers_; + + DISALLOW_COPY_AND_ASSIGN(CHACheckpoint); +}; + +void ClassHierarchyAnalysis::VerifyNonSingleImplementation(mirror::Class* verify_class, + uint16_t verify_index) { + // Grab cha_lock_ to make sure all single-implementation updates are seen. + PointerSize image_pointer_size = + Runtime::Current()->GetClassLinker()->GetImagePointerSize(); + MutexLock cha_mu(Thread::Current(), *Locks::cha_lock_); + while (verify_class != nullptr) { + if (verify_index >= verify_class->GetVTableLength()) { + return; + } + ArtMethod* verify_method = verify_class->GetVTableEntry(verify_index, image_pointer_size); + DCHECK(!verify_method->HasSingleImplementation()) + << "class: " << verify_class->PrettyClass() + << " verify_method: " << verify_method->PrettyMethod(true); + verify_class = verify_class->GetSuperClass(); + } +} + +void ClassHierarchyAnalysis::CheckSingleImplementationInfo( + Handle<mirror::Class> klass, + ArtMethod* virtual_method, + ArtMethod* method_in_super, + std::unordered_set<ArtMethod*>& invalidated_single_impl_methods) { + // TODO: if klass is not instantiable, virtual_method isn't invocable yet so + // even if it overrides, it doesn't invalidate single-implementation + // assumption. + + DCHECK_NE(virtual_method, method_in_super); + DCHECK(method_in_super->GetDeclaringClass()->IsResolved()) << "class isn't resolved"; + // If virtual_method doesn't come from a default interface method, it should + // be supplied by klass. + DCHECK(virtual_method->IsCopied() || + virtual_method->GetDeclaringClass() == klass.Get()); + + // A new virtual_method should set method_in_super to + // non-single-implementation (if not set already). + // We don't grab cha_lock_. Single-implementation flag won't be set to true + // again once it's set to false. + if (!method_in_super->HasSingleImplementation()) { + // method_in_super already has multiple implementations. All methods in the + // same vtable slots in its super classes should have + // non-single-implementation already. + if (kIsDebugBuild) { + VerifyNonSingleImplementation(klass->GetSuperClass()->GetSuperClass(), + method_in_super->GetMethodIndex()); + } + return; + } + + // Native methods don't have single-implementation flag set. + DCHECK(!method_in_super->IsNative()); + // Invalidate method_in_super's single-implementation status. + invalidated_single_impl_methods.insert(method_in_super); +} + +void ClassHierarchyAnalysis::InitSingleImplementationFlag(Handle<mirror::Class> klass, + ArtMethod* method) { + DCHECK(method->IsCopied() || method->GetDeclaringClass() == klass.Get()); + if (klass->IsFinal() || method->IsFinal()) { + // Final classes or methods do not need CHA for devirtualization. + // This frees up modifier bits for intrinsics which currently are only + // used for static methods or methods of final classes. + return; + } + if (method->IsNative()) { + // Native method's invocation overhead is already high and it + // cannot be inlined. It's not worthwhile to devirtualize the + // call which can add a deoptimization point. + DCHECK(!method->HasSingleImplementation()); + } else { + method->SetHasSingleImplementation(true); + if (method->IsAbstract()) { + // There is no real implementation yet. + // TODO: implement single-implementation logic for abstract methods. + DCHECK(method->GetSingleImplementation() == nullptr); + } else { + // Single implementation of non-abstract method is itself. + DCHECK_EQ(method->GetSingleImplementation(), method); + } + } +} + +void ClassHierarchyAnalysis::UpdateAfterLoadingOf(Handle<mirror::Class> klass) { + if (klass->IsInterface()) { + return; + } + mirror::Class* super_class = klass->GetSuperClass(); + if (super_class == nullptr) { + return; + } + + // Keeps track of all methods whose single-implementation assumption + // is invalidated by linking `klass`. + std::unordered_set<ArtMethod*> invalidated_single_impl_methods; + + PointerSize image_pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize(); + // Do an entry-by-entry comparison of vtable contents with super's vtable. + for (int32_t i = 0; i < super_class->GetVTableLength(); ++i) { + ArtMethod* method = klass->GetVTableEntry(i, image_pointer_size); + ArtMethod* method_in_super = super_class->GetVTableEntry(i, image_pointer_size); + if (method == method_in_super) { + // vtable slot entry is inherited from super class. + continue; + } + InitSingleImplementationFlag(klass, method); + CheckSingleImplementationInfo(klass, + method, + method_in_super, + invalidated_single_impl_methods); + } + + // For new virtual methods that don't override. + for (int32_t i = super_class->GetVTableLength(); i < klass->GetVTableLength(); ++i) { + ArtMethod* method = klass->GetVTableEntry(i, image_pointer_size); + InitSingleImplementationFlag(klass, method); + } + + Runtime* const runtime = Runtime::Current(); + if (!invalidated_single_impl_methods.empty()) { + Thread *self = Thread::Current(); + // Method headers for compiled code to be invalidated. + std::unordered_set<OatQuickMethodHeader*> dependent_method_headers; + + { + // We do this under cha_lock_. Committing code also grabs this lock to + // make sure the code is only committed when all single-implementation + // assumptions are still true. + MutexLock cha_mu(self, *Locks::cha_lock_); + // Invalidate compiled methods that assume some virtual calls have only + // single implementations. + for (ArtMethod* invalidated : invalidated_single_impl_methods) { + if (!invalidated->HasSingleImplementation()) { + // It might have been invalidated already when other class linking is + // going on. + continue; + } + invalidated->SetHasSingleImplementation(false); + + if (runtime->IsAotCompiler()) { + // No need to invalidate any compiled code as the AotCompiler doesn't + // run any code. + continue; + } + + // Invalidate all dependents. + auto dependents = GetDependents(invalidated); + if (dependents == nullptr) { + continue; + } + for (const auto& dependent : *dependents) { + ArtMethod* method = dependent.first;; + OatQuickMethodHeader* method_header = dependent.second; + VLOG(class_linker) << "CHA invalidated compiled code for " << method->PrettyMethod(); + DCHECK(runtime->UseJitCompilation()); + runtime->GetJit()->GetCodeCache()->InvalidateCompiledCodeFor( + method, method_header); + dependent_method_headers.insert(method_header); + } + RemoveDependencyFor(invalidated); + } + } + + if (dependent_method_headers.empty()) { + return; + } + // Deoptimze compiled code on stack that should have been invalidated. + CHACheckpoint checkpoint(dependent_method_headers); + size_t threads_running_checkpoint = runtime->GetThreadList()->RunCheckpoint(&checkpoint); + if (threads_running_checkpoint != 0) { + checkpoint.WaitForThreadsToRunThroughCheckpoint(threads_running_checkpoint); + } + } +} + +} // namespace art diff --git a/runtime/cha.h b/runtime/cha.h new file mode 100644 index 0000000000..ada5c89981 --- /dev/null +++ b/runtime/cha.h @@ -0,0 +1,144 @@ +/* + * Copyright (C) 2016 The Android Open Source Project + * + * Licensed under the Apache License, Version 2.0 (the "License"); + * you may not use this file except in compliance with the License. + * You may obtain a copy of the License at + * + * http://www.apache.org/licenses/LICENSE-2.0 + * + * Unless required by applicable law or agreed to in writing, software + * distributed under the License is distributed on an "AS IS" BASIS, + * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. + * See the License for the specific language governing permissions and + * limitations under the License. + */ + +#ifndef ART_RUNTIME_CHA_H_ +#define ART_RUNTIME_CHA_H_ + +#include "art_method.h" +#include "base/enums.h" +#include "base/mutex.h" +#include "handle.h" +#include "mirror/class.h" +#include "oat_quick_method_header.h" +#include <unordered_map> +#include <unordered_set> + +namespace art { + +/** + * Class Hierarchy Analysis (CHA) tries to devirtualize virtual calls into + * direct calls based on the info generated by analyzing class hierarchies. + * If a class is not subclassed, or even if it's subclassed but one of its + * virtual methods isn't overridden, a virtual call for that method can be + * changed into a direct call. + * + * Each virtual method carries a single-implementation status. The status is + * incrementally maintained at the end of class linking time when method + * overriding takes effect. + * + * Compiler takes advantage of the single-implementation info of a + * method. If a method A has the single-implementation flag set, the compiler + * devirtualizes the virtual call for method A into a direct call, and + * further try to inline the direct call as a result. The compiler will + * also register a dependency that the compiled code depends on the + * assumption that method A has single-implementation status. + * + * When single-implementation info is updated at the end of class linking, + * and if method A's single-implementation status is invalidated, all compiled + * code that depends on the assumption that method A has single-implementation + * status need to be invalidated. Method entrypoints that have this dependency + * will be updated as a result. Method A can later be recompiled with less + * aggressive assumptions. + * + * For live compiled code that's on stack, deoptmization will be initiated + * to force the invalidated compiled code into interpreter mode to guarantee + * correctness. The deoptimization mechanism used is a hybrid of + * synchronous and asynchronous deoptimization. The synchronous deoptimization + * part checks a hidden local variable flag for the method, and if true, + * initiates deoptimization. The asynchronous deoptimization part issues a + * checkpoint that walks the stack and for any compiled code on the stack + * that should be deoptimized, set the hidden local variable value to be true. + * + * A cha_lock_ needs to be held for updating single-implementation status, + * and registering/unregistering CHA dependencies. Registering CHA dependency + * and making compiled code visible also need to be atomic. Otherwise, we + * may miss invalidating CHA dependents or making compiled code visible even + * after it is invalidated. Care needs to be taken between cha_lock_ and + * JitCodeCache::lock_ to guarantee the atomicity. + * + * We base our CHA on dynamically linked class profiles instead of doing static + * analysis. Static analysis can be too aggressive due to dynamic class loading + * at runtime, and too conservative since some classes may not be really loaded + * at runtime. + */ +class ClassHierarchyAnalysis { + public: + // Types for recording CHA dependencies. + // For invalidating CHA dependency, we need to know both the ArtMethod and + // the method header. If the ArtMethod has compiled code with the method header + // as the entrypoint, we update the entrypoint to the interpreter bridge. + // We will also deoptimize frames that are currently executing the code of + // the method header. + typedef std::pair<ArtMethod*, OatQuickMethodHeader*> MethodAndMethodHeaderPair; + typedef std::vector<MethodAndMethodHeaderPair> ListOfDependentPairs; + + ClassHierarchyAnalysis() {} + + // Add a dependency that compiled code with `dependent_header` for `dependent_method` + // assumes that virtual `method` has single-implementation. + void AddDependency(ArtMethod* method, + ArtMethod* dependent_method, + OatQuickMethodHeader* dependent_header) REQUIRES(Locks::cha_lock_); + + // Return compiled code that assumes that `method` has single-implementation. + std::vector<MethodAndMethodHeaderPair>* GetDependents(ArtMethod* method) + REQUIRES(Locks::cha_lock_); + + // Remove dependency tracking for compiled code that assumes that + // `method` has single-implementation. + void RemoveDependencyFor(ArtMethod* method) REQUIRES(Locks::cha_lock_); + + // Remove from cha_dependency_map_ all entries that contain OatQuickMethodHeader from + // the given `method_headers` set. + // This is used when some compiled code is freed. + void RemoveDependentsWithMethodHeaders( + const std::unordered_set<OatQuickMethodHeader*>& method_headers) + REQUIRES(Locks::cha_lock_); + + // Update CHA info for methods that `klass` overrides, after loading `klass`. + void UpdateAfterLoadingOf(Handle<mirror::Class> klass) REQUIRES_SHARED(Locks::mutator_lock_); + + private: + void InitSingleImplementationFlag(Handle<mirror::Class> klass, ArtMethod* method) + REQUIRES_SHARED(Locks::mutator_lock_); + + // `virtual_method` in `klass` overrides `method_in_super`. + // This will invalidate some assumptions on single-implementation. + // Append methods that should have their single-implementation flag invalidated + // to `invalidated_single_impl_methods`. + void CheckSingleImplementationInfo( + Handle<mirror::Class> klass, + ArtMethod* virtual_method, + ArtMethod* method_in_super, + std::unordered_set<ArtMethod*>& invalidated_single_impl_methods) + REQUIRES_SHARED(Locks::mutator_lock_); + + // Verify all methods in the same vtable slot from verify_class and its supers + // don't have single-implementation. + void VerifyNonSingleImplementation(mirror::Class* verify_class, uint16_t verify_index) + REQUIRES_SHARED(Locks::mutator_lock_); + + // A map that maps a method to a set of compiled code that assumes that method has a + // single implementation, which is used to do CHA-based devirtualization. + std::unordered_map<ArtMethod*, ListOfDependentPairs*> cha_dependency_map_ + GUARDED_BY(Locks::cha_lock_); + + DISALLOW_COPY_AND_ASSIGN(ClassHierarchyAnalysis); +}; + +} // namespace art + +#endif // ART_RUNTIME_CHA_H_ diff --git a/runtime/cha_test.cc b/runtime/cha_test.cc new file mode 100644 index 0000000000..d2f335e951 --- /dev/null +++ b/runtime/cha_test.cc @@ -0,0 +1,93 @@ +/* + * Copyright (C) 2016 The Android Open Source Project + * + * Licensed under the Apache License, Version 2.0 (the "License"); + * you may not use this file except in compliance with the License. + * You may obtain a copy of the License at + * + * http://www.apache.org/licenses/LICENSE-2.0 + * + * Unless required by applicable law or agreed to in writing, software + * distributed under the License is distributed on an "AS IS" BASIS, + * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. + * See the License for the specific language governing permissions and + * limitations under the License. + */ + +#include "cha.h" + +#include "common_runtime_test.h" + +namespace art { + +class CHATest : public CommonRuntimeTest {}; + +// Mocks some methods. +#define METHOD1 (reinterpret_cast<ArtMethod*>(8u)) +#define METHOD2 (reinterpret_cast<ArtMethod*>(16u)) +#define METHOD3 (reinterpret_cast<ArtMethod*>(24u)) + +// Mocks some method headers. +#define METHOD_HEADER1 (reinterpret_cast<OatQuickMethodHeader*>(128u)) +#define METHOD_HEADER2 (reinterpret_cast<OatQuickMethodHeader*>(136u)) +#define METHOD_HEADER3 (reinterpret_cast<OatQuickMethodHeader*>(144u)) + +TEST_F(CHATest, CHACheckDependency) { + ClassHierarchyAnalysis cha; + MutexLock cha_mu(Thread::Current(), *Locks::cha_lock_); + + ASSERT_EQ(cha.GetDependents(METHOD1), nullptr); + ASSERT_EQ(cha.GetDependents(METHOD2), nullptr); + ASSERT_EQ(cha.GetDependents(METHOD3), nullptr); + + cha.AddDependency(METHOD1, METHOD2, METHOD_HEADER2); + ASSERT_EQ(cha.GetDependents(METHOD2), nullptr); + ASSERT_EQ(cha.GetDependents(METHOD3), nullptr); + auto dependents = cha.GetDependents(METHOD1); + ASSERT_EQ(dependents->size(), 1u); + ASSERT_EQ(dependents->at(0).first, METHOD2); + ASSERT_EQ(dependents->at(0).second, METHOD_HEADER2); + + cha.AddDependency(METHOD1, METHOD3, METHOD_HEADER3); + ASSERT_EQ(cha.GetDependents(METHOD2), nullptr); + ASSERT_EQ(cha.GetDependents(METHOD3), nullptr); + dependents = cha.GetDependents(METHOD1); + ASSERT_EQ(dependents->size(), 2u); + ASSERT_EQ(dependents->at(0).first, METHOD2); + ASSERT_EQ(dependents->at(0).second, METHOD_HEADER2); + ASSERT_EQ(dependents->at(1).first, METHOD3); + ASSERT_EQ(dependents->at(1).second, METHOD_HEADER3); + + std::unordered_set<OatQuickMethodHeader*> headers; + headers.insert(METHOD_HEADER2); + cha.RemoveDependentsWithMethodHeaders(headers); + ASSERT_EQ(cha.GetDependents(METHOD2), nullptr); + ASSERT_EQ(cha.GetDependents(METHOD3), nullptr); + dependents = cha.GetDependents(METHOD1); + ASSERT_EQ(dependents->size(), 1u); + ASSERT_EQ(dependents->at(0).first, METHOD3); + ASSERT_EQ(dependents->at(0).second, METHOD_HEADER3); + + cha.AddDependency(METHOD2, METHOD1, METHOD_HEADER1); + ASSERT_EQ(cha.GetDependents(METHOD3), nullptr); + dependents = cha.GetDependents(METHOD1); + ASSERT_EQ(dependents->size(), 1u); + dependents = cha.GetDependents(METHOD2); + ASSERT_EQ(dependents->size(), 1u); + + headers.insert(METHOD_HEADER3); + cha.RemoveDependentsWithMethodHeaders(headers); + ASSERT_EQ(cha.GetDependents(METHOD1), nullptr); + ASSERT_EQ(cha.GetDependents(METHOD3), nullptr); + dependents = cha.GetDependents(METHOD2); + ASSERT_EQ(dependents->size(), 1u); + ASSERT_EQ(dependents->at(0).first, METHOD1); + ASSERT_EQ(dependents->at(0).second, METHOD_HEADER1); + + cha.RemoveDependencyFor(METHOD2); + ASSERT_EQ(cha.GetDependents(METHOD1), nullptr); + ASSERT_EQ(cha.GetDependents(METHOD2), nullptr); + ASSERT_EQ(cha.GetDependents(METHOD3), nullptr); +} + +} // namespace art diff --git a/runtime/class_linker-inl.h b/runtime/class_linker-inl.h index 7005c292c8..0a65cd11aa 100644 --- a/runtime/class_linker-inl.h +++ b/runtime/class_linker-inl.h @@ -248,7 +248,7 @@ ArtMethod* ClassLinker::FindMethodForProxy(ObjPtr<mirror::Class> proxy_class, DCHECK(proxy_method->IsProxyMethod<kReadBarrierOption>()); { Thread* const self = Thread::Current(); - ReaderMutexLock mu(self, dex_lock_); + ReaderMutexLock mu(self, *Locks::dex_lock_); // Locate the dex cache of the original interface/Object for (const DexCacheData& data : dex_caches_) { if (!self->IsJWeakCleared(data.weak_root) && diff --git a/runtime/class_linker.cc b/runtime/class_linker.cc index f98f364bc7..674bad7a3c 100644 --- a/runtime/class_linker.cc +++ b/runtime/class_linker.cc @@ -40,6 +40,7 @@ #include "base/time_utils.h" #include "base/unix_file/fd_file.h" #include "base/value_object.h" +#include "cha.h" #include "class_linker-inl.h" #include "class_table-inl.h" #include "compiler_callbacks.h" @@ -96,6 +97,7 @@ #include "ScopedLocalRef.h" #include "scoped_thread_state_change-inl.h" #include "thread-inl.h" +#include "thread_list.h" #include "trace.h" #include "utils.h" #include "utils/dex_cache_arrays_layout-inl.h" @@ -240,10 +242,11 @@ static void WrapExceptionInInitializer(Handle<mirror::Class> klass) ScopedLocalRef<jthrowable> cause(env, env->ExceptionOccurred()); CHECK(cause.get() != nullptr); - // Boot classpath classes should not fail initialization. - if (!Runtime::Current()->IsAotCompiler()) { + // Boot classpath classes should not fail initialization. This is a sanity debug check. This + // cannot in general be guaranteed, but in all likelihood leads to breakage down the line. + if (klass->GetClassLoader() == nullptr && !Runtime::Current()->IsAotCompiler()) { std::string tmp; - CHECK(klass->GetClassLoader() != nullptr) << klass->GetDescriptor(&tmp); + LOG(kIsDebugBuild ? FATAL : WARNING) << klass->GetDescriptor(&tmp) << " failed initialization"; } env->ExceptionClear(); @@ -339,9 +342,7 @@ static void ShuffleForward(size_t* current_field_idx, } ClassLinker::ClassLinker(InternTable* intern_table) - // dex_lock_ is recursive as it may be used in stack dumping. - : dex_lock_("ClassLinker dex lock", kDexLock), - failed_dex_cache_class_lookups_(0), + : failed_dex_cache_class_lookups_(0), class_roots_(nullptr), array_iftable_(nullptr), find_array_class_cache_next_victim_(0), @@ -820,123 +821,6 @@ void ClassLinker::RunRootClinits() { } } -static void SanityCheckArtMethod(ArtMethod* m, - ObjPtr<mirror::Class> expected_class, - const std::vector<gc::space::ImageSpace*>& spaces) - REQUIRES_SHARED(Locks::mutator_lock_) { - if (m->IsRuntimeMethod()) { - ObjPtr<mirror::Class> declaring_class = m->GetDeclaringClassUnchecked(); - CHECK(declaring_class == nullptr) << declaring_class << " " << m->PrettyMethod(); - } else if (m->IsCopied()) { - CHECK(m->GetDeclaringClass() != nullptr) << m->PrettyMethod(); - } else if (expected_class != nullptr) { - CHECK_EQ(m->GetDeclaringClassUnchecked(), expected_class) << m->PrettyMethod(); - } - if (!spaces.empty()) { - bool contains = false; - for (gc::space::ImageSpace* space : spaces) { - auto& header = space->GetImageHeader(); - size_t offset = reinterpret_cast<uint8_t*>(m) - space->Begin(); - - const ImageSection& methods = header.GetMethodsSection(); - contains = contains || methods.Contains(offset); - - const ImageSection& runtime_methods = header.GetRuntimeMethodsSection(); - contains = contains || runtime_methods.Contains(offset); - } - CHECK(contains) << m << " not found"; - } -} - -static void SanityCheckArtMethodPointerArray(ObjPtr<mirror::PointerArray> arr, - ObjPtr<mirror::Class> expected_class, - PointerSize pointer_size, - const std::vector<gc::space::ImageSpace*>& spaces) - REQUIRES_SHARED(Locks::mutator_lock_) { - CHECK(arr != nullptr); - for (int32_t j = 0; j < arr->GetLength(); ++j) { - auto* method = arr->GetElementPtrSize<ArtMethod*>(j, pointer_size); - // expected_class == null means we are a dex cache. - if (expected_class != nullptr) { - CHECK(method != nullptr); - } - if (method != nullptr) { - SanityCheckArtMethod(method, expected_class, spaces); - } - } -} - -static void SanityCheckArtMethodPointerArray(ArtMethod** arr, - size_t size, - PointerSize pointer_size, - const std::vector<gc::space::ImageSpace*>& spaces) - REQUIRES_SHARED(Locks::mutator_lock_) { - CHECK_EQ(arr != nullptr, size != 0u); - if (arr != nullptr) { - bool contains = false; - for (auto space : spaces) { - auto offset = reinterpret_cast<uint8_t*>(arr) - space->Begin(); - if (space->GetImageHeader().GetImageSection( - ImageHeader::kSectionDexCacheArrays).Contains(offset)) { - contains = true; - break; - } - } - CHECK(contains); - } - for (size_t j = 0; j < size; ++j) { - ArtMethod* method = mirror::DexCache::GetElementPtrSize(arr, j, pointer_size); - // expected_class == null means we are a dex cache. - if (method != nullptr) { - SanityCheckArtMethod(method, nullptr, spaces); - } - } -} - -static void SanityCheckObjectsCallback(mirror::Object* obj, void* arg ATTRIBUTE_UNUSED) - REQUIRES_SHARED(Locks::mutator_lock_) { - DCHECK(obj != nullptr); - CHECK(obj->GetClass() != nullptr) << "Null class in object " << obj; - CHECK(obj->GetClass()->GetClass() != nullptr) << "Null class class " << obj; - if (obj->IsClass()) { - auto klass = obj->AsClass(); - for (ArtField& field : klass->GetIFields()) { - CHECK_EQ(field.GetDeclaringClass(), klass); - } - for (ArtField& field : klass->GetSFields()) { - CHECK_EQ(field.GetDeclaringClass(), klass); - } - auto* runtime = Runtime::Current(); - auto image_spaces = runtime->GetHeap()->GetBootImageSpaces(); - auto pointer_size = runtime->GetClassLinker()->GetImagePointerSize(); - for (auto& m : klass->GetMethods(pointer_size)) { - SanityCheckArtMethod(&m, klass, image_spaces); - } - auto* vtable = klass->GetVTable(); - if (vtable != nullptr) { - SanityCheckArtMethodPointerArray(vtable, nullptr, pointer_size, image_spaces); - } - if (klass->ShouldHaveImt()) { - ImTable* imt = klass->GetImt(pointer_size); - for (size_t i = 0; i < ImTable::kSize; ++i) { - SanityCheckArtMethod(imt->Get(i, pointer_size), nullptr, image_spaces); - } - } - if (klass->ShouldHaveEmbeddedVTable()) { - for (int32_t i = 0; i < klass->GetEmbeddedVTableLength(); ++i) { - SanityCheckArtMethod(klass->GetEmbeddedVTableEntry(i, pointer_size), nullptr, image_spaces); - } - } - mirror::IfTable* iftable = klass->GetIfTable(); - for (int32_t i = 0; i < klass->GetIfTableCount(); ++i) { - if (iftable->GetMethodArrayCount(i) > 0) { - SanityCheckArtMethodPointerArray( - iftable->GetMethodArray(i), nullptr, pointer_size, image_spaces); - } - } - } -} - // Set image methods' entry point to interpreter. class SetInterpreterEntrypointArtMethodVisitor : public ArtMethodVisitor { public: @@ -1444,7 +1328,7 @@ bool ClassLinker::UpdateAppImageClassLoadersAndDexCaches( } } { - WriterMutexLock mu2(self, dex_lock_); + WriterMutexLock mu2(self, *Locks::dex_lock_); // Make sure to do this after we update the arrays since we store the resolved types array // in DexCacheData in RegisterDexFileLocked. We need the array pointer to be the one in the // BSS. @@ -1607,6 +1491,153 @@ bool ClassLinker::OpenImageDexFiles(gc::space::ImageSpace* space, return true; } +// Helper class for ArtMethod checks when adding an image. Keeps all required functionality +// together and caches some intermediate results. +class ImageSanityChecks FINAL { + public: + static void CheckObjects(gc::Heap* heap, ClassLinker* class_linker) + REQUIRES_SHARED(Locks::mutator_lock_) { + ImageSanityChecks isc(heap, class_linker); + heap->VisitObjects(ImageSanityChecks::SanityCheckObjectsCallback, &isc); + } + + static void CheckPointerArray(gc::Heap* heap, + ClassLinker* class_linker, + ArtMethod** arr, + size_t size) + REQUIRES_SHARED(Locks::mutator_lock_) { + ImageSanityChecks isc(heap, class_linker); + isc.SanityCheckArtMethodPointerArray(arr, size); + } + + static void SanityCheckObjectsCallback(mirror::Object* obj, void* arg) + REQUIRES_SHARED(Locks::mutator_lock_) { + DCHECK(obj != nullptr); + CHECK(obj->GetClass() != nullptr) << "Null class in object " << obj; + CHECK(obj->GetClass()->GetClass() != nullptr) << "Null class class " << obj; + if (obj->IsClass()) { + ImageSanityChecks* isc = reinterpret_cast<ImageSanityChecks*>(arg); + + auto klass = obj->AsClass(); + for (ArtField& field : klass->GetIFields()) { + CHECK_EQ(field.GetDeclaringClass(), klass); + } + for (ArtField& field : klass->GetSFields()) { + CHECK_EQ(field.GetDeclaringClass(), klass); + } + const auto pointer_size = isc->pointer_size_; + for (auto& m : klass->GetMethods(pointer_size)) { + isc->SanityCheckArtMethod(&m, klass); + } + auto* vtable = klass->GetVTable(); + if (vtable != nullptr) { + isc->SanityCheckArtMethodPointerArray(vtable, nullptr); + } + if (klass->ShouldHaveImt()) { + ImTable* imt = klass->GetImt(pointer_size); + for (size_t i = 0; i < ImTable::kSize; ++i) { + isc->SanityCheckArtMethod(imt->Get(i, pointer_size), nullptr); + } + } + if (klass->ShouldHaveEmbeddedVTable()) { + for (int32_t i = 0; i < klass->GetEmbeddedVTableLength(); ++i) { + isc->SanityCheckArtMethod(klass->GetEmbeddedVTableEntry(i, pointer_size), nullptr); + } + } + mirror::IfTable* iftable = klass->GetIfTable(); + for (int32_t i = 0; i < klass->GetIfTableCount(); ++i) { + if (iftable->GetMethodArrayCount(i) > 0) { + isc->SanityCheckArtMethodPointerArray(iftable->GetMethodArray(i), nullptr); + } + } + } + } + + private: + ImageSanityChecks(gc::Heap* heap, ClassLinker* class_linker) + : spaces_(heap->GetBootImageSpaces()), + pointer_size_(class_linker->GetImagePointerSize()) { + space_begin_.reserve(spaces_.size()); + method_sections_.reserve(spaces_.size()); + runtime_method_sections_.reserve(spaces_.size()); + for (gc::space::ImageSpace* space : spaces_) { + space_begin_.push_back(space->Begin()); + auto& header = space->GetImageHeader(); + method_sections_.push_back(&header.GetMethodsSection()); + runtime_method_sections_.push_back(&header.GetRuntimeMethodsSection()); + } + } + + void SanityCheckArtMethod(ArtMethod* m, ObjPtr<mirror::Class> expected_class) + REQUIRES_SHARED(Locks::mutator_lock_) { + if (m->IsRuntimeMethod()) { + ObjPtr<mirror::Class> declaring_class = m->GetDeclaringClassUnchecked(); + CHECK(declaring_class == nullptr) << declaring_class << " " << m->PrettyMethod(); + } else if (m->IsCopied()) { + CHECK(m->GetDeclaringClass() != nullptr) << m->PrettyMethod(); + } else if (expected_class != nullptr) { + CHECK_EQ(m->GetDeclaringClassUnchecked(), expected_class) << m->PrettyMethod(); + } + if (!spaces_.empty()) { + bool contains = false; + for (size_t i = 0; !contains && i != space_begin_.size(); ++i) { + const size_t offset = reinterpret_cast<uint8_t*>(m) - space_begin_[i]; + contains = method_sections_[i]->Contains(offset) || + runtime_method_sections_[i]->Contains(offset); + } + CHECK(contains) << m << " not found"; + } + } + + void SanityCheckArtMethodPointerArray(ObjPtr<mirror::PointerArray> arr, + ObjPtr<mirror::Class> expected_class) + REQUIRES_SHARED(Locks::mutator_lock_) { + CHECK(arr != nullptr); + for (int32_t j = 0; j < arr->GetLength(); ++j) { + auto* method = arr->GetElementPtrSize<ArtMethod*>(j, pointer_size_); + // expected_class == null means we are a dex cache. + if (expected_class != nullptr) { + CHECK(method != nullptr); + } + if (method != nullptr) { + SanityCheckArtMethod(method, expected_class); + } + } + } + + void SanityCheckArtMethodPointerArray(ArtMethod** arr, size_t size) + REQUIRES_SHARED(Locks::mutator_lock_) { + CHECK_EQ(arr != nullptr, size != 0u); + if (arr != nullptr) { + bool contains = false; + for (auto space : spaces_) { + auto offset = reinterpret_cast<uint8_t*>(arr) - space->Begin(); + if (space->GetImageHeader().GetImageSection( + ImageHeader::kSectionDexCacheArrays).Contains(offset)) { + contains = true; + break; + } + } + CHECK(contains); + } + for (size_t j = 0; j < size; ++j) { + ArtMethod* method = mirror::DexCache::GetElementPtrSize(arr, j, pointer_size_); + // expected_class == null means we are a dex cache. + if (method != nullptr) { + SanityCheckArtMethod(method, nullptr); + } + } + } + + const std::vector<gc::space::ImageSpace*>& spaces_; + const PointerSize pointer_size_; + + // Cached sections from the spaces. + std::vector<const uint8_t*> space_begin_; + std::vector<const ImageSection*> method_sections_; + std::vector<const ImageSection*> runtime_method_sections_; +}; + bool ClassLinker::AddImageSpace( gc::space::ImageSpace* space, Handle<mirror::ClassLoader> class_loader, @@ -1697,10 +1728,10 @@ bool ClassLinker::AddImageSpace( } } else { if (kSanityCheckObjects) { - SanityCheckArtMethodPointerArray(h_dex_cache->GetResolvedMethods(), - h_dex_cache->NumResolvedMethods(), - image_pointer_size_, - heap->GetBootImageSpaces()); + ImageSanityChecks::CheckPointerArray(heap, + this, + h_dex_cache->GetResolvedMethods(), + h_dex_cache->NumResolvedMethods()); } // Register dex files, keep track of existing ones that are conflicts. AppendToBootClassPath(*dex_file.get(), h_dex_cache); @@ -1785,7 +1816,7 @@ bool ClassLinker::AddImageSpace( } } if (!app_image) { - heap->VisitObjects(SanityCheckObjectsCallback, nullptr); + ImageSanityChecks::CheckObjects(heap, this); } } @@ -1949,36 +1980,13 @@ class VisitClassLoaderClassesVisitor : public ClassLoaderVisitor { void Visit(ObjPtr<mirror::ClassLoader> class_loader) REQUIRES_SHARED(Locks::classlinker_classes_lock_, Locks::mutator_lock_) OVERRIDE { ClassTable* const class_table = class_loader->GetClassTable(); - if (!done_ && class_table != nullptr) { - DefiningClassLoaderFilterVisitor visitor(class_loader, visitor_); - if (!class_table->Visit(visitor)) { - // If the visitor ClassTable returns false it means that we don't need to continue. - done_ = true; - } + if (!done_ && class_table != nullptr && !class_table->Visit(*visitor_)) { + // If the visitor ClassTable returns false it means that we don't need to continue. + done_ = true; } } private: - // Class visitor that limits the class visits from a ClassTable to the classes with - // the provided defining class loader. This filter is used to avoid multiple visits - // of the same class which can be recorded for multiple initiating class loaders. - class DefiningClassLoaderFilterVisitor : public ClassVisitor { - public: - DefiningClassLoaderFilterVisitor(ObjPtr<mirror::ClassLoader> defining_class_loader, - ClassVisitor* visitor) - : defining_class_loader_(defining_class_loader), visitor_(visitor) { } - - bool operator()(ObjPtr<mirror::Class> klass) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_) { - if (klass->GetClassLoader() != defining_class_loader_) { - return true; - } - return (*visitor_)(klass); - } - - ObjPtr<mirror::ClassLoader> const defining_class_loader_; - ClassVisitor* const visitor_; - }; - ClassVisitor* const visitor_; // If done is true then we don't need to do any more visiting. bool done_; @@ -2135,109 +2143,6 @@ mirror::PointerArray* ClassLinker::AllocPointerArray(Thread* self, size_t length : static_cast<mirror::Array*>(mirror::IntArray::Alloc(self, length))); } -void ClassLinker::InitializeDexCache(Thread* self, - ObjPtr<mirror::DexCache> dex_cache, - ObjPtr<mirror::String> location, - const DexFile& dex_file, - LinearAlloc* linear_alloc) { - ScopedAssertNoThreadSuspension sants(__FUNCTION__); - DexCacheArraysLayout layout(image_pointer_size_, &dex_file); - uint8_t* raw_arrays = nullptr; - - const OatDexFile* const oat_dex = dex_file.GetOatDexFile(); - if (oat_dex != nullptr && oat_dex->GetDexCacheArrays() != nullptr) { - raw_arrays = oat_dex->GetDexCacheArrays(); - } else if (dex_file.NumStringIds() != 0u || - dex_file.NumTypeIds() != 0u || - dex_file.NumMethodIds() != 0u || - dex_file.NumFieldIds() != 0u) { - // Zero-initialized. - raw_arrays = reinterpret_cast<uint8_t*>(linear_alloc->Alloc(self, layout.Size())); - } - - mirror::StringDexCacheType* strings = (dex_file.NumStringIds() == 0u) ? nullptr : - reinterpret_cast<mirror::StringDexCacheType*>(raw_arrays + layout.StringsOffset()); - GcRoot<mirror::Class>* types = (dex_file.NumTypeIds() == 0u) ? nullptr : - reinterpret_cast<GcRoot<mirror::Class>*>(raw_arrays + layout.TypesOffset()); - ArtMethod** methods = (dex_file.NumMethodIds() == 0u) ? nullptr : - reinterpret_cast<ArtMethod**>(raw_arrays + layout.MethodsOffset()); - ArtField** fields = (dex_file.NumFieldIds() == 0u) ? nullptr : - reinterpret_cast<ArtField**>(raw_arrays + layout.FieldsOffset()); - - size_t num_strings = mirror::DexCache::kDexCacheStringCacheSize; - if (dex_file.NumStringIds() < num_strings) { - num_strings = dex_file.NumStringIds(); - } - - // Note that we allocate the method type dex caches regardless of this flag, - // and we make sure here that they're not used by the runtime. This is in the - // interest of simplicity and to avoid extensive compiler and layout class changes. - // - // If this needs to be mitigated in a production system running this code, - // DexCache::kDexCacheMethodTypeCacheSize can be set to zero. - mirror::MethodTypeDexCacheType* method_types = nullptr; - size_t num_method_types = 0; - - if (dex_file.NumProtoIds() < mirror::DexCache::kDexCacheMethodTypeCacheSize) { - num_method_types = dex_file.NumProtoIds(); - } else { - num_method_types = mirror::DexCache::kDexCacheMethodTypeCacheSize; - } - - if (num_method_types > 0) { - method_types = reinterpret_cast<mirror::MethodTypeDexCacheType*>( - raw_arrays + layout.MethodTypesOffset()); - } - - DCHECK_ALIGNED(raw_arrays, alignof(mirror::StringDexCacheType)) << - "Expected raw_arrays to align to StringDexCacheType."; - DCHECK_ALIGNED(layout.StringsOffset(), alignof(mirror::StringDexCacheType)) << - "Expected StringsOffset() to align to StringDexCacheType."; - DCHECK_ALIGNED(strings, alignof(mirror::StringDexCacheType)) << - "Expected strings to align to StringDexCacheType."; - static_assert(alignof(mirror::StringDexCacheType) == 8u, - "Expected StringDexCacheType to have align of 8."); - if (kIsDebugBuild) { - // Sanity check to make sure all the dex cache arrays are empty. b/28992179 - for (size_t i = 0; i < num_strings; ++i) { - CHECK_EQ(strings[i].load(std::memory_order_relaxed).index, 0u); - CHECK(strings[i].load(std::memory_order_relaxed).object.IsNull()); - } - for (size_t i = 0; i < dex_file.NumTypeIds(); ++i) { - CHECK(types[i].IsNull()); - } - for (size_t i = 0; i < dex_file.NumMethodIds(); ++i) { - CHECK(mirror::DexCache::GetElementPtrSize(methods, i, image_pointer_size_) == nullptr); - } - for (size_t i = 0; i < dex_file.NumFieldIds(); ++i) { - CHECK(mirror::DexCache::GetElementPtrSize(fields, i, image_pointer_size_) == nullptr); - } - for (size_t i = 0; i < num_method_types; ++i) { - CHECK_EQ(method_types[i].load(std::memory_order_relaxed).index, 0u); - CHECK(method_types[i].load(std::memory_order_relaxed).object.IsNull()); - } - } - if (strings != nullptr) { - mirror::StringDexCachePair::Initialize(strings); - } - if (method_types != nullptr) { - mirror::MethodTypeDexCachePair::Initialize(method_types); - } - dex_cache->Init(&dex_file, - location, - strings, - num_strings, - types, - dex_file.NumTypeIds(), - methods, - dex_file.NumMethodIds(), - fields, - dex_file.NumFieldIds(), - method_types, - num_method_types, - image_pointer_size_); -} - mirror::DexCache* ClassLinker::AllocDexCache(ObjPtr<mirror::String>* out_location, Thread* self, const DexFile& dex_file) { @@ -2264,9 +2169,14 @@ mirror::DexCache* ClassLinker::AllocAndInitializeDexCache(Thread* self, ObjPtr<mirror::String> location = nullptr; ObjPtr<mirror::DexCache> dex_cache = AllocDexCache(&location, self, dex_file); if (dex_cache != nullptr) { - WriterMutexLock mu(self, dex_lock_); + WriterMutexLock mu(self, *Locks::dex_lock_); DCHECK(location != nullptr); - InitializeDexCache(self, dex_cache, location, dex_file, linear_alloc); + mirror::DexCache::InitializeDexCache(self, + dex_cache, + location, + &dex_file, + linear_alloc, + image_pointer_size_); } return dex_cache.Ptr(); } @@ -2563,109 +2473,56 @@ mirror::Class* ClassLinker::FindClass(Thread* self, } } else { ScopedObjectAccessUnchecked soa(self); - ObjPtr<mirror::Class> result_ptr; - bool descriptor_equals; - bool known_hierarchy = - FindClassInBaseDexClassLoader(soa, self, descriptor, hash, class_loader, &result_ptr); - if (result_ptr != nullptr) { - // The chain was understood and we found the class. We still need to add the class to - // the class table to protect from racy programs that can try and redefine the path list - // which would change the Class<?> returned for subsequent evaluation of const-class. - DCHECK(known_hierarchy); - DCHECK(result_ptr->DescriptorEquals(descriptor)); - descriptor_equals = true; - } else { - // Either the chain wasn't understood or the class wasn't found. - // - // If the chain was understood but we did not find the class, let the Java-side - // rediscover all this and throw the exception with the right stack trace. Note that - // the Java-side could still succeed for racy programs if another thread is actively - // modifying the class loader's path list. - - if (Runtime::Current()->IsAotCompiler()) { - // Oops, compile-time, can't run actual class-loader code. - ObjPtr<mirror::Throwable> pre_allocated = - Runtime::Current()->GetPreAllocatedNoClassDefFoundError(); - self->SetException(pre_allocated); - return nullptr; + ObjPtr<mirror::Class> cp_klass; + if (FindClassInBaseDexClassLoader(soa, self, descriptor, hash, class_loader, &cp_klass)) { + // The chain was understood. So the value in cp_klass is either the class we were looking + // for, or not found. + if (cp_klass != nullptr) { + return cp_klass.Ptr(); } + // TODO: We handle the boot classpath loader in FindClassInBaseDexClassLoader. Try to unify + // this and the branch above. TODO: throw the right exception here. - ScopedLocalRef<jobject> class_loader_object( - soa.Env(), soa.AddLocalReference<jobject>(class_loader.Get())); - std::string class_name_string(DescriptorToDot(descriptor)); - ScopedLocalRef<jobject> result(soa.Env(), nullptr); - { - ScopedThreadStateChange tsc(self, kNative); - ScopedLocalRef<jobject> class_name_object( - soa.Env(), soa.Env()->NewStringUTF(class_name_string.c_str())); - if (class_name_object.get() == nullptr) { - DCHECK(self->IsExceptionPending()); // OOME. - return nullptr; - } - CHECK(class_loader_object.get() != nullptr); - result.reset(soa.Env()->CallObjectMethod(class_loader_object.get(), - WellKnownClasses::java_lang_ClassLoader_loadClass, - class_name_object.get())); - } - if (self->IsExceptionPending()) { - // If the ClassLoader threw, pass that exception up. - // However, to comply with the RI behavior, first check if another thread succeeded. - result_ptr = LookupClass(self, descriptor, hash, class_loader.Get()); - if (result_ptr != nullptr && !result_ptr->IsErroneous()) { - self->ClearException(); - return EnsureResolved(self, descriptor, result_ptr); - } - return nullptr; - } else if (result.get() == nullptr) { - // broken loader - throw NPE to be compatible with Dalvik - ThrowNullPointerException(StringPrintf("ClassLoader.loadClass returned null for %s", - class_name_string.c_str()).c_str()); - return nullptr; - } - result_ptr = soa.Decode<mirror::Class>(result.get()); - // Check the name of the returned class. - descriptor_equals = result_ptr->DescriptorEquals(descriptor); + // We'll let the Java-side rediscover all this and throw the exception with the right stack + // trace. + } + + if (Runtime::Current()->IsAotCompiler()) { + // Oops, compile-time, can't run actual class-loader code. + ObjPtr<mirror::Throwable> pre_allocated = Runtime::Current()->GetPreAllocatedNoClassDefFoundError(); + self->SetException(pre_allocated); + return nullptr; } - // Try to insert the class to the class table, checking for mismatch. - ObjPtr<mirror::Class> old; + ScopedLocalRef<jobject> class_loader_object(soa.Env(), + soa.AddLocalReference<jobject>(class_loader.Get())); + std::string class_name_string(DescriptorToDot(descriptor)); + ScopedLocalRef<jobject> result(soa.Env(), nullptr); { - ReaderMutexLock mu(self, *Locks::classlinker_classes_lock_); - ClassTable* const class_table = InsertClassTableForClassLoader(class_loader.Get()); - old = class_table->Lookup(descriptor, hash); - if (old == nullptr) { - old = result_ptr; // For the comparison below, after releasing the lock. - if (descriptor_equals) { - class_table->InsertWithHash(result_ptr.Ptr(), hash); - Runtime::Current()->GetHeap()->WriteBarrierEveryFieldOf(class_loader.Get()); - } // else throw below, after releasing the lock. - } - } - if (UNLIKELY(old != result_ptr)) { - // Return `old` (even if `!descriptor_equals`) to mimic the RI behavior for parallel - // capable class loaders. (All class loaders are considered parallel capable on Android.) - mirror::Class* loader_class = class_loader->GetClass(); - const char* loader_class_name = - loader_class->GetDexFile().StringByTypeIdx(loader_class->GetDexTypeIndex()); - LOG(WARNING) << "Initiating class loader of type " << DescriptorToDot(loader_class_name) - << " is not well-behaved; it returned a different Class for racing loadClass(\"" - << DescriptorToDot(descriptor) << "\")."; - return EnsureResolved(self, descriptor, old); - } - if (UNLIKELY(!descriptor_equals)) { - std::string result_storage; - const char* result_name = result_ptr->GetDescriptor(&result_storage); - std::string loader_storage; - const char* loader_class_name = class_loader->GetClass()->GetDescriptor(&loader_storage); - ThrowNoClassDefFoundError( - "Initiating class loader of type %s returned class %s instead of %s.", - DescriptorToDot(loader_class_name).c_str(), - DescriptorToDot(result_name).c_str(), - DescriptorToDot(descriptor).c_str()); + ScopedThreadStateChange tsc(self, kNative); + ScopedLocalRef<jobject> class_name_object(soa.Env(), + soa.Env()->NewStringUTF(class_name_string.c_str())); + if (class_name_object.get() == nullptr) { + DCHECK(self->IsExceptionPending()); // OOME. + return nullptr; + } + CHECK(class_loader_object.get() != nullptr); + result.reset(soa.Env()->CallObjectMethod(class_loader_object.get(), + WellKnownClasses::java_lang_ClassLoader_loadClass, + class_name_object.get())); + } + if (self->IsExceptionPending()) { + // If the ClassLoader threw, pass that exception up. return nullptr; + } else if (result.get() == nullptr) { + // broken loader - throw NPE to be compatible with Dalvik + ThrowNullPointerException(StringPrintf("ClassLoader.loadClass returned null for %s", + class_name_string.c_str()).c_str()); + return nullptr; + } else { + // success, return mirror::Class* + return soa.Decode<mirror::Class>(result.get()).Ptr(); } - // success, return mirror::Class* - return result_ptr.Ptr(); } UNREACHABLE(); } @@ -3339,7 +3196,7 @@ void ClassLinker::AppendToBootClassPath(const DexFile& dex_file, void ClassLinker::RegisterDexFileLocked(const DexFile& dex_file, Handle<mirror::DexCache> dex_cache) { Thread* const self = Thread::Current(); - dex_lock_.AssertExclusiveHeld(self); + Locks::dex_lock_->AssertExclusiveHeld(self); CHECK(dex_cache.Get() != nullptr) << dex_file.GetLocation(); // For app images, the dex cache location may be a suffix of the dex file location since the // dex file location is an absolute path. @@ -3381,7 +3238,7 @@ mirror::DexCache* ClassLinker::RegisterDexFile(const DexFile& dex_file, ObjPtr<mirror::ClassLoader> class_loader) { Thread* self = Thread::Current(); { - ReaderMutexLock mu(self, dex_lock_); + ReaderMutexLock mu(self, *Locks::dex_lock_); ObjPtr<mirror::DexCache> dex_cache = FindDexCacheLocked(self, dex_file, true); if (dex_cache != nullptr) { return dex_cache.Ptr(); @@ -3404,7 +3261,7 @@ mirror::DexCache* ClassLinker::RegisterDexFile(const DexFile& dex_file, dex_file))); Handle<mirror::String> h_location(hs.NewHandle(location)); { - WriterMutexLock mu(self, dex_lock_); + WriterMutexLock mu(self, *Locks::dex_lock_); ObjPtr<mirror::DexCache> dex_cache = FindDexCacheLocked(self, dex_file, true); if (dex_cache != nullptr) { // Another thread managed to initialize the dex cache faster, so use that DexCache. @@ -3420,7 +3277,12 @@ mirror::DexCache* ClassLinker::RegisterDexFile(const DexFile& dex_file, // Do InitializeDexCache while holding dex lock to make sure two threads don't call it at the // same time with the same dex cache. Since the .bss is shared this can cause failing DCHECK // that the arrays are null. - InitializeDexCache(self, h_dex_cache.Get(), h_location.Get(), dex_file, linear_alloc); + mirror::DexCache::InitializeDexCache(self, + h_dex_cache.Get(), + h_location.Get(), + &dex_file, + linear_alloc, + image_pointer_size_); RegisterDexFileLocked(dex_file, h_dex_cache); } table->InsertStrongRoot(h_dex_cache.Get()); @@ -3429,14 +3291,14 @@ mirror::DexCache* ClassLinker::RegisterDexFile(const DexFile& dex_file, void ClassLinker::RegisterDexFile(const DexFile& dex_file, Handle<mirror::DexCache> dex_cache) { - WriterMutexLock mu(Thread::Current(), dex_lock_); + WriterMutexLock mu(Thread::Current(), *Locks::dex_lock_); RegisterDexFileLocked(dex_file, dex_cache); } mirror::DexCache* ClassLinker::FindDexCache(Thread* self, const DexFile& dex_file, bool allow_failure) { - ReaderMutexLock mu(self, dex_lock_); + ReaderMutexLock mu(self, *Locks::dex_lock_); return FindDexCacheLocked(self, dex_file, allow_failure); } @@ -3473,7 +3335,7 @@ mirror::DexCache* ClassLinker::FindDexCacheLocked(Thread* self, void ClassLinker::FixupDexCaches(ArtMethod* resolution_method) { Thread* const self = Thread::Current(); - ReaderMutexLock mu(self, dex_lock_); + ReaderMutexLock mu(self, *Locks::dex_lock_); for (const DexCacheData& data : dex_caches_) { if (!self->IsJWeakCleared(data.weak_root)) { ObjPtr<mirror::DexCache> dex_cache = ObjPtr<mirror::DexCache>::DownCast( @@ -3746,6 +3608,12 @@ void ClassLinker::UpdateClassMethods(ObjPtr<mirror::Class> klass, Runtime::Current()->GetHeap()->WriteBarrierEveryFieldOf(klass); } +bool ClassLinker::RemoveClass(const char* descriptor, ObjPtr<mirror::ClassLoader> class_loader) { + WriterMutexLock mu(Thread::Current(), *Locks::classlinker_classes_lock_); + ClassTable* const class_table = ClassTableForClassLoader(class_loader); + return class_table != nullptr && class_table->Remove(descriptor); +} + mirror::Class* ClassLinker::LookupClass(Thread* self, const char* descriptor, size_t hash, @@ -3796,8 +3664,7 @@ class LookupClassesVisitor : public ClassLoaderVisitor { REQUIRES_SHARED(Locks::classlinker_classes_lock_, Locks::mutator_lock_) OVERRIDE { ClassTable* const class_table = class_loader->GetClassTable(); ObjPtr<mirror::Class> klass = class_table->Lookup(descriptor_, hash_); - // Add `klass` only if `class_loader` is its defining (not just initiating) class loader. - if (klass != nullptr && klass->GetClassLoader() == class_loader) { + if (klass != nullptr) { result_->push_back(klass); } } @@ -3816,7 +3683,6 @@ void ClassLinker::LookupClasses(const char* descriptor, const size_t hash = ComputeModifiedUtf8Hash(descriptor); ObjPtr<mirror::Class> klass = boot_class_table_.Lookup(descriptor, hash); if (klass != nullptr) { - DCHECK(klass->GetClassLoader() == nullptr); result.push_back(klass); } LookupClassesVisitor visitor(descriptor, hash, &result); @@ -3864,6 +3730,17 @@ bool ClassLinker::AttemptSupertypeVerification(Thread* self, return false; } +// Ensures that methods have the kAccSkipAccessChecks bit set. We use the +// kAccVerificationAttempted bit on the class access flags to determine whether this has been done +// before. +static void EnsureSkipAccessChecksMethods(Handle<mirror::Class> klass, PointerSize pointer_size) + REQUIRES_SHARED(Locks::mutator_lock_) { + if (!klass->WasVerificationAttempted()) { + klass->SetSkipAccessChecksFlagOnAllMethods(pointer_size); + klass->SetVerificationAttempted(); + } +} + verifier::MethodVerifier::FailureKind ClassLinker::VerifyClass( Thread* self, Handle<mirror::Class> klass, verifier::HardFailLogMode log_level) { { @@ -3891,7 +3768,7 @@ verifier::MethodVerifier::FailureKind ClassLinker::VerifyClass( // Don't attempt to re-verify if already sufficiently verified. if (klass->IsVerified()) { - EnsureSkipAccessChecksMethods(klass); + EnsureSkipAccessChecksMethods(klass, image_pointer_size_); return verifier::MethodVerifier::kNoFailure; } if (klass->IsCompileTimeVerified() && Runtime::Current()->IsAotCompiler()) { @@ -3910,7 +3787,7 @@ verifier::MethodVerifier::FailureKind ClassLinker::VerifyClass( // Skip verification if disabled. if (!Runtime::Current()->IsVerificationEnabled()) { mirror::Class::SetStatus(klass, mirror::Class::kStatusVerified, self); - EnsureSkipAccessChecksMethods(klass); + EnsureSkipAccessChecksMethods(klass, image_pointer_size_); return verifier::MethodVerifier::kNoFailure; } } @@ -4045,19 +3922,12 @@ verifier::MethodVerifier::FailureKind ClassLinker::VerifyClass( // Mark the class as having a verification attempt to avoid re-running the verifier. klass->SetVerificationAttempted(); } else { - EnsureSkipAccessChecksMethods(klass); + EnsureSkipAccessChecksMethods(klass, image_pointer_size_); } } return verifier_failure; } -void ClassLinker::EnsureSkipAccessChecksMethods(Handle<mirror::Class> klass) { - if (!klass->WasVerificationAttempted()) { - klass->SetSkipAccessChecksFlagOnAllMethods(image_pointer_size_); - klass->SetVerificationAttempted(); - } -} - bool ClassLinker::VerifyClassUsingOatFile(const DexFile& dex_file, ObjPtr<mirror::Class> klass, mirror::Class::Status& oat_file_class_status) { @@ -5027,7 +4897,7 @@ bool ClassLinker::EnsureInitialized(Thread* self, bool can_init_parents) { DCHECK(c.Get() != nullptr); if (c->IsInitialized()) { - EnsureSkipAccessChecksMethods(c); + EnsureSkipAccessChecksMethods(c, image_pointer_size_); self->AssertNoPendingException(); return true; } @@ -5183,6 +5053,12 @@ bool ClassLinker::LinkClass(Thread* self, if (klass->ShouldHaveImt()) { klass->SetImt(imt, image_pointer_size_); } + + // Update CHA info based on whether we override methods. + // Have to do this before setting the class as resolved which allows + // instantiation of klass. + Runtime::Current()->GetClassHierarchyAnalysis()->UpdateAfterLoadingOf(klass); + // This will notify waiters on klass that saw the not yet resolved // class in the class_table_ during EnsureResolved. mirror::Class::SetStatus(klass, mirror::Class::kStatusResolved, self); @@ -5226,6 +5102,11 @@ bool ClassLinker::LinkClass(Thread* self, } } + // Update CHA info based on whether we override methods. + // Have to do this before setting the class as resolved which allows + // instantiation of klass. + Runtime::Current()->GetClassHierarchyAnalysis()->UpdateAfterLoadingOf(h_new_class); + // This will notify waiters on temp class that saw the not yet resolved class in the // class_table_ during EnsureResolved. mirror::Class::SetStatus(klass, mirror::Class::kStatusRetired, self); @@ -8039,42 +7920,6 @@ mirror::MethodType* ClassLinker::ResolveMethodType(const DexFile& dex_file, return type.Get(); } -const char* ClassLinker::MethodShorty(uint32_t method_idx, - ArtMethod* referrer, - uint32_t* length) { - ObjPtr<mirror::Class> declaring_class = referrer->GetDeclaringClass(); - ObjPtr<mirror::DexCache> dex_cache = declaring_class->GetDexCache(); - const DexFile& dex_file = *dex_cache->GetDexFile(); - const DexFile::MethodId& method_id = dex_file.GetMethodId(method_idx); - return dex_file.GetMethodShorty(method_id, length); -} - -class DumpClassVisitor : public ClassVisitor { - public: - explicit DumpClassVisitor(int flags) : flags_(flags) {} - - bool operator()(ObjPtr<mirror::Class> klass) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_) { - klass->DumpClass(LOG_STREAM(ERROR), flags_); - return true; - } - - private: - const int flags_; -}; - -void ClassLinker::DumpAllClasses(int flags) { - DumpClassVisitor visitor(flags); - VisitClasses(&visitor); -} - -static OatFile::OatMethod CreateOatMethod(const void* code) { - CHECK(code != nullptr); - const uint8_t* base = reinterpret_cast<const uint8_t*>(code); // Base of data points at code. - base -= sizeof(void*); // Move backward so that code_offset != 0. - const uint32_t code_offset = sizeof(void*); - return OatFile::OatMethod(base, code_offset); -} - bool ClassLinker::IsQuickResolutionStub(const void* entry_point) const { return (entry_point == GetQuickResolutionStub()) || (quick_resolution_trampoline_ == entry_point); @@ -8094,9 +7939,12 @@ const void* ClassLinker::GetRuntimeQuickGenericJniStub() const { return GetQuickGenericJniStub(); } -void ClassLinker::SetEntryPointsToCompiledCode(ArtMethod* method, - const void* method_code) const { - OatFile::OatMethod oat_method = CreateOatMethod(method_code); +void ClassLinker::SetEntryPointsToCompiledCode(ArtMethod* method, const void* code) const { + CHECK(code != nullptr); + const uint8_t* base = reinterpret_cast<const uint8_t*>(code); // Base of data points at code. + base -= sizeof(void*); // Move backward so that code_offset != 0. + const uint32_t code_offset = sizeof(void*); + OatFile::OatMethod oat_method(base, code_offset); oat_method.LinkMethod(method); } @@ -8104,9 +7952,7 @@ void ClassLinker::SetEntryPointsToInterpreter(ArtMethod* method) const { if (!method->IsNative()) { method->SetEntryPointFromQuickCompiledCode(GetQuickToInterpreterBridge()); } else { - const void* quick_method_code = GetQuickGenericJniStub(); - OatFile::OatMethod oat_method = CreateOatMethod(quick_method_code); - oat_method.LinkMethod(method); + SetEntryPointsToCompiledCode(method, GetQuickGenericJniStub()); } } @@ -8125,8 +7971,8 @@ class CountClassesVisitor : public ClassLoaderVisitor { REQUIRES_SHARED(Locks::classlinker_classes_lock_, Locks::mutator_lock_) OVERRIDE { ClassTable* const class_table = class_loader->GetClassTable(); if (class_table != nullptr) { - num_zygote_classes += class_table->NumZygoteClasses(class_loader); - num_non_zygote_classes += class_table->NumNonZygoteClasses(class_loader); + num_zygote_classes += class_table->NumZygoteClasses(); + num_non_zygote_classes += class_table->NumNonZygoteClasses(); } } @@ -8137,13 +7983,13 @@ class CountClassesVisitor : public ClassLoaderVisitor { size_t ClassLinker::NumZygoteClasses() const { CountClassesVisitor visitor; VisitClassLoaders(&visitor); - return visitor.num_zygote_classes + boot_class_table_.NumZygoteClasses(nullptr); + return visitor.num_zygote_classes + boot_class_table_.NumZygoteClasses(); } size_t ClassLinker::NumNonZygoteClasses() const { CountClassesVisitor visitor; VisitClassLoaders(&visitor); - return visitor.num_non_zygote_classes + boot_class_table_.NumNonZygoteClasses(nullptr); + return visitor.num_non_zygote_classes + boot_class_table_.NumNonZygoteClasses(); } size_t ClassLinker::NumLoadedClasses() { @@ -8157,7 +8003,7 @@ pid_t ClassLinker::GetClassesLockOwner() { } pid_t ClassLinker::GetDexLockOwner() { - return dex_lock_.GetExclusiveOwnerTid(); + return Locks::dex_lock_->GetExclusiveOwnerTid(); } void ClassLinker::SetClassRoot(ClassRoot class_root, ObjPtr<mirror::Class> klass) { @@ -8323,20 +8169,6 @@ jobject ClassLinker::CreatePathClassLoader(Thread* self, return soa.Env()->NewGlobalRef(local_ref.get()); } -ArtMethod* ClassLinker::CreateRuntimeMethod(LinearAlloc* linear_alloc) { - const size_t method_alignment = ArtMethod::Alignment(image_pointer_size_); - const size_t method_size = ArtMethod::Size(image_pointer_size_); - LengthPrefixedArray<ArtMethod>* method_array = AllocArtMethodArray( - Thread::Current(), - linear_alloc, - 1); - ArtMethod* method = &method_array->At(0, method_size, method_alignment); - CHECK(method != nullptr); - method->SetDexMethodIndex(DexFile::kDexNoIndex); - CHECK(method->IsRuntimeMethod()); - return method; -} - void ClassLinker::DropFindArrayClassCache() { std::fill_n(find_array_class_cache_, kFindArrayCacheSize, GcRoot<mirror::Class>(nullptr)); find_array_class_cache_next_victim_ = 0; @@ -8410,7 +8242,7 @@ std::set<DexCacheResolvedClasses> ClassLinker::GetResolvedClasses(bool ignore_bo std::set<DexCacheResolvedClasses> ret; VLOG(class_linker) << "Collecting resolved classes"; const uint64_t start_time = NanoTime(); - ReaderMutexLock mu(soa.Self(), *DexLock()); + ReaderMutexLock mu(soa.Self(), *Locks::dex_lock_); // Loop through all the dex caches and inspect resolved classes. for (const ClassLinker::DexCacheData& data : GetDexCachesData()) { if (soa.Self()->IsJWeakCleared(data.weak_root)) { @@ -8479,7 +8311,7 @@ std::unordered_set<std::string> ClassLinker::GetClassDescriptorsForProfileKeys( std::unordered_map<std::string, const DexFile*> location_to_dex_file; ScopedObjectAccess soa(self); ScopedAssertNoThreadSuspension ants(__FUNCTION__); - ReaderMutexLock mu(self, *DexLock()); + ReaderMutexLock mu(self, *Locks::dex_lock_); for (const ClassLinker::DexCacheData& data : GetDexCachesData()) { if (!self->IsJWeakCleared(data.weak_root)) { ObjPtr<mirror::DexCache> dex_cache = soa.Decode<mirror::DexCache>(data.weak_root); diff --git a/runtime/class_linker.h b/runtime/class_linker.h index 12050745c8..de1f0f09be 100644 --- a/runtime/class_linker.h +++ b/runtime/class_linker.h @@ -140,12 +140,12 @@ class ClassLinker { bool InitWithoutImage(std::vector<std::unique_ptr<const DexFile>> boot_class_path, std::string* error_msg) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_); + REQUIRES(!Locks::dex_lock_); // Initialize class linker from one or more boot images. bool InitFromBootImage(std::string* error_msg) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_); + REQUIRES(!Locks::dex_lock_); // Add an image space to the class linker, may fix up classloader fields and dex cache fields. // The dex files that were newly opened for the space are placed in the out argument @@ -158,13 +158,13 @@ class ClassLinker { const char* dex_location, std::vector<std::unique_ptr<const DexFile>>* out_dex_files, std::string* error_msg) - REQUIRES(!dex_lock_) + REQUIRES(!Locks::dex_lock_) REQUIRES_SHARED(Locks::mutator_lock_); bool OpenImageDexFiles(gc::space::ImageSpace* space, std::vector<std::unique_ptr<const DexFile>>* out_dex_files, std::string* error_msg) - REQUIRES(!dex_lock_) + REQUIRES(!Locks::dex_lock_) REQUIRES_SHARED(Locks::mutator_lock_); // Finds a class by its descriptor, loading it if necessary. @@ -173,18 +173,18 @@ class ClassLinker { const char* descriptor, Handle<mirror::ClassLoader> class_loader) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_); + REQUIRES(!Locks::dex_lock_); // Finds a class by its descriptor using the "system" class loader, ie by searching the // boot_class_path_. mirror::Class* FindSystemClass(Thread* self, const char* descriptor) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_); + REQUIRES(!Locks::dex_lock_); // Finds the array class given for the element class. mirror::Class* FindArrayClass(Thread* self, ObjPtr<mirror::Class>* element_class) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_); + REQUIRES(!Locks::dex_lock_); // Returns true if the class linker is initialized. bool IsInitialized() const { @@ -199,7 +199,7 @@ class ClassLinker { const DexFile& dex_file, const DexFile::ClassDef& dex_class_def) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_); + REQUIRES(!Locks::dex_lock_); // Finds a class by its descriptor, returning null if it isn't wasn't loaded // by the given 'class_loader'. @@ -218,7 +218,9 @@ class ClassLinker { mirror::Class* FindPrimitiveClass(char type) REQUIRES_SHARED(Locks::mutator_lock_); - void DumpAllClasses(int flags) + // General class unloading is not supported, this is used to prune + // unwanted classes during image writing. + bool RemoveClass(const char* descriptor, ObjPtr<mirror::ClassLoader> class_loader) REQUIRES(!Locks::classlinker_classes_lock_) REQUIRES_SHARED(Locks::mutator_lock_); @@ -255,18 +257,18 @@ class ClassLinker { dex::TypeIndex type_idx, ObjPtr<mirror::Class> referrer) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_, !Roles::uninterruptible_); + REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_); // Resolve a Type with the given index from the DexFile, storing the // result in the DexCache. The referrer is used to identify the // target DexCache and ClassLoader to use for resolution. mirror::Class* ResolveType(dex::TypeIndex type_idx, ArtMethod* referrer) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_, !Roles::uninterruptible_); + REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_); mirror::Class* ResolveType(dex::TypeIndex type_idx, ArtField* referrer) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_, !Roles::uninterruptible_); + REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_); // Look up a resolved type with the given ID from the DexFile. The ClassLoader is used to search // for the type, since it may be referenced from but not contained within the given DexFile. @@ -285,7 +287,7 @@ class ClassLinker { Handle<mirror::DexCache> dex_cache, Handle<mirror::ClassLoader> class_loader) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_, !Roles::uninterruptible_); + REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_); // Determine whether a dex cache result should be trusted, or an IncompatibleClassChangeError // check should be performed even after a hit. @@ -307,7 +309,7 @@ class ClassLinker { ArtMethod* referrer, InvokeType type) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_, !Roles::uninterruptible_); + REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_); ArtMethod* GetResolvedMethod(uint32_t method_idx, ArtMethod* referrer) REQUIRES_SHARED(Locks::mutator_lock_); @@ -319,17 +321,17 @@ class ClassLinker { Handle<mirror::DexCache> dex_cache, Handle<mirror::ClassLoader> class_loader) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_, !Roles::uninterruptible_); + REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_); template <ResolveMode kResolveMode> ArtMethod* ResolveMethod(Thread* self, uint32_t method_idx, ArtMethod* referrer, InvokeType type) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_, !Roles::uninterruptible_); + REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_); ArtMethod* ResolveMethodWithoutInvokeType(const DexFile& dex_file, uint32_t method_idx, Handle<mirror::DexCache> dex_cache, Handle<mirror::ClassLoader> class_loader) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_, !Roles::uninterruptible_); + REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_); ArtField* GetResolvedField(uint32_t field_idx, ObjPtr<mirror::Class> field_declaring_class) REQUIRES_SHARED(Locks::mutator_lock_); @@ -337,7 +339,7 @@ class ClassLinker { REQUIRES_SHARED(Locks::mutator_lock_); ArtField* ResolveField(uint32_t field_idx, ArtMethod* referrer, bool is_static) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_, !Roles::uninterruptible_); + REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_); // Resolve a field with a given ID from the DexFile, storing the // result in DexCache. The ClassLinker and ClassLoader are used as @@ -348,7 +350,7 @@ class ClassLinker { Handle<mirror::DexCache> dex_cache, Handle<mirror::ClassLoader> class_loader, bool is_static) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_, !Roles::uninterruptible_); + REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_); // Resolve a field with a given ID from the DexFile, storing the // result in DexCache. The ClassLinker and ClassLoader are used as @@ -359,7 +361,7 @@ class ClassLinker { Handle<mirror::DexCache> dex_cache, Handle<mirror::ClassLoader> class_loader) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_, !Roles::uninterruptible_); + REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_); // Resolve a method type with a given ID from the DexFile, storing // the result in the DexCache. @@ -368,11 +370,7 @@ class ClassLinker { Handle<mirror::DexCache> dex_cache, Handle<mirror::ClassLoader> class_loader) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_, !Roles::uninterruptible_); - - // Get shorty from method index without resolution. Used to do handlerization. - const char* MethodShorty(uint32_t method_idx, ArtMethod* referrer, uint32_t* length) - REQUIRES_SHARED(Locks::mutator_lock_); + REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_); // Returns true on success, false if there's an exception pending. // can_run_clinit=false allows the compiler to attempt to init a class, @@ -382,20 +380,20 @@ class ClassLinker { bool can_init_fields, bool can_init_parents) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_, !Roles::uninterruptible_); + REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_); // Initializes classes that have instances in the image but that have // <clinit> methods so they could not be initialized by the compiler. void RunRootClinits() REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_, !Roles::uninterruptible_); + REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_); mirror::DexCache* RegisterDexFile(const DexFile& dex_file, ObjPtr<mirror::ClassLoader> class_loader) - REQUIRES(!dex_lock_) + REQUIRES(!Locks::dex_lock_) REQUIRES_SHARED(Locks::mutator_lock_); void RegisterDexFile(const DexFile& dex_file, Handle<mirror::DexCache> dex_cache) - REQUIRES(!dex_lock_) + REQUIRES(!Locks::dex_lock_) REQUIRES_SHARED(Locks::mutator_lock_); const std::vector<const DexFile*>& GetBootClassPath() { @@ -412,22 +410,22 @@ class ClassLinker { // can race with insertion and deletion of classes while the visitor is being called. void VisitClassesWithoutClassesLock(ClassVisitor* visitor) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_); + REQUIRES(!Locks::dex_lock_); void VisitClassRoots(RootVisitor* visitor, VisitRootFlags flags) REQUIRES(!Locks::classlinker_classes_lock_, !Locks::trace_lock_) REQUIRES_SHARED(Locks::mutator_lock_); void VisitRoots(RootVisitor* visitor, VisitRootFlags flags) - REQUIRES(!dex_lock_, !Locks::classlinker_classes_lock_, !Locks::trace_lock_) + REQUIRES(!Locks::dex_lock_, !Locks::classlinker_classes_lock_, !Locks::trace_lock_) REQUIRES_SHARED(Locks::mutator_lock_); mirror::DexCache* FindDexCache(Thread* self, const DexFile& dex_file, bool allow_failure = false) - REQUIRES(!dex_lock_) + REQUIRES(!Locks::dex_lock_) REQUIRES_SHARED(Locks::mutator_lock_); void FixupDexCaches(ArtMethod* resolution_method) - REQUIRES(!dex_lock_) + REQUIRES(!Locks::dex_lock_) REQUIRES_SHARED(Locks::mutator_lock_); // Allocate an instance of a java.lang.Object. @@ -475,18 +473,18 @@ class ClassLinker { Handle<mirror::Class> klass, verifier::HardFailLogMode log_level = verifier::HardFailLogMode::kLogNone) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_); + REQUIRES(!Locks::dex_lock_); bool VerifyClassUsingOatFile(const DexFile& dex_file, ObjPtr<mirror::Class> klass, mirror::Class::Status& oat_file_class_status) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_); + REQUIRES(!Locks::dex_lock_); void ResolveClassExceptionHandlerTypes(Handle<mirror::Class> klass) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_); + REQUIRES(!Locks::dex_lock_); void ResolveMethodExceptionHandlerTypes(ArtMethod* klass) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_); + REQUIRES(!Locks::dex_lock_); mirror::Class* CreateProxyClass(ScopedObjectAccessAlreadyRunnable& soa, jstring name, @@ -499,7 +497,7 @@ class ClassLinker { REQUIRES_SHARED(Locks::mutator_lock_); template<ReadBarrierOption kReadBarrierOption = kWithReadBarrier> ArtMethod* FindMethodForProxy(ObjPtr<mirror::Class> proxy_class, ArtMethod* proxy_method) - REQUIRES(!dex_lock_) + REQUIRES(!Locks::dex_lock_) REQUIRES_SHARED(Locks::mutator_lock_); // Get the oat code for a method when its class isn't yet initialized. @@ -562,7 +560,7 @@ class ClassLinker { // Note: the objects are not completely set up. Do not use this outside of tests and the compiler. jobject CreatePathClassLoader(Thread* self, const std::vector<const DexFile*>& dex_files) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_); + REQUIRES(!Locks::dex_lock_); PointerSize GetImagePointerSize() const { return image_pointer_size_; @@ -573,8 +571,6 @@ class ClassLinker { REQUIRES(Locks::classlinker_classes_lock_) REQUIRES_SHARED(Locks::mutator_lock_); - ArtMethod* CreateRuntimeMethod(LinearAlloc* linear_alloc); - // Clear the ArrayClass cache. This is necessary when cleaning up for the image, as the cache // entries are roots, but potentially not image classes. void DropFindArrayClassCache() REQUIRES_SHARED(Locks::mutator_lock_); @@ -605,11 +601,11 @@ class ClassLinker { REQUIRES_SHARED(Locks::mutator_lock_); std::set<DexCacheResolvedClasses> GetResolvedClasses(bool ignore_boot_classes) - REQUIRES(!dex_lock_); + REQUIRES(!Locks::dex_lock_); std::unordered_set<std::string> GetClassDescriptorsForProfileKeys( const std::set<DexCacheResolvedClasses>& classes) - REQUIRES(!dex_lock_); + REQUIRES(!Locks::dex_lock_); static bool IsBootClassLoader(ScopedObjectAccessAlreadyRunnable& soa, ObjPtr<mirror::ClassLoader> class_loader) @@ -644,7 +640,7 @@ class ClassLinker { // class. void ThrowEarlierClassFailure(ObjPtr<mirror::Class> c, bool wrap_in_no_class_def = false) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_); + REQUIRES(!Locks::dex_lock_); // Get the actual holding class for a copied method. Pretty slow, don't call often. mirror::Class* GetHoldingClassOfCopiedMethod(ArtMethod* method) @@ -674,7 +670,7 @@ class ClassLinker { bool AttemptSupertypeVerification(Thread* self, Handle<mirror::Class> klass, Handle<mirror::Class> supertype) - REQUIRES(!dex_lock_) + REQUIRES(!Locks::dex_lock_) REQUIRES_SHARED(Locks::mutator_lock_); static void DeleteClassLoader(Thread* self, const ClassLoaderData& data) @@ -698,7 +694,7 @@ class ClassLinker { void FinishInit(Thread* self) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_, !Roles::uninterruptible_); + REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_); // For early bootstrapping by Init mirror::Class* AllocClass(Thread* self, @@ -725,17 +721,9 @@ class ClassLinker { const DexFile& dex_file, LinearAlloc* linear_alloc) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_) + REQUIRES(!Locks::dex_lock_) REQUIRES(!Roles::uninterruptible_); - void InitializeDexCache(Thread* self, - ObjPtr<mirror::DexCache> dex_cache, - ObjPtr<mirror::String> location, - const DexFile& dex_file, - LinearAlloc* linear_alloc) - REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(dex_lock_); - mirror::Class* CreatePrimitiveClass(Thread* self, Primitive::Type type) REQUIRES_SHARED(Locks::mutator_lock_) REQUIRES(!Roles::uninterruptible_); @@ -749,14 +737,14 @@ class ClassLinker { size_t hash, Handle<mirror::ClassLoader> class_loader) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_, !Roles::uninterruptible_); + REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_); void AppendToBootClassPath(Thread* self, const DexFile& dex_file) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_); + REQUIRES(!Locks::dex_lock_); void AppendToBootClassPath(const DexFile& dex_file, Handle<mirror::DexCache> dex_cache) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_); + REQUIRES(!Locks::dex_lock_); // Precomputes size needed for Class, in the case of a non-temporary class this size must be // sufficient to hold all static fields. @@ -804,7 +792,7 @@ class ClassLinker { Handle<mirror::ClassLoader> class_loader, ObjPtr<mirror::Class>* result) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_); + REQUIRES(!Locks::dex_lock_); // Finds a class by its descriptor, returning NULL if it isn't wasn't loaded // by the given 'class_loader'. Uses the provided hash for the descriptor. @@ -816,10 +804,10 @@ class ClassLinker { REQUIRES_SHARED(Locks::mutator_lock_); void RegisterDexFileLocked(const DexFile& dex_file, Handle<mirror::DexCache> dex_cache) - REQUIRES(dex_lock_) + REQUIRES(Locks::dex_lock_) REQUIRES_SHARED(Locks::mutator_lock_); mirror::DexCache* FindDexCacheLocked(Thread* self, const DexFile& dex_file, bool allow_failure) - REQUIRES(dex_lock_) + REQUIRES(Locks::dex_lock_) REQUIRES_SHARED(Locks::mutator_lock_); bool InitializeClass(Thread* self, @@ -827,12 +815,12 @@ class ClassLinker { bool can_run_clinit, bool can_init_parents) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_); + REQUIRES(!Locks::dex_lock_); bool InitializeDefaultInterfaceRecursive(Thread* self, Handle<mirror::Class> klass, bool can_run_clinit, bool can_init_parents) - REQUIRES(!dex_lock_) + REQUIRES(!Locks::dex_lock_) REQUIRES_SHARED(Locks::mutator_lock_); bool WaitForInitializeClass(Handle<mirror::Class> klass, Thread* self, @@ -865,7 +853,7 @@ class ClassLinker { bool LoadSuperAndInterfaces(Handle<mirror::Class> klass, const DexFile& dex_file) REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_); + REQUIRES(!Locks::dex_lock_); bool LinkMethods(Thread* self, Handle<mirror::Class> klass, @@ -1031,17 +1019,11 @@ class ClassLinker { void CheckProxyMethod(ArtMethod* method, ArtMethod* prototype) const REQUIRES_SHARED(Locks::mutator_lock_); - // For use by ImageWriter to find DexCaches for its roots - ReaderWriterMutex* DexLock() - REQUIRES_SHARED(Locks::mutator_lock_) - LOCK_RETURNED(dex_lock_) { - return &dex_lock_; - } - size_t GetDexCacheCount() REQUIRES_SHARED(Locks::mutator_lock_, dex_lock_) { + size_t GetDexCacheCount() REQUIRES_SHARED(Locks::mutator_lock_, Locks::dex_lock_) { return dex_caches_.size(); } const std::list<DexCacheData>& GetDexCachesData() - REQUIRES_SHARED(Locks::mutator_lock_, dex_lock_) { + REQUIRES_SHARED(Locks::mutator_lock_, Locks::dex_lock_) { return dex_caches_; } @@ -1050,12 +1032,6 @@ class ClassLinker { void CreateProxyMethod(Handle<mirror::Class> klass, ArtMethod* prototype, ArtMethod* out) REQUIRES_SHARED(Locks::mutator_lock_); - // Ensures that methods have the kAccSkipAccessChecks bit set. We use the - // kAccVerificationAttempted bit on the class access flags to determine whether this has been done - // before. - void EnsureSkipAccessChecksMethods(Handle<mirror::Class> c) - REQUIRES_SHARED(Locks::mutator_lock_); - // Register a class loader and create its class table and allocator. Should not be called if // these are already created. void RegisterClassLoader(ObjPtr<mirror::ClassLoader> class_loader) @@ -1080,7 +1056,7 @@ class ClassLinker { mirror::Class* EnsureResolved(Thread* self, const char* descriptor, ObjPtr<mirror::Class> klass) WARN_UNUSED REQUIRES_SHARED(Locks::mutator_lock_) - REQUIRES(!dex_lock_); + REQUIRES(!Locks::dex_lock_); void FixupTemporaryDeclaringClass(ObjPtr<mirror::Class> temp_class, ObjPtr<mirror::Class> new_class) @@ -1111,12 +1087,12 @@ class ClassLinker { ClassTable::ClassSet* new_class_set, bool* out_forward_dex_cache_array, std::string* out_error_msg) - REQUIRES(!dex_lock_) + REQUIRES(!Locks::dex_lock_) REQUIRES_SHARED(Locks::mutator_lock_); // Check that c1 == FindSystemClass(self, descriptor). Abort with class dumps otherwise. void CheckSystemClass(Thread* self, Handle<mirror::Class> c1, const char* descriptor) - REQUIRES(!dex_lock_) + REQUIRES(!Locks::dex_lock_) REQUIRES_SHARED(Locks::mutator_lock_); // Sets imt_ref appropriately for LinkInterfaceMethods. @@ -1147,10 +1123,9 @@ class ClassLinker { std::vector<const DexFile*> boot_class_path_; std::vector<std::unique_ptr<const DexFile>> boot_dex_files_; - mutable ReaderWriterMutex dex_lock_ DEFAULT_MUTEX_ACQUIRED_AFTER; // JNI weak globals and side data to allow dex caches to get unloaded. We lazily delete weak // globals when we register new dex files. - std::list<DexCacheData> dex_caches_ GUARDED_BY(dex_lock_); + std::list<DexCacheData> dex_caches_ GUARDED_BY(Locks::dex_lock_); // This contains the class loaders which have class tables. It is populated by // InsertClassTableForClassLoader. diff --git a/runtime/class_linker_test.cc b/runtime/class_linker_test.cc index 7c06ffedb8..ddb9e590a7 100644 --- a/runtime/class_linker_test.cc +++ b/runtime/class_linker_test.cc @@ -1319,7 +1319,7 @@ TEST_F(ClassLinkerTest, RegisterDexFileName) { ClassLinker* class_linker = Runtime::Current()->GetClassLinker(); MutableHandle<mirror::DexCache> dex_cache(hs.NewHandle<mirror::DexCache>(nullptr)); { - ReaderMutexLock mu(soa.Self(), *class_linker->DexLock()); + ReaderMutexLock mu(soa.Self(), *Locks::dex_lock_); for (const ClassLinker::DexCacheData& data : class_linker->GetDexCachesData()) { dex_cache.Assign(soa.Self()->DecodeJObject(data.weak_root)->AsDexCache()); if (dex_cache.Get() != nullptr) { @@ -1343,7 +1343,7 @@ TEST_F(ClassLinkerTest, RegisterDexFileName) { 0u, nullptr)); { - WriterMutexLock mu(soa.Self(), *class_linker->DexLock()); + WriterMutexLock mu(soa.Self(), *Locks::dex_lock_); // Check that inserting with a UTF16 name works. class_linker->RegisterDexFileLocked(*dex_file, dex_cache); } diff --git a/runtime/class_table.cc b/runtime/class_table.cc index 81cdce57a8..0fcce6b307 100644 --- a/runtime/class_table.cc +++ b/runtime/class_table.cc @@ -83,29 +83,18 @@ mirror::Class* ClassTable::UpdateClass(const char* descriptor, mirror::Class* kl #pragma clang diagnostic pop // http://b/31104323 -size_t ClassTable::CountDefiningLoaderClasses(ObjPtr<mirror::ClassLoader> defining_loader, - const ClassSet& set) const { - size_t count = 0; - for (const GcRoot<mirror::Class>& klass : set) { - if (klass.Read()->GetClassLoader() == defining_loader) { - ++count; - } - } - return count; -} - -size_t ClassTable::NumZygoteClasses(ObjPtr<mirror::ClassLoader> defining_loader) const { +size_t ClassTable::NumZygoteClasses() const { ReaderMutexLock mu(Thread::Current(), lock_); size_t sum = 0; for (size_t i = 0; i < classes_.size() - 1; ++i) { - sum += CountDefiningLoaderClasses(defining_loader, classes_[i]); + sum += classes_[i].Size(); } return sum; } -size_t ClassTable::NumNonZygoteClasses(ObjPtr<mirror::ClassLoader> defining_loader) const { +size_t ClassTable::NumNonZygoteClasses() const { ReaderMutexLock mu(Thread::Current(), lock_); - return CountDefiningLoaderClasses(defining_loader, classes_.back()); + return classes_.back().Size(); } mirror::Class* ClassTable::Lookup(const char* descriptor, size_t hash) { @@ -113,7 +102,7 @@ mirror::Class* ClassTable::Lookup(const char* descriptor, size_t hash) { for (ClassSet& class_set : classes_) { auto it = class_set.FindWithHash(descriptor, hash); if (it != class_set.end()) { - return it->Read(); + return it->Read(); } } return nullptr; @@ -153,6 +142,7 @@ uint32_t ClassTable::ClassDescriptorHashEquals::operator()(const GcRoot<mirror:: bool ClassTable::ClassDescriptorHashEquals::operator()(const GcRoot<mirror::Class>& a, const GcRoot<mirror::Class>& b) const { + DCHECK_EQ(a.Read()->GetClassLoader(), b.Read()->GetClassLoader()); std::string temp; return a.Read()->DescriptorEquals(b.Read()->GetDescriptor(&temp)); } diff --git a/runtime/class_table.h b/runtime/class_table.h index 92634a434a..558c144013 100644 --- a/runtime/class_table.h +++ b/runtime/class_table.h @@ -84,14 +84,10 @@ class ClassTable { REQUIRES_SHARED(Locks::mutator_lock_); // Returns the number of classes in previous snapshots. - size_t NumZygoteClasses(ObjPtr<mirror::ClassLoader> defining_loader) const - REQUIRES(!lock_) - REQUIRES_SHARED(Locks::mutator_lock_); + size_t NumZygoteClasses() const REQUIRES(!lock_); // Returns all off the classes in the lastest snapshot. - size_t NumNonZygoteClasses(ObjPtr<mirror::ClassLoader> defining_loader) const - REQUIRES(!lock_) - REQUIRES_SHARED(Locks::mutator_lock_); + size_t NumNonZygoteClasses() const REQUIRES(!lock_); // Update a class in the table with the new class. Returns the existing class which was replaced. mirror::Class* UpdateClass(const char* descriptor, mirror::Class* new_klass, size_t hash) @@ -177,11 +173,6 @@ class ClassTable { private: void InsertWithoutLocks(ObjPtr<mirror::Class> klass) NO_THREAD_SAFETY_ANALYSIS; - size_t CountDefiningLoaderClasses(ObjPtr<mirror::ClassLoader> defining_loader, - const ClassSet& set) const - REQUIRES(lock_) - REQUIRES_SHARED(Locks::mutator_lock_); - // Return true if we inserted the oat file, false if it already exists. bool InsertOatFileLocked(const OatFile* oat_file) REQUIRES(lock_) diff --git a/runtime/dex_instruction.h b/runtime/dex_instruction.h index 99b9f9dd13..578550cae2 100644 --- a/runtime/dex_instruction.h +++ b/runtime/dex_instruction.h @@ -189,6 +189,7 @@ class Instruction { kVerifyVarArgRangeNonZero = 0x100000, kVerifyRuntimeOnly = 0x200000, kVerifyError = 0x400000, + kVerifyRegHPrototype = 0x800000 }; static constexpr uint32_t kMaxVarArgRegs = 5; @@ -579,6 +580,10 @@ class Instruction { kVerifyRegCNewArray | kVerifyRegCType | kVerifyRegCWide)); } + int GetVerifyTypeArgumentH() const { + return (kInstructionVerifyFlags[Opcode()] & kVerifyRegHPrototype); + } + int GetVerifyExtraFlags() const { return (kInstructionVerifyFlags[Opcode()] & (kVerifyArrayData | kVerifyBranchTarget | kVerifySwitchTargets | kVerifyVarArg | kVerifyVarArgNonZero | kVerifyVarArgRange | diff --git a/runtime/dex_instruction_list.h b/runtime/dex_instruction_list.h index e537afe313..ca2ce1d990 100644 --- a/runtime/dex_instruction_list.h +++ b/runtime/dex_instruction_list.h @@ -269,8 +269,8 @@ V(0xF7, UNUSED_F7, "unused-f7", k10x, kIndexUnknown, 0, kVerifyError) \ V(0xF8, UNUSED_F8, "unused-f8", k10x, kIndexUnknown, 0, kVerifyError) \ V(0xF9, UNUSED_F9, "unused-f9", k10x, kIndexUnknown, 0, kVerifyError) \ - V(0xFA, INVOKE_POLYMORPHIC, "invoke-polymorphic", k45cc, kIndexMethodAndProtoRef, kContinue | kThrow | kInvoke, kVerifyRegBMethod | kVerifyVarArgNonZero | kExperimental) \ - V(0xFB, INVOKE_POLYMORPHIC_RANGE, "invoke-polymorphic/range", k4rcc, kIndexMethodAndProtoRef, kContinue | kThrow | kInvoke, kVerifyRegBMethod | kVerifyVarArgRangeNonZero | kExperimental) \ + V(0xFA, INVOKE_POLYMORPHIC, "invoke-polymorphic", k45cc, kIndexMethodAndProtoRef, kContinue | kThrow | kInvoke, kVerifyRegBMethod | kVerifyVarArgNonZero | kVerifyRegHPrototype) \ + V(0xFB, INVOKE_POLYMORPHIC_RANGE, "invoke-polymorphic/range", k4rcc, kIndexMethodAndProtoRef, kContinue | kThrow | kInvoke, kVerifyRegBMethod | kVerifyVarArgRangeNonZero | kVerifyRegHPrototype) \ V(0xFC, UNUSED_FC, "unused-fc", k10x, kIndexUnknown, 0, kVerifyError) \ V(0xFD, UNUSED_FD, "unused-fd", k10x, kIndexUnknown, 0, kVerifyError) \ V(0xFE, UNUSED_FE, "unused-fe", k10x, kIndexUnknown, 0, kVerifyError) \ diff --git a/runtime/gc/allocator/rosalloc.cc b/runtime/gc/allocator/rosalloc.cc index 40186f8f26..2e4475f225 100644 --- a/runtime/gc/allocator/rosalloc.cc +++ b/runtime/gc/allocator/rosalloc.cc @@ -2068,26 +2068,30 @@ void RosAlloc::LogFragmentationAllocFailure(std::ostream& os, size_t failed_allo size_t largest_continuous_free_pages = 0; WriterMutexLock wmu(self, bulk_free_lock_); MutexLock mu(self, lock_); + uint64_t total_free = 0; for (FreePageRun* fpr : free_page_runs_) { largest_continuous_free_pages = std::max(largest_continuous_free_pages, fpr->ByteSize(this)); + total_free += fpr->ByteSize(this); } + size_t required_bytes = 0; + const char* new_buffer_msg = ""; if (failed_alloc_bytes > kLargeSizeThreshold) { // Large allocation. - size_t required_bytes = RoundUp(failed_alloc_bytes, kPageSize); - if (required_bytes > largest_continuous_free_pages) { - os << "; failed due to fragmentation (required continguous free " - << required_bytes << " bytes where largest contiguous free " - << largest_continuous_free_pages << " bytes)"; - } + required_bytes = RoundUp(failed_alloc_bytes, kPageSize); } else { // Non-large allocation. - size_t required_bytes = numOfPages[SizeToIndex(failed_alloc_bytes)] * kPageSize; - if (required_bytes > largest_continuous_free_pages) { - os << "; failed due to fragmentation (required continguous free " - << required_bytes << " bytes for a new buffer where largest contiguous free " - << largest_continuous_free_pages << " bytes)"; - } + required_bytes = numOfPages[SizeToIndex(failed_alloc_bytes)] * kPageSize; + new_buffer_msg = " for a new buffer"; + } + if (required_bytes > largest_continuous_free_pages) { + os << "; failed due to fragmentation (" + << "required contiguous free " << required_bytes << " bytes" << new_buffer_msg + << ", largest contiguous free " << largest_continuous_free_pages << " bytes" + << ", total free pages " << total_free << " bytes" + << ", space footprint " << footprint_ << " bytes" + << ", space max capacity " << max_capacity_ << " bytes" + << ")" << std::endl; } } diff --git a/runtime/gc/collector/concurrent_copying.cc b/runtime/gc/collector/concurrent_copying.cc index 19ee0fbeab..fbab73f022 100644 --- a/runtime/gc/collector/concurrent_copying.cc +++ b/runtime/gc/collector/concurrent_copying.cc @@ -812,13 +812,13 @@ void ConcurrentCopying::ProcessFalseGrayStack() { false_gray_stack_.clear(); } - void ConcurrentCopying::IssueEmptyCheckpoint() { Thread* self = Thread::Current(); ThreadList* thread_list = Runtime::Current()->GetThreadList(); Barrier* barrier = thread_list->EmptyCheckpointBarrier(); barrier->Init(self, 0); - size_t barrier_count = thread_list->RunEmptyCheckpoint(); + std::vector<uint32_t> runnable_thread_ids; // Used in debug build only + size_t barrier_count = thread_list->RunEmptyCheckpoint(runnable_thread_ids); // If there are no threads to wait which implys that all the checkpoint functions are finished, // then no need to release the mutator lock. if (barrier_count == 0) { @@ -828,7 +828,27 @@ void ConcurrentCopying::IssueEmptyCheckpoint() { Locks::mutator_lock_->SharedUnlock(self); { ScopedThreadStateChange tsc(self, kWaitingForCheckPointsToRun); - barrier->Increment(self, barrier_count); + if (kIsDebugBuild) { + static constexpr uint64_t kEmptyCheckpointTimeoutMs = 600 * 1000; // 10 minutes. + bool timed_out = barrier->Increment(self, barrier_count, kEmptyCheckpointTimeoutMs); + if (timed_out) { + Runtime* runtime = Runtime::Current(); + std::ostringstream ss; + ss << "Empty checkpoint timeout\n"; + ss << "Barrier count " << barrier->GetCount(self) << "\n"; + ss << "Runnable thread IDs"; + for (uint32_t tid : runnable_thread_ids) { + ss << " " << tid; + } + ss << "\n"; + Locks::mutator_lock_->Dump(ss); + ss << "\n"; + runtime->GetThreadList()->Dump(ss); + LOG(FATAL) << ss.str(); + } + } else { + barrier->Increment(self, barrier_count); + } } Locks::mutator_lock_->SharedLock(self); } diff --git a/runtime/gc/heap.cc b/runtime/gc/heap.cc index 5c219cc871..8ff5e5a062 100644 --- a/runtime/gc/heap.cc +++ b/runtime/gc/heap.cc @@ -1326,7 +1326,9 @@ void Heap::ThrowOutOfMemoryError(Thread* self, size_t byte_count, AllocatorType std::ostringstream oss; size_t total_bytes_free = GetFreeMemory(); oss << "Failed to allocate a " << byte_count << " byte allocation with " << total_bytes_free - << " free bytes and " << PrettySize(GetFreeMemoryUntilOOME()) << " until OOM"; + << " free bytes and " << PrettySize(GetFreeMemoryUntilOOME()) << " until OOM," + << " max allowed footprint " << max_allowed_footprint_ << ", growth limit " + << growth_limit_; // If the allocation failed due to fragmentation, print out the largest continuous allocation. if (total_bytes_free >= byte_count) { space::AllocSpace* space = nullptr; diff --git a/runtime/interpreter/interpreter_common.cc b/runtime/interpreter/interpreter_common.cc index 72dbe6aace..22da07dd24 100644 --- a/runtime/interpreter/interpreter_common.cc +++ b/runtime/interpreter/interpreter_common.cc @@ -865,11 +865,6 @@ inline bool DoInvokePolymorphic(Thread* self, // The invoke_method_idx here is the name of the signature polymorphic method that // was symbolically invoked in bytecode (say MethodHandle.invoke or MethodHandle.invokeExact) // and not the method that we'll dispatch to in the end. - // - // TODO(narayan) We'll have to check in the verifier that this is in fact a - // signature polymorphic method so that we disallow calls via invoke-polymorphic - // to non sig-poly methods. This would also have the side effect of verifying - // that vRegC really is a reference type. StackHandleScope<6> hs(self); Handle<mirror::MethodHandleImpl> method_handle(hs.NewHandle( ObjPtr<mirror::MethodHandleImpl>::DownCast( diff --git a/runtime/jit/jit_code_cache.cc b/runtime/jit/jit_code_cache.cc index 2ae989a239..93f50ad2b1 100644 --- a/runtime/jit/jit_code_cache.cc +++ b/runtime/jit/jit_code_cache.cc @@ -23,6 +23,7 @@ #include "base/stl_util.h" #include "base/systrace.h" #include "base/time_utils.h" +#include "cha.h" #include "debugger_interface.h" #include "entrypoints/runtime_asm_entrypoints.h" #include "gc/accounting/bitmap-inl.h" @@ -217,7 +218,9 @@ uint8_t* JitCodeCache::CommitCode(Thread* self, const uint8_t* code, size_t code_size, bool osr, - Handle<mirror::ObjectArray<mirror::Object>> roots) { + Handle<mirror::ObjectArray<mirror::Object>> roots, + bool has_should_deoptimize_flag, + const ArenaSet<ArtMethod*>& cha_single_implementation_list) { uint8_t* result = CommitCodeInternal(self, method, stack_map, @@ -228,7 +231,9 @@ uint8_t* JitCodeCache::CommitCode(Thread* self, code, code_size, osr, - roots); + roots, + has_should_deoptimize_flag, + cha_single_implementation_list); if (result == nullptr) { // Retry. GarbageCollectCache(self); @@ -242,7 +247,9 @@ uint8_t* JitCodeCache::CommitCode(Thread* self, code, code_size, osr, - roots); + roots, + has_should_deoptimize_flag, + cha_single_implementation_list); } return result; } @@ -277,6 +284,10 @@ static void FillRootTableLength(uint8_t* roots_data, uint32_t length) { reinterpret_cast<uint32_t*>(roots_data)[length] = length; } +static const uint8_t* FromStackMapToRoots(const uint8_t* stack_map_data) { + return stack_map_data - ComputeRootTableSize(GetNumberOfRoots(stack_map_data)); +} + static void FillRootTable(uint8_t* roots_data, Handle<mirror::ObjectArray<mirror::Object>> roots) REQUIRES_SHARED(Locks::mutator_lock_) { GcRoot<mirror::Object>* gc_roots = reinterpret_cast<GcRoot<mirror::Object>*>(roots_data); @@ -293,7 +304,6 @@ static void FillRootTable(uint8_t* roots_data, Handle<mirror::ObjectArray<mirror } gc_roots[i] = GcRoot<mirror::Object>(object); } - FillRootTableLength(roots_data, length); } static uint8_t* GetRootTable(const void* code_ptr, uint32_t* number_of_roots = nullptr) { @@ -359,7 +369,7 @@ void JitCodeCache::SweepRootTables(IsMarkedVisitor* visitor) { } } -void JitCodeCache::FreeCode(const void* code_ptr, ArtMethod* method ATTRIBUTE_UNUSED) { +void JitCodeCache::FreeCode(const void* code_ptr) { uintptr_t allocation = FromCodeToAllocation(code_ptr); // Notify native debugger that we are about to remove the code. // It does nothing if we are not using native debugger. @@ -368,41 +378,69 @@ void JitCodeCache::FreeCode(const void* code_ptr, ArtMethod* method ATTRIBUTE_UN FreeCode(reinterpret_cast<uint8_t*>(allocation)); } +void JitCodeCache::FreeAllMethodHeaders( + const std::unordered_set<OatQuickMethodHeader*>& method_headers) { + { + MutexLock mu(Thread::Current(), *Locks::cha_lock_); + Runtime::Current()->GetClassHierarchyAnalysis() + ->RemoveDependentsWithMethodHeaders(method_headers); + } + + // We need to remove entries in method_headers from CHA dependencies + // first since once we do FreeCode() below, the memory can be reused + // so it's possible for the same method_header to start representing + // different compile code. + MutexLock mu(Thread::Current(), lock_); + ScopedCodeCacheWrite scc(code_map_.get()); + for (const OatQuickMethodHeader* method_header : method_headers) { + FreeCode(method_header->GetCode()); + } +} + void JitCodeCache::RemoveMethodsIn(Thread* self, const LinearAlloc& alloc) { ScopedTrace trace(__PRETTY_FUNCTION__); - MutexLock mu(self, lock_); - // We do not check if a code cache GC is in progress, as this method comes - // with the classlinker_classes_lock_ held, and suspending ourselves could - // lead to a deadlock. + // We use a set to first collect all method_headers whose code need to be + // removed. We need to free the underlying code after we remove CHA dependencies + // for entries in this set. And it's more efficient to iterate through + // the CHA dependency map just once with an unordered_set. + std::unordered_set<OatQuickMethodHeader*> method_headers; { - ScopedCodeCacheWrite scc(code_map_.get()); - for (auto it = method_code_map_.begin(); it != method_code_map_.end();) { - if (alloc.ContainsUnsafe(it->second)) { - FreeCode(it->first, it->second); - it = method_code_map_.erase(it); + MutexLock mu(self, lock_); + // We do not check if a code cache GC is in progress, as this method comes + // with the classlinker_classes_lock_ held, and suspending ourselves could + // lead to a deadlock. + { + ScopedCodeCacheWrite scc(code_map_.get()); + for (auto it = method_code_map_.begin(); it != method_code_map_.end();) { + if (alloc.ContainsUnsafe(it->second)) { + method_headers.insert(OatQuickMethodHeader::FromCodePointer(it->first)); + it = method_code_map_.erase(it); + } else { + ++it; + } + } + } + for (auto it = osr_code_map_.begin(); it != osr_code_map_.end();) { + if (alloc.ContainsUnsafe(it->first)) { + // Note that the code has already been pushed to method_headers in the loop + // above and is going to be removed in FreeCode() below. + it = osr_code_map_.erase(it); } else { ++it; } } - } - for (auto it = osr_code_map_.begin(); it != osr_code_map_.end();) { - if (alloc.ContainsUnsafe(it->first)) { - // Note that the code has already been removed in the loop above. - it = osr_code_map_.erase(it); - } else { - ++it; - } - } - for (auto it = profiling_infos_.begin(); it != profiling_infos_.end();) { - ProfilingInfo* info = *it; - if (alloc.ContainsUnsafe(info->GetMethod())) { - info->GetMethod()->SetProfilingInfo(nullptr); - FreeData(reinterpret_cast<uint8_t*>(info)); - it = profiling_infos_.erase(it); - } else { - ++it; + for (auto it = profiling_infos_.begin(); it != profiling_infos_.end();) { + ProfilingInfo* info = *it; + if (alloc.ContainsUnsafe(info->GetMethod())) { + info->GetMethod()->SetProfilingInfo(nullptr); + FreeData(reinterpret_cast<uint8_t*>(info)); + it = profiling_infos_.erase(it); + } else { + ++it; + } } } + FreeAllMethodHeaders(method_headers); } bool JitCodeCache::IsWeakAccessEnabled(Thread* self) const { @@ -464,13 +502,15 @@ uint8_t* JitCodeCache::CommitCodeInternal(Thread* self, const uint8_t* code, size_t code_size, bool osr, - Handle<mirror::ObjectArray<mirror::Object>> roots) { + Handle<mirror::ObjectArray<mirror::Object>> roots, + bool has_should_deoptimize_flag, + const ArenaSet<ArtMethod*>& + cha_single_implementation_list) { DCHECK(stack_map != nullptr); size_t alignment = GetInstructionSetAlignment(kRuntimeISA); // Ensure the header ends up at expected instruction alignment. size_t header_size = RoundUp(sizeof(OatQuickMethodHeader), alignment); size_t total_size = header_size + code_size; - const uint32_t num_roots = roots->GetLength(); OatQuickMethodHeader* method_header = nullptr; uint8_t* code_ptr = nullptr; @@ -483,9 +523,6 @@ uint8_t* JitCodeCache::CommitCodeInternal(Thread* self, ScopedCodeCacheWrite scc(code_map_.get()); memory = AllocateCode(total_size); if (memory == nullptr) { - // Fill root table length so that ClearData works correctly in case of failure. Otherwise - // the length will be 0 and cause incorrect DCHECK failure. - FillRootTableLength(roots_data, num_roots); return nullptr; } code_ptr = memory + header_size; @@ -506,15 +543,48 @@ uint8_t* JitCodeCache::CommitCodeInternal(Thread* self, // https://patchwork.kernel.org/patch/9047921/ FlushInstructionCache(reinterpret_cast<char*>(code_ptr), reinterpret_cast<char*>(code_ptr + code_size)); + DCHECK(!Runtime::Current()->IsAotCompiler()); + if (has_should_deoptimize_flag) { + method_header->SetHasShouldDeoptimizeFlag(); + } } number_of_compilations_++; } // We need to update the entry point in the runnable state for the instrumentation. { + // Need cha_lock_ for checking all single-implementation flags and register + // dependencies. + MutexLock cha_mu(self, *Locks::cha_lock_); + bool single_impl_still_valid = true; + for (ArtMethod* single_impl : cha_single_implementation_list) { + if (!single_impl->HasSingleImplementation()) { + // We simply discard the compiled code. Clear the + // counter so that it may be recompiled later. Hopefully the + // class hierarchy will be more stable when compilation is retried. + single_impl_still_valid = false; + method->ClearCounter(); + break; + } + } + + // Discard the code if any single-implementation assumptions are now invalid. + if (!single_impl_still_valid) { + VLOG(jit) << "JIT discarded jitted code due to invalid single-implementation assumptions."; + return nullptr; + } + for (ArtMethod* single_impl : cha_single_implementation_list) { + Runtime::Current()->GetClassHierarchyAnalysis()->AddDependency( + single_impl, method, method_header); + } + + // The following needs to be guarded by cha_lock_ also. Otherwise it's + // possible that the compiled code is considered invalidated by some class linking, + // but below we still make the compiled code valid for the method. MutexLock mu(self, lock_); method_code_map_.Put(code_ptr, method); // Fill the root table before updating the entry point. + DCHECK_EQ(FromStackMapToRoots(stack_map), roots_data); FillRootTable(roots_data, roots); if (osr) { number_of_osr_compilations_++; @@ -535,7 +605,8 @@ uint8_t* JitCodeCache::CommitCodeInternal(Thread* self, << " ccache_size=" << PrettySize(CodeCacheSizeLocked()) << ": " << " dcache_size=" << PrettySize(DataCacheSizeLocked()) << ": " << reinterpret_cast<const void*>(method_header->GetEntryPoint()) << "," - << reinterpret_cast<const void*>(method_header->GetEntryPoint() + method_header->code_size_); + << reinterpret_cast<const void*>(method_header->GetEntryPoint() + + method_header->GetCodeSize()); histogram_code_memory_use_.AddValue(code_size); if (code_size > kCodeSizeLogThreshold) { LOG(INFO) << "JIT allocated " @@ -566,10 +637,6 @@ size_t JitCodeCache::DataCacheSizeLocked() { return used_memory_for_data_; } -static const uint8_t* FromStackMapToRoots(const uint8_t* stack_map_data) { - return stack_map_data - ComputeRootTableSize(GetNumberOfRoots(stack_map_data)); -} - void JitCodeCache::ClearData(Thread* self, uint8_t* stack_map_data, uint8_t* roots_data) { @@ -612,8 +679,14 @@ void JitCodeCache::ReserveData(Thread* self, << " for stack maps of " << ArtMethod::PrettyMethod(method); } - *roots_data = result; - *stack_map_data = result + table_size; + if (result != nullptr) { + *roots_data = result; + *stack_map_data = result + table_size; + FillRootTableLength(*roots_data, number_of_roots); + } else { + *roots_data = nullptr; + *stack_map_data = nullptr; + } } class MarkCodeVisitor FINAL : public StackVisitor { @@ -836,20 +909,23 @@ void JitCodeCache::GarbageCollectCache(Thread* self) { void JitCodeCache::RemoveUnmarkedCode(Thread* self) { ScopedTrace trace(__FUNCTION__); - MutexLock mu(self, lock_); - ScopedCodeCacheWrite scc(code_map_.get()); - // Iterate over all compiled code and remove entries that are not marked. - for (auto it = method_code_map_.begin(); it != method_code_map_.end();) { - const void* code_ptr = it->first; - ArtMethod* method = it->second; - uintptr_t allocation = FromCodeToAllocation(code_ptr); - if (GetLiveBitmap()->Test(allocation)) { - ++it; - } else { - FreeCode(code_ptr, method); - it = method_code_map_.erase(it); + std::unordered_set<OatQuickMethodHeader*> method_headers; + { + MutexLock mu(self, lock_); + ScopedCodeCacheWrite scc(code_map_.get()); + // Iterate over all compiled code and remove entries that are not marked. + for (auto it = method_code_map_.begin(); it != method_code_map_.end();) { + const void* code_ptr = it->first; + uintptr_t allocation = FromCodeToAllocation(code_ptr); + if (GetLiveBitmap()->Test(allocation)) { + ++it; + } else { + method_headers.insert(OatQuickMethodHeader::FromCodePointer(it->first)); + it = method_code_map_.erase(it); + } } } + FreeAllMethodHeaders(method_headers); } void JitCodeCache::DoCollection(Thread* self, bool collect_profiling_info) { diff --git a/runtime/jit/jit_code_cache.h b/runtime/jit/jit_code_cache.h index be2cec5091..30e2efbac5 100644 --- a/runtime/jit/jit_code_cache.h +++ b/runtime/jit/jit_code_cache.h @@ -20,6 +20,7 @@ #include "instrumentation.h" #include "atomic.h" +#include "base/arena_containers.h" #include "base/histogram-inl.h" #include "base/macros.h" #include "base/mutex.h" @@ -91,6 +92,11 @@ class JitCodeCache { REQUIRES(!lock_); // Allocate and write code and its metadata to the code cache. + // `cha_single_implementation_list` needs to be registered via CHA (if it's + // still valid), since the compiled code still needs to be invalidated if the + // single-implementation assumptions are violated later. This needs to be done + // even if `has_should_deoptimize_flag` is false, which can happen due to CHA + // guard elimination. uint8_t* CommitCode(Thread* self, ArtMethod* method, uint8_t* stack_map, @@ -101,7 +107,9 @@ class JitCodeCache { const uint8_t* code, size_t code_size, bool osr, - Handle<mirror::ObjectArray<mirror::Object>> roots) + Handle<mirror::ObjectArray<mirror::Object>> roots, + bool has_should_deoptimize_flag, + const ArenaSet<ArtMethod*>& cha_single_implementation_list) REQUIRES_SHARED(Locks::mutator_lock_) REQUIRES(!lock_); @@ -230,7 +238,9 @@ class JitCodeCache { const uint8_t* code, size_t code_size, bool osr, - Handle<mirror::ObjectArray<mirror::Object>> roots) + Handle<mirror::ObjectArray<mirror::Object>> roots, + bool has_should_deoptimize_flag, + const ArenaSet<ArtMethod*>& cha_single_implementation_list) REQUIRES(!lock_) REQUIRES_SHARED(Locks::mutator_lock_); @@ -245,8 +255,13 @@ class JitCodeCache { bool WaitForPotentialCollectionToComplete(Thread* self) REQUIRES(lock_) REQUIRES(!Locks::mutator_lock_); - // Free in the mspace allocations taken by 'method'. - void FreeCode(const void* code_ptr, ArtMethod* method) REQUIRES(lock_); + // Remove CHA dependents and underlying allocations for entries in `method_headers`. + void FreeAllMethodHeaders(const std::unordered_set<OatQuickMethodHeader*>& method_headers) + REQUIRES(!lock_) + REQUIRES(!Locks::cha_lock_); + + // Free in the mspace allocations for `code_ptr`. + void FreeCode(const void* code_ptr) REQUIRES(lock_); // Number of bytes allocated in the code cache. size_t CodeCacheSizeLocked() REQUIRES(lock_); diff --git a/runtime/jit/offline_profiling_info.h b/runtime/jit/offline_profiling_info.h index 413648829a..53d0eea932 100644 --- a/runtime/jit/offline_profiling_info.h +++ b/runtime/jit/offline_profiling_info.h @@ -180,6 +180,7 @@ class ProfileCompilationInfo { friend class ProfileCompilationInfoTest; friend class CompilerDriverProfileTest; friend class ProfileAssistantTest; + friend class Dex2oatLayoutTest; DexFileToProfileInfoMap info_; }; diff --git a/runtime/jvalue.h b/runtime/jvalue.h index 52a0f23361..398bfbc27a 100644 --- a/runtime/jvalue.h +++ b/runtime/jvalue.h @@ -29,7 +29,7 @@ namespace mirror { class Object; } // namespace mirror -union PACKED(4) JValue { +union PACKED(alignof(mirror::Object*)) JValue { // We default initialize JValue instances to all-zeros. JValue() : j(0) {} diff --git a/runtime/mirror/class-inl.h b/runtime/mirror/class-inl.h index 5def65e4d4..5fdf8f3c3a 100644 --- a/runtime/mirror/class-inl.h +++ b/runtime/mirror/class-inl.h @@ -238,7 +238,7 @@ inline ArtMethod* Class::GetVirtualMethodUnchecked(size_t i, PointerSize pointer template<VerifyObjectFlags kVerifyFlags, ReadBarrierOption kReadBarrierOption> inline PointerArray* Class::GetVTable() { - DCHECK(IsResolved<kVerifyFlags>() || IsErroneous<kVerifyFlags>()); + DCHECK(IsLoaded<kVerifyFlags>() || IsErroneous<kVerifyFlags>()); return GetFieldObject<PointerArray, kVerifyFlags, kReadBarrierOption>( OFFSET_OF_OBJECT_MEMBER(Class, vtable_)); } diff --git a/runtime/mirror/class_ext.cc b/runtime/mirror/class_ext.cc index 259bbbe174..7c6a710cef 100644 --- a/runtime/mirror/class_ext.cc +++ b/runtime/mirror/class_ext.cc @@ -46,8 +46,9 @@ void ClassExt::SetObsoleteArrays(ObjPtr<PointerArray> methods, SetFieldObject<false>(obsolete_methods_off, methods.Ptr()); } -// TODO We really need to be careful how we update this. If we ever in the future make it so that -// these arrays are written into without all threads being suspended we have a race condition! +// We really need to be careful how we update this. If we ever in the future make it so that +// these arrays are written into without all threads being suspended we have a race condition! This +// race could cause obsolete methods to be missed. bool ClassExt::ExtendObsoleteArrays(Thread* self, uint32_t increase) { DCHECK_EQ(GetLockOwnerThreadId(), Thread::Current()->GetThreadId()) << "Obsolete arrays are set without synchronization!"; diff --git a/runtime/mirror/dex_cache.cc b/runtime/mirror/dex_cache.cc index a32d51fbef..741cf3bb47 100644 --- a/runtime/mirror/dex_cache.cc +++ b/runtime/mirror/dex_cache.cc @@ -22,15 +22,123 @@ #include "gc/accounting/card_table-inl.h" #include "gc/heap.h" #include "globals.h" +#include "linear_alloc.h" #include "object.h" #include "object-inl.h" #include "object_array-inl.h" #include "runtime.h" #include "string.h" +#include "thread.h" +#include "utils/dex_cache_arrays_layout-inl.h" namespace art { namespace mirror { +void DexCache::InitializeDexCache(Thread* self, + ObjPtr<mirror::DexCache> dex_cache, + ObjPtr<mirror::String> location, + const DexFile* dex_file, + LinearAlloc* linear_alloc, + PointerSize image_pointer_size) { + DCHECK(dex_file != nullptr); + ScopedAssertNoThreadSuspension sants(__FUNCTION__); + DexCacheArraysLayout layout(image_pointer_size, dex_file); + uint8_t* raw_arrays = nullptr; + + const OatDexFile* const oat_dex = dex_file->GetOatDexFile(); + if (oat_dex != nullptr && oat_dex->GetDexCacheArrays() != nullptr) { + raw_arrays = oat_dex->GetDexCacheArrays(); + } else if (dex_file->NumStringIds() != 0u || + dex_file->NumTypeIds() != 0u || + dex_file->NumMethodIds() != 0u || + dex_file->NumFieldIds() != 0u) { + // Zero-initialized. + raw_arrays = reinterpret_cast<uint8_t*>(linear_alloc->Alloc(self, layout.Size())); + } + + mirror::StringDexCacheType* strings = (dex_file->NumStringIds() == 0u) ? nullptr : + reinterpret_cast<mirror::StringDexCacheType*>(raw_arrays + layout.StringsOffset()); + GcRoot<mirror::Class>* types = (dex_file->NumTypeIds() == 0u) ? nullptr : + reinterpret_cast<GcRoot<mirror::Class>*>(raw_arrays + layout.TypesOffset()); + ArtMethod** methods = (dex_file->NumMethodIds() == 0u) ? nullptr : + reinterpret_cast<ArtMethod**>(raw_arrays + layout.MethodsOffset()); + ArtField** fields = (dex_file->NumFieldIds() == 0u) ? nullptr : + reinterpret_cast<ArtField**>(raw_arrays + layout.FieldsOffset()); + + size_t num_strings = mirror::DexCache::kDexCacheStringCacheSize; + if (dex_file->NumStringIds() < num_strings) { + num_strings = dex_file->NumStringIds(); + } + + // Note that we allocate the method type dex caches regardless of this flag, + // and we make sure here that they're not used by the runtime. This is in the + // interest of simplicity and to avoid extensive compiler and layout class changes. + // + // If this needs to be mitigated in a production system running this code, + // DexCache::kDexCacheMethodTypeCacheSize can be set to zero. + mirror::MethodTypeDexCacheType* method_types = nullptr; + size_t num_method_types = 0; + + if (dex_file->NumProtoIds() < mirror::DexCache::kDexCacheMethodTypeCacheSize) { + num_method_types = dex_file->NumProtoIds(); + } else { + num_method_types = mirror::DexCache::kDexCacheMethodTypeCacheSize; + } + + if (num_method_types > 0) { + method_types = reinterpret_cast<mirror::MethodTypeDexCacheType*>( + raw_arrays + layout.MethodTypesOffset()); + } + + DCHECK_ALIGNED(raw_arrays, alignof(mirror::StringDexCacheType)) << + "Expected raw_arrays to align to StringDexCacheType."; + DCHECK_ALIGNED(layout.StringsOffset(), alignof(mirror::StringDexCacheType)) << + "Expected StringsOffset() to align to StringDexCacheType."; + DCHECK_ALIGNED(strings, alignof(mirror::StringDexCacheType)) << + "Expected strings to align to StringDexCacheType."; + static_assert(alignof(mirror::StringDexCacheType) == 8u, + "Expected StringDexCacheType to have align of 8."); + if (kIsDebugBuild) { + // Sanity check to make sure all the dex cache arrays are empty. b/28992179 + for (size_t i = 0; i < num_strings; ++i) { + CHECK_EQ(strings[i].load(std::memory_order_relaxed).index, 0u); + CHECK(strings[i].load(std::memory_order_relaxed).object.IsNull()); + } + for (size_t i = 0; i < dex_file->NumTypeIds(); ++i) { + CHECK(types[i].IsNull()); + } + for (size_t i = 0; i < dex_file->NumMethodIds(); ++i) { + CHECK(mirror::DexCache::GetElementPtrSize(methods, i, image_pointer_size) == nullptr); + } + for (size_t i = 0; i < dex_file->NumFieldIds(); ++i) { + CHECK(mirror::DexCache::GetElementPtrSize(fields, i, image_pointer_size) == nullptr); + } + for (size_t i = 0; i < num_method_types; ++i) { + CHECK_EQ(method_types[i].load(std::memory_order_relaxed).index, 0u); + CHECK(method_types[i].load(std::memory_order_relaxed).object.IsNull()); + } + } + if (strings != nullptr) { + mirror::StringDexCachePair::Initialize(strings); + } + if (method_types != nullptr) { + mirror::MethodTypeDexCachePair::Initialize(method_types); + } + dex_cache->Init(dex_file, + location, + strings, + num_strings, + types, + dex_file->NumTypeIds(), + methods, + dex_file->NumMethodIds(), + fields, + dex_file->NumFieldIds(), + method_types, + num_method_types, + image_pointer_size); +} + void DexCache::Init(const DexFile* dex_file, ObjPtr<String> location, StringDexCacheType* strings, diff --git a/runtime/mirror/dex_cache.h b/runtime/mirror/dex_cache.h index cc4d01a075..ec265e5ab3 100644 --- a/runtime/mirror/dex_cache.h +++ b/runtime/mirror/dex_cache.h @@ -31,6 +31,8 @@ struct DexCacheOffsets; class DexFile; class ImageWriter; union JValue; +class LinearAlloc; +class Thread; namespace mirror { @@ -137,19 +139,14 @@ class MANAGED DexCache FINAL : public Object { return sizeof(DexCache); } - void Init(const DexFile* dex_file, - ObjPtr<String> location, - StringDexCacheType* strings, - uint32_t num_strings, - GcRoot<Class>* resolved_types, - uint32_t num_resolved_types, - ArtMethod** resolved_methods, - uint32_t num_resolved_methods, - ArtField** resolved_fields, - uint32_t num_resolved_fields, - MethodTypeDexCacheType* resolved_methodtypes, - uint32_t num_resolved_methodtypes, - PointerSize pointer_size) REQUIRES_SHARED(Locks::mutator_lock_); + static void InitializeDexCache(Thread* self, + ObjPtr<mirror::DexCache> dex_cache, + ObjPtr<mirror::String> location, + const DexFile* dex_file, + LinearAlloc* linear_alloc, + PointerSize image_pointer_size) + REQUIRES_SHARED(Locks::mutator_lock_) + REQUIRES(Locks::dex_lock_); void Fixup(ArtMethod* trampoline, PointerSize pointer_size) REQUIRES_SHARED(Locks::mutator_lock_); @@ -339,6 +336,21 @@ class MANAGED DexCache FINAL : public Object { static void SetElementPtrSize(PtrType* ptr_array, size_t idx, PtrType ptr, PointerSize ptr_size); private: + void Init(const DexFile* dex_file, + ObjPtr<String> location, + StringDexCacheType* strings, + uint32_t num_strings, + GcRoot<Class>* resolved_types, + uint32_t num_resolved_types, + ArtMethod** resolved_methods, + uint32_t num_resolved_methods, + ArtField** resolved_fields, + uint32_t num_resolved_fields, + MethodTypeDexCacheType* resolved_methodtypes, + uint32_t num_resolved_methodtypes, + PointerSize pointer_size) + REQUIRES_SHARED(Locks::mutator_lock_); + // Visit instance fields of the dex cache as well as its associated arrays. template <bool kVisitNativeRoots, VerifyObjectFlags kVerifyFlags = kDefaultVerifyFlags, diff --git a/runtime/mirror/method_handle_impl.cc b/runtime/mirror/method_handle_impl.cc index fdfaaa8ca8..4f1c448b56 100644 --- a/runtime/mirror/method_handle_impl.cc +++ b/runtime/mirror/method_handle_impl.cc @@ -22,6 +22,12 @@ namespace art { namespace mirror { +mirror::Class* MethodHandle::StaticClass() { + mirror::Class* klass = MethodHandleImpl::StaticClass()->GetSuperClass(); + DCHECK(klass->DescriptorEquals("Ljava/lang/invoke/MethodHandle;")); + return klass; +} + GcRoot<mirror::Class> MethodHandleImpl::static_class_; void MethodHandleImpl::SetClass(Class* klass) { diff --git a/runtime/mirror/method_handle_impl.h b/runtime/mirror/method_handle_impl.h index 9054216065..5ea82b5357 100644 --- a/runtime/mirror/method_handle_impl.h +++ b/runtime/mirror/method_handle_impl.h @@ -57,6 +57,8 @@ class MANAGED MethodHandle : public Object { return static_cast<MethodHandleKind>(handle_kind); } + static mirror::Class* StaticClass() REQUIRES_SHARED(Locks::mutator_lock_); + private: HeapReference<mirror::MethodType> nominal_type_; HeapReference<mirror::MethodType> method_type_; diff --git a/runtime/modifiers.h b/runtime/modifiers.h index a1110d92a5..ae6b31d2fe 100644 --- a/runtime/modifiers.h +++ b/runtime/modifiers.h @@ -67,10 +67,15 @@ static constexpr uint32_t kAccCompileDontBother = 0x01000000; // method (ru // Set by the verifier for a method that could not be verified to follow structured locking. static constexpr uint32_t kAccMustCountLocks = 0x02000000; // method (runtime) -// Set to indicate that the ArtMethod is obsolete and has a different DexCache from it's declaring +// Set to indicate that the ArtMethod is obsolete and has a different DexCache from its declaring // class. // TODO Might want to re-arrange some of these so that we can have obsolete + intrinsic methods. static constexpr uint32_t kAccObsoleteMethod = 0x04000000; // method (runtime) + +// Set by the class linker for a method that has only one implementation for a +// virtual call. +static constexpr uint32_t kAccSingleImplementation = 0x08000000; // method (runtime) + static constexpr uint32_t kAccIntrinsic = 0x80000000; // method (runtime) // Special runtime-only flags. diff --git a/runtime/native/dalvik_system_VMDebug.cc b/runtime/native/dalvik_system_VMDebug.cc index adf35b6f01..67b2e1c503 100644 --- a/runtime/native/dalvik_system_VMDebug.cc +++ b/runtime/native/dalvik_system_VMDebug.cc @@ -177,8 +177,22 @@ static void VMDebug_resetInstructionCount(JNIEnv* env, jclass) { } static void VMDebug_printLoadedClasses(JNIEnv* env, jclass, jint flags) { + class DumpClassVisitor : public ClassVisitor { + public: + explicit DumpClassVisitor(int dump_flags) : flags_(dump_flags) {} + + bool operator()(ObjPtr<mirror::Class> klass) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_) { + klass->DumpClass(LOG_STREAM(ERROR), flags_); + return true; + } + + private: + const int flags_; + }; + DumpClassVisitor visitor(flags); + ScopedFastNativeObjectAccess soa(env); - return Runtime::Current()->GetClassLinker()->DumpAllClasses(flags); + return Runtime::Current()->GetClassLinker()->VisitClasses(&visitor); } static jint VMDebug_getLoadedClassCount(JNIEnv* env, jclass) { diff --git a/runtime/native_stack_dump.cc b/runtime/native_stack_dump.cc index 23768899bd..5565565c7b 100644 --- a/runtime/native_stack_dump.cc +++ b/runtime/native_stack_dump.cc @@ -272,7 +272,7 @@ static bool PcIsWithinQuickCode(ArtMethod* method, uintptr_t pc) NO_THREAD_SAFET if (code == 0) { return pc == 0; } - uintptr_t code_size = reinterpret_cast<const OatQuickMethodHeader*>(code)[-1].code_size_; + uintptr_t code_size = reinterpret_cast<const OatQuickMethodHeader*>(code)[-1].GetCodeSize(); return code <= pc && pc <= (code + code_size); } diff --git a/runtime/oat_file-inl.h b/runtime/oat_file-inl.h index d7d0c4f733..721fab993f 100644 --- a/runtime/oat_file-inl.h +++ b/runtime/oat_file-inl.h @@ -44,7 +44,7 @@ inline uint32_t OatFile::OatMethod::GetQuickCodeSizeOffset() const { if (method_header == nullptr) { return 0u; } - return reinterpret_cast<const uint8_t*>(&method_header->code_size_) - begin_; + return reinterpret_cast<const uint8_t*>(method_header->GetCodeSizeAddr()) - begin_; } inline size_t OatFile::OatMethod::GetFrameSizeInBytes() const { @@ -52,7 +52,7 @@ inline size_t OatFile::OatMethod::GetFrameSizeInBytes() const { if (code == nullptr) { return 0u; } - return reinterpret_cast<const OatQuickMethodHeader*>(code)[-1].frame_info_.FrameSizeInBytes(); + return reinterpret_cast<const OatQuickMethodHeader*>(code)[-1].GetFrameInfo().FrameSizeInBytes(); } inline uint32_t OatFile::OatMethod::GetCoreSpillMask() const { @@ -60,7 +60,7 @@ inline uint32_t OatFile::OatMethod::GetCoreSpillMask() const { if (code == nullptr) { return 0u; } - return reinterpret_cast<const OatQuickMethodHeader*>(code)[-1].frame_info_.CoreSpillMask(); + return reinterpret_cast<const OatQuickMethodHeader*>(code)[-1].GetFrameInfo().CoreSpillMask(); } inline uint32_t OatFile::OatMethod::GetFpSpillMask() const { @@ -68,7 +68,7 @@ inline uint32_t OatFile::OatMethod::GetFpSpillMask() const { if (code == nullptr) { return 0u; } - return reinterpret_cast<const OatQuickMethodHeader*>(code)[-1].frame_info_.FpSpillMask(); + return reinterpret_cast<const OatQuickMethodHeader*>(code)[-1].GetFrameInfo().FpSpillMask(); } inline uint32_t OatFile::OatMethod::GetVmapTableOffset() const { @@ -81,7 +81,7 @@ inline uint32_t OatFile::OatMethod::GetVmapTableOffsetOffset() const { if (method_header == nullptr) { return 0u; } - return reinterpret_cast<const uint8_t*>(&method_header->vmap_table_offset_) - begin_; + return reinterpret_cast<const uint8_t*>(method_header->GetVmapTableOffsetAddr()) - begin_; } inline const uint8_t* OatFile::OatMethod::GetVmapTable() const { @@ -89,7 +89,7 @@ inline const uint8_t* OatFile::OatMethod::GetVmapTable() const { if (code == nullptr) { return nullptr; } - uint32_t offset = reinterpret_cast<const OatQuickMethodHeader*>(code)[-1].vmap_table_offset_; + uint32_t offset = reinterpret_cast<const OatQuickMethodHeader*>(code)[-1].GetVmapTableOffset(); if (UNLIKELY(offset == 0u)) { return nullptr; } @@ -101,7 +101,7 @@ inline uint32_t OatFile::OatMethod::GetQuickCodeSize() const { if (code == nullptr) { return 0u; } - return reinterpret_cast<const OatQuickMethodHeader*>(code)[-1].code_size_; + return reinterpret_cast<const OatQuickMethodHeader*>(code)[-1].GetCodeSize(); } inline uint32_t OatFile::OatMethod::GetCodeOffset() const { diff --git a/runtime/oat_file_assistant.cc b/runtime/oat_file_assistant.cc index 4d1e1eafc5..6a62a166a3 100644 --- a/runtime/oat_file_assistant.cc +++ b/runtime/oat_file_assistant.cc @@ -314,7 +314,7 @@ OatFileAssistant::OatStatus OatFileAssistant::GivenOatFileStatus(const OatFile& const OatFile::OatDexFile* oat_dex_file = file.GetOatDexFile( dex_location_.c_str(), dex_checksum_pointer, &error_msg); if (oat_dex_file == nullptr) { - VLOG(oat) << error_msg; + LOG(ERROR) << error_msg; return kOatDexOutOfDate; } diff --git a/runtime/oat_quick_method_header.h b/runtime/oat_quick_method_header.h index 4afca7d828..3cdde5a065 100644 --- a/runtime/oat_quick_method_header.h +++ b/runtime/oat_quick_method_header.h @@ -58,7 +58,7 @@ class PACKED(4) OatQuickMethodHeader { } bool IsOptimized() const { - return code_size_ != 0 && vmap_table_offset_ != 0; + return GetCodeSize() != 0 && vmap_table_offset_ != 0; } const void* GetOptimizedCodeInfoPtr() const { @@ -81,7 +81,23 @@ class PACKED(4) OatQuickMethodHeader { } uint32_t GetCodeSize() const { - return code_size_; + return code_size_ & kCodeSizeMask; + } + + const uint32_t* GetCodeSizeAddr() const { + return &code_size_; + } + + uint32_t GetVmapTableOffset() const { + return vmap_table_offset_; + } + + void SetVmapTableOffset(uint32_t offset) { + vmap_table_offset_ = offset; + } + + const uint32_t* GetVmapTableOffsetAddr() const { + return &vmap_table_offset_; } const uint8_t* GetVmapTable() const { @@ -96,7 +112,7 @@ class PACKED(4) OatQuickMethodHeader { // On Thumb-2, the pc is offset by one. code_start++; } - return code_start <= pc && pc <= (code_start + code_size_); + return code_start <= pc && pc <= (code_start + GetCodeSize()); } const uint8_t* GetEntryPoint() const { @@ -130,11 +146,25 @@ class PACKED(4) OatQuickMethodHeader { uint32_t ToDexPc(ArtMethod* method, const uintptr_t pc, bool abort_on_failure = true) const; + void SetHasShouldDeoptimizeFlag() { + DCHECK_EQ(code_size_ & kShouldDeoptimizeMask, 0u); + code_size_ |= kShouldDeoptimizeMask; + } + + bool HasShouldDeoptimizeFlag() const { + return (code_size_ & kShouldDeoptimizeMask) != 0; + } + + private: + static constexpr uint32_t kShouldDeoptimizeMask = 0x80000000; + static constexpr uint32_t kCodeSizeMask = ~kShouldDeoptimizeMask; + // The offset in bytes from the start of the vmap table to the end of the header. uint32_t vmap_table_offset_; // The stack frame information. QuickMethodFrameInfo frame_info_; - // The code size in bytes. + // The code size in bytes. The highest bit is used to signify if the compiled + // code with the method header has should_deoptimize flag. uint32_t code_size_; // The actual code. uint8_t code_[0]; diff --git a/runtime/openjdkjvmti/OpenjdkJvmTi.cc b/runtime/openjdkjvmti/OpenjdkJvmTi.cc index d1c2293cc3..1ad3f0814f 100644 --- a/runtime/openjdkjvmti/OpenjdkJvmTi.cc +++ b/runtime/openjdkjvmti/OpenjdkJvmTi.cc @@ -1142,6 +1142,34 @@ class JvmtiFunctions { return RetransformClassesWithHook(reinterpret_cast<ArtJvmTiEnv*>(env), classes, hook); } + static jvmtiError RedefineClassDirect(ArtJvmTiEnv* env, + jclass klass, + jint dex_size, + unsigned char* dex_file) { + if (!IsValidEnv(env)) { + return ERR(INVALID_ENVIRONMENT); + } + jvmtiError ret = OK; + std::string location; + if ((ret = GetClassLocation(env, klass, &location)) != OK) { + // TODO Do something more here? Maybe give log statements? + return ret; + } + std::string error; + ret = Redefiner::RedefineClass(env, + art::Runtime::Current(), + art::Thread::Current(), + klass, + location, + dex_size, + reinterpret_cast<uint8_t*>(dex_file), + &error); + if (ret != OK) { + LOG(ERROR) << "FAILURE TO REDEFINE " << error; + } + return ret; + } + // TODO This will be called by the event handler for the art::ti Event Load Event static jvmtiError RetransformClassesWithHook(ArtJvmTiEnv* env, const std::vector<jclass>& classes, @@ -1252,7 +1280,10 @@ const jvmtiInterface_1 gJvmtiInterface = { reinterpret_cast<void*>(JvmtiFunctions::RetransformClassWithHook), // nullptr, // reserved1 JvmtiFunctions::SetEventNotificationMode, - nullptr, // reserved3 + // SPECIAL FUNCTION: RedefineClassDirect Is normally reserved3 + // TODO Remove once we have events working. + reinterpret_cast<void*>(JvmtiFunctions::RedefineClassDirect), + // nullptr, // reserved3 JvmtiFunctions::GetAllThreads, JvmtiFunctions::SuspendThread, JvmtiFunctions::ResumeThread, diff --git a/runtime/openjdkjvmti/ti_redefine.cc b/runtime/openjdkjvmti/ti_redefine.cc index 69bd88768c..d0349b987f 100644 --- a/runtime/openjdkjvmti/ti_redefine.cc +++ b/runtime/openjdkjvmti/ti_redefine.cc @@ -66,7 +66,8 @@ std::unique_ptr<art::MemMap> Redefiner::MoveDataToMemMap(const std::string& orig return map; } memcpy(map->Begin(), dex_data, data_len); - // Make the dex files mmap read only. + // Make the dex files mmap read only. This matches how other DexFiles are mmaped and prevents + // programs from corrupting it. map->Protect(PROT_READ); return map; } diff --git a/runtime/openjdkjvmti/ti_redefine.h b/runtime/openjdkjvmti/ti_redefine.h index f3a583478b..c819acd5ac 100644 --- a/runtime/openjdkjvmti/ti_redefine.h +++ b/runtime/openjdkjvmti/ti_redefine.h @@ -68,7 +68,7 @@ class Redefiner { public: // Redefine the given class with the given dex data. Note this function does not take ownership of // the dex_data pointer. It is not used after this call however and may be freed if desired. - // The caller is responsible for freeing it. The runtime makes it's own copy of the data. + // The caller is responsible for freeing it. The runtime makes its own copy of the data. static jvmtiError RedefineClass(ArtJvmTiEnv* env, art::Runtime* runtime, art::Thread* self, @@ -146,6 +146,7 @@ class Redefiner { // This will check that no constraints are violated (more than 1 class in dex file, any changes in // number/declaration of methods & fields, changes in access flags, etc.) bool EnsureRedefinitionIsValid() { + LOG(WARNING) << "Redefinition is not checked for validity currently"; return true; } diff --git a/runtime/openjdkjvmti/transform.cc b/runtime/openjdkjvmti/transform.cc index f7b8b92a75..f5451254c0 100644 --- a/runtime/openjdkjvmti/transform.cc +++ b/runtime/openjdkjvmti/transform.cc @@ -58,6 +58,21 @@ namespace openjdkjvmti { +jvmtiError GetClassLocation(ArtJvmTiEnv* env, jclass klass, /*out*/std::string* location) { + JNIEnv* jni_env = nullptr; + jint ret = env->art_vm->GetEnv(reinterpret_cast<void**>(&jni_env), JNI_VERSION_1_1); + if (ret != JNI_OK) { + // TODO Different error might be better? + return ERR(INTERNAL); + } + art::ScopedObjectAccess soa(jni_env); + art::StackHandleScope<1> hs(art::Thread::Current()); + art::Handle<art::mirror::Class> hs_klass(hs.NewHandle(soa.Decode<art::mirror::Class>(klass))); + const art::DexFile& dex = hs_klass->GetDexFile(); + *location = dex.GetLocation(); + return OK; +} + // TODO Move this function somewhere more appropriate. // Gets the data surrounding the given class. jvmtiError GetTransformationData(ArtJvmTiEnv* env, diff --git a/runtime/openjdkjvmti/transform.h b/runtime/openjdkjvmti/transform.h index 35b990b976..0ad5099daf 100644 --- a/runtime/openjdkjvmti/transform.h +++ b/runtime/openjdkjvmti/transform.h @@ -41,6 +41,8 @@ namespace openjdkjvmti { +jvmtiError GetClassLocation(ArtJvmTiEnv* env, jclass klass, /*out*/std::string* location); + // Gets the data surrounding the given class. jvmtiError GetTransformationData(ArtJvmTiEnv* env, jclass klass, diff --git a/runtime/runtime.cc b/runtime/runtime.cc index 68b956b17e..66bb80315d 100644 --- a/runtime/runtime.cc +++ b/runtime/runtime.cc @@ -62,6 +62,7 @@ #include "base/stl_util.h" #include "base/systrace.h" #include "base/unix_file/fd_file.h" +#include "cha.h" #include "class_linker-inl.h" #include "compiler_callbacks.h" #include "debugger.h" @@ -349,6 +350,7 @@ Runtime::~Runtime() { delete monitor_list_; delete monitor_pool_; delete class_linker_; + delete cha_; delete heap_; delete intern_table_; delete oat_file_manager_; @@ -1203,6 +1205,7 @@ bool Runtime::Init(RuntimeArgumentMap&& runtime_options_in) { CHECK_GE(GetHeap()->GetContinuousSpaces().size(), 1U); class_linker_ = new ClassLinker(intern_table_); + cha_ = new ClassHierarchyAnalysis; if (GetHeap()->HasBootImageSpace()) { bool result = class_linker_->InitFromBootImage(&error_msg); if (!result) { @@ -1733,9 +1736,24 @@ void Runtime::VisitImageRoots(RootVisitor* visitor) { } } +static ArtMethod* CreateRuntimeMethod(ClassLinker* class_linker, LinearAlloc* linear_alloc) { + const PointerSize image_pointer_size = class_linker->GetImagePointerSize(); + const size_t method_alignment = ArtMethod::Alignment(image_pointer_size); + const size_t method_size = ArtMethod::Size(image_pointer_size); + LengthPrefixedArray<ArtMethod>* method_array = class_linker->AllocArtMethodArray( + Thread::Current(), + linear_alloc, + 1); + ArtMethod* method = &method_array->At(0, method_size, method_alignment); + CHECK(method != nullptr); + method->SetDexMethodIndex(DexFile::kDexNoIndex); + CHECK(method->IsRuntimeMethod()); + return method; +} + ArtMethod* Runtime::CreateImtConflictMethod(LinearAlloc* linear_alloc) { ClassLinker* const class_linker = GetClassLinker(); - ArtMethod* method = class_linker->CreateRuntimeMethod(linear_alloc); + ArtMethod* method = CreateRuntimeMethod(class_linker, linear_alloc); // When compiling, the code pointer will get set later when the image is loaded. const PointerSize pointer_size = GetInstructionSetPointerSize(instruction_set_); if (IsAotCompiler()) { @@ -1756,7 +1774,7 @@ void Runtime::SetImtConflictMethod(ArtMethod* method) { } ArtMethod* Runtime::CreateResolutionMethod() { - auto* method = GetClassLinker()->CreateRuntimeMethod(GetLinearAlloc()); + auto* method = CreateRuntimeMethod(GetClassLinker(), GetLinearAlloc()); // When compiling, the code pointer will get set later when the image is loaded. if (IsAotCompiler()) { PointerSize pointer_size = GetInstructionSetPointerSize(instruction_set_); @@ -1768,7 +1786,7 @@ ArtMethod* Runtime::CreateResolutionMethod() { } ArtMethod* Runtime::CreateCalleeSaveMethod() { - auto* method = GetClassLinker()->CreateRuntimeMethod(GetLinearAlloc()); + auto* method = CreateRuntimeMethod(GetClassLinker(), GetLinearAlloc()); PointerSize pointer_size = GetInstructionSetPointerSize(instruction_set_); method->SetEntryPointFromQuickCompiledCodePtrSize(nullptr, pointer_size); DCHECK_NE(instruction_set_, kNone); diff --git a/runtime/runtime.h b/runtime/runtime.h index 4f31887b72..e6b3128675 100644 --- a/runtime/runtime.h +++ b/runtime/runtime.h @@ -76,6 +76,7 @@ namespace verifier { } // namespace verifier class ArenaPool; class ArtMethod; +class ClassHierarchyAnalysis; class ClassLinker; class Closure; class CompilerCallbacks; @@ -674,6 +675,10 @@ class Runtime { void AddSystemWeakHolder(gc::AbstractSystemWeakHolder* holder); void RemoveSystemWeakHolder(gc::AbstractSystemWeakHolder* holder); + ClassHierarchyAnalysis* GetClassHierarchyAnalysis() { + return cha_; + } + NO_RETURN static void Aborter(const char* abort_message); @@ -921,6 +926,8 @@ class Runtime { // Generic system-weak holders. std::vector<gc::AbstractSystemWeakHolder*> system_weak_holders_; + ClassHierarchyAnalysis* cha_; + DISALLOW_COPY_AND_ASSIGN(Runtime); }; std::ostream& operator<<(std::ostream& os, const Runtime::CalleeSaveType& rhs); diff --git a/runtime/stack.cc b/runtime/stack.cc index 167a30ba2b..f20aa201aa 100644 --- a/runtime/stack.cc +++ b/runtime/stack.cc @@ -648,7 +648,7 @@ static void AssertPcIsWithinQuickCode(ArtMethod* method, uintptr_t pc) return; } - uint32_t code_size = OatQuickMethodHeader::FromEntryPoint(code)->code_size_; + uint32_t code_size = OatQuickMethodHeader::FromEntryPoint(code)->GetCodeSize(); uintptr_t code_start = reinterpret_cast<uintptr_t>(code); CHECK(code_start <= pc && pc <= (code_start + code_size)) << method->PrettyMethod() diff --git a/runtime/stack.h b/runtime/stack.h index e879214c75..d02e4b71d1 100644 --- a/runtime/stack.h +++ b/runtime/stack.h @@ -66,6 +66,11 @@ std::ostream& operator<<(std::ostream& os, const VRegKind& rhs); struct ShadowFrameDeleter; using ShadowFrameAllocaUniquePtr = std::unique_ptr<ShadowFrame, ShadowFrameDeleter>; +// Size in bytes of the should_deoptimize flag on stack. +// We just need 4 bytes for our purpose regardless of the architecture. Frame size +// calculation will automatically do alignment for the final frame size. +static constexpr size_t kShouldDeoptimizeFlagSize = 4; + // Counting locks by storing object pointers into a vector. Duplicate entries mark recursive locks. // The vector will be visited with the ShadowFrame during GC (so all the locked-on objects are // thread roots). diff --git a/runtime/thread.cc b/runtime/thread.cc index 1283cf0e96..17f5513967 100644 --- a/runtime/thread.cc +++ b/runtime/thread.cc @@ -1394,6 +1394,7 @@ void Thread::DumpState(std::ostream& os, const Thread* thread, pid_t tid) { os << " | group=\"" << group_name << "\"" << " sCount=" << thread->tls32_.suspend_count << " dsCount=" << thread->tls32_.debug_suspend_count + << " flags=" << thread->tls32_.state_and_flags.as_struct.flags << " obj=" << reinterpret_cast<void*>(thread->tlsPtr_.opeer) << " self=" << reinterpret_cast<const void*>(thread) << "\n"; } @@ -3175,4 +3176,8 @@ void Thread::SetException(ObjPtr<mirror::Throwable> new_exception) { tlsPtr_.exception = new_exception.Ptr(); } +bool Thread::IsAotCompiler() { + return Runtime::Current()->IsAotCompiler(); +} + } // namespace art diff --git a/runtime/thread.h b/runtime/thread.h index 35226f2230..b80fdc751b 100644 --- a/runtime/thread.h +++ b/runtime/thread.h @@ -33,13 +33,13 @@ #include "base/mutex.h" #include "entrypoints/jni/jni_entrypoints.h" #include "entrypoints/quick/quick_entrypoints.h" +#include "gc_root.h" #include "globals.h" #include "handle_scope.h" #include "instrumentation.h" #include "jvalue.h" #include "object_callbacks.h" #include "offsets.h" -#include "runtime.h" #include "runtime_stats.h" #include "stack.h" #include "thread_state.h" @@ -87,7 +87,6 @@ class FrameIdToShadowFrame; class JavaVMExt; struct JNIEnvExt; class Monitor; -class Runtime; class ScopedObjectAccessAlreadyRunnable; class ShadowFrame; class SingleStepControl; @@ -949,17 +948,17 @@ class Thread { } std::vector<ArtMethod*>* GetStackTraceSample() const { - DCHECK(!Runtime::Current()->IsAotCompiler()); + DCHECK(!IsAotCompiler()); return tlsPtr_.deps_or_stack_trace_sample.stack_trace_sample; } void SetStackTraceSample(std::vector<ArtMethod*>* sample) { - DCHECK(!Runtime::Current()->IsAotCompiler()); + DCHECK(!IsAotCompiler()); tlsPtr_.deps_or_stack_trace_sample.stack_trace_sample = sample; } verifier::VerifierDeps* GetVerifierDeps() const { - DCHECK(Runtime::Current()->IsAotCompiler()); + DCHECK(IsAotCompiler()); return tlsPtr_.deps_or_stack_trace_sample.verifier_deps; } @@ -967,7 +966,7 @@ class Thread { // entry in the thread is cleared before destruction of the actual VerifierDeps // object, or the thread. void SetVerifierDeps(verifier::VerifierDeps* verifier_deps) { - DCHECK(Runtime::Current()->IsAotCompiler()); + DCHECK(IsAotCompiler()); DCHECK(verifier_deps == nullptr || tlsPtr_.deps_or_stack_trace_sample.verifier_deps == nullptr); tlsPtr_.deps_or_stack_trace_sample.verifier_deps = verifier_deps; } @@ -1246,6 +1245,8 @@ class Thread { // Install the protected region for implicit stack checks. void InstallImplicitProtection(); + static bool IsAotCompiler(); + // 32 bits of atomically changed state and flags. Keeping as 32 bits allows and atomic CAS to // change from being Suspended to Runnable without a suspend request occurring. union PACKED(4) StateAndFlags { diff --git a/runtime/thread_list.cc b/runtime/thread_list.cc index 27fb37a662..a6bd83d3ce 100644 --- a/runtime/thread_list.cc +++ b/runtime/thread_list.cc @@ -375,7 +375,7 @@ size_t ThreadList::RunCheckpoint(Closure* checkpoint_function, Closure* callback return count; } -size_t ThreadList::RunEmptyCheckpoint() { +size_t ThreadList::RunEmptyCheckpoint(std::vector<uint32_t>& runnable_thread_ids) { Thread* self = Thread::Current(); Locks::mutator_lock_->AssertNotExclusiveHeld(self); Locks::thread_list_lock_->AssertNotHeld(self); @@ -392,6 +392,9 @@ size_t ThreadList::RunEmptyCheckpoint() { // This thread will run an empty checkpoint (decrement the empty checkpoint barrier) // some time in the near future. ++count; + if (kIsDebugBuild) { + runnable_thread_ids.push_back(thread->GetThreadId()); + } break; } if (thread->GetState() != kRunnable) { diff --git a/runtime/thread_list.h b/runtime/thread_list.h index 133d43029a..1acabcb101 100644 --- a/runtime/thread_list.h +++ b/runtime/thread_list.h @@ -27,6 +27,7 @@ #include <bitset> #include <list> +#include <vector> namespace art { namespace gc { @@ -106,7 +107,9 @@ class ThreadList { // in-flight mutator heap access (eg. a read barrier.) Runnable threads will respond by // decrementing the empty checkpoint barrier count. This works even when the weak ref access is // disabled. Only one concurrent use is currently supported. - size_t RunEmptyCheckpoint() + // In debug build, runnable_thread_ids will be populated with the thread IDS of the runnable + // thread to wait for. + size_t RunEmptyCheckpoint(std::vector<uint32_t>& runnable_thread_ids) REQUIRES(!Locks::thread_list_lock_, !Locks::thread_suspend_count_lock_); size_t RunCheckpointOnRunnableThreads(Closure* checkpoint_function) diff --git a/runtime/vdex_file.cc b/runtime/vdex_file.cc index 843be92c00..dabf8c8e93 100644 --- a/runtime/vdex_file.cc +++ b/runtime/vdex_file.cc @@ -35,10 +35,12 @@ bool VdexFile::Header::IsVersionValid() const { return (memcmp(version_, kVdexVersion, sizeof(kVdexVersion)) == 0); } -VdexFile::Header::Header(uint32_t dex_size, +VdexFile::Header::Header(uint32_t number_of_dex_files, + uint32_t dex_size, uint32_t verifier_deps_size, uint32_t quickening_info_size) - : dex_size_(dex_size), + : number_of_dex_files_(number_of_dex_files), + dex_size_(dex_size), verifier_deps_size_(verifier_deps_size), quickening_info_size_(quickening_info_size) { memcpy(magic_, kVdexMagic, sizeof(kVdexMagic)); diff --git a/runtime/vdex_file.h b/runtime/vdex_file.h index 75a0d5e31e..3b114a9f10 100644 --- a/runtime/vdex_file.h +++ b/runtime/vdex_file.h @@ -43,7 +43,10 @@ class VdexFile { public: struct Header { public: - Header(uint32_t dex_size, uint32_t verifier_deps_size, uint32_t quickening_info_size); + Header(uint32_t number_of_dex_files_, + uint32_t dex_size, + uint32_t verifier_deps_size, + uint32_t quickening_info_size); const char* GetMagic() const { return reinterpret_cast<const char*>(magic_); } const char* GetVersion() const { return reinterpret_cast<const char*>(version_); } @@ -54,18 +57,22 @@ class VdexFile { uint32_t GetDexSize() const { return dex_size_; } uint32_t GetVerifierDepsSize() const { return verifier_deps_size_; } uint32_t GetQuickeningInfoSize() const { return quickening_info_size_; } + uint32_t GetNumberOfDexFiles() const { return number_of_dex_files_; } private: static constexpr uint8_t kVdexMagic[] = { 'v', 'd', 'e', 'x' }; - static constexpr uint8_t kVdexVersion[] = { '0', '0', '0', '\0' }; + static constexpr uint8_t kVdexVersion[] = { '0', '0', '1', '\0' }; uint8_t magic_[4]; uint8_t version_[4]; + uint32_t number_of_dex_files_; uint32_t dex_size_; uint32_t verifier_deps_size_; uint32_t quickening_info_size_; }; + typedef uint32_t VdexChecksum; + static VdexFile* Open(const std::string& vdex_filename, bool writable, bool low_4gb, @@ -88,7 +95,7 @@ class VdexFile { ArrayRef<const uint8_t> GetVerifierDepsData() const { return ArrayRef<const uint8_t>( - Begin() + sizeof(Header) + GetHeader().GetDexSize(), GetHeader().GetVerifierDepsSize()); + DexBegin() + GetHeader().GetDexSize(), GetHeader().GetVerifierDepsSize()); } ArrayRef<const uint8_t> GetQuickeningInfo() const { @@ -107,6 +114,12 @@ class VdexFile { // is none. const uint8_t* GetNextDexFileData(const uint8_t* cursor) const; + // Get the location checksum of the dex file number `dex_file_index`. + uint32_t GetLocationChecksum(uint32_t dex_file_index) const { + DCHECK_LT(dex_file_index, GetHeader().GetNumberOfDexFiles()); + return reinterpret_cast<const uint32_t*>(Begin() + sizeof(Header))[dex_file_index]; + } + private: explicit VdexFile(MemMap* mmap) : mmap_(mmap) {} @@ -115,11 +128,15 @@ class VdexFile { } const uint8_t* DexBegin() const { - return Begin() + sizeof(Header); + return Begin() + sizeof(Header) + GetSizeOfChecksumsSection(); } const uint8_t* DexEnd() const { - return Begin() + sizeof(Header) + GetHeader().GetDexSize(); + return DexBegin() + GetHeader().GetDexSize(); + } + + size_t GetSizeOfChecksumsSection() const { + return sizeof(VdexChecksum) * GetHeader().GetNumberOfDexFiles(); } std::unique_ptr<MemMap> mmap_; diff --git a/runtime/verifier/method_verifier.cc b/runtime/verifier/method_verifier.cc index 7137db8773..ebecc85a3c 100644 --- a/runtime/verifier/method_verifier.cc +++ b/runtime/verifier/method_verifier.cc @@ -41,6 +41,7 @@ #include "mirror/class.h" #include "mirror/class-inl.h" #include "mirror/dex_cache-inl.h" +#include "mirror/method_handle_impl.h" #include "mirror/object-inl.h" #include "mirror/object_array-inl.h" #include "reg_type-inl.h" @@ -410,15 +411,15 @@ MethodVerifier::FailureData MethodVerifier::VerifyMethod(Thread* self, result.kind = kSoftFailure; if (method != nullptr && !CanCompilerHandleVerificationFailure(verifier.encountered_failure_types_)) { - method->SetAccessFlags(method->GetAccessFlags() | kAccCompileDontBother); + method->AddAccessFlags(kAccCompileDontBother); } } if (method != nullptr) { if (verifier.HasInstructionThatWillThrow()) { - method->SetAccessFlags(method->GetAccessFlags() | kAccCompileDontBother); + method->AddAccessFlags(kAccCompileDontBother); } if ((verifier.encountered_failure_types_ & VerifyError::VERIFY_ERROR_LOCKING) != 0) { - method->SetAccessFlags(method->GetAccessFlags() | kAccMustCountLocks); + method->AddAccessFlags(kAccMustCountLocks); } } } else { @@ -1184,6 +1185,11 @@ bool MethodVerifier::VerifyInstruction(const Instruction* inst, uint32_t code_of result = result && CheckWideRegisterIndex(inst->VRegC()); break; } + switch (inst->GetVerifyTypeArgumentH()) { + case Instruction::kVerifyRegHPrototype: + result = result && CheckPrototypeIndex(inst->VRegH()); + break; + } switch (inst->GetVerifyExtraFlags()) { case Instruction::kVerifyArrayData: result = result && CheckArrayData(code_offset); @@ -1289,6 +1295,15 @@ inline bool MethodVerifier::CheckNewInstance(dex::TypeIndex idx) { return true; } +inline bool MethodVerifier::CheckPrototypeIndex(uint32_t idx) { + if (idx >= dex_file_->GetHeader().proto_ids_size_) { + Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "bad prototype index " << idx << " (max " + << dex_file_->GetHeader().proto_ids_size_ << ")"; + return false; + } + return true; +} + inline bool MethodVerifier::CheckStringIndex(uint32_t idx) { if (idx >= dex_file_->GetHeader().string_ids_size_) { Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "bad string index " << idx << " (max " @@ -2934,7 +2949,7 @@ bool MethodVerifier::CodeFlowVerifyInstruction(uint32_t* start_guess) { * allowing the latter only if the "this" argument is the same as the "this" argument to * this method (which implies that we're in a constructor ourselves). */ - const RegType& this_type = work_line_->GetInvocationThis(this, inst, is_range); + const RegType& this_type = work_line_->GetInvocationThis(this, inst); if (this_type.IsConflict()) // failure. break; @@ -3015,7 +3030,7 @@ bool MethodVerifier::CodeFlowVerifyInstruction(uint32_t* start_guess) { /* Get the type of the "this" arg, which should either be a sub-interface of called * interface or Object (see comments in RegType::JoinClass). */ - const RegType& this_type = work_line_->GetInvocationThis(this, inst, is_range); + const RegType& this_type = work_line_->GetInvocationThis(this, inst); if (this_type.IsZero()) { /* null pointer always passes (and always fails at runtime) */ } else { @@ -3057,10 +3072,37 @@ bool MethodVerifier::CodeFlowVerifyInstruction(uint32_t* start_guess) { } case Instruction::INVOKE_POLYMORPHIC: case Instruction::INVOKE_POLYMORPHIC_RANGE: { + bool is_range = (inst->Opcode() == Instruction::INVOKE_POLYMORPHIC_RANGE); + ArtMethod* called_method = VerifyInvocationArgs(inst, METHOD_POLYMORPHIC, is_range); + if (called_method == nullptr) { + // Convert potential soft failures in VerifyInvocationArgs() to hard errors. + if (failure_messages_.size() > 0) { + std::string message = failure_messages_.back()->str(); + Fail(VERIFY_ERROR_BAD_CLASS_HARD) << message; + } else { + Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "invoke-polymorphic verification failure."; + } + break; + } + if (!CheckSignaturePolymorphicMethod(called_method) || + !CheckSignaturePolymorphicReceiver(inst)) { + break; + } + const uint32_t proto_idx = (is_range) ? inst->VRegH_4rcc() : inst->VRegH_45cc(); + const char* descriptor = + dex_file_->GetReturnTypeDescriptor(dex_file_->GetProtoId(proto_idx)); + const RegType& return_type = + reg_types_.FromDescriptor(GetClassLoader(), descriptor, false); + if (!return_type.IsLowHalf()) { + work_line_->SetResultRegisterType(this, return_type); + } else { + work_line_->SetResultRegisterTypeWide(return_type, return_type.HighHalf(®_types_)); + } + // TODO(oth): remove when compiler support is available. Fail(VERIFY_ERROR_FORCE_INTERPRETER) - << "instruction is not supported by verifier; skipping verification"; + << "invoke-polymorphic is not supported by compiler"; have_pending_experimental_failure_ = true; - return false; + break; } case Instruction::NEG_INT: case Instruction::NOT_INT: @@ -3416,8 +3458,6 @@ bool MethodVerifier::CodeFlowVerifyInstruction(uint32_t* start_guess) { work_line_->SetResultTypeToUnknown(this); } - - /* * Handle "branch". Tag the branch target. * @@ -3740,7 +3780,8 @@ inline static MethodResolutionKind GetMethodResolutionKind( } else if (method_type == METHOD_SUPER && is_interface) { return kInterfaceMethodResolution; } else { - DCHECK(method_type == METHOD_VIRTUAL || method_type == METHOD_SUPER); + DCHECK(method_type == METHOD_VIRTUAL || method_type == METHOD_SUPER + || method_type == METHOD_POLYMORPHIC); return kVirtualMethodResolution; } } @@ -3868,15 +3909,18 @@ ArtMethod* MethodVerifier::ResolveMethodAndCheckAccess( return nullptr; } // See if the method type implied by the invoke instruction matches the access flags for the - // target method. + // target method. The flags for METHOD_POLYMORPHIC are based on there being precisely two + // signature polymorphic methods supported by the run-time which are native methods with variable + // arguments. if ((method_type == METHOD_DIRECT && (!res_method->IsDirect() || res_method->IsStatic())) || (method_type == METHOD_STATIC && !res_method->IsStatic()) || ((method_type == METHOD_SUPER || method_type == METHOD_VIRTUAL || - method_type == METHOD_INTERFACE) && res_method->IsDirect()) - ) { + method_type == METHOD_INTERFACE) && res_method->IsDirect()) || + ((method_type == METHOD_POLYMORPHIC) && + (!res_method->IsNative() || !res_method->IsVarargs()))) { Fail(VERIFY_ERROR_CLASS_CHANGE) << "invoke type (" << method_type << ") does not match method " - " type of " << res_method->PrettyMethod(); + "type of " << res_method->PrettyMethod(); return nullptr; } return res_method; @@ -3888,20 +3932,18 @@ ArtMethod* MethodVerifier::VerifyInvocationArgsFromIterator( // We use vAA as our expected arg count, rather than res_method->insSize, because we need to // match the call to the signature. Also, we might be calling through an abstract method // definition (which doesn't have register count values). - const size_t expected_args = (is_range) ? inst->VRegA_3rc() : inst->VRegA_35c(); + const size_t expected_args = inst->VRegA(); /* caught by static verifier */ DCHECK(is_range || expected_args <= 5); - if (expected_args > code_item_->outs_size_) { - Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "invalid argument count (" << expected_args - << ") exceeds outsSize (" << code_item_->outs_size_ << ")"; - return nullptr; - } - uint32_t arg[5]; - if (!is_range) { - inst->GetVarArgs(arg); + // TODO(oth): Enable this path for invoke-polymorphic when b/33099829 is resolved. + if (method_type != METHOD_POLYMORPHIC) { + if (expected_args > code_item_->outs_size_) { + Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "invalid argument count (" << expected_args + << ") exceeds outsSize (" << code_item_->outs_size_ << ")"; + return nullptr; + } } - uint32_t sig_registers = 0; /* * Check the "this" argument, which must be an instance of the class that declared the method. @@ -3909,7 +3951,7 @@ ArtMethod* MethodVerifier::VerifyInvocationArgsFromIterator( * rigorous check here (which is okay since we have to do it at runtime). */ if (method_type != METHOD_STATIC) { - const RegType& actual_arg_type = work_line_->GetInvocationThis(this, inst, is_range); + const RegType& actual_arg_type = work_line_->GetInvocationThis(this, inst); if (actual_arg_type.IsConflict()) { // GetInvocationThis failed. CHECK(have_pending_hard_failure_); return nullptr; @@ -3945,7 +3987,7 @@ ArtMethod* MethodVerifier::VerifyInvocationArgsFromIterator( res_method_class = &FromClass(klass->GetDescriptor(&temp), klass, klass->CannotBeAssignedFromOtherTypes()); } else { - const uint32_t method_idx = (is_range) ? inst->VRegB_3rc() : inst->VRegB_35c(); + const uint32_t method_idx = inst->VRegB(); const dex::TypeIndex class_idx = dex_file_->GetMethodId(method_idx).class_idx_; res_method_class = ®_types_.FromDescriptor( GetClassLoader(), @@ -3965,13 +4007,17 @@ ArtMethod* MethodVerifier::VerifyInvocationArgsFromIterator( } } } - sig_registers = 1; } + uint32_t arg[5]; + if (!is_range) { + inst->GetVarArgs(arg); + } + uint32_t sig_registers = (method_type == METHOD_STATIC) ? 0 : 1; for ( ; it->HasNext(); it->Next()) { if (sig_registers >= expected_args) { Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "Rejecting invocation, expected " << inst->VRegA() << - " arguments, found " << sig_registers << " or more."; + " argument registers, method signature has " << sig_registers + 1 << " or more"; return nullptr; } @@ -3984,7 +4030,7 @@ ArtMethod* MethodVerifier::VerifyInvocationArgsFromIterator( } const RegType& reg_type = reg_types_.FromDescriptor(GetClassLoader(), param_descriptor, false); - uint32_t get_reg = is_range ? inst->VRegC_3rc() + static_cast<uint32_t>(sig_registers) : + uint32_t get_reg = is_range ? inst->VRegC() + static_cast<uint32_t>(sig_registers) : arg[sig_registers]; if (reg_type.IsIntegralTypes()) { const RegType& src_type = work_line_->GetRegisterType(this, get_reg); @@ -4020,7 +4066,7 @@ ArtMethod* MethodVerifier::VerifyInvocationArgsFromIterator( } if (expected_args != sig_registers) { Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "Rejecting invocation, expected " << expected_args << - " arguments, found " << sig_registers; + " argument registers, method signature has " << sig_registers; return nullptr; } return res_method; @@ -4032,11 +4078,10 @@ void MethodVerifier::VerifyInvocationArgsUnresolvedMethod(const Instruction* ins // As the method may not have been resolved, make this static check against what we expect. // The main reason for this code block is to fail hard when we find an illegal use, e.g., // wrong number of arguments or wrong primitive types, even if the method could not be resolved. - const uint32_t method_idx = (is_range) ? inst->VRegB_3rc() : inst->VRegB_35c(); + const uint32_t method_idx = inst->VRegB(); DexFileParameterIterator it(*dex_file_, dex_file_->GetProtoId(dex_file_->GetMethodId(method_idx).proto_idx_)); - VerifyInvocationArgsFromIterator<DexFileParameterIterator>(&it, inst, method_type, is_range, - nullptr); + VerifyInvocationArgsFromIterator(&it, inst, method_type, is_range, nullptr); } class MethodParamListDescriptorIterator { @@ -4069,8 +4114,7 @@ ArtMethod* MethodVerifier::VerifyInvocationArgs( const Instruction* inst, MethodType method_type, bool is_range) { // Resolve the method. This could be an abstract or concrete method depending on what sort of call // we're making. - const uint32_t method_idx = (is_range) ? inst->VRegB_3rc() : inst->VRegB_35c(); - + const uint32_t method_idx = inst->VRegB(); ArtMethod* res_method = ResolveMethodAndCheckAccess(method_idx, method_type); if (res_method == nullptr) { // error or class is unresolved // Check what we can statically. @@ -4133,10 +4177,84 @@ ArtMethod* MethodVerifier::VerifyInvocationArgs( } } - // Process the target method's signature. This signature may or may not - MethodParamListDescriptorIterator it(res_method); - return VerifyInvocationArgsFromIterator<MethodParamListDescriptorIterator>(&it, inst, method_type, - is_range, res_method); + if (method_type == METHOD_POLYMORPHIC) { + // Process the signature of the calling site that is invoking the method handle. + DexFileParameterIterator it(*dex_file_, dex_file_->GetProtoId(inst->VRegH())); + return VerifyInvocationArgsFromIterator(&it, inst, method_type, is_range, res_method); + } else { + // Process the target method's signature. + MethodParamListDescriptorIterator it(res_method); + return VerifyInvocationArgsFromIterator(&it, inst, method_type, is_range, res_method); + } +} + +bool MethodVerifier::CheckSignaturePolymorphicMethod(ArtMethod* method) { + mirror::Class* klass = method->GetDeclaringClass(); + if (klass != mirror::MethodHandle::StaticClass()) { + Fail(VERIFY_ERROR_BAD_CLASS_HARD) + << "Signature polymorphic method must be declared in java.lang.invoke.MethodClass"; + return false; + } + + const char* method_name = method->GetName(); + if (strcmp(method_name, "invoke") != 0 && strcmp(method_name, "invokeExact") != 0) { + Fail(VERIFY_ERROR_BAD_CLASS_HARD) + << "Signature polymorphic method name invalid: " << method_name; + return false; + } + + const DexFile::TypeList* types = method->GetParameterTypeList(); + if (types->Size() != 1) { + Fail(VERIFY_ERROR_BAD_CLASS_HARD) + << "Signature polymorphic method has too many arguments " << types->Size() << " != 1"; + return false; + } + + const dex::TypeIndex argument_type_index = types->GetTypeItem(0).type_idx_; + const char* argument_descriptor = method->GetTypeDescriptorFromTypeIdx(argument_type_index); + if (strcmp(argument_descriptor, "[Ljava/lang/Object;") != 0) { + Fail(VERIFY_ERROR_BAD_CLASS_HARD) + << "Signature polymorphic method has unexpected argument type: " << argument_descriptor; + return false; + } + + const char* return_descriptor = method->GetReturnTypeDescriptor(); + if (strcmp(return_descriptor, "Ljava/lang/Object;") != 0) { + Fail(VERIFY_ERROR_BAD_CLASS_HARD) + << "Signature polymorphic method has unexpected return type: " << return_descriptor; + return false; + } + + return true; +} + +bool MethodVerifier::CheckSignaturePolymorphicReceiver(const Instruction* inst) { + const RegType& this_type = work_line_->GetInvocationThis(this, inst); + if (this_type.IsZero()) { + /* null pointer always passes (and always fails at run time) */ + return true; + } else if (!this_type.IsNonZeroReferenceTypes()) { + Fail(VERIFY_ERROR_BAD_CLASS_HARD) + << "invoke-polymorphic receiver is not a reference: " + << this_type; + return false; + } else if (this_type.IsUninitializedReference()) { + Fail(VERIFY_ERROR_BAD_CLASS_HARD) + << "invoke-polymorphic receiver is uninitialized: " + << this_type; + return false; + } else if (!this_type.HasClass()) { + Fail(VERIFY_ERROR_BAD_CLASS_HARD) + << "invoke-polymorphic receiver has no class: " + << this_type; + return false; + } else if (!this_type.GetClass()->IsSubClass(mirror::MethodHandle::StaticClass())) { + Fail(VERIFY_ERROR_BAD_CLASS_HARD) + << "invoke-polymorphic receiver is not a subclass of MethodHandle: " + << this_type; + return false; + } + return true; } ArtMethod* MethodVerifier::GetQuickInvokedMethod(const Instruction* inst, RegisterLine* reg_line, @@ -4146,7 +4264,7 @@ ArtMethod* MethodVerifier::GetQuickInvokedMethod(const Instruction* inst, Regist } else { DCHECK_EQ(inst->Opcode(), Instruction::INVOKE_VIRTUAL_QUICK); } - const RegType& actual_arg_type = reg_line->GetInvocationThis(this, inst, is_range, allow_failure); + const RegType& actual_arg_type = reg_line->GetInvocationThis(this, inst, allow_failure); if (!actual_arg_type.HasClass()) { VLOG(verifier) << "Failed to get mirror::Class* from '" << actual_arg_type << "'"; return nullptr; @@ -4208,7 +4326,7 @@ ArtMethod* MethodVerifier::VerifyInvokeVirtualQuickArgs(const Instruction* inst, // We use vAA as our expected arg count, rather than res_method->insSize, because we need to // match the call to the signature. Also, we might be calling through an abstract method // definition (which doesn't have register count values). - const RegType& actual_arg_type = work_line_->GetInvocationThis(this, inst, is_range); + const RegType& actual_arg_type = work_line_->GetInvocationThis(this, inst); if (actual_arg_type.IsConflict()) { // GetInvocationThis failed. return nullptr; } diff --git a/runtime/verifier/method_verifier.h b/runtime/verifier/method_verifier.h index f3faecd9a7..fa5a698423 100644 --- a/runtime/verifier/method_verifier.h +++ b/runtime/verifier/method_verifier.h @@ -63,7 +63,8 @@ enum MethodType { METHOD_STATIC, // static METHOD_VIRTUAL, // virtual METHOD_SUPER, // super - METHOD_INTERFACE // interface + METHOD_INTERFACE, // interface + METHOD_POLYMORPHIC // polymorphic }; std::ostream& operator<<(std::ostream& os, const MethodType& rhs); @@ -474,6 +475,10 @@ class MethodVerifier { // reference isn't for an array class. bool CheckNewInstance(dex::TypeIndex idx); + // Perform static checks on a prototype indexing instruction. All we do here is ensure that the + // prototype index is in the valid range. + bool CheckPrototypeIndex(uint32_t idx); + /* Ensure that the string index is in the valid range. */ bool CheckStringIndex(uint32_t idx); @@ -512,6 +517,12 @@ class MethodVerifier { // - vA holds word count, vC holds index of first reg. bool CheckVarArgRangeRegs(uint32_t vA, uint32_t vC); + // Checks the method matches the expectations required to be signature polymorphic. + bool CheckSignaturePolymorphicMethod(ArtMethod* method) REQUIRES_SHARED(Locks::mutator_lock_); + + // Checks the invoked receiver matches the expectations for signature polymorphic methods. + bool CheckSignaturePolymorphicReceiver(const Instruction* inst) REQUIRES_SHARED(Locks::mutator_lock_); + // Extract the relative offset from a branch instruction. // Returns "false" on failure (e.g. this isn't a branch instruction). bool GetBranchOffset(uint32_t cur_offset, int32_t* pOffset, bool* pConditional, diff --git a/runtime/verifier/register_line.cc b/runtime/verifier/register_line.cc index da3d946142..a6088aa036 100644 --- a/runtime/verifier/register_line.cc +++ b/runtime/verifier/register_line.cc @@ -44,8 +44,9 @@ bool RegisterLine::CheckConstructorReturn(MethodVerifier* verifier) const { } const RegType& RegisterLine::GetInvocationThis(MethodVerifier* verifier, const Instruction* inst, - bool is_range, bool allow_failure) { - const size_t args_count = is_range ? inst->VRegA_3rc() : inst->VRegA_35c(); + bool allow_failure) { + DCHECK(inst->IsInvoke()); + const size_t args_count = inst->VRegA(); if (args_count < 1) { if (!allow_failure) { verifier->Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "invoke lacks 'this'"; @@ -53,7 +54,7 @@ const RegType& RegisterLine::GetInvocationThis(MethodVerifier* verifier, const I return verifier->GetRegTypeCache()->Conflict(); } /* Get the element type of the array held in vsrc */ - const uint32_t this_reg = (is_range) ? inst->VRegC_3rc() : inst->VRegC_35c(); + const uint32_t this_reg = inst->VRegC(); const RegType& this_type = GetRegisterType(verifier, this_reg); if (!this_type.IsReferenceTypes()) { if (!allow_failure) { diff --git a/runtime/verifier/register_line.h b/runtime/verifier/register_line.h index 7603a79c85..221aa80e43 100644 --- a/runtime/verifier/register_line.h +++ b/runtime/verifier/register_line.h @@ -217,7 +217,6 @@ class RegisterLine { */ const RegType& GetInvocationThis(MethodVerifier* verifier, const Instruction* inst, - bool is_range, bool allow_failure = false) REQUIRES_SHARED(Locks::mutator_lock_); diff --git a/test/080-oom-fragmentation/expected.txt b/test/080-oom-fragmentation/expected.txt new file mode 100644 index 0000000000..e69de29bb2 --- /dev/null +++ b/test/080-oom-fragmentation/expected.txt diff --git a/test/080-oom-fragmentation/info.txt b/test/080-oom-fragmentation/info.txt new file mode 100644 index 0000000000..5bcc425d31 --- /dev/null +++ b/test/080-oom-fragmentation/info.txt @@ -0,0 +1,2 @@ +Test that the allocator can go from a full heap to an empty one and is able to allocate a large +object array. diff --git a/test/080-oom-fragmentation/src/Main.java b/test/080-oom-fragmentation/src/Main.java new file mode 100644 index 0000000000..cf2113906f --- /dev/null +++ b/test/080-oom-fragmentation/src/Main.java @@ -0,0 +1,35 @@ +/* + * Copyright (C) 2016 The Android Open Source Project + * + * Licensed under the Apache License, Version 2.0 (the "License"); + * you may not use this file except in compliance with the License. + * You may obtain a copy of the License at + * + * http://www.apache.org/licenses/LICENSE-2.0 + * + * Unless required by applicable law or agreed to in writing, software + * distributed under the License is distributed on an "AS IS" BASIS, + * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. + * See the License for the specific language governing permissions and + * limitations under the License. + */ + +public class Main { + public static void main(String[] args) { + // Reserve around 1/4 of the RAM for keeping objects live. + long maxMem = Runtime.getRuntime().maxMemory(); + Object[] holder = new Object[(int)maxMem / 16]; + int count = 0; + try { + while (true) { + holder[count++] = new Object[1025]; // A bit over one page. + } + } catch (OutOfMemoryError e) {} + for (int i = 0; i < count; ++i) { + holder[i] = null; + } + // Make sure the heap can handle allocating large object array. This makes sure that free + // pages are correctly coalesced together by the allocator. + holder[0] = new Object[(int)maxMem / 8]; + } +} diff --git a/test/522-checker-regression-monitor-exit/src/Main.java b/test/522-checker-regression-monitor-exit/src/Main.java index a5e9512796..c4f80fc9c6 100644 --- a/test/522-checker-regression-monitor-exit/src/Main.java +++ b/test/522-checker-regression-monitor-exit/src/Main.java @@ -66,7 +66,7 @@ public class Main { } try { - List<Future<Integer>> results = pool.invokeAll(queries, 5, TimeUnit.SECONDS); + List<Future<Integer>> results = pool.invokeAll(queries); int hash = obj.hashCode(); for (int i = 0; i < numThreads; ++i) { diff --git a/test/616-cha/expected.txt b/test/616-cha/expected.txt new file mode 100644 index 0000000000..6a5618ebc6 --- /dev/null +++ b/test/616-cha/expected.txt @@ -0,0 +1 @@ +JNI_OnLoad called diff --git a/test/616-cha/info.txt b/test/616-cha/info.txt new file mode 100644 index 0000000000..50e3b0db18 --- /dev/null +++ b/test/616-cha/info.txt @@ -0,0 +1 @@ +Test for Class Hierarchy Analysis (CHA). diff --git a/test/616-cha/src/Main.java b/test/616-cha/src/Main.java new file mode 100644 index 0000000000..787318dd67 --- /dev/null +++ b/test/616-cha/src/Main.java @@ -0,0 +1,255 @@ +/* + * Copyright (C) 2016 The Android Open Source Project + * + * Licensed under the Apache License, Version 2.0 (the "License"); + * you may not use this file except in compliance with the License. + * You may obtain a copy of the License at + * + * http://www.apache.org/licenses/LICENSE-2.0 + * + * Unless required by applicable law or agreed to in writing, software + * distributed under the License is distributed on an "AS IS" BASIS, + * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. + * See the License for the specific language governing permissions and + * limitations under the License. + */ + +class Main1 { + String getName() { + return "Main1"; + } + + void printError(String msg) { + System.out.println(msg); + } + + void foo(int i) { + if (i != 1) { + printError("error1"); + } + } + + int getValue1() { + return 1; + } + int getValue2() { + return 2; + } + int getValue3() { + return 3; + } + int getValue4() { + return 4; + } + int getValue5() { + return 5; + } + int getValue6() { + return 6; + } +} + +class Main2 extends Main1 { + String getName() { + return "Main2"; + } + + void foo(int i) { + if (i != 2) { + printError("error2"); + } + } +} + +class Main3 extends Main1 { + String getName() { + return "Main3"; + } +} + +public class Main { + static Main1 sMain1; + static Main1 sMain2; + + static boolean sIsOptimizing = true; + static boolean sHasJIT = true; + static volatile boolean sOtherThreadStarted; + + // sMain1.foo() will be always be Main1.foo() before Main2 is loaded/linked. + // So sMain1.foo() can be devirtualized to Main1.foo() and be inlined. + // After Dummy.createMain2() which links in Main2, live testOverride() on stack + // should be deoptimized. + static void testOverride(boolean createMain2, boolean wait, boolean setHasJIT) { + if (setHasJIT) { + if (isInterpreted()) { + sHasJIT = false; + } + return; + } + + if (createMain2 && (sIsOptimizing || sHasJIT)) { + assertIsManaged(); + } + + sMain1.foo(sMain1.getClass() == Main1.class ? 1 : 2); + + if (createMain2) { + // Wait for the other thread to start. + while (!sOtherThreadStarted); + // Create an Main2 instance and assign it to sMain2. + // sMain1 is kept the same. + sMain2 = Dummy.createMain2(); + // Wake up the other thread. + synchronized(Main.class) { + Main.class.notify(); + } + } else if (wait) { + // This is the other thread. + synchronized(Main.class) { + sOtherThreadStarted = true; + // Wait for Main2 to be linked and deoptimization is triggered. + try { + Main.class.wait(); + } catch (Exception e) { + } + } + } + + // There should be a deoptimization here right after Main2 is linked by + // calling Dummy.createMain2(), even though sMain1 didn't change. + // The behavior here would be different if inline-cache is used, which + // doesn't deoptimize since sMain1 still hits the type cache. + sMain1.foo(sMain1.getClass() == Main1.class ? 1 : 2); + if ((createMain2 || wait) && sHasJIT && !sIsOptimizing) { + // This method should be deoptimized right after Main2 is created. + assertIsInterpreted(); + } + + if (sMain2 != null) { + sMain2.foo(sMain2.getClass() == Main1.class ? 1 : 2); + } + } + + static Main1[] sArray; + + static long calcValue(Main1 m) { + return m.getValue1() + + m.getValue2() * 2 + + m.getValue3() * 3 + + m.getValue4() * 4 + + m.getValue5() * 5 + + m.getValue6() * 6; + } + + static long testNoOverrideLoop(int count) { + long sum = 0; + for (int i=0; i<count; i++) { + sum += calcValue(sArray[0]); + sum += calcValue(sArray[1]); + sum += calcValue(sArray[2]); + } + return sum; + } + + static void testNoOverride() { + sArray = new Main1[3]; + sArray[0] = new Main1(); + sArray[1] = Dummy.createMain2(); + sArray[2] = Dummy.createMain3(); + long sum = 0; + // Loop enough to get methods JITed. + for (int i=0; i<100; i++) { + testNoOverrideLoop(1); + } + ensureJitCompiled(Main.class, "testNoOverrideLoop"); + ensureJitCompiled(Main.class, "calcValue"); + + long t1 = System.currentTimeMillis(); + sum = testNoOverrideLoop(100000); + long t2 = System.currentTimeMillis(); + if (sum != 27300000L) { + System.out.println("Unexpected result."); + } + } + + private static void assertSingleImplementation(Class<?> clazz, String method_name, boolean b) { + if (hasSingleImplementation(clazz, method_name) != b) { + System.out.println(clazz + "." + method_name + + " doesn't have single implementation value of " + b); + } + } + + // Test scanerios under which CHA-based devirtualization happens, + // and class loading that overrides a method can invalidate compiled code. + // Also test pure non-overriding case, which is more for checking generated + // code form. + public static void main(String[] args) { + System.loadLibrary(args[0]); + + // CHeck some boot-image methods. + assertSingleImplementation(java.util.ArrayList.class, "size", true); + // java.util.LinkedHashMap overrides get(). + assertSingleImplementation(java.util.HashMap.class, "get", false); + + // We don't set single-implementation modifier bit for final classes or methods + // since we can devirtualize without CHA for those cases. However hasSingleImplementation() + // should return true for those cases. + assertSingleImplementation(java.lang.String.class, "charAt", true); + assertSingleImplementation(java.lang.Thread.class, "join", true); + // We don't set single-implementation modifier bit for native methods. + assertSingleImplementation(java.lang.Thread.class, "isInterrupted", false); + + if (isInterpreted()) { + sIsOptimizing = false; + } + + // sMain1 is an instance of Main1. Main2 hasn't bee loaded yet. + sMain1 = new Main1(); + + // Loop enough to get testOverride() JITed. + for (int i=0; i<100; i++) { + testOverride(false, false, false); + } + + ensureJitCompiled(Main.class, "testOverride"); + testOverride(false, false, true); + + if (sHasJIT && !sIsOptimizing) { + assertSingleImplementation(Main1.class, "foo", true); + } else { + // Main2 is verified ahead-of-time so it's linked in already. + } + assertSingleImplementation(Main1.class, "getValue1", true); + + // Create another thread that also calls sMain1.foo(). + // Try to test suspend and deopt another thread. + new Thread() { + public void run() { + testOverride(false, true, false); + } + }.start(); + + // This will create Main2 instance in the middle of testOverride(). + testOverride(true, false, false); + assertSingleImplementation(Main1.class, "foo", false); + assertSingleImplementation(Main1.class, "getValue1", true); + + testNoOverride(); + } + + private static native void ensureJitCompiled(Class<?> itf, String method_name); + private static native void assertIsInterpreted(); + private static native void assertIsManaged(); + private static native boolean isInterpreted(); + private static native boolean hasSingleImplementation(Class<?> clazz, String method_name); +} + +// Do it in another class to avoid class loading due to verifier. +class Dummy { + static Main1 createMain2() { + return new Main2(); + } + static Main1 createMain3() { + return new Main3(); + } +} diff --git a/test/626-const-class-linking/clear_dex_cache_types.cc b/test/626-const-class-linking/clear_dex_cache_types.cc deleted file mode 100644 index b035896166..0000000000 --- a/test/626-const-class-linking/clear_dex_cache_types.cc +++ /dev/null @@ -1,65 +0,0 @@ -/* - * Copyright (C) 2016 The Android Open Source Project - * - * Licensed under the Apache License, Version 2.0 (the "License"); - * you may not use this file except in compliance with the License. - * You may obtain a copy of the License at - * - * http://www.apache.org/licenses/LICENSE-2.0 - * - * Unless required by applicable law or agreed to in writing, software - * distributed under the License is distributed on an "AS IS" BASIS, - * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. - * See the License for the specific language governing permissions and - * limitations under the License. - */ - -#include "jni.h" -#include "object_lock.h" -#include "scoped_thread_state_change-inl.h" - -namespace art { - -extern "C" JNIEXPORT void JNICALL Java_Main_nativeClearResolvedTypes(JNIEnv*, jclass, jclass cls) { - ScopedObjectAccess soa(Thread::Current()); - mirror::DexCache* dex_cache = soa.Decode<mirror::Class>(cls)->GetDexCache(); - for (size_t i = 0, num_types = dex_cache->NumResolvedTypes(); i != num_types; ++i) { - dex_cache->SetResolvedType(dex::TypeIndex(i), ObjPtr<mirror::Class>(nullptr)); - } -} - -extern "C" JNIEXPORT void JNICALL Java_Main_nativeSkipVerification(JNIEnv*, jclass, jclass cls) { - ScopedObjectAccess soa(Thread::Current()); - StackHandleScope<1> hs(soa.Self()); - Handle<mirror::Class> klass = hs.NewHandle(soa.Decode<mirror::Class>(cls)); - mirror::Class::Status status = klass->GetStatus(); - if (status == mirror::Class::kStatusResolved) { - ObjectLock<mirror::Class> lock(soa.Self(), klass); - klass->SetStatus(klass, mirror::Class::kStatusVerified, soa.Self()); - } else { - LOG(ERROR) << klass->PrettyClass() << " has unexpected status: " << status; - } -} - -extern "C" JNIEXPORT void JNICALL Java_Main_nativeDumpClasses(JNIEnv*, jclass, jobjectArray array) { - ScopedObjectAccess soa(Thread::Current()); - StackHandleScope<1> hs(soa.Self()); - Handle<mirror::ObjectArray<mirror::Object>> classes = - hs.NewHandle(soa.Decode<mirror::ObjectArray<mirror::Object>>(array)); - CHECK(classes.Get() != nullptr); - for (size_t i = 0, length = classes->GetLength(); i != length; ++i) { - CHECK(classes->Get(i) != nullptr) << i; - CHECK(classes->Get(i)->IsClass()) - << i << " " << classes->Get(i)->GetClass()->PrettyDescriptor(); - mirror::Class* as_class = classes->Get(i)->AsClass(); - mirror::ClassLoader* loader = as_class->GetClassLoader(); - LOG(ERROR) << "Class #" << i << ": " << as_class->PrettyDescriptor() - << " @" << static_cast<const void*>(as_class) - << " status:" << as_class->GetStatus() - << " definingLoader:" << static_cast<const void*>(loader) - << " definingLoaderClass:" - << (loader != nullptr ? loader->GetClass()->PrettyDescriptor() : "N/A"); - } -} - -} // namespace art diff --git a/test/626-const-class-linking/expected.txt b/test/626-const-class-linking/expected.txt deleted file mode 100644 index de1b8152ee..0000000000 --- a/test/626-const-class-linking/expected.txt +++ /dev/null @@ -1,61 +0,0 @@ -JNI_OnLoad called -first: Helper1 class loader: DelegatingLoader -second: Test class loader: DefiningLoader -first: Helper1 class loader: DelegatingLoader -second: Test class loader: DefiningLoader -testClearDexCache done -first: Helper1 class loader: DelegatingLoader -second: Test class loader: DefiningLoader -first: Helper2 class loader: DelegatingLoader -second: Test class loader: DefiningLoader -testMultiDex done -first: Helper1 class loader: RacyLoader -second: Test class loader: DefiningLoader -first: Helper1 class loader: RacyLoader -second: Test class loader: DefiningLoader -first: Helper1 class loader: RacyLoader -second: Test class loader: DefiningLoader -first: Helper1 class loader: RacyLoader -second: Test class loader: DefiningLoader -total: 4 - throwables: 0 - classes: 4 (1 unique) -testRacyLoader done -first: Helper1 class loader: RacyLoader -second: Test class loader: DefiningLoader -first: Helper1 class loader: RacyLoader -second: Test class loader: DefiningLoader -first: Helper3 class loader: RacyLoader -second: Test3 class loader: DefiningLoader -first: Helper3 class loader: RacyLoader -second: Test3 class loader: DefiningLoader -total: 4 - throwables: 0 - classes: 4 (2 unique) -testRacyLoader2 done -java.lang.NoClassDefFoundError: Initiating class loader of type MisbehavingLoader returned class Helper2 instead of Test. -testMisbehavingLoader done -first: Helper1 class loader: RacyMisbehavingLoader -second: Test class loader: DefiningLoader -first: Helper1 class loader: RacyMisbehavingLoader -second: Test class loader: DefiningLoader -first: Helper1 class loader: RacyMisbehavingLoader -second: Test class loader: DefiningLoader -first: Helper1 class loader: RacyMisbehavingLoader -second: Test class loader: DefiningLoader -total: 4 - throwables: 0 - classes: 4 (1 unique) -testRacyMisbehavingLoader done -first: Helper1 class loader: RacyMisbehavingLoader -second: Test class loader: DefiningLoader -first: Helper1 class loader: RacyMisbehavingLoader -second: Test class loader: DefiningLoader -first: Helper1 class loader: RacyMisbehavingLoader -second: Test class loader: DefiningLoader -first: Helper1 class loader: RacyMisbehavingLoader -second: Test class loader: DefiningLoader -total: 4 - throwables: 0 - classes: 4 (1 unique) -testRacyMisbehavingLoader2 done diff --git a/test/626-const-class-linking/info.txt b/test/626-const-class-linking/info.txt deleted file mode 100644 index 9c19a46659..0000000000 --- a/test/626-const-class-linking/info.txt +++ /dev/null @@ -1,3 +0,0 @@ -Test that once a const-class instruction is linked, it will keep referring -to the same class even in the presence of custom class loaders even after -clearing the dex cache type array. diff --git a/test/626-const-class-linking/multidex.jpp b/test/626-const-class-linking/multidex.jpp deleted file mode 100644 index c7a66488c0..0000000000 --- a/test/626-const-class-linking/multidex.jpp +++ /dev/null @@ -1,27 +0,0 @@ -ClassPair: - @@com.android.jack.annotations.ForceInMainDex - class ClassPair -DefiningLoader: - @@com.android.jack.annotations.ForceInMainDex - class DefiningLoader -DelegatingLoader: - @@com.android.jack.annotations.ForceInMainDex - class DelegatingLoader -Helper1: - @@com.android.jack.annotations.ForceInMainDex - class Helper1 -Main: - @@com.android.jack.annotations.ForceInMainDex - class Main -MisbehavingLoader: - @@com.android.jack.annotations.ForceInMainDex - class MisbehavingLoader -RacyLoader: - @@com.android.jack.annotations.ForceInMainDex - class RacyLoader -RacyMisbehavingHelper: - @@com.android.jack.annotations.ForceInMainDex - class RacyMisbehavingHelper -RacyMisbehavingLoader: - @@com.android.jack.annotations.ForceInMainDex - class RacyMisbehavingLoader diff --git a/test/626-const-class-linking/src-multidex/Helper3.java b/test/626-const-class-linking/src-multidex/Helper3.java deleted file mode 100644 index af996de2a7..0000000000 --- a/test/626-const-class-linking/src-multidex/Helper3.java +++ /dev/null @@ -1,23 +0,0 @@ -/* - * Copyright (C) 2016 The Android Open Source Project - * - * Licensed under the Apache License, Version 2.0 (the "License"); - * you may not use this file except in compliance with the License. - * You may obtain a copy of the License at - * - * http://www.apache.org/licenses/LICENSE-2.0 - * - * Unless required by applicable law or agreed to in writing, software - * distributed under the License is distributed on an "AS IS" BASIS, - * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. - * See the License for the specific language governing permissions and - * limitations under the License. - */ - -public class Helper3 { - public static ClassPair get() { - Class<?> helper3_class = Helper3.class; - Class<?> test3_class = Test3.class; - return new ClassPair(helper3_class, test3_class); - } -} diff --git a/test/626-const-class-linking/src-multidex/Test.java b/test/626-const-class-linking/src-multidex/Test.java deleted file mode 100644 index 1b0cc2a791..0000000000 --- a/test/626-const-class-linking/src-multidex/Test.java +++ /dev/null @@ -1,18 +0,0 @@ -/* - * Copyright (C) 2016 The Android Open Source Project - * - * Licensed under the Apache License, Version 2.0 (the "License"); - * you may not use this file except in compliance with the License. - * You may obtain a copy of the License at - * - * http://www.apache.org/licenses/LICENSE-2.0 - * - * Unless required by applicable law or agreed to in writing, software - * distributed under the License is distributed on an "AS IS" BASIS, - * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. - * See the License for the specific language governing permissions and - * limitations under the License. - */ - -public class Test { -} diff --git a/test/626-const-class-linking/src-multidex/Test3.java b/test/626-const-class-linking/src-multidex/Test3.java deleted file mode 100644 index c4b134deaa..0000000000 --- a/test/626-const-class-linking/src-multidex/Test3.java +++ /dev/null @@ -1,18 +0,0 @@ -/* - * Copyright (C) 2016 The Android Open Source Project - * - * Licensed under the Apache License, Version 2.0 (the "License"); - * you may not use this file except in compliance with the License. - * You may obtain a copy of the License at - * - * http://www.apache.org/licenses/LICENSE-2.0 - * - * Unless required by applicable law or agreed to in writing, software - * distributed under the License is distributed on an "AS IS" BASIS, - * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. - * See the License for the specific language governing permissions and - * limitations under the License. - */ - -public class Test3 { -} diff --git a/test/626-const-class-linking/src/ClassPair.java b/test/626-const-class-linking/src/ClassPair.java deleted file mode 100644 index b07036c70c..0000000000 --- a/test/626-const-class-linking/src/ClassPair.java +++ /dev/null @@ -1,32 +0,0 @@ -/* - * Copyright (C) 2016 The Android Open Source Project - * - * Licensed under the Apache License, Version 2.0 (the "License"); - * you may not use this file except in compliance with the License. - * You may obtain a copy of the License at - * - * http://www.apache.org/licenses/LICENSE-2.0 - * - * Unless required by applicable law or agreed to in writing, software - * distributed under the License is distributed on an "AS IS" BASIS, - * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. - * See the License for the specific language governing permissions and - * limitations under the License. - */ - -public class ClassPair { - public Class<?> first; - public Class<?> second; - - public ClassPair(Class<?> first, Class<?> second) { - this.first = first; - this.second = second; - } - - public void print() { - String first_loader_name = first.getClassLoader().getClass().getName(); - System.out.println("first: " + first.getName() + " class loader: " + first_loader_name); - String second_loader_name = second.getClassLoader().getClass().getName(); - System.out.println("second: " + second.getName() + " class loader: " + second_loader_name); - } -} diff --git a/test/626-const-class-linking/src/DefiningLoader.java b/test/626-const-class-linking/src/DefiningLoader.java deleted file mode 100644 index b17ab7755f..0000000000 --- a/test/626-const-class-linking/src/DefiningLoader.java +++ /dev/null @@ -1,239 +0,0 @@ -/* - * Copyright (C) 2016 The Android Open Source Project - * - * Licensed under the Apache License, Version 2.0 (the "License"); - * you may not use this file except in compliance with the License. - * You may obtain a copy of the License at - * - * http://www.apache.org/licenses/LICENSE-2.0 - * - * Unless required by applicable law or agreed to in writing, software - * distributed under the License is distributed on an "AS IS" BASIS, - * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. - * See the License for the specific language governing permissions and - * limitations under the License. - */ - -import java.io.File; -import java.io.FileNotFoundException; -import java.io.IOException; -import java.io.RandomAccessFile; -import java.lang.reflect.Constructor; -import java.lang.reflect.Method; -import java.lang.reflect.InvocationTargetException; - -/** - * A class loader with atypical behavior: we try to load a private - * class implementation before asking the system or boot loader. This - * is used to create multiple classes with identical names in a single VM. - * - * If DexFile is available, we use that; if not, we assume we're not in - * Dalvik and instantiate the class with defineClass(). - * - * The location of the DEX files and class data is dependent upon the - * test framework. - */ -public class DefiningLoader extends ClassLoader { - static { - // For JVM, register as parallel capable. - // Android treats all class loaders as parallel capable and makes this a no-op. - registerAsParallelCapable(); - } - - /* this is where the .class files live */ - static final String CLASS_PATH1 = "classes/"; - static final String CLASS_PATH2 = "classes2/"; - - /* this is the DEX/Jar file */ - static final String DEX_FILE = System.getenv("DEX_LOCATION") + "/626-const-class-linking.jar"; - - /* on Dalvik, this is a DexFile; otherwise, it's null */ - private Class<?> mDexClass; - - private Object mDexFile; - - /** - * Construct DefiningLoader, grabbing a reference to the DexFile class - * if we're running under Dalvik. - */ - public DefiningLoader(ClassLoader parent) { - super(parent); - - try { - mDexClass = parent.loadClass("dalvik.system.DexFile"); - } catch (ClassNotFoundException cnfe) { - // ignore -- not running Dalvik - } - } - - /** - * Finds the class with the specified binary name. - * - * We search for a file in CLASS_PATH or pull an entry from DEX_FILE. - * If we don't find a match, we throw an exception. - */ - protected Class<?> findClass(String name) throws ClassNotFoundException - { - if (mDexClass != null) { - return findClassDalvik(name); - } else { - return findClassNonDalvik(name); - } - } - - /** - * Finds the class with the specified binary name, from a DEX file. - */ - private Class<?> findClassDalvik(String name) - throws ClassNotFoundException { - - if (mDexFile == null) { - synchronized (DefiningLoader.class) { - Constructor<?> ctor; - /* - * Construct a DexFile object through reflection. - */ - try { - ctor = mDexClass.getConstructor(String.class); - } catch (NoSuchMethodException nsme) { - throw new ClassNotFoundException("getConstructor failed", - nsme); - } - - try { - mDexFile = ctor.newInstance(DEX_FILE); - } catch (InstantiationException ie) { - throw new ClassNotFoundException("newInstance failed", ie); - } catch (IllegalAccessException iae) { - throw new ClassNotFoundException("newInstance failed", iae); - } catch (InvocationTargetException ite) { - throw new ClassNotFoundException("newInstance failed", ite); - } - } - } - - /* - * Call DexFile.loadClass(String, ClassLoader). - */ - Method meth; - - try { - meth = mDexClass.getMethod("loadClass", String.class, ClassLoader.class); - } catch (NoSuchMethodException nsme) { - throw new ClassNotFoundException("getMethod failed", nsme); - } - - try { - meth.invoke(mDexFile, name, this); - } catch (IllegalAccessException iae) { - throw new ClassNotFoundException("loadClass failed", iae); - } catch (InvocationTargetException ite) { - throw new ClassNotFoundException("loadClass failed", - ite.getCause()); - } - - return null; - } - - /** - * Finds the class with the specified binary name, from .class files. - */ - private Class<?> findClassNonDalvik(String name) - throws ClassNotFoundException { - - String[] pathNames = { CLASS_PATH1 + name + ".class", CLASS_PATH2 + name + ".class" }; - - String pathName = null; - RandomAccessFile raf = null; - - for (String pn : pathNames) { - pathName = pn; - try { - //System.out.println("--- Defining: looking for " + pathName); - raf = new RandomAccessFile(new File(pathName), "r"); - break; - } catch (FileNotFoundException fnfe) { - } - } - if (raf == null) { - throw new ClassNotFoundException("Not found: " + pathNames[0] + ":" + pathNames[1]); - } - - /* read the entire file in */ - byte[] fileData; - try { - fileData = new byte[(int) raf.length()]; - raf.readFully(fileData); - } catch (IOException ioe) { - throw new ClassNotFoundException("Read error: " + pathName); - } finally { - try { - raf.close(); - } catch (IOException ioe) { - // drop - } - } - - /* create the class */ - //System.out.println("--- Defining: defining " + name); - try { - return defineClass(name, fileData, 0, fileData.length); - } catch (Throwable th) { - throw new ClassNotFoundException("defineClass failed", th); - } - } - - /** - * Load a class. - * - * Normally a class loader wouldn't override this, but we want our - * version of the class to take precedence over an already-loaded - * version. - * - * We still want the system classes (e.g. java.lang.Object) from the - * bootstrap class loader. - */ - synchronized protected Class<?> loadClass(String name, boolean resolve) - throws ClassNotFoundException - { - Class<?> res; - - /* - * 1. Invoke findLoadedClass(String) to check if the class has - * already been loaded. - * - * This doesn't change. - */ - res = findLoadedClass(name); - if (res != null) { - // System.out.println("FancyLoader.loadClass: " + name + " already loaded"); - if (resolve) - resolveClass(res); - return res; - } - - /* - * 3. Invoke the findClass(String) method to find the class. - */ - try { - res = findClass(name); - if (resolve) - resolveClass(res); - } - catch (ClassNotFoundException e) { - // we couldn't find it, so eat the exception and keep going - } - - /* - * 2. Invoke the loadClass method on the parent class loader. If - * the parent loader is null the class loader built-in to the - * virtual machine is used, instead. - * - * (Since we're not in java.lang, we can't actually invoke the - * parent's loadClass() method, but we passed our parent to the - * super-class which can take care of it for us.) - */ - res = super.loadClass(name, resolve); // returns class or throws - return res; - } -} diff --git a/test/626-const-class-linking/src/DelegatingLoader.java b/test/626-const-class-linking/src/DelegatingLoader.java deleted file mode 100644 index 49955d4e95..0000000000 --- a/test/626-const-class-linking/src/DelegatingLoader.java +++ /dev/null @@ -1,45 +0,0 @@ -/* - * Copyright (C) 2016 The Android Open Source Project - * - * Licensed under the Apache License, Version 2.0 (the "License"); - * you may not use this file except in compliance with the License. - * You may obtain a copy of the License at - * - * http://www.apache.org/licenses/LICENSE-2.0 - * - * Unless required by applicable law or agreed to in writing, software - * distributed under the License is distributed on an "AS IS" BASIS, - * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. - * See the License for the specific language governing permissions and - * limitations under the License. - */ - -public class DelegatingLoader extends DefiningLoader { - private DefiningLoader defining_loader; - - public DelegatingLoader(ClassLoader parent, DefiningLoader defining_loader) { - super(parent); - this.defining_loader = defining_loader; - } - - public void resetDefiningLoader(DefiningLoader defining_loader) { - this.defining_loader = defining_loader; - } - - protected Class<?> findClass(String name) throws ClassNotFoundException - { - if (name.equals("Test")) { - throw new Error("Unexpected DelegatingLoader.findClass(\"Test\")"); - } - return super.findClass(name); - } - - protected Class<?> loadClass(String name, boolean resolve) - throws ClassNotFoundException - { - if (name.equals("Test")) { - return defining_loader.loadClass(name, resolve); - } - return super.loadClass(name, resolve); - } -} diff --git a/test/626-const-class-linking/src/Helper1.java b/test/626-const-class-linking/src/Helper1.java deleted file mode 100644 index ff9cd1a532..0000000000 --- a/test/626-const-class-linking/src/Helper1.java +++ /dev/null @@ -1,23 +0,0 @@ -/* - * Copyright (C) 2016 The Android Open Source Project - * - * Licensed under the Apache License, Version 2.0 (the "License"); - * you may not use this file except in compliance with the License. - * You may obtain a copy of the License at - * - * http://www.apache.org/licenses/LICENSE-2.0 - * - * Unless required by applicable law or agreed to in writing, software - * distributed under the License is distributed on an "AS IS" BASIS, - * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. - * See the License for the specific language governing permissions and - * limitations under the License. - */ - -public class Helper1 { - public static ClassPair get() { - Class<?> helper1_class = Helper1.class; - Class<?> test_class = Test.class; - return new ClassPair(helper1_class, test_class); - } -} diff --git a/test/626-const-class-linking/src/Main.java b/test/626-const-class-linking/src/Main.java deleted file mode 100644 index 0029428d90..0000000000 --- a/test/626-const-class-linking/src/Main.java +++ /dev/null @@ -1,354 +0,0 @@ -/* - * Copyright (C) 2016 The Android Open Source Project - * - * Licensed under the Apache License, Version 2.0 (the "License"); - * you may not use this file except in compliance with the License. - * You may obtain a copy of the License at - * - * http://www.apache.org/licenses/LICENSE-2.0 - * - * Unless required by applicable law or agreed to in writing, software - * distributed under the License is distributed on an "AS IS" BASIS, - * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. - * See the License for the specific language governing permissions and - * limitations under the License. - */ - -import java.lang.ref.WeakReference; -import java.lang.reflect.Field; -import java.lang.reflect.InvocationTargetException; -import java.lang.reflect.Method; -import java.util.ArrayList; - -public class Main { - public static void main(String[] args) throws Exception { - try { - System.loadLibrary(args[0]); - } catch (UnsatisfiedLinkError ule) { - usingRI = true; - // Add expected JNI_OnLoad log line to match expected.txt. - System.out.println("JNI_OnLoad called"); - } - - testClearDexCache(); - testMultiDex(); - testRacyLoader(); - testRacyLoader2(); - testMisbehavingLoader(); - testRacyMisbehavingLoader(); - testRacyMisbehavingLoader2(); - } - - private static void testClearDexCache() throws Exception { - DelegatingLoader delegating_loader = createDelegatingLoader(); - Class<?> helper = delegating_loader.loadClass("Helper1"); - - WeakReference<Class<?>> weak_test1 = wrapHelperGet(helper); - changeInner(delegating_loader); - clearResolvedTypes(helper); - Runtime.getRuntime().gc(); - WeakReference<Class<?>> weak_test2 = wrapHelperGet(helper); - Runtime.getRuntime().gc(); - - Class<?> test1 = weak_test1.get(); - if (test1 == null) { - System.out.println("test1 disappeared"); - } - Class<?> test2 = weak_test2.get(); - if (test2 == null) { - System.out.println("test2 disappeared"); - } - if (test1 != test2) { - System.out.println("test1 != test2"); - } - - System.out.println("testClearDexCache done"); - } - - private static void testMultiDex() throws Exception { - DelegatingLoader delegating_loader = createDelegatingLoader(); - - Class<?> helper1 = delegating_loader.loadClass("Helper1"); - WeakReference<Class<?>> weak_test1 = wrapHelperGet(helper1); - - changeInner(delegating_loader); - - Class<?> helper2 = delegating_loader.loadClass("Helper2"); - WeakReference<Class<?>> weak_test2 = wrapHelperGet(helper2); - - Runtime.getRuntime().gc(); - - Class<?> test1 = weak_test1.get(); - if (test1 == null) { - System.out.println("test1 disappeared"); - } - Class<?> test2 = weak_test2.get(); - if (test2 == null) { - System.out.println("test2 disappeared"); - } - if (test1 != test2) { - System.out.println("test1 != test2"); - } - - System.out.println("testMultiDex done"); - } - - private static void testMisbehavingLoader() throws Exception { - ClassLoader system_loader = ClassLoader.getSystemClassLoader(); - DefiningLoader defining_loader = new DefiningLoader(system_loader); - MisbehavingLoader misbehaving_loader = - new MisbehavingLoader(system_loader, defining_loader); - Class<?> helper = misbehaving_loader.loadClass("Helper1"); - - try { - WeakReference<Class<?>> weak_test = wrapHelperGet(helper); - } catch (InvocationTargetException ite) { - String message = ite.getCause().getMessage(); - if (usingRI && "Test".equals(message)) { - // Replace RI message with dalvik message to match expected.txt. - message = "Initiating class loader of type " + - misbehaving_loader.getClass().getName() + - " returned class Helper2 instead of Test."; - } - System.out.println(ite.getCause().getClass().getName() + ": " + message); - } - System.out.println("testMisbehavingLoader done"); - } - - private static void testRacyLoader() throws Exception { - final ClassLoader system_loader = ClassLoader.getSystemClassLoader(); - - final Thread[] threads = new Thread[4]; - final Object[] results = new Object[threads.length]; - - final RacyLoader racy_loader = new RacyLoader(system_loader, threads.length); - final Class<?> helper1 = racy_loader.loadClass("Helper1"); - skipVerification(helper1); // Avoid class loading during verification. - - for (int i = 0; i != threads.length; ++i) { - final int my_index = i; - Thread t = new Thread() { - public void run() { - try { - Method get = helper1.getDeclaredMethod("get"); - results[my_index] = get.invoke(null); - } catch (InvocationTargetException ite) { - results[my_index] = ite.getCause(); - } catch (Throwable t) { - results[my_index] = t; - } - } - }; - t.start(); - threads[i] = t; - } - for (Thread t : threads) { - t.join(); - } - dumpResultStats(results, 1); - System.out.println("testRacyLoader done"); - } - - private static void testRacyLoader2() throws Exception { - final ClassLoader system_loader = ClassLoader.getSystemClassLoader(); - - final Thread[] threads = new Thread[4]; - final Object[] results = new Object[threads.length]; - - final RacyLoader racy_loader = new RacyLoader(system_loader, threads.length); - final Class<?> helper1 = racy_loader.loadClass("Helper1"); - skipVerification(helper1); // Avoid class loading during verification. - final Class<?> helper3 = racy_loader.loadClass("Helper3"); - skipVerification(helper3); // Avoid class loading during verification. - - for (int i = 0; i != threads.length; ++i) { - final int my_index = i; - Thread t = new Thread() { - public void run() { - try { - Class<?> helper = (my_index < threads.length / 2) ? helper1 : helper3; - Method get = helper.getDeclaredMethod("get"); - results[my_index] = get.invoke(null); - } catch (InvocationTargetException ite) { - results[my_index] = ite.getCause(); - } catch (Throwable t) { - results[my_index] = t; - } - } - }; - t.start(); - threads[i] = t; - } - for (Thread t : threads) { - t.join(); - } - dumpResultStats(results, 2); - System.out.println("testRacyLoader2 done"); - } - - private static void testRacyMisbehavingLoader() throws Exception { - final ClassLoader system_loader = ClassLoader.getSystemClassLoader(); - - final Thread[] threads = new Thread[4]; - final Object[] results = new Object[threads.length]; - - final RacyMisbehavingLoader racy_loader = - new RacyMisbehavingLoader(system_loader, threads.length, false); - final Class<?> helper1 = racy_loader.loadClass("RacyMisbehavingHelper"); - skipVerification(helper1); // Avoid class loading during verification. - - for (int i = 0; i != threads.length; ++i) { - final int my_index = i; - Thread t = new Thread() { - public void run() { - try { - Method get = helper1.getDeclaredMethod("get"); - results[my_index] = get.invoke(null); - } catch (InvocationTargetException ite) { - results[my_index] = ite.getCause(); - } catch (Throwable t) { - results[my_index] = t; - } - } - }; - t.start(); - threads[i] = t; - } - for (Thread t : threads) { - t.join(); - } - dumpResultStats(results, 1); - System.out.println("testRacyMisbehavingLoader done"); - } - - private static void testRacyMisbehavingLoader2() throws Exception { - final ClassLoader system_loader = ClassLoader.getSystemClassLoader(); - - final Thread[] threads = new Thread[4]; - final Object[] results = new Object[threads.length]; - - final RacyMisbehavingLoader racy_loader = - new RacyMisbehavingLoader(system_loader, threads.length, true); - final Class<?> helper1 = racy_loader.loadClass("RacyMisbehavingHelper"); - skipVerification(helper1); // Avoid class loading during verification. - - for (int i = 0; i != threads.length; ++i) { - final int my_index = i; - Thread t = new Thread() { - public void run() { - try { - Method get = helper1.getDeclaredMethod("get"); - results[my_index] = get.invoke(null); - } catch (InvocationTargetException ite) { - results[my_index] = ite.getCause(); - } catch (Throwable t) { - results[my_index] = t; - } - } - }; - t.start(); - threads[i] = t; - } - for (Thread t : threads) { - t.join(); - } - dumpResultStats(results, 1); - System.out.println("testRacyMisbehavingLoader2 done"); - } - - private static void dumpResultStats(Object[] results, int expected_unique) throws Exception { - int throwables = 0; - int classes = 0; - int unique_classes = 0; - for (int i = 0; i != results.length; ++i) { - Object r = results[i]; - if (r instanceof Throwable) { - ++throwables; - System.out.println(((Throwable) r).getMessage()); - } else if (isClassPair(r)) { - printPair(r); - Object ref = getSecond(r); - ++classes; - ++unique_classes; - for (int j = 0; j != i; ++j) { - Object rj = results[j]; - if (isClassPair(results[j]) && getSecond(results[j]) == ref) { - --unique_classes; - break; - } - } - } - } - System.out.println("total: " + results.length); - System.out.println(" throwables: " + throwables); - System.out.println(" classes: " + classes - + " (" + unique_classes + " unique)"); - if (expected_unique != unique_classes) { - System.out.println("MISMATCH with expected_unique: " + expected_unique); - ArrayList<Class<?>> list = new ArrayList<Class<?>>(); - for (int i = 0; i != results.length; ++i) { - Object r = results[i]; - if (isClassPair(r)) { - list.add(getSecond(r)); - } - } - nativeDumpClasses(list.toArray()); - } - } - - private static DelegatingLoader createDelegatingLoader() { - ClassLoader system_loader = ClassLoader.getSystemClassLoader(); - DefiningLoader defining_loader = new DefiningLoader(system_loader); - return new DelegatingLoader(system_loader, defining_loader); - } - - private static void changeInner(DelegatingLoader delegating_loader) { - ClassLoader system_loader = ClassLoader.getSystemClassLoader(); - DefiningLoader defining_loader = new DefiningLoader(system_loader); - delegating_loader.resetDefiningLoader(defining_loader); - } - - private static WeakReference<Class<?>> wrapHelperGet(Class<?> helper) throws Exception { - Method get = helper.getDeclaredMethod("get"); - Object pair = get.invoke(null); - printPair(pair); - return new WeakReference<Class<?>>(getSecond(pair)); - } - - private static void printPair(Object pair) throws Exception { - Method print = pair.getClass().getDeclaredMethod("print"); - print.invoke(pair); - } - - private static Class<?> getSecond(Object pair) throws Exception { - Field second = pair.getClass().getDeclaredField("second"); - return (Class<?>) second.get(pair); - } - - private static boolean isClassPair(Object r) { - return r != null && r.getClass().getName().equals("ClassPair"); - } - - public static void clearResolvedTypes(Class<?> c) { - if (!usingRI) { - nativeClearResolvedTypes(c); - } - } - - // Skip verification of a class on ART. Verification can cause classes to be loaded - // while holding a lock on the class being verified and holding that lock can interfere - // with the intent of the "racy" tests. In these tests we're waiting in the loadClass() - // for all the tested threads to synchronize and they cannot reach that point if they - // are waiting for the class lock on ClassLinker::InitializeClass(Helper1/Helper3). - public static void skipVerification(Class<?> c) { - if (!usingRI) { - nativeSkipVerification(c); - } - } - - public static native void nativeClearResolvedTypes(Class<?> c); - public static native void nativeSkipVerification(Class<?> c); - public static native void nativeDumpClasses(Object[] array); - - static boolean usingRI = false; -} diff --git a/test/626-const-class-linking/src/MisbehavingLoader.java b/test/626-const-class-linking/src/MisbehavingLoader.java deleted file mode 100644 index ca9783e4ef..0000000000 --- a/test/626-const-class-linking/src/MisbehavingLoader.java +++ /dev/null @@ -1,47 +0,0 @@ -/* - * Copyright (C) 2016 The Android Open Source Project - * - * Licensed under the Apache License, Version 2.0 (the "License"); - * you may not use this file except in compliance with the License. - * You may obtain a copy of the License at - * - * http://www.apache.org/licenses/LICENSE-2.0 - * - * Unless required by applicable law or agreed to in writing, software - * distributed under the License is distributed on an "AS IS" BASIS, - * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. - * See the License for the specific language governing permissions and - * limitations under the License. - */ - -// Class loader that returns Helper2.class when asked to load "Test". -public class MisbehavingLoader extends DefiningLoader { - private DefiningLoader defining_loader; - - public MisbehavingLoader(ClassLoader parent, DefiningLoader defining_loader) { - super(parent); - this.defining_loader = defining_loader; - } - - protected Class<?> findClass(String name) throws ClassNotFoundException - { - if (name.equals("Helper1") || name.equals("Helper2")) { - return super.findClass(name); - } else if (name.equals("Test")) { - throw new Error("Unexpected MisbehavingLoader.findClass(\"Test\")"); - } - return super.findClass(name); - } - - protected Class<?> loadClass(String name, boolean resolve) - throws ClassNotFoundException - { - if (name.equals("Helper1") || name.equals("Helper2")) { - return super.loadClass(name, resolve); - } else if (name.equals("Test")) { - // Ask for a different class. - return defining_loader.loadClass("Helper2", resolve); - } - return super.loadClass(name, resolve); - } -} diff --git a/test/626-const-class-linking/src/RacyLoader.java b/test/626-const-class-linking/src/RacyLoader.java deleted file mode 100644 index 9c164a3124..0000000000 --- a/test/626-const-class-linking/src/RacyLoader.java +++ /dev/null @@ -1,78 +0,0 @@ -/* - * Copyright (C) 2016 The Android Open Source Project - * - * Licensed under the Apache License, Version 2.0 (the "License"); - * you may not use this file except in compliance with the License. - * You may obtain a copy of the License at - * - * http://www.apache.org/licenses/LICENSE-2.0 - * - * Unless required by applicable law or agreed to in writing, software - * distributed under the License is distributed on an "AS IS" BASIS, - * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. - * See the License for the specific language governing permissions and - * limitations under the License. - */ - -public class RacyLoader extends DefiningLoader { - static { - // For JVM, register as parallel capable. - // Android treats all class loaders as parallel capable and makes this a no-op. - registerAsParallelCapable(); - } - - private Object lock = new Object(); - private int index = 0; - private int count; - - private DefiningLoader[] defining_loaders; - - public RacyLoader(ClassLoader parent, int count) { - super(parent); - this.count = count; - defining_loaders = new DefiningLoader[2]; - for (int i = 0; i != defining_loaders.length; ++i) { - defining_loaders[i] = new DefiningLoader(parent); - } - } - - protected Class<?> findClass(String name) throws ClassNotFoundException - { - if (name.equals("Test") || name.equals("Test3")) { - throw new Error("Unexpected RacyLoader.findClass(\"" + name + "\")"); - } - return super.findClass(name); - } - - protected Class<?> loadClass(String name, boolean resolve) - throws ClassNotFoundException - { - if (name.equals("Test") || name.equals("Test3")) { - int my_index = syncWithOtherInstances(count); - Class<?> result = defining_loaders[my_index & 1].loadClass(name, resolve); - syncWithOtherInstances(2 * count); - return result; - } - return super.loadClass(name, resolve); - } - - private int syncWithOtherInstances(int limit) { - int my_index; - synchronized (lock) { - my_index = index; - ++index; - if (index != limit) { - do { - try { - lock.wait(); - } catch (InterruptedException ie) { - throw new Error(ie); - } - } while (index < limit); - } else { - lock.notifyAll(); - } - } - return my_index; - } -} diff --git a/test/626-const-class-linking/src/RacyMisbehavingHelper.java b/test/626-const-class-linking/src/RacyMisbehavingHelper.java deleted file mode 100644 index 45252789e4..0000000000 --- a/test/626-const-class-linking/src/RacyMisbehavingHelper.java +++ /dev/null @@ -1,33 +0,0 @@ -/* - * Copyright (C) 2016 The Android Open Source Project - * - * Licensed under the Apache License, Version 2.0 (the "License"); - * you may not use this file except in compliance with the License. - * You may obtain a copy of the License at - * - * http://www.apache.org/licenses/LICENSE-2.0 - * - * Unless required by applicable law or agreed to in writing, software - * distributed under the License is distributed on an "AS IS" BASIS, - * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. - * See the License for the specific language governing permissions and - * limitations under the License. - */ - -import java.lang.reflect.Method; - -public class RacyMisbehavingHelper { - public static ClassPair get() { - Class<?> helper1_class = Helper1.class; - Class<?> test_class = Test.class; - try { - // After loading the correct class, allow loading the incorrect class. - ClassLoader loader = helper1_class.getClassLoader(); - Method reportAfterLoading = loader.getClass().getDeclaredMethod("reportAfterLoading"); - reportAfterLoading.invoke(loader); - } catch (Throwable t) { - t.printStackTrace(); - } - return new ClassPair(helper1_class, test_class); - } -} diff --git a/test/626-const-class-linking/src/RacyMisbehavingLoader.java b/test/626-const-class-linking/src/RacyMisbehavingLoader.java deleted file mode 100644 index f5bcb4c412..0000000000 --- a/test/626-const-class-linking/src/RacyMisbehavingLoader.java +++ /dev/null @@ -1,99 +0,0 @@ -/* - * Copyright (C) 2016 The Android Open Source Project - * - * Licensed under the Apache License, Version 2.0 (the "License"); - * you may not use this file except in compliance with the License. - * You may obtain a copy of the License at - * - * http://www.apache.org/licenses/LICENSE-2.0 - * - * Unless required by applicable law or agreed to in writing, software - * distributed under the License is distributed on an "AS IS" BASIS, - * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. - * See the License for the specific language governing permissions and - * limitations under the License. - */ - -public class RacyMisbehavingLoader extends DefiningLoader { - static { - // For JVM, register as parallel capable. - // Android treats all class loaders as parallel capable and makes this a no-op. - registerAsParallelCapable(); - } - - private Object lock = new Object(); - private int index = 0; - private int count; - private boolean throw_error; - - private DefiningLoader[] defining_loaders; - - public RacyMisbehavingLoader(ClassLoader parent, int count, boolean throw_error) { - super(parent); - this.count = count; - this.throw_error = throw_error; - defining_loaders = new DefiningLoader[2]; - for (int i = 0; i != defining_loaders.length; ++i) { - defining_loaders[i] = new DefiningLoader(parent); - } - } - - public void reportAfterLoading() { - synchronized (lock) { - ++index; - if (index == 2 * count) { - lock.notifyAll(); - } - } - } - - protected Class<?> findClass(String name) throws ClassNotFoundException - { - if (name.equals("Test")) { - throw new Error("Unexpected RacyLoader.findClass(\"" + name + "\")"); - } - return super.findClass(name); - } - - protected Class<?> loadClass(String name, boolean resolve) - throws ClassNotFoundException - { - if (name.equals("Test")) { - int my_index = syncWithOtherInstances(count); - Class<?> result; - if ((my_index & 1) == 0) { - // Do not delay loading the correct class. - result = defining_loaders[my_index & 1].loadClass(name, resolve); - } else { - // Delay loading the wrong class. - syncWithOtherInstances(2 * count); - if (throw_error) { - throw new Error("RacyMisbehavingLoader throw_error=true"); - } - result = defining_loaders[my_index & 1].loadClass("Test3", resolve); - } - return result; - } - return super.loadClass(name, resolve); - } - - private int syncWithOtherInstances(int limit) { - int my_index; - synchronized (lock) { - my_index = index; - ++index; - if (index != limit) { - do { - try { - lock.wait(); - } catch (InterruptedException ie) { - throw new Error(ie); - } - } while (index < limit); - } else { - lock.notifyAll(); - } - } - return my_index; - } -} diff --git a/test/629-vdex-speed/expected.txt b/test/629-vdex-speed/expected.txt new file mode 100644 index 0000000000..6a5618ebc6 --- /dev/null +++ b/test/629-vdex-speed/expected.txt @@ -0,0 +1 @@ +JNI_OnLoad called diff --git a/test/629-vdex-speed/info.txt b/test/629-vdex-speed/info.txt new file mode 100644 index 0000000000..6d84cb5b31 --- /dev/null +++ b/test/629-vdex-speed/info.txt @@ -0,0 +1,2 @@ +Regression test for vdex that used to not AOT compile +methods when the VerifierDeps were verified. diff --git a/test/629-vdex-speed/run b/test/629-vdex-speed/run new file mode 100644 index 0000000000..f1b0a95f64 --- /dev/null +++ b/test/629-vdex-speed/run @@ -0,0 +1,17 @@ +#!/bin/bash +# +# Copyright (C) 2016 The Android Open Source Project +# +# Licensed under the Apache License, Version 2.0 (the "License"); +# you may not use this file except in compliance with the License. +# You may obtain a copy of the License at +# +# http://www.apache.org/licenses/LICENSE-2.0 +# +# Unless required by applicable law or agreed to in writing, software +# distributed under the License is distributed on an "AS IS" BASIS, +# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. +# See the License for the specific language governing permissions and +# limitations under the License. + +exec ${RUN} --vdex "${@}" diff --git a/test/626-const-class-linking/src-multidex/Helper2.java b/test/629-vdex-speed/src/Main.java index 5bb31eeb17..470565ae33 100644 --- a/test/626-const-class-linking/src-multidex/Helper2.java +++ b/test/629-vdex-speed/src/Main.java @@ -14,10 +14,14 @@ * limitations under the License. */ -public class Helper2 { - public static ClassPair get() { - Class<?> helper2_class = Helper2.class; - Class<?> test_class = Test.class; - return new ClassPair(helper2_class, test_class); +public class Main { + public static void main(String[] args) { + System.loadLibrary(args[0]); + if (!isAotCompiled(Main.class, "main")) { + throw new Error("Expected Main.main to be AOT compiled"); } + } + + private native static boolean isAotCompiled(Class<?> cls, String methodName); } + diff --git a/test/902-hello-transformation/expected.txt b/test/902-hello-transformation/expected.txt index a826f932d8..4774b81b49 100644 --- a/test/902-hello-transformation/expected.txt +++ b/test/902-hello-transformation/expected.txt @@ -1,3 +1,2 @@ hello -modifying class 'Transform' Goodbye diff --git a/test/902-hello-transformation/run b/test/902-hello-transformation/run index 3755d1dd9e..94a8b2d975 100755 --- a/test/902-hello-transformation/run +++ b/test/902-hello-transformation/run @@ -27,12 +27,11 @@ if [[ "$@" == *"--jvm"* ]]; then arg="jvm" else arg="art" -fi - -if [[ "$@" != *"--debuggable"* ]]; then - other_args=" -Xcompiler-option --debuggable " -else - other_args="" + if [[ "$@" != *"--debuggable"* ]]; then + other_args=" -Xcompiler-option --debuggable " + else + other_args="" + fi fi ./default-run "$@" --experimental agents \ diff --git a/test/902-hello-transformation/src/Main.java b/test/902-hello-transformation/src/Main.java index 204b6e757d..ec4711954a 100644 --- a/test/902-hello-transformation/src/Main.java +++ b/test/902-hello-transformation/src/Main.java @@ -14,7 +14,40 @@ * limitations under the License. */ +import java.util.Base64; public class Main { + + /** + * base64 encoded class/dex file for + * class Transform { + * public void sayHi() { + * System.out.println("Goodbye"); + * } + * } + */ + private static final byte[] CLASS_BYTES = Base64.getDecoder().decode( + "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" + + "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" + + "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" + + "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" + + "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" + + "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" + + "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0="); + private static final byte[] DEX_BYTES = Base64.getDecoder().decode( + "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" + + "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" + + "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" + + "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" + + "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" + + "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" + + "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" + + "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" + + "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" + + "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" + + "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" + + "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" + + "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA="); + public static void main(String[] args) { System.loadLibrary(args[1]); doTest(new Transform()); @@ -22,10 +55,12 @@ public class Main { public static void doTest(Transform t) { t.sayHi(); - doClassTransformation(Transform.class); + doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES); t.sayHi(); } // Transforms the class - private static native void doClassTransformation(Class target); + private static native void doCommonClassRedefinition(Class<?> target, + byte[] class_file, + byte[] dex_file); } diff --git a/test/902-hello-transformation/transform.cc b/test/902-hello-transformation/transform.cc deleted file mode 100644 index 3369dd4857..0000000000 --- a/test/902-hello-transformation/transform.cc +++ /dev/null @@ -1,153 +0,0 @@ -/* - * Copyright (C) 2013 The Android Open Source Project - * - * Licensed under the Apache License, Version 2.0 (the "License"); - * you may not use this file except in compliance with the License. - * You may obtain a copy of the License at - * - * http://www.apache.org/licenses/LICENSE-2.0 - * - * Unless required by applicable law or agreed to in writing, software - * distributed under the License is distributed on an "AS IS" BASIS, - * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. - * See the License for the specific language governing permissions and - * limitations under the License. - */ - -#include <iostream> -#include <pthread.h> -#include <stdio.h> -#include <vector> - -#include "art_method-inl.h" -#include "base/logging.h" -#include "jni.h" -#include "openjdkjvmti/jvmti.h" -#include "ti-agent/common_helper.h" -#include "ti-agent/common_load.h" -#include "utils.h" - -namespace art { -namespace Test902HelloTransformation { - -static bool RuntimeIsJvm = false; - -bool IsJVM() { - return RuntimeIsJvm; -} - -// base64 encoded class/dex file for -// -// class Transform { -// public void sayHi() { -// System.out.println("Goodbye"); -// } -// } -const char* class_file_base64 = - "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" - "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" - "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" - "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" - "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" - "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" - "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0="; - -const char* dex_file_base64 = - "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" - "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" - "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" - "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" - "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" - "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" - "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" - "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" - "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" - "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" - "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" - "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" - "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA="; - -static void JNICALL transformationHook(jvmtiEnv *jvmtienv, - JNIEnv* jni_env ATTRIBUTE_UNUSED, - jclass class_being_redefined ATTRIBUTE_UNUSED, - jobject loader ATTRIBUTE_UNUSED, - const char* name, - jobject protection_domain ATTRIBUTE_UNUSED, - jint class_data_len ATTRIBUTE_UNUSED, - const unsigned char* class_data ATTRIBUTE_UNUSED, - jint* new_class_data_len, - unsigned char** new_class_data) { - if (strcmp("Transform", name)) { - return; - } - printf("modifying class '%s'\n", name); - bool is_jvm = IsJVM(); - size_t decode_len = 0; - unsigned char* new_data; - std::unique_ptr<uint8_t[]> file_data( - DecodeBase64((is_jvm) ? class_file_base64 : dex_file_base64, &decode_len)); - jvmtiError ret = JVMTI_ERROR_NONE; - if ((ret = jvmtienv->Allocate(static_cast<jlong>(decode_len), &new_data)) != JVMTI_ERROR_NONE) { - printf("Unable to allocate buffer!\n"); - return; - } - memcpy(new_data, file_data.get(), decode_len); - *new_class_data_len = static_cast<jint>(decode_len); - *new_class_data = new_data; - return; -} - -using RetransformWithHookFunction = jvmtiError (*)(jvmtiEnv*, jclass, jvmtiEventClassFileLoadHook); -static void DoClassTransformation(jvmtiEnv* jvmtienv, JNIEnv* jnienv, jclass target) { - if (IsJVM()) { - UNUSED(jnienv); - jvmtienv->SetEventNotificationMode(JVMTI_ENABLE, JVMTI_EVENT_CLASS_FILE_LOAD_HOOK, nullptr); - jvmtiError ret = jvmtienv->RetransformClasses(1, &target); - if (ret != JVMTI_ERROR_NONE) { - char* err; - jvmtienv->GetErrorName(ret, &err); - printf("Error transforming: %s\n", err); - } - } else { - RetransformWithHookFunction f = - reinterpret_cast<RetransformWithHookFunction>(jvmtienv->functions->reserved1); - if (f(jvmtienv, target, transformationHook) != JVMTI_ERROR_NONE) { - printf("Failed to tranform class!"); - return; - } - } -} - -extern "C" JNIEXPORT void JNICALL Java_Main_doClassTransformation(JNIEnv* env, - jclass, - jclass target) { - JavaVM* vm; - if (env->GetJavaVM(&vm)) { - printf("Unable to get javaVM!\n"); - return; - } - DoClassTransformation(jvmti_env, env, target); -} - -// Don't do anything -jint OnLoad(JavaVM* vm, - char* options, - void* reserved ATTRIBUTE_UNUSED) { - RuntimeIsJvm = (strcmp("jvm", options) == 0); - if (vm->GetEnv(reinterpret_cast<void**>(&jvmti_env), JVMTI_VERSION_1_0)) { - printf("Unable to get jvmti env!\n"); - return 1; - } - SetAllCapabilities(jvmti_env); - if (IsJVM()) { - jvmtiEventCallbacks cbs; - memset(&cbs, 0, sizeof(cbs)); - cbs.ClassFileLoadHook = transformationHook; - jvmti_env->SetEventCallbacks(&cbs, sizeof(jvmtiEventCallbacks)); - } - return 0; -} - -} // namespace Test902HelloTransformation -} // namespace art - diff --git a/test/902-hello-transformation/transform.h b/test/902-hello-transformation/transform.h deleted file mode 100644 index 661058dd99..0000000000 --- a/test/902-hello-transformation/transform.h +++ /dev/null @@ -1,30 +0,0 @@ -/* - * Copyright (C) 2016 The Android Open Source Project - * - * Licensed under the Apache License, Version 2.0 (the "License"); - * you may not use this file except in compliance with the License. - * You may obtain a copy of the License at - * - * http://www.apache.org/licenses/LICENSE-2.0 - * - * Unless required by applicable law or agreed to in writing, software - * distributed under the License is distributed on an "AS IS" BASIS, - * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. - * See the License for the specific language governing permissions and - * limitations under the License. - */ - -#ifndef ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_ -#define ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_ - -#include <jni.h> - -namespace art { -namespace Test902HelloTransformation { - -jint OnLoad(JavaVM* vm, char* options, void* reserved); - -} // namespace Test902HelloTransformation -} // namespace art - -#endif // ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_ diff --git a/test/954-invoke-polymorphic-verifier/build b/test/954-invoke-polymorphic-verifier/build new file mode 100755 index 0000000000..a423ca6b4e --- /dev/null +++ b/test/954-invoke-polymorphic-verifier/build @@ -0,0 +1,25 @@ +#!/bin/bash +# +# Copyright 2016 The Android Open Source Project +# +# Licensed under the Apache License, Version 2.0 (the "License"); +# you may not use this file except in compliance with the License. +# You may obtain a copy of the License at +# +# http://www.apache.org/licenses/LICENSE-2.0 +# +# Unless required by applicable law or agreed to in writing, software +# distributed under the License is distributed on an "AS IS" BASIS, +# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. +# See the License for the specific language governing permissions and +# limitations under the License. + +# make us exit on a failure +set -e + +if [[ $@ != *"--jvm"* ]]; then + # Don't do anything with jvm. + export USE_JACK=true +fi + +./default-build "$@" --experimental method-handles diff --git a/test/954-invoke-polymorphic-verifier/check b/test/954-invoke-polymorphic-verifier/check new file mode 100755 index 0000000000..dc5ddb7fc9 --- /dev/null +++ b/test/954-invoke-polymorphic-verifier/check @@ -0,0 +1,19 @@ +#!/bin/bash +# +# Copyright (C) 2014 The Android Open Source Project +# +# Licensed under the Apache License, Version 2.0 (the "License"); +# you may not use this file except in compliance with the License. +# You may obtain a copy of the License at +# +# http://www.apache.org/licenses/LICENSE-2.0 +# +# Unless required by applicable law or agreed to in writing, software +# distributed under the License is distributed on an "AS IS" BASIS, +# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. +# See the License for the specific language governing permissions and +# limitations under the License. + +# Strip out temporary file path information and indicies from output. +sed -e "s/ [(]declaration of.*//" -e "s/\[0x[0-9A-F]*\] //g" "$2" > "$2.tmp" +diff --strip-trailing-cr -q "$1" "$2.tmp" >/dev/null diff --git a/test/954-invoke-polymorphic-verifier/expected.txt b/test/954-invoke-polymorphic-verifier/expected.txt new file mode 100644 index 0000000000..5df393aede --- /dev/null +++ b/test/954-invoke-polymorphic-verifier/expected.txt @@ -0,0 +1,10 @@ +java.lang.VerifyError: Verifier rejected class MethodHandleNotInvoke: void MethodHandleNotInvoke.<init>() failed to verify: void MethodHandleNotInvoke.<init>(): void MethodHandleNotInvoke.<init>(): couldn't find method java.lang.invoke.MethodHandle.notInvoke ([Ljava/lang/Object;)Ljava/lang/Object; +java.lang.VerifyError: Verifier rejected class MethodHandleToString: void MethodHandleToString.<init>() failed to verify: void MethodHandleToString.<init>(): void MethodHandleToString.<init>(): invoke type (METHOD_POLYMORPHIC) does not match method type of java.lang.String java.lang.invoke.MethodHandle.toString() +java.lang.VerifyError: Verifier rejected class NonReference: void NonReference.<init>() failed to verify: void NonReference.<init>(): void NonReference.<init>(): tried to get class from non-reference register v0 (type=Precise Low-half Constant: 0) +java.lang.VerifyError: Verifier rejected class TooFewArguments: void TooFewArguments.<init>() failed to verify: void TooFewArguments.<init>(): void TooFewArguments.<init>(): Rejecting invocation, expected 2 argument registers, method signature has 3 or more +java.lang.VerifyError: Verifier rejected class TooManyArguments: void TooManyArguments.<init>() failed to verify: void TooManyArguments.<init>(): void TooManyArguments.<init>(): Rejecting invocation, expected 4 argument registers, method signature has 3 +java.lang.VerifyError: Verifier rejected class BadThis: void BadThis.<init>() failed to verify: void BadThis.<init>(): void BadThis.<init>(): 'this' argument 'Precise Reference: java.lang.String' not instance of 'Reference: java.lang.invoke.MethodHandle' +java.lang.VerifyError: Verifier rejected class FakeSignaturePolymorphic: void FakeSignaturePolymorphic.<init>() failed to verify: void FakeSignaturePolymorphic.<init>(): void FakeSignaturePolymorphic.<init>(): invoke type (METHOD_POLYMORPHIC) does not match method type of java.lang.Object Main.invoke(java.lang.Object[]) +java.lang.VerifyError: Verifier rejected class BetterFakeSignaturePolymorphic: void BetterFakeSignaturePolymorphic.<init>() failed to verify: void BetterFakeSignaturePolymorphic.<init>(): Signature polymorphic method must be declared in java.lang.invoke.MethodClass +Passed Subclass test +java.lang.VerifyError: Verifier rejected class Unresolved: void Unresolved.<init>() failed to verify: void Unresolved.<init>(): invoke-polymorphic receiver has no class: Unresolved Reference: other.thing.Foo diff --git a/test/954-invoke-polymorphic-verifier/info.txt b/test/954-invoke-polymorphic-verifier/info.txt new file mode 100644 index 0000000000..cb10d42572 --- /dev/null +++ b/test/954-invoke-polymorphic-verifier/info.txt @@ -0,0 +1,3 @@ +Test cases that should be rejected by the method verifier. + +NOTE: needs to run under ART. diff --git a/test/954-invoke-polymorphic-verifier/run b/test/954-invoke-polymorphic-verifier/run new file mode 100755 index 0000000000..a9f182288c --- /dev/null +++ b/test/954-invoke-polymorphic-verifier/run @@ -0,0 +1,20 @@ +#!/bin/bash +# +# Copyright 2016 The Android Open Source Project +# +# Licensed under the Apache License, Version 2.0 (the "License"); +# you may not use this file except in compliance with the License. +# You may obtain a copy of the License at +# +# http://www.apache.org/licenses/LICENSE-2.0 +# +# Unless required by applicable law or agreed to in writing, software +# distributed under the License is distributed on an "AS IS" BASIS, +# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. +# See the License for the specific language governing permissions and +# limitations under the License. + +# make us exit on a failure +set -e + +./default-run "$@" --experimental method-handles diff --git a/test/954-invoke-polymorphic-verifier/smali/BadThis.smali b/test/954-invoke-polymorphic-verifier/smali/BadThis.smali new file mode 100644 index 0000000000..d9edf6713a --- /dev/null +++ b/test/954-invoke-polymorphic-verifier/smali/BadThis.smali @@ -0,0 +1,30 @@ +# +# Copyright (C) 2016 The Android Open Source Project +# +# Licensed under the Apache License, Version 2.0 (the "License"); +# you may not use this file except in compliance with the License. +# You may obtain a copy of the License at +# +# http://www.apache.org/licenses/LICENSE-2.0 +# +# Unless required by applicable law or agreed to in writing, software +# distributed under the License is distributed on an "AS IS" BASIS, +# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. +# See the License for the specific language governing permissions and +# limitations under the License. + +.source "BadThis.smali" + +.class public LBadThis; +.super Ljava/lang/Object; + +.method public constructor <init>()V +.registers 4 + invoke-direct {p0}, Ljava/lang/Object;-><init>()V + const-string v0, "0" + const-string v1, "1" + const-string v2, "2" + # v0 is a String, not a MethodHandle. + invoke-polymorphic {v0, v1, v2}, Ljava/lang/invoke/MethodHandle;->invoke([Ljava/lang/Object;)Ljava/lang/Object;, (Ljava/lang/String;Ljava/lang/String;)Ljava/lang/String; + return-void +.end method
\ No newline at end of file diff --git a/test/954-invoke-polymorphic-verifier/smali/BetterFakeSignaturePolymorphic.smali b/test/954-invoke-polymorphic-verifier/smali/BetterFakeSignaturePolymorphic.smali new file mode 100644 index 0000000000..631e704bd0 --- /dev/null +++ b/test/954-invoke-polymorphic-verifier/smali/BetterFakeSignaturePolymorphic.smali @@ -0,0 +1,43 @@ +# +# Copyright (C) 2016 The Android Open Source Project +# +# Licensed under the Apache License, Version 2.0 (the "License"); +# you may not use this file except in compliance with the License. +# You may obtain a copy of the License at +# +# http://www.apache.org/licenses/LICENSE-2.0 +# +# Unless required by applicable law or agreed to in writing, software +# distributed under the License is distributed on an "AS IS" BASIS, +# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. +# See the License for the specific language governing permissions and +# limitations under the License. + +.source "BetterFakeSignaturePolymorphic.smali" + +.class public LBetterFakeSignaturePolymorphic; +.super Ljava/lang/Object; + +.method public constructor <init>()V +.registers 4 + invoke-direct {p0}, Ljava/lang/Object;-><init>()V + invoke-static {}, LBetterFakeSignaturePolymorphic;->getMain()LMain; + move-result-object v0 + const/4 v1, 0 + move-object v1, v1 + # Fail here because Main;->invokeExact is on wrong class. + invoke-polymorphic {v0, v1}, LMain;->invokeExact([Ljava/lang/Object;)Ljava/lang/Object;, ([Ljava/lang/Object;)Ljava/lang/Object; + return-void +.end method + +.method public static getMethodHandle()Ljava/lang/invoke/MethodHandle; +.registers 1 + const/4 v0, 0 + return-object v0 +.end method + +.method public static getMain()LMain; +.registers 1 + const/4 v0, 0 + return-object v0 +.end method
\ No newline at end of file diff --git a/test/954-invoke-polymorphic-verifier/smali/FakeSignaturePolymorphic.smali b/test/954-invoke-polymorphic-verifier/smali/FakeSignaturePolymorphic.smali new file mode 100644 index 0000000000..5bd054a2da --- /dev/null +++ b/test/954-invoke-polymorphic-verifier/smali/FakeSignaturePolymorphic.smali @@ -0,0 +1,43 @@ +# +# Copyright (C) 2016 The Android Open Source Project +# +# Licensed under the Apache License, Version 2.0 (the "License"); +# you may not use this file except in compliance with the License. +# You may obtain a copy of the License at +# +# http://www.apache.org/licenses/LICENSE-2.0 +# +# Unless required by applicable law or agreed to in writing, software +# distributed under the License is distributed on an "AS IS" BASIS, +# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. +# See the License for the specific language governing permissions and +# limitations under the License. + +.source "FakeSignaturePolymorphic.smali" + +.class public LFakeSignaturePolymorphic; +.super Ljava/lang/Object; + +.method public constructor <init>()V +.registers 4 + invoke-direct {p0}, Ljava/lang/Object;-><init>()V + invoke-static {}, LFakeSignaturePolymorphic;->getMain()LMain; + move-result-object v0 + const/4 v1, 0 + move-object v1, v1 + # Fail here because Main;->invoke does not have right flags (ie not native or varargs). + invoke-polymorphic {v0, v1}, LMain;->invoke([Ljava/lang/Object;)Ljava/lang/Object;, ([Ljava/lang/Object;)Ljava/lang/Object; + return-void +.end method + +.method public static getMethodHandle()Ljava/lang/invoke/MethodHandle; +.registers 1 + const/4 v0, 0 + return-object v0 +.end method + +.method public static getMain()LMain; +.registers 1 + const/4 v0, 0 + return-object v0 +.end method
\ No newline at end of file diff --git a/test/954-invoke-polymorphic-verifier/smali/Main.smali b/test/954-invoke-polymorphic-verifier/smali/Main.smali new file mode 100644 index 0000000000..5b5e5557d7 --- /dev/null +++ b/test/954-invoke-polymorphic-verifier/smali/Main.smali @@ -0,0 +1,85 @@ +# +# Copyright (C) 2016 The Android Open Source Project +# +# Licensed under the Apache License, Version 2.0 (the "License"); +# you may not use this file except in compliance with the License. +# You may obtain a copy of the License at +# +# http://www.apache.org/licenses/LICENSE-2.0 +# +# Unless required by applicable law or agreed to in writing, software +# distributed under the License is distributed on an "AS IS" BASIS, +# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. +# See the License for the specific language governing permissions and +# limitations under the License. + +# This is the test suite runner. It is written in smali rather than +# Java pending support in dx/dxmerge for invoke-polymorphic (b/33191712). + +.source "Main.smali" + +.class public LMain; +.super Ljava/lang/Object; + +.method public constructor<init>()V +.registers 1 + invoke-direct {v0}, Ljava/lang/Object;-><init>()V + return-void +.end method + +.method public static main([Ljava/lang/String;)V +.registers 1 + # New tests should be added here. + const-string v0, "MethodHandleNotInvoke" + invoke-static {v0}, LMain;->test(Ljava/lang/String;)V + const-string v0, "MethodHandleToString" + invoke-static {v0}, LMain;->test(Ljava/lang/String;)V + const-string v0, "NonReference" + invoke-static {v0}, LMain;->test(Ljava/lang/String;)V + const-string v0, "TooFewArguments" + invoke-static {v0}, LMain;->test(Ljava/lang/String;)V + const-string v0, "TooManyArguments" + invoke-static {v0}, LMain;->test(Ljava/lang/String;)V + const-string v0, "BadThis" + invoke-static {v0}, LMain;->test(Ljava/lang/String;)V + const-string v0, "FakeSignaturePolymorphic" + invoke-static {v0}, LMain;->test(Ljava/lang/String;)V + const-string v0, "BetterFakeSignaturePolymorphic" + invoke-static {v0}, LMain;->test(Ljava/lang/String;)V + const-string v0, "Subclass" + invoke-static {v0}, LMain;->test(Ljava/lang/String;)V + const-string v0, "Unresolved" + invoke-static {v0}, LMain;->test(Ljava/lang/String;)V + return-void +.end method + +.method public static test(Ljava/lang/String;)V +.registers 6 + :try_start_1 + invoke-static {v5}, Ljava/lang/Class;->forName(Ljava/lang/String;)Ljava/lang/Class; + move-result-object v0 + invoke-virtual {v0}, Ljava/lang/Class;->newInstance()Ljava/lang/Object; + :try_end_1 + .catch Ljava/lang/VerifyError; {:try_start_1 .. :try_end_1} :catch_verifier + return-void + :catch_verifier + move-exception v3 + invoke-virtual {v3}, Ljava/lang/Exception;->toString()Ljava/lang/String; + move-result-object v3 + sget-object v2, Ljava/lang/System;->out:Ljava/io/PrintStream; + invoke-virtual {v2, v3}, Ljava/io/PrintStream;->println(Ljava/lang/String;)V + return-void +.end method + +# A test method called "invoke", but on a class other than MethodHandle. +.method public invoke([Ljava/lang/Object;)Ljava/lang/Object; +.registers 2 + const/4 v0, 0 + aget-object v0, p0, v0 + return-object v0 +.end method + +# A test method called "invokeExact" that is native varargs, but is on a class +# other than MethodHandle. +.method public native varargs invokeExact([Ljava/lang/Object;)Ljava/lang/Object; +.end method
\ No newline at end of file diff --git a/test/954-invoke-polymorphic-verifier/smali/MethodHandleNotInvoke.smali b/test/954-invoke-polymorphic-verifier/smali/MethodHandleNotInvoke.smali new file mode 100644 index 0000000000..42546d1793 --- /dev/null +++ b/test/954-invoke-polymorphic-verifier/smali/MethodHandleNotInvoke.smali @@ -0,0 +1,37 @@ +# +# Copyright (C) 2016 The Android Open Source Project +# +# Licensed under the Apache License, Version 2.0 (the "License"); +# you may not use this file except in compliance with the License. +# You may obtain a copy of the License at +# +# http://www.apache.org/licenses/LICENSE-2.0 +# +# Unless required by applicable law or agreed to in writing, software +# distributed under the License is distributed on an "AS IS" BASIS, +# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. +# See the License for the specific language governing permissions and +# limitations under the License. + +.source "MethodHandleNotInvoke.smali" + +.class public LMethodHandleNotInvoke; +.super Ljava/lang/Object; + +.method public constructor <init>()V +.registers 4 + invoke-direct {p0}, Ljava/lang/Object;-><init>()V + invoke-static {}, LMethodHandleNotInvoke;->getMethodHandle()Ljava/lang/invoke/MethodHandle; + move-result-object v0 + const/4 v1, 0 + move-object v1, v1 + # Attempt invoke-polymorphic on MethodHandle.notInvoke(). + invoke-polymorphic {v0, v1}, Ljava/lang/invoke/MethodHandle;->notInvoke([Ljava/lang/Object;)Ljava/lang/Object;, ([Ljava/lang/Object;)Ljava/lang/Object; + return-void +.end method + +.method public static getMethodHandle()Ljava/lang/invoke/MethodHandle; +.registers 1 + const/4 v0, 0 + return-object v0 +.end method diff --git a/test/954-invoke-polymorphic-verifier/smali/MethodHandleToString.smali b/test/954-invoke-polymorphic-verifier/smali/MethodHandleToString.smali new file mode 100644 index 0000000000..c48429ca7c --- /dev/null +++ b/test/954-invoke-polymorphic-verifier/smali/MethodHandleToString.smali @@ -0,0 +1,35 @@ +# +# Copyright (C) 2016 The Android Open Source Project +# +# Licensed under the Apache License, Version 2.0 (the "License"); +# you may not use this file except in compliance with the License. +# You may obtain a copy of the License at +# +# http://www.apache.org/licenses/LICENSE-2.0 +# +# Unless required by applicable law or agreed to in writing, software +# distributed under the License is distributed on an "AS IS" BASIS, +# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. +# See the License for the specific language governing permissions and +# limitations under the License. + +.source "MethodHandleToString.smali" + +.class public LMethodHandleToString; +.super Ljava/lang/Object; + +.method public constructor <init>()V +.registers 1 + invoke-direct {p0}, Ljava/lang/Object;-><init>()V + invoke-static {}, LMethodHandleToString;->getMethodHandle()Ljava/lang/invoke/MethodHandle; + move-result-object v0 + # Attempt invoke-polymorphic on MethodHandle.toString(). + invoke-polymorphic {v0}, Ljava/lang/invoke/MethodHandle;->toString()Ljava/lang/String;, ()Ljava/lang/Object; + return-void +.end method + +.method public static getMethodHandle()Ljava/lang/invoke/MethodHandle; +.registers 1 + const/4 v0, 0 + return-object v0 +.end method diff --git a/test/954-invoke-polymorphic-verifier/smali/NonReference.smali b/test/954-invoke-polymorphic-verifier/smali/NonReference.smali new file mode 100644 index 0000000000..4e1eff235c --- /dev/null +++ b/test/954-invoke-polymorphic-verifier/smali/NonReference.smali @@ -0,0 +1,30 @@ +# +# Copyright (C) 2016 The Android Open Source Project +# +# Licensed under the Apache License, Version 2.0 (the "License"); +# you may not use this file except in compliance with the License. +# You may obtain a copy of the License at +# +# http://www.apache.org/licenses/LICENSE-2.0 +# +# Unless required by applicable law or agreed to in writing, software +# distributed under the License is distributed on an "AS IS" BASIS, +# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. +# See the License for the specific language governing permissions and +# limitations under the License. + +.source "NonReference.smali" + +.class public LNonReference; +.super Ljava/lang/Object; + +.method public constructor <init>()V +.registers 4 + invoke-direct {p0}, Ljava/lang/Object;-><init>()V + # Set v0 to have incorrect type (not a MethodHandle) and value (not null). + const-wide v0, 0 + const-string v1, "1" + const-string v2, "2" + invoke-polymorphic {v0, v1, v2}, Ljava/lang/invoke/MethodHandle;->invoke([Ljava/lang/Object;)Ljava/lang/Object;, (Ljava/lang/String;Ljava/lang/String;)Ljava/lang/String; + return-void +.end method diff --git a/test/954-invoke-polymorphic-verifier/smali/Subclass.smali b/test/954-invoke-polymorphic-verifier/smali/Subclass.smali new file mode 100644 index 0000000000..7ef61bedc2 --- /dev/null +++ b/test/954-invoke-polymorphic-verifier/smali/Subclass.smali @@ -0,0 +1,45 @@ +# +# Copyright (C) 2016 The Android Open Source Project +# +# Licensed under the Apache License, Version 2.0 (the "License"); +# you may not use this file except in compliance with the License. +# You may obtain a copy of the License at +# +# http://www.apache.org/licenses/LICENSE-2.0 +# +# Unless required by applicable law or agreed to in writing, software +# distributed under the License is distributed on an "AS IS" BASIS, +# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. +# See the License for the specific language governing permissions and +# limitations under the License. + +.source "Subclass.smali" + +.class public LSubclass; +.super Ljava/lang/Object; + +.method public constructor <init>()V +.registers 3 + invoke-direct {p0}, Ljava/lang/Object;-><init>()V + goto :happy + # Get a MethodHandleImpl instance (subclass of MethodHandle). + invoke-static {}, LSubclass;->getMethodHandleSubclassInstance()Ljava/lang/invoke/MethodHandleImpl; + move-result-object v0 + const-string v1, "1" + const-string v2, "2" + # Calling MethodHandle.invoke() on MethodHandleImpl instance (subclass of MethodHandle) => Okay + invoke-polymorphic {v0, v1, v2}, Ljava/lang/invoke/MethodHandle;->invoke([Ljava/lang/Object;)Ljava/lang/Object;, (Ljava/lang/String;Ljava/lang/String;)Ljava/lang/String; + # Calling MethodHandleImpl.invoke() rather than MethodHandle.invoke() [ declaring class is okay ] => Okay + invoke-polymorphic {v0, v1, v2}, Ljava/lang/invoke/MethodHandleImpl;->invoke([Ljava/lang/Object;)Ljava/lang/Object;, (Ljava/lang/String;Ljava/lang/String;)Ljava/lang/String; +:happy + sget-object v1, Ljava/lang/System;->out:Ljava/io/PrintStream; + const-string v2, "Passed Subclass test" + invoke-virtual {v1, v2}, Ljava/io/PrintStream;->println(Ljava/lang/String;)V + return-void +.end method + +.method public static getMethodHandleSubclassInstance()Ljava/lang/invoke/MethodHandleImpl; +.registers 1 + const/4 v0, 0 + return-object v0 +.end method diff --git a/test/954-invoke-polymorphic-verifier/smali/TooFewArguments.smali b/test/954-invoke-polymorphic-verifier/smali/TooFewArguments.smali new file mode 100644 index 0000000000..da29c6f133 --- /dev/null +++ b/test/954-invoke-polymorphic-verifier/smali/TooFewArguments.smali @@ -0,0 +1,33 @@ +# +# Copyright (C) 2016 The Android Open Source Project +# +# Licensed under the Apache License, Version 2.0 (the "License"); +# you may not use this file except in compliance with the License. +# You may obtain a copy of the License at +# +# http://www.apache.org/licenses/LICENSE-2.0 +# +# Unless required by applicable law or agreed to in writing, software +# distributed under the License is distributed on an "AS IS" BASIS, +# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. +# See the License for the specific language governing permissions and +# limitations under the License. + +.source "TooFewArguments.smali" + +.class public LTooFewArguments; +.super Ljava/lang/Object; + +.method public constructor <init>()V +.registers 4 + invoke-direct {p0}, Ljava/lang/Object;-><init>()V + # Set up v0 as a null MethodHandle + const/4 v0, 0 + move-object v0, v0 + invoke-virtual {v0}, Ljava/lang/invoke/MethodHandle;->asFixedArity()Ljava/lang/invoke/MethodHandle; + move-result-object v0 + const-string v1, "1" + # Invoke with one argument too few for prototype. + invoke-polymorphic {v0, v1}, Ljava/lang/invoke/MethodHandle;->invoke([Ljava/lang/Object;)Ljava/lang/Object;, (Ljava/lang/String;Ljava/lang/String;)Ljava/lang/String; + return-void +.end method diff --git a/test/954-invoke-polymorphic-verifier/smali/TooManyArguments.smali b/test/954-invoke-polymorphic-verifier/smali/TooManyArguments.smali new file mode 100644 index 0000000000..bc0135e0d0 --- /dev/null +++ b/test/954-invoke-polymorphic-verifier/smali/TooManyArguments.smali @@ -0,0 +1,35 @@ +# +# Copyright (C) 2016 The Android Open Source Project +# +# Licensed under the Apache License, Version 2.0 (the "License"); +# you may not use this file except in compliance with the License. +# You may obtain a copy of the License at +# +# http://www.apache.org/licenses/LICENSE-2.0 +# +# Unless required by applicable law or agreed to in writing, software +# distributed under the License is distributed on an "AS IS" BASIS, +# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. +# See the License for the specific language governing permissions and +# limitations under the License. + +.source "TooManyArguments.smali" + +.class public LTooManyArguments; +.super Ljava/lang/Object; + +.method public constructor <init>()V +.registers 4 + invoke-direct {p0}, Ljava/lang/Object;-><init>()V + # Set up v0 as a null MethodHandle + const/4 v0, 0 + move-object v0, v0 + invoke-virtual {v0}, Ljava/lang/invoke/MethodHandle;->asFixedArity()Ljava/lang/invoke/MethodHandle; + move-result-object v0 + const-string v1, "1" + const-string v2, "2" + const-string v3, "3" + # Invoke with one argument too many for prototype. + invoke-polymorphic {v0, v1, v2, v3}, Ljava/lang/invoke/MethodHandle;->invoke([Ljava/lang/Object;)Ljava/lang/Object;, (Ljava/lang/String;Ljava/lang/String;)Ljava/lang/String; + return-void +.end method diff --git a/test/954-invoke-polymorphic-verifier/smali/Unresolved.smali b/test/954-invoke-polymorphic-verifier/smali/Unresolved.smali new file mode 100644 index 0000000000..882f0e9256 --- /dev/null +++ b/test/954-invoke-polymorphic-verifier/smali/Unresolved.smali @@ -0,0 +1,40 @@ +# +# Copyright (C) 2016 The Android Open Source Project +# +# Licensed under the Apache License, Version 2.0 (the "License"); +# you may not use this file except in compliance with the License. +# You may obtain a copy of the License at +# +# http://www.apache.org/licenses/LICENSE-2.0 +# +# Unless required by applicable law or agreed to in writing, software +# distributed under the License is distributed on an "AS IS" BASIS, +# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. +# See the License for the specific language governing permissions and +# limitations under the License. + +.source "Unresolved.smali" + +.class public LUnresolved; +.super Ljava/lang/Object; + +.method public constructor <init>()V +.registers 3 +.line 23 + invoke-direct {p0}, Ljava/lang/Object;-><init>()V + # Get an unresolvable instance (abstract class) + invoke-static {}, LAbstract;->getUnresolvedInstance()Lother/thing/Foo; + move-result-object v0 + const-string v1, "1" + const-string v2, "2" + # Calling MethodHandle.invoke() on unresolved receiver. + invoke-polymorphic {v0, v1, v2}, Ljava/lang/invoke/MethodHandle;->invoke([Ljava/lang/Object;)Ljava/lang/Object;, (Ljava/lang/String;Ljava/lang/String;)Ljava/lang/String; + return-void +.end method + +.method public static getUnresolvedInstance()Lother/thing/Foo; +.registers 1 +.line 37 + const/4 v0, 0 + return-object v0 +.end method diff --git a/test/Android.arm_vixl.mk b/test/Android.arm_vixl.mk index 5ae961a6f1..c89eb4a1d8 100644 --- a/test/Android.arm_vixl.mk +++ b/test/Android.arm_vixl.mk @@ -16,6 +16,5 @@ # Known broken tests for the ARM VIXL backend. TEST_ART_BROKEN_OPTIMIZING_ARM_VIXL_RUN_TESTS := \ - 488-checker-inline-recursive-calls \ - 552-checker-sharpening \ 562-checker-no-intermediate \ + 624-checker-stringops \ diff --git a/test/Android.bp b/test/Android.bp index 39a4059f76..44c64c1a9c 100644 --- a/test/Android.bp +++ b/test/Android.bp @@ -244,8 +244,8 @@ art_cc_defaults { defaults: ["libartagent-defaults"], srcs: [ "ti-agent/common_load.cc", + "ti-agent/common_helper.cc", "901-hello-ti-agent/basics.cc", - "902-hello-transformation/transform.cc", "903-hello-tagging/tagging.cc", "904-object-allocation/tracking.cc", "905-object-free/tracking_free.cc", @@ -314,7 +314,6 @@ cc_defaults { "595-profile-saving/profile-saving.cc", "596-app-images/app_images.cc", "597-deopt-new-string/deopt.cc", - "626-const-class-linking/clear_dex_cache_types.cc", ], shared_libs: [ "libbacktrace", diff --git a/test/Android.run-test.mk b/test/Android.run-test.mk index 96b984d7e4..d7dfe5a3a0 100644 --- a/test/Android.run-test.mk +++ b/test/Android.run-test.mk @@ -360,8 +360,10 @@ endif TEST_ART_BROKEN_NO_RELOCATE_TESTS := # Temporarily disable some broken tests when forcing access checks in interpreter b/22414682 +# 629 requires compilation. TEST_ART_BROKEN_INTERPRETER_ACCESS_CHECK_TESTS := \ - 137-cfi + 137-cfi \ + 629-vdex-speed ifneq (,$(filter interp-ac,$(COMPILER_TYPES))) ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,$(TARGET_TYPES),$(RUN_TYPES),$(PREBUILD_TYPES), \ @@ -470,12 +472,14 @@ TEST_ART_BROKEN_FALLBACK_RUN_TESTS := # This test dynamically enables tracing to force a deoptimization. This makes the test meaningless # when already tracing, and writes an error message that we do not want to check for. # 130 occasional timeout b/32383962. +# 629 requires compilation. TEST_ART_BROKEN_TRACING_RUN_TESTS := \ 087-gc-after-link \ 130-hprof \ 137-cfi \ 141-class-unload \ 570-checker-osr \ + 629-vdex-speed \ 802-deoptimization ifneq (,$(filter trace stream,$(TRACE_TYPES))) @@ -486,9 +490,11 @@ endif # Known broken tests for the interpreter. # CFI unwinding expects managed frames. +# 629 requires compilation. TEST_ART_BROKEN_INTERPRETER_RUN_TESTS := \ 137-cfi \ - 554-jit-profile-file + 554-jit-profile-file \ + 629-vdex-speed ifneq (,$(filter interpreter,$(COMPILER_TYPES))) ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,$(TARGET_TYPES),$(RUN_TYPES),$(PREBUILD_TYPES), \ @@ -504,8 +510,10 @@ TEST_ART_BROKEN_INTERPRETER_RUN_TESTS := # Test 906 iterates the heap filtering with different options. No instances should be created # between those runs to be able to have precise checks. # Test 902 hits races with the JIT compiler. b/32821077 +# Test 629 requires compilation. TEST_ART_BROKEN_JIT_RUN_TESTS := \ 137-cfi \ + 629-vdex-speed \ 902-hello-transformation \ 904-object-allocation \ 906-iterate-heap \ @@ -660,6 +668,15 @@ ifeq ($(ART_USE_READ_BARRIER),true) endif endif +# Tests disabled for GSS. +TEST_ART_BROKEN_GSS_RUN_TESTS := 080-oom-fragmentation +ifeq ($(ART_DEFAULT_GC_TYPE),GSS) + ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,$(TARGET_TYPES),$(RUN_TYPES), \ + $(PREBUILD_TYPES),$(COMPILER_TYPES),$(RELOCATE_TYPES),$(TRACE_TYPES),$(GC_TYPES), \ + $(JNI_TYPES),$(IMAGE_TYPES),$(PICTEST_TYPES),$(DEBUGGABLE_TYPES), \ + $(TEST_ART_BROKEN_GSS_RUN_TESTS),$(ALL_ADDRESS_SIZES)) +endif + TEST_ART_BROKEN_OPTIMIZING_READ_BARRIER_RUN_TESTS := TEST_ART_BROKEN_JIT_READ_BARRIER_RUN_TESTS := diff --git a/test/common/runtime_state.cc b/test/common/runtime_state.cc index a2eb370326..285f3aa541 100644 --- a/test/common/runtime_state.cc +++ b/test/common/runtime_state.cc @@ -119,6 +119,24 @@ extern "C" JNIEXPORT jboolean JNICALL Java_Main_compiledWithOptimizing(JNIEnv* e return JNI_TRUE; } +extern "C" JNIEXPORT jboolean JNICALL Java_Main_isAotCompiled(JNIEnv* env, + jclass, + jclass cls, + jstring method_name) { + Thread* self = Thread::Current(); + ScopedObjectAccess soa(self); + ScopedUtfChars chars(env, method_name); + CHECK(chars.c_str() != nullptr); + ArtMethod* method = soa.Decode<mirror::Class>(cls)->FindDeclaredDirectMethodByName( + chars.c_str(), kRuntimePointerSize); + const void* code = method->GetOatMethodQuickCode(kRuntimePointerSize); + jit::Jit* jit = Runtime::Current()->GetJit(); + if (jit != nullptr && jit->GetCodeCache()->ContainsPc(code)) { + return true; + } + return code != nullptr; +} + extern "C" JNIEXPORT void JNICALL Java_Main_ensureJitCompiled(JNIEnv* env, jclass, jclass cls, @@ -157,4 +175,17 @@ extern "C" JNIEXPORT void JNICALL Java_Main_ensureJitCompiled(JNIEnv* env, } } +extern "C" JNIEXPORT jboolean JNICALL Java_Main_hasSingleImplementation(JNIEnv* env, + jclass, + jclass cls, + jstring method_name) { + ArtMethod* method = nullptr; + ScopedObjectAccess soa(Thread::Current()); + ScopedUtfChars chars(env, method_name); + CHECK(chars.c_str() != nullptr); + method = soa.Decode<mirror::Class>(cls)->FindDeclaredVirtualMethodByName( + chars.c_str(), kRuntimePointerSize); + return method->HasSingleImplementation(); +} + } // namespace art diff --git a/test/etc/default-build b/test/etc/default-build index 408dcfdf9b..f2b50789c6 100755 --- a/test/etc/default-build +++ b/test/etc/default-build @@ -71,7 +71,7 @@ DEFAULT_EXPERIMENT="no-experiment" declare -A JACK_EXPERIMENTAL_ARGS JACK_EXPERIMENTAL_ARGS["default-methods"]="-D jack.java.source.version=1.8 -D jack.android.min-api-level=24" JACK_EXPERIMENTAL_ARGS["lambdas"]="-D jack.java.source.version=1.8 -D jack.android.min-api-level=24" -JACK_EXPERIMENTAL_ARGS["method-handles"]="-D jack.java.source.version=1.8 -D jack.android.min-api-level=26" +JACK_EXPERIMENTAL_ARGS["method-handles"]="-D jack.java.source.version=1.7 -D jack.android.min-api-level=o-b1" declare -A SMALI_EXPERIMENTAL_ARGS SMALI_EXPERIMENTAL_ARGS["default-methods"]="--api-level 24" @@ -273,10 +273,8 @@ if [ ${HAS_SRC_EX} = "true" ]; then fi # Create a single jar with two dex files for multidex. -if [ ${NEED_DEX} = "true" ]; then - if [ ${HAS_SRC_MULTIDEX} = "true" ] || [ ${HAS_SMALI_MULTIDEX} = "true" ]; then - zip $TEST_NAME.jar classes.dex classes2.dex - else - zip $TEST_NAME.jar classes.dex - fi +if [ ${HAS_SRC_MULTIDEX} = "true" ] || [ ${HAS_SMALI_MULTIDEX} = "true" ]; then + zip $TEST_NAME.jar classes.dex classes2.dex +elif [ ${NEED_DEX} = "true" ]; then + zip $TEST_NAME.jar classes.dex fi diff --git a/test/etc/run-test-jar b/test/etc/run-test-jar index f0abb442bf..bb3a3ad714 100755 --- a/test/etc/run-test-jar +++ b/test/etc/run-test-jar @@ -316,8 +316,7 @@ fi if [ "$USE_JVM" = "y" ]; then export LD_LIBRARY_PATH=${ANDROID_HOST_OUT}/lib64 # Xmx is necessary since we don't pass down the ART flags to JVM. - # We pass the classes2 path whether it's used (src-multidex) or not. - cmdline="${JAVA} ${DEBUGGER_OPTS} ${JVM_VERIFY_ARG} -Xmx256m -classpath classes:classes2 ${FLAGS} $MAIN $@ ${ARGS}" + cmdline="${JAVA} ${DEBUGGER_OPTS} ${JVM_VERIFY_ARG} -Xmx256m -classpath classes ${FLAGS} $MAIN $@ ${ARGS}" if [ "$DEV_MODE" = "y" ]; then echo $cmdline fi diff --git a/test/ti-agent/common_helper.cc b/test/ti-agent/common_helper.cc new file mode 100644 index 0000000000..3e2b16802b --- /dev/null +++ b/test/ti-agent/common_helper.cc @@ -0,0 +1,91 @@ +/* + * Copyright (C) 2016 The Android Open Source Project + * + * Licensed under the Apache License, Version 2.0 (the "License"); + * you may not use this file except in compliance with the License. + * You may obtain a copy of the License at + * + * http://www.apache.org/licenses/LICENSE-2.0 + * + * Unless required by applicable law or agreed to in writing, software + * distributed under the License is distributed on an "AS IS" BASIS, + * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. + * See the License for the specific language governing permissions and + * limitations under the License. + */ + +#include "ti-agent/common_helper.h" + +#include <stdio.h> + +#include "jni.h" +#include "openjdkjvmti/jvmti.h" +#include "ti-agent/common_load.h" +#include "utils.h" + +namespace art { +bool RuntimeIsJVM; + +bool IsJVM() { + return RuntimeIsJVM; +} + +void SetAllCapabilities(jvmtiEnv* env) { + jvmtiCapabilities caps; + env->GetPotentialCapabilities(&caps); + env->AddCapabilities(&caps); +} + +namespace common_redefine { + +using RedefineDirectFunction = jvmtiError (*)(jvmtiEnv*, jclass, jint, const unsigned char*); +static void DoClassTransformation(jvmtiEnv* jvmti_env, JNIEnv* env, + jclass target, + jbyteArray class_file_bytes, + jbyteArray dex_file_bytes) { + jbyteArray desired_array = IsJVM() ? class_file_bytes : dex_file_bytes; + jint len = static_cast<jint>(env->GetArrayLength(desired_array)); + const unsigned char* redef_bytes = reinterpret_cast<const unsigned char*>( + env->GetByteArrayElements(desired_array, nullptr)); + jvmtiError res; + if (IsJVM()) { + jvmtiClassDefinition def; + def.klass = target; + def.class_byte_count = static_cast<jint>(len); + def.class_bytes = redef_bytes; + res = jvmti_env->RedefineClasses(1, &def); + } else { + RedefineDirectFunction f = + reinterpret_cast<RedefineDirectFunction>(jvmti_env->functions->reserved3); + res = f(jvmti_env, target, len, redef_bytes); + } + if (res != JVMTI_ERROR_NONE) { + printf("Redefinition failed!"); + } +} + +// Magic JNI export that classes can use for redefining classes. +// To use classes should declare this as a native function with signature (Ljava/lang/Class;[B[B)V +extern "C" JNIEXPORT void JNICALL Java_Main_doCommonClassRedefinition(JNIEnv* env, + jclass, + jclass target, + jbyteArray class_file_bytes, + jbyteArray dex_file_bytes) { + DoClassTransformation(jvmti_env, env, target, class_file_bytes, dex_file_bytes); +} + +// Don't do anything +jint OnLoad(JavaVM* vm, + char* options ATTRIBUTE_UNUSED, + void* reserved ATTRIBUTE_UNUSED) { + if (vm->GetEnv(reinterpret_cast<void**>(&jvmti_env), JVMTI_VERSION_1_0)) { + printf("Unable to get jvmti env!\n"); + return 1; + } + SetAllCapabilities(jvmti_env); + return 0; +} + +} // namespace common_redefine + +} // namespace art diff --git a/test/ti-agent/common_helper.h b/test/ti-agent/common_helper.h index 84997f3455..76543fed23 100644 --- a/test/ti-agent/common_helper.h +++ b/test/ti-agent/common_helper.h @@ -18,9 +18,19 @@ #define ART_TEST_TI_AGENT_COMMON_HELPER_H_ #include "jni.h" +#include "openjdkjvmti/jvmti.h" #include "ScopedLocalRef.h" namespace art { +namespace common_redefine { + +jint OnLoad(JavaVM* vm, char* options, void* reserved); + +} // namespace common_redefine + +extern bool RuntimeIsJVM; + +bool IsJVM(); template <typename T> static jobjectArray CreateObjectArray(JNIEnv* env, @@ -53,11 +63,7 @@ static jobjectArray CreateObjectArray(JNIEnv* env, return ret.release(); } -static void SetAllCapabilities(jvmtiEnv* env) { - jvmtiCapabilities caps; - env->GetPotentialCapabilities(&caps); - env->AddCapabilities(&caps); -} +void SetAllCapabilities(jvmtiEnv* env); } // namespace art diff --git a/test/ti-agent/common_load.cc b/test/ti-agent/common_load.cc index a959482772..2795cbc25c 100644 --- a/test/ti-agent/common_load.cc +++ b/test/ti-agent/common_load.cc @@ -23,9 +23,9 @@ #include "base/logging.h" #include "base/macros.h" #include "common_load.h" +#include "common_helper.h" #include "901-hello-ti-agent/basics.h" -#include "902-hello-transformation/transform.h" #include "903-hello-tagging/tagging.h" #include "904-object-allocation/tracking.h" #include "905-object-free/tracking_free.h" @@ -54,7 +54,7 @@ struct AgentLib { // A list of all the agents we have for testing. AgentLib agents[] = { { "901-hello-ti-agent", Test901HelloTi::OnLoad, nullptr }, - { "902-hello-transformation", Test902HelloTransformation::OnLoad, nullptr }, + { "902-hello-transformation", common_redefine::OnLoad, nullptr }, { "903-hello-tagging", Test903HelloTagging::OnLoad, nullptr }, { "904-object-allocation", Test904ObjectAllocation::OnLoad, nullptr }, { "905-object-free", Test905ObjectFree::OnLoad, nullptr }, @@ -95,6 +95,10 @@ static bool FindAgentNameAndOptions(char* options, return true; } +static void SetIsJVM(char* options) { + RuntimeIsJVM = strncmp(options, "jvm", 3) == 0; +} + extern "C" JNIEXPORT jint JNICALL Agent_OnLoad(JavaVM* vm, char* options, void* reserved) { char* remaining_options = nullptr; char* name_option = nullptr; @@ -112,6 +116,7 @@ extern "C" JNIEXPORT jint JNICALL Agent_OnLoad(JavaVM* vm, char* options, void* printf("agent: %s does not include an OnLoad method.\n", name_option); return -3; } + SetIsJVM(remaining_options); return lib->load(vm, remaining_options, reserved); } @@ -132,6 +137,7 @@ extern "C" JNIEXPORT jint JNICALL Agent_OnAttach(JavaVM* vm, char* options, void printf("agent: %s does not include an OnAttach method.\n", name_option); return -3; } + SetIsJVM(remaining_options); return lib->attach(vm, remaining_options, reserved); } diff --git a/tools/libcore_failures.txt b/tools/libcore_failures.txt index 53fe8fedc5..ae18f411d3 100644 --- a/tools/libcore_failures.txt +++ b/tools/libcore_failures.txt @@ -173,12 +173,6 @@ bug: 25178637 }, { - description: "Non-deterministic test because of a dependency on weak ref collection.", - result: EXEC_FAILED, - names: ["org.apache.harmony.tests.java.util.WeakHashMapTest#test_keySet"], - bug: 25437292 -}, -{ description: "Missing resource in classpath", result: EXEC_FAILED, modes: [device], |