summaryrefslogtreecommitdiff
diff options
context:
space:
mode:
author Alex Light <allight@google.com> 2017-01-19 15:05:06 -0800
committer Alex Light <allight@google.com> 2017-01-19 15:16:53 -0800
commit6ac5750807e0df930bb3791a9d5a8d8d5b5c45c4 (patch)
treeb4e73fa53001a99f687663e10f4edb9e7cce0b99
parent152b9567d0c2382464c844c91c2108608a1bc06f (diff)
Revert "Revert "Implement RetransformClasses""
This reverts commit 52a2db50b76f2b981d21d5508c3d9e8ab4c5fe93. Reason for revert: Issue with RedefineClasses was resolved. Test: ART_TEST_JNI_FORCECOPY=true mma -j40 test-art-host Change-Id: I06f198df4fb40c48647b358d241710329e0812e9
-rw-r--r--runtime/openjdkjvmti/OpenjdkJvmTi.cc89
-rw-r--r--runtime/openjdkjvmti/art_jvmti.h28
-rw-r--r--runtime/openjdkjvmti/events-inl.h86
-rw-r--r--runtime/openjdkjvmti/events.h9
-rw-r--r--runtime/openjdkjvmti/ti_redefine.cc98
-rw-r--r--runtime/openjdkjvmti/ti_redefine.h16
-rw-r--r--runtime/openjdkjvmti/transform.cc136
-rw-r--r--runtime/openjdkjvmti/transform.h34
-rw-r--r--test/921-hello-failure/expected.txt8
-rw-r--r--test/921-hello-failure/src/Main.java14
-rw-r--r--test/921-hello-failure/src/MultiRetrans.java108
-rwxr-xr-xtest/930-hello-retransform/build17
-rw-r--r--test/930-hello-retransform/expected.txt2
-rw-r--r--test/930-hello-retransform/info.txt1
-rwxr-xr-xtest/930-hello-retransform/run19
-rw-r--r--test/930-hello-retransform/src/Main.java70
-rw-r--r--test/930-hello-retransform/src/Transform.java28
-rw-r--r--test/Android.run-test.mk1
-rw-r--r--test/ti-agent/common_helper.cc167
-rw-r--r--test/ti-agent/common_helper.h4
-rw-r--r--test/ti-agent/common_load.cc3
21 files changed, 785 insertions, 153 deletions
diff --git a/runtime/openjdkjvmti/OpenjdkJvmTi.cc b/runtime/openjdkjvmti/OpenjdkJvmTi.cc
index 90467db8f6..32e3948e3e 100644
--- a/runtime/openjdkjvmti/OpenjdkJvmTi.cc
+++ b/runtime/openjdkjvmti/OpenjdkJvmTi.cc
@@ -631,7 +631,17 @@ class JvmtiFunctions {
}
static jvmtiError RetransformClasses(jvmtiEnv* env, jint class_count, const jclass* classes) {
- return ERR(NOT_IMPLEMENTED);
+ std::string error_msg;
+ jvmtiError res = Transformer::RetransformClasses(ArtJvmTiEnv::AsArtJvmTiEnv(env),
+ art::Runtime::Current(),
+ art::Thread::Current(),
+ class_count,
+ classes,
+ &error_msg);
+ if (res != OK) {
+ LOG(WARNING) << "FAILURE TO RETRANFORM " << error_msg;
+ }
+ return res;
}
static jvmtiError RedefineClasses(jvmtiEnv* env,
@@ -1255,78 +1265,6 @@ class JvmtiFunctions {
*format_ptr = jvmtiJlocationFormat::JVMTI_JLOCATION_JVMBCI;
return ERR(NONE);
}
-
- // TODO Remove this once events are working.
- static jvmtiError RetransformClassWithHook(jvmtiEnv* env,
- jclass klass,
- jvmtiEventClassFileLoadHook hook) {
- std::vector<jclass> classes;
- classes.push_back(klass);
- return RetransformClassesWithHook(reinterpret_cast<ArtJvmTiEnv*>(env), classes, hook);
- }
-
- // TODO This will be called by the event handler for the art::ti Event Load Event
- static jvmtiError RetransformClassesWithHook(ArtJvmTiEnv* env,
- const std::vector<jclass>& classes,
- jvmtiEventClassFileLoadHook hook) {
- if (!IsValidEnv(env)) {
- return ERR(INVALID_ENVIRONMENT);
- }
- jvmtiError res = OK;
- std::string error;
- for (jclass klass : classes) {
- JNIEnv* jni_env = nullptr;
- jobject loader = nullptr;
- std::string name;
- jobject protection_domain = nullptr;
- jint data_len = 0;
- unsigned char* dex_data = nullptr;
- jvmtiError ret = OK;
- std::string location;
- if ((ret = GetTransformationData(env,
- klass,
- /*out*/&location,
- /*out*/&jni_env,
- /*out*/&loader,
- /*out*/&name,
- /*out*/&protection_domain,
- /*out*/&data_len,
- /*out*/&dex_data)) != OK) {
- // TODO Do something more here? Maybe give log statements?
- return ret;
- }
- jint new_data_len = 0;
- unsigned char* new_dex_data = nullptr;
- hook(env,
- jni_env,
- klass,
- loader,
- name.c_str(),
- protection_domain,
- data_len,
- dex_data,
- /*out*/&new_data_len,
- /*out*/&new_dex_data);
- // Check if anything actually changed.
- if ((new_data_len != 0 || new_dex_data != nullptr) && new_dex_data != dex_data) {
- jvmtiClassDefinition def = { klass, new_data_len, new_dex_data };
- res = Redefiner::RedefineClasses(env,
- art::Runtime::Current(),
- art::Thread::Current(),
- 1,
- &def,
- &error);
- env->Deallocate(new_dex_data);
- }
- // Deallocate the old dex data.
- env->Deallocate(dex_data);
- if (res != OK) {
- LOG(ERROR) << "FAILURE TO REDEFINE " << error;
- return res;
- }
- }
- return OK;
- }
};
static bool IsJvmtiVersion(jint version) {
@@ -1369,10 +1307,7 @@ extern "C" bool ArtPlugin_Initialize() {
// The actual struct holding all of the entrypoints into the jvmti interface.
const jvmtiInterface_1 gJvmtiInterface = {
- // SPECIAL FUNCTION: RetransformClassWithHook Is normally reserved1
- // TODO Remove once we have events working.
- reinterpret_cast<void*>(JvmtiFunctions::RetransformClassWithHook),
- // nullptr, // reserved1
+ nullptr, // reserved1
JvmtiFunctions::SetEventNotificationMode,
nullptr, // reserved3
JvmtiFunctions::GetAllThreads,
diff --git a/runtime/openjdkjvmti/art_jvmti.h b/runtime/openjdkjvmti/art_jvmti.h
index 5eadc5a8e0..1c84d4d0ce 100644
--- a/runtime/openjdkjvmti/art_jvmti.h
+++ b/runtime/openjdkjvmti/art_jvmti.h
@@ -47,6 +47,7 @@
namespace openjdkjvmti {
extern const jvmtiInterface_1 gJvmtiInterface;
+extern EventHandler gEventHandler;
// A structure that is a jvmtiEnv with additional information for the runtime.
struct ArtJvmTiEnv : public jvmtiEnv {
@@ -124,6 +125,29 @@ static inline jvmtiError CopyString(jvmtiEnv* env, const char* src, unsigned cha
return ret;
}
+struct ArtClassDefinition {
+ jclass klass;
+ jobject loader;
+ std::string name;
+ jobject protection_domain;
+ jint dex_len;
+ JvmtiUniquePtr dex_data;
+ bool modified;
+
+ ArtClassDefinition() = default;
+ ArtClassDefinition(ArtClassDefinition&& o) = default;
+
+ void SetNewDexData(ArtJvmTiEnv* env, jint new_dex_len, unsigned char* new_dex_data) {
+ if (new_dex_data == nullptr) {
+ return;
+ } else if (new_dex_data != dex_data.get() || new_dex_len != dex_len) {
+ modified = true;
+ dex_len = new_dex_len;
+ dex_data = MakeJvmtiUniquePtr(env, new_dex_data);
+ }
+ }
+};
+
const jvmtiCapabilities kPotentialCapabilities = {
.can_tag_objects = 1,
.can_generate_field_modification_events = 0,
@@ -134,7 +158,7 @@ const jvmtiCapabilities kPotentialCapabilities = {
.can_get_current_contended_monitor = 0,
.can_get_monitor_info = 0,
.can_pop_frame = 0,
- .can_redefine_classes = 0,
+ .can_redefine_classes = 1,
.can_signal_thread = 0,
.can_get_source_file_name = 0,
.can_get_line_numbers = 0,
@@ -162,7 +186,7 @@ const jvmtiCapabilities kPotentialCapabilities = {
.can_get_owned_monitor_stack_depth_info = 0,
.can_get_constant_pool = 0,
.can_set_native_method_prefix = 0,
- .can_retransform_classes = 0,
+ .can_retransform_classes = 1,
.can_retransform_any_class = 0,
.can_generate_resource_exhaustion_heap_events = 0,
.can_generate_resource_exhaustion_threads_events = 0,
diff --git a/runtime/openjdkjvmti/events-inl.h b/runtime/openjdkjvmti/events-inl.h
index 1e07bc6b7b..21ec731ba5 100644
--- a/runtime/openjdkjvmti/events-inl.h
+++ b/runtime/openjdkjvmti/events-inl.h
@@ -115,9 +115,95 @@ ALWAYS_INLINE static inline FnType* GetCallback(ArtJvmTiEnv* env, ArtJvmtiEvent
}
template <typename ...Args>
+inline void EventHandler::DispatchClassFileLoadHookEvent(art::Thread*,
+ ArtJvmtiEvent event,
+ Args... args ATTRIBUTE_UNUSED) const {
+ CHECK(event == ArtJvmtiEvent::kClassFileLoadHookRetransformable ||
+ event == ArtJvmtiEvent::kClassFileLoadHookNonRetransformable);
+ LOG(FATAL) << "Incorrect arguments to ClassFileLoadHook!";
+}
+
+// TODO Locking of some type!
+template <>
+inline void EventHandler::DispatchClassFileLoadHookEvent(art::Thread* thread,
+ ArtJvmtiEvent event,
+ JNIEnv* jnienv,
+ jclass class_being_redefined,
+ jobject loader,
+ const char* name,
+ jobject protection_domain,
+ jint class_data_len,
+ const unsigned char* class_data,
+ jint* new_class_data_len,
+ unsigned char** new_class_data) const {
+ CHECK(event == ArtJvmtiEvent::kClassFileLoadHookRetransformable ||
+ event == ArtJvmtiEvent::kClassFileLoadHookNonRetransformable);
+ using FnType = void(jvmtiEnv* /* jvmti_env */,
+ JNIEnv* /* jnienv */,
+ jclass /* class_being_redefined */,
+ jobject /* loader */,
+ const char* /* name */,
+ jobject /* protection_domain */,
+ jint /* class_data_len */,
+ const unsigned char* /* class_data */,
+ jint* /* new_class_data_len */,
+ unsigned char** /* new_class_data */);
+ jint current_len = class_data_len;
+ unsigned char* current_class_data = const_cast<unsigned char*>(class_data);
+ ArtJvmTiEnv* last_env = nullptr;
+ for (ArtJvmTiEnv* env : envs) {
+ if (ShouldDispatch(event, env, thread)) {
+ jint new_len;
+ unsigned char* new_data;
+ FnType* callback = GetCallback<FnType>(env, event);
+ callback(env,
+ jnienv,
+ class_being_redefined,
+ loader,
+ name,
+ protection_domain,
+ current_len,
+ current_class_data,
+ &new_len,
+ &new_data);
+ if (new_data != nullptr && new_data != current_class_data) {
+ // Destroy the data the last transformer made. We skip this if the previous state was the
+ // initial one since we don't know here which jvmtiEnv allocated it.
+ // NB Currently this doesn't matter since all allocations just go to malloc but in the
+ // future we might have jvmtiEnv's keep track of their allocations for leak-checking.
+ if (last_env != nullptr) {
+ last_env->Deallocate(current_class_data);
+ }
+ last_env = env;
+ current_class_data = new_data;
+ current_len = new_len;
+ }
+ }
+ }
+ if (last_env != nullptr) {
+ *new_class_data_len = current_len;
+ *new_class_data = current_class_data;
+ }
+}
+
+template <typename ...Args>
inline void EventHandler::DispatchEvent(art::Thread* thread,
ArtJvmtiEvent event,
Args... args) const {
+ switch (event) {
+ case ArtJvmtiEvent::kClassFileLoadHookRetransformable:
+ case ArtJvmtiEvent::kClassFileLoadHookNonRetransformable:
+ return DispatchClassFileLoadHookEvent(thread, event, args...);
+ default:
+ return GenericDispatchEvent(thread, event, args...);
+ }
+}
+
+// TODO Locking of some type!
+template <typename ...Args>
+inline void EventHandler::GenericDispatchEvent(art::Thread* thread,
+ ArtJvmtiEvent event,
+ Args... args) const {
using FnType = void(jvmtiEnv*, Args...);
for (ArtJvmTiEnv* env : envs) {
if (ShouldDispatch(event, env, thread)) {
diff --git a/runtime/openjdkjvmti/events.h b/runtime/openjdkjvmti/events.h
index 7990141562..08a87659c7 100644
--- a/runtime/openjdkjvmti/events.h
+++ b/runtime/openjdkjvmti/events.h
@@ -178,6 +178,15 @@ class EventHandler {
ALWAYS_INLINE
inline void RecalculateGlobalEventMask(ArtJvmtiEvent event);
+ template <typename ...Args>
+ ALWAYS_INLINE inline void GenericDispatchEvent(art::Thread* thread,
+ ArtJvmtiEvent event,
+ Args... args) const;
+ template <typename ...Args>
+ ALWAYS_INLINE inline void DispatchClassFileLoadHookEvent(art::Thread* thread,
+ ArtJvmtiEvent event,
+ Args... args) const;
+
void HandleEventType(ArtJvmtiEvent event, bool enable);
// List of all JvmTiEnv objects that have been created, in their creation order.
diff --git a/runtime/openjdkjvmti/ti_redefine.cc b/runtime/openjdkjvmti/ti_redefine.cc
index 6af51c4c6c..2db8a40ad4 100644
--- a/runtime/openjdkjvmti/ti_redefine.cc
+++ b/runtime/openjdkjvmti/ti_redefine.cc
@@ -242,14 +242,12 @@ Redefiner::ClassRedefinition::~ClassRedefinition() {
}
}
-// TODO This should handle doing multiple classes at once so we need to do less cleanup when things
-// go wrong.
jvmtiError Redefiner::RedefineClasses(ArtJvmTiEnv* env,
art::Runtime* runtime,
art::Thread* self,
jint class_count,
const jvmtiClassDefinition* definitions,
- std::string* error_msg) {
+ /*out*/std::string* error_msg) {
if (env == nullptr) {
*error_msg = "env was null!";
return ERR(INVALID_ENVIRONMENT);
@@ -263,46 +261,95 @@ jvmtiError Redefiner::RedefineClasses(ArtJvmTiEnv* env,
*error_msg = "null definitions!";
return ERR(NULL_POINTER);
}
+ std::vector<ArtClassDefinition> def_vector;
+ def_vector.reserve(class_count);
+ for (jint i = 0; i < class_count; i++) {
+ // We make a copy of the class_bytes to pass into the retransformation.
+ // This makes cleanup easier (since we unambiguously own the bytes) and also is useful since we
+ // will need to keep the original bytes around unaltered for subsequent RetransformClasses calls
+ // to get the passed in bytes.
+ // TODO Implement saving the original bytes.
+ unsigned char* class_bytes_copy = nullptr;
+ jvmtiError res = env->Allocate(definitions[i].class_byte_count, &class_bytes_copy);
+ if (res != OK) {
+ return res;
+ }
+ memcpy(class_bytes_copy, definitions[i].class_bytes, definitions[i].class_byte_count);
+
+ ArtClassDefinition def;
+ def.dex_len = definitions[i].class_byte_count;
+ def.dex_data = MakeJvmtiUniquePtr(env, class_bytes_copy);
+ // We are definitely modified.
+ def.modified = true;
+ res = Transformer::FillInTransformationData(env, definitions[i].klass, &def);
+ if (res != OK) {
+ return res;
+ }
+ def_vector.push_back(std::move(def));
+ }
+ // Call all the transformation events.
+ jvmtiError res = Transformer::RetransformClassesDirect(env,
+ self,
+ &def_vector);
+ if (res != OK) {
+ // Something went wrong with transformation!
+ return res;
+ }
+ return RedefineClassesDirect(env, runtime, self, def_vector, error_msg);
+}
+
+jvmtiError Redefiner::RedefineClassesDirect(ArtJvmTiEnv* env,
+ art::Runtime* runtime,
+ art::Thread* self,
+ const std::vector<ArtClassDefinition>& definitions,
+ std::string* error_msg) {
+ DCHECK(env != nullptr);
+ if (definitions.size() == 0) {
+ // We don't actually need to do anything. Just return OK.
+ return OK;
+ }
// Stop JIT for the duration of this redefine since the JIT might concurrently compile a method we
// are going to redefine.
art::jit::ScopedJitSuspend suspend_jit;
// Get shared mutator lock so we can lock all the classes.
art::ScopedObjectAccess soa(self);
std::vector<Redefiner::ClassRedefinition> redefinitions;
- redefinitions.reserve(class_count);
+ redefinitions.reserve(definitions.size());
Redefiner r(runtime, self, error_msg);
- for (jint i = 0; i < class_count; i++) {
- jvmtiError res = r.AddRedefinition(env, definitions[i]);
- if (res != OK) {
- return res;
+ for (const ArtClassDefinition& def : definitions) {
+ // Only try to transform classes that have been modified.
+ if (def.modified) {
+ jvmtiError res = r.AddRedefinition(env, def);
+ if (res != OK) {
+ return res;
+ }
}
}
return r.Run();
}
-jvmtiError Redefiner::AddRedefinition(ArtJvmTiEnv* env, const jvmtiClassDefinition& def) {
+jvmtiError Redefiner::AddRedefinition(ArtJvmTiEnv* env, const ArtClassDefinition& def) {
std::string original_dex_location;
jvmtiError ret = OK;
if ((ret = GetClassLocation(env, def.klass, &original_dex_location))) {
*error_msg_ = "Unable to get original dex file location!";
return ret;
}
- std::unique_ptr<art::MemMap> map(MoveDataToMemMap(original_dex_location,
- def.class_byte_count,
- def.class_bytes,
- error_msg_));
- std::ostringstream os;
char* generic_ptr_unused = nullptr;
char* signature_ptr = nullptr;
- if (env->GetClassSignature(def.klass, &signature_ptr, &generic_ptr_unused) != OK) {
- *error_msg_ = "A jclass passed in does not seem to be valid";
- return ERR(INVALID_CLASS);
+ if ((ret = env->GetClassSignature(def.klass, &signature_ptr, &generic_ptr_unused)) != OK) {
+ *error_msg_ = "Unable to get class signature!";
+ return ret;
}
- // These will make sure we deallocate the signature.
- JvmtiUniquePtr sig_unique_ptr(MakeJvmtiUniquePtr(env, signature_ptr));
JvmtiUniquePtr generic_unique_ptr(MakeJvmtiUniquePtr(env, generic_ptr_unused));
+ JvmtiUniquePtr signature_unique_ptr(MakeJvmtiUniquePtr(env, signature_ptr));
+ std::unique_ptr<art::MemMap> map(MoveDataToMemMap(original_dex_location,
+ def.dex_len,
+ def.dex_data.get(),
+ error_msg_));
+ std::ostringstream os;
if (map.get() == nullptr) {
- os << "Failed to create anonymous mmap for modified dex file of class " << signature_ptr
+ os << "Failed to create anonymous mmap for modified dex file of class " << def.name
<< "in dex file " << original_dex_location << " because: " << *error_msg_;
*error_msg_ = os.str();
return ERR(OUT_OF_MEMORY);
@@ -319,7 +366,7 @@ jvmtiError Redefiner::AddRedefinition(ArtJvmTiEnv* env, const jvmtiClassDefiniti
/*verify_checksum*/true,
error_msg_));
if (dex_file.get() == nullptr) {
- os << "Unable to load modified dex file for " << signature_ptr << ": " << *error_msg_;
+ os << "Unable to load modified dex file for " << def.name << ": " << *error_msg_;
*error_msg_ = os.str();
return ERR(INVALID_CLASS_FORMAT);
}
@@ -989,17 +1036,16 @@ void Redefiner::ClassRedefinition::UpdateFields(art::ObjPtr<art::mirror::Class>
// Performs updates to class that will allow us to verify it.
void Redefiner::ClassRedefinition::UpdateClass(art::ObjPtr<art::mirror::Class> mclass,
art::ObjPtr<art::mirror::DexCache> new_dex_cache) {
- const art::DexFile::ClassDef* class_def = art::OatFile::OatDexFile::FindClassDef(
- *dex_file_, class_sig_.c_str(), art::ComputeModifiedUtf8Hash(class_sig_.c_str()));
- DCHECK(class_def != nullptr);
- UpdateMethods(mclass, new_dex_cache, *class_def);
+ DCHECK_EQ(dex_file_->NumClassDefs(), 1u);
+ const art::DexFile::ClassDef& class_def = dex_file_->GetClassDef(0);
+ UpdateMethods(mclass, new_dex_cache, class_def);
UpdateFields(mclass);
// Update the class fields.
// Need to update class last since the ArtMethod gets its DexFile from the class (which is needed
// to call GetReturnTypeDescriptor and GetParameterTypeList above).
mclass->SetDexCache(new_dex_cache.Ptr());
- mclass->SetDexClassDefIndex(dex_file_->GetIndexForClassDef(*class_def));
+ mclass->SetDexClassDefIndex(dex_file_->GetIndexForClassDef(class_def));
mclass->SetDexTypeIndex(dex_file_->GetIndexForTypeId(*dex_file_->FindTypeId(class_sig_.c_str())));
}
diff --git a/runtime/openjdkjvmti/ti_redefine.h b/runtime/openjdkjvmti/ti_redefine.h
index 8626bc54d5..f8d51ad124 100644
--- a/runtime/openjdkjvmti/ti_redefine.h
+++ b/runtime/openjdkjvmti/ti_redefine.h
@@ -72,13 +72,25 @@ class Redefiner {
public:
// Redefine the given classes with the given dex data. Note this function does not take ownership
// of the dex_data pointers. It is not used after this call however and may be freed if desired.
+ // The caller is responsible for freeing it. The runtime makes its own copy of the data. This
+ // function does not call the transformation events.
+ // TODO Check modified flag of the definitions.
+ static jvmtiError RedefineClassesDirect(ArtJvmTiEnv* env,
+ art::Runtime* runtime,
+ art::Thread* self,
+ const std::vector<ArtClassDefinition>& definitions,
+ /*out*/std::string* error_msg);
+
+ // Redefine the given classes with the given dex data. Note this function does not take ownership
+ // of the dex_data pointers. It is not used after this call however and may be freed if desired.
// The caller is responsible for freeing it. The runtime makes its own copy of the data.
+ // TODO This function should call the transformation events.
static jvmtiError RedefineClasses(ArtJvmTiEnv* env,
art::Runtime* runtime,
art::Thread* self,
jint class_count,
const jvmtiClassDefinition* definitions,
- std::string* error_msg);
+ /*out*/std::string* error_msg);
static jvmtiError IsModifiableClass(jvmtiEnv* env, jclass klass, jboolean* is_redefinable);
@@ -209,7 +221,7 @@ class Redefiner {
redefinitions_(),
error_msg_(error_msg) { }
- jvmtiError AddRedefinition(ArtJvmTiEnv* env, const jvmtiClassDefinition& def)
+ jvmtiError AddRedefinition(ArtJvmTiEnv* env, const ArtClassDefinition& def)
REQUIRES_SHARED(art::Locks::mutator_lock_);
static jvmtiError GetClassRedefinitionError(art::Handle<art::mirror::Class> klass,
diff --git a/runtime/openjdkjvmti/transform.cc b/runtime/openjdkjvmti/transform.cc
index f5451254c0..2809cb6926 100644
--- a/runtime/openjdkjvmti/transform.cc
+++ b/runtime/openjdkjvmti/transform.cc
@@ -38,6 +38,7 @@
#include "class_linker.h"
#include "dex_file.h"
#include "dex_file_types.h"
+#include "events-inl.h"
#include "gc_root-inl.h"
#include "globals.h"
#include "jni_env_ext-inl.h"
@@ -52,12 +53,76 @@
#include "scoped_thread_state_change-inl.h"
#include "stack.h"
#include "thread_list.h"
+#include "ti_redefine.h"
#include "transform.h"
#include "utf.h"
#include "utils/dex_cache_arrays_layout-inl.h"
namespace openjdkjvmti {
+jvmtiError Transformer::RetransformClassesDirect(
+ ArtJvmTiEnv* env,
+ art::Thread* self,
+ /*in-out*/std::vector<ArtClassDefinition>* definitions) {
+ for (ArtClassDefinition& def : *definitions) {
+ jint new_len = -1;
+ unsigned char* new_data = nullptr;
+ // Static casts are so that we get the right template initialization for the special event
+ // handling code required by the ClassFileLoadHooks.
+ gEventHandler.DispatchEvent(self,
+ ArtJvmtiEvent::kClassFileLoadHookRetransformable,
+ GetJniEnv(env),
+ static_cast<jclass>(def.klass),
+ static_cast<jobject>(def.loader),
+ static_cast<const char*>(def.name.c_str()),
+ static_cast<jobject>(def.protection_domain),
+ static_cast<jint>(def.dex_len),
+ static_cast<const unsigned char*>(def.dex_data.get()),
+ static_cast<jint*>(&new_len),
+ static_cast<unsigned char**>(&new_data));
+ def.SetNewDexData(env, new_len, new_data);
+ }
+ return OK;
+}
+
+jvmtiError Transformer::RetransformClasses(ArtJvmTiEnv* env,
+ art::Runtime* runtime,
+ art::Thread* self,
+ jint class_count,
+ const jclass* classes,
+ /*out*/std::string* error_msg) {
+ if (env == nullptr) {
+ *error_msg = "env was null!";
+ return ERR(INVALID_ENVIRONMENT);
+ } else if (class_count < 0) {
+ *error_msg = "class_count was less then 0";
+ return ERR(ILLEGAL_ARGUMENT);
+ } else if (class_count == 0) {
+ // We don't actually need to do anything. Just return OK.
+ return OK;
+ } else if (classes == nullptr) {
+ *error_msg = "null classes!";
+ return ERR(NULL_POINTER);
+ }
+ // A holder that will Deallocate all the class bytes buffers on destruction.
+ std::vector<ArtClassDefinition> definitions;
+ jvmtiError res = OK;
+ for (jint i = 0; i < class_count; i++) {
+ ArtClassDefinition def;
+ res = FillInTransformationData(env, classes[i], &def);
+ if (res != OK) {
+ return res;
+ }
+ definitions.push_back(std::move(def));
+ }
+ res = RetransformClassesDirect(env, self, &definitions);
+ if (res != OK) {
+ return res;
+ }
+ return Redefiner::RedefineClassesDirect(env, runtime, self, definitions, error_msg);
+}
+
+// TODO Move this somewhere else, ti_class?
jvmtiError GetClassLocation(ArtJvmTiEnv* env, jclass klass, /*out*/std::string* location) {
JNIEnv* jni_env = nullptr;
jint ret = env->art_vm->GetEnv(reinterpret_cast<void**>(&jni_env), JNI_VERSION_1_1);
@@ -73,42 +138,61 @@ jvmtiError GetClassLocation(ArtJvmTiEnv* env, jclass klass, /*out*/std::string*
return OK;
}
+// TODO Implement this for real once transformed dex data is actually saved.
+jvmtiError Transformer::GetDexDataForRetransformation(ArtJvmTiEnv* env,
+ art::Handle<art::mirror::Class> klass,
+ /*out*/jint* dex_data_len,
+ /*out*/unsigned char** dex_data) {
+ // TODO De-quicken the dex file before passing it to the agents.
+ LOG(WARNING) << "Dex file is not de-quickened yet! Quickened dex instructions might be present";
+ LOG(WARNING) << "Caching of initial dex data is not yet performed! Dex data might have been "
+ << "transformed by agent already";
+ const art::DexFile& dex = klass->GetDexFile();
+ *dex_data_len = static_cast<jint>(dex.Size());
+ unsigned char* new_dex_data = nullptr;
+ jvmtiError alloc_error = env->Allocate(*dex_data_len, &new_dex_data);
+ if (alloc_error != OK) {
+ return alloc_error;
+ }
+ // Copy the data into a temporary buffer.
+ memcpy(reinterpret_cast<void*>(new_dex_data),
+ reinterpret_cast<const void*>(dex.Begin()),
+ *dex_data_len);
+ *dex_data = new_dex_data;
+ return OK;
+}
+
// TODO Move this function somewhere more appropriate.
// Gets the data surrounding the given class.
-jvmtiError GetTransformationData(ArtJvmTiEnv* env,
- jclass klass,
- /*out*/std::string* location,
- /*out*/JNIEnv** jni_env_ptr,
- /*out*/jobject* loader,
- /*out*/std::string* name,
- /*out*/jobject* protection_domain,
- /*out*/jint* data_len,
- /*out*/unsigned char** dex_data) {
- jint ret = env->art_vm->GetEnv(reinterpret_cast<void**>(jni_env_ptr), JNI_VERSION_1_1);
- if (ret != JNI_OK) {
+// TODO Make this less magical.
+jvmtiError Transformer::FillInTransformationData(ArtJvmTiEnv* env,
+ jclass klass,
+ ArtClassDefinition* def) {
+ JNIEnv* jni_env = GetJniEnv(env);
+ if (jni_env == nullptr) {
// TODO Different error might be better?
return ERR(INTERNAL);
}
- JNIEnv* jni_env = *jni_env_ptr;
art::ScopedObjectAccess soa(jni_env);
art::StackHandleScope<3> hs(art::Thread::Current());
art::Handle<art::mirror::Class> hs_klass(hs.NewHandle(soa.Decode<art::mirror::Class>(klass)));
- *loader = soa.AddLocalReference<jobject>(hs_klass->GetClassLoader());
- *name = art::mirror::Class::ComputeName(hs_klass)->ToModifiedUtf8();
+ if (hs_klass.IsNull()) {
+ return ERR(INVALID_CLASS);
+ }
+ def->klass = klass;
+ def->loader = soa.AddLocalReference<jobject>(hs_klass->GetClassLoader());
+ def->name = art::mirror::Class::ComputeName(hs_klass)->ToModifiedUtf8();
// TODO is this always null?
- *protection_domain = nullptr;
- const art::DexFile& dex = hs_klass->GetDexFile();
- *location = dex.GetLocation();
- *data_len = static_cast<jint>(dex.Size());
- // TODO We should maybe change env->Allocate to allow us to mprotect this memory and stop writes.
- jvmtiError alloc_error = env->Allocate(*data_len, dex_data);
- if (alloc_error != OK) {
- return alloc_error;
+ def->protection_domain = nullptr;
+ if (def->dex_data.get() == nullptr) {
+ unsigned char* new_data;
+ jvmtiError res = GetDexDataForRetransformation(env, hs_klass, &def->dex_len, &new_data);
+ if (res == OK) {
+ def->dex_data = MakeJvmtiUniquePtr(env, new_data);
+ } else {
+ return res;
+ }
}
- // Copy the data into a temporary buffer.
- memcpy(reinterpret_cast<void*>(*dex_data),
- reinterpret_cast<const void*>(dex.Begin()),
- *data_len);
return OK;
}
diff --git a/runtime/openjdkjvmti/transform.h b/runtime/openjdkjvmti/transform.h
index 0ad5099daf..0ff2bd1d40 100644
--- a/runtime/openjdkjvmti/transform.h
+++ b/runtime/openjdkjvmti/transform.h
@@ -43,16 +43,30 @@ namespace openjdkjvmti {
jvmtiError GetClassLocation(ArtJvmTiEnv* env, jclass klass, /*out*/std::string* location);
-// Gets the data surrounding the given class.
-jvmtiError GetTransformationData(ArtJvmTiEnv* env,
- jclass klass,
- /*out*/std::string* location,
- /*out*/JNIEnv** jni_env_ptr,
- /*out*/jobject* loader,
- /*out*/std::string* name,
- /*out*/jobject* protection_domain,
- /*out*/jint* data_len,
- /*out*/unsigned char** dex_data);
+class Transformer {
+ public:
+ static jvmtiError RetransformClassesDirect(
+ ArtJvmTiEnv* env, art::Thread* self, /*in-out*/std::vector<ArtClassDefinition>* definitions);
+
+ static jvmtiError RetransformClasses(ArtJvmTiEnv* env,
+ art::Runtime* runtime,
+ art::Thread* self,
+ jint class_count,
+ const jclass* classes,
+ /*out*/std::string* error_msg);
+
+ // Gets the data surrounding the given class.
+ static jvmtiError FillInTransformationData(ArtJvmTiEnv* env,
+ jclass klass,
+ ArtClassDefinition* def);
+
+ private:
+ static jvmtiError GetDexDataForRetransformation(ArtJvmTiEnv* env,
+ art::Handle<art::mirror::Class> klass,
+ /*out*/jint* dex_data_length,
+ /*out*/unsigned char** dex_data)
+ REQUIRES_SHARED(art::Locks::mutator_lock_);
+};
} // namespace openjdkjvmti
diff --git a/test/921-hello-failure/expected.txt b/test/921-hello-failure/expected.txt
index 1c1d4d9b80..9615e6b33d 100644
--- a/test/921-hello-failure/expected.txt
+++ b/test/921-hello-failure/expected.txt
@@ -21,3 +21,11 @@ hello2 - MultiRedef
Transformation error : java.lang.Exception(Failed to redefine classes <LTransform;, LTransform2;> due to JVMTI_ERROR_NAMES_DONT_MATCH)
hello - MultiRedef
hello2 - MultiRedef
+hello - MultiRetrans
+hello2 - MultiRetrans
+Transformation error : java.lang.Exception(Failed to retransform classes <LTransform2;, LTransform;> due to JVMTI_ERROR_NAMES_DONT_MATCH)
+hello - MultiRetrans
+hello2 - MultiRetrans
+Transformation error : java.lang.Exception(Failed to retransform classes <LTransform;, LTransform2;> due to JVMTI_ERROR_NAMES_DONT_MATCH)
+hello - MultiRetrans
+hello2 - MultiRetrans
diff --git a/test/921-hello-failure/src/Main.java b/test/921-hello-failure/src/Main.java
index 1fe259961d..43d6e9ed07 100644
--- a/test/921-hello-failure/src/Main.java
+++ b/test/921-hello-failure/src/Main.java
@@ -25,6 +25,7 @@ public class Main {
MissingInterface.doTest(new Transform2());
ReorderInterface.doTest(new Transform2());
MultiRedef.doTest(new Transform(), new Transform2());
+ MultiRetrans.doTest(new Transform(), new Transform2());
}
// Transforms the class. This throws an exception if something goes wrong.
@@ -47,7 +48,20 @@ public class Main {
dex_files.toArray(new byte[0][]));
}
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) throws Exception {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
byte[][] classfiles,
byte[][] dexfiles) throws Exception;
+ public static native void doCommonClassRetransformation(Class<?>... target) throws Exception;
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
}
diff --git a/test/921-hello-failure/src/MultiRetrans.java b/test/921-hello-failure/src/MultiRetrans.java
new file mode 100644
index 0000000000..95aaf074e9
--- /dev/null
+++ b/test/921-hello-failure/src/MultiRetrans.java
@@ -0,0 +1,108 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+
+class MultiRetrans {
+
+ // class NotTransform {
+ // public void sayHi(String name) {
+ // throw new Error("Should not be called!");
+ // }
+ // }
+ private static CommonClassDefinition INVALID_DEFINITION_T1 = new CommonClassDefinition(
+ Transform.class,
+ Base64.getDecoder().decode(
+ "yv66vgAAADQAFQoABgAPBwAQCAARCgACABIHABMHABQBAAY8aW5pdD4BAAMoKVYBAARDb2RlAQAP" +
+ "TGluZU51bWJlclRhYmxlAQAFc2F5SGkBABUoTGphdmEvbGFuZy9TdHJpbmc7KVYBAApTb3VyY2VG" +
+ "aWxlAQARTm90VHJhbnNmb3JtLmphdmEMAAcACAEAD2phdmEvbGFuZy9FcnJvcgEAFVNob3VsZCBu" +
+ "b3QgYmUgY2FsbGVkIQwABwAMAQAMTm90VHJhbnNmb3JtAQAQamF2YS9sYW5nL09iamVjdAAgAAUA" +
+ "BgAAAAAAAgAAAAcACAABAAkAAAAdAAEAAQAAAAUqtwABsQAAAAEACgAAAAYAAQAAAAEAAQALAAwA" +
+ "AQAJAAAAIgADAAIAAAAKuwACWRIDtwAEvwAAAAEACgAAAAYAAQAAAAMAAQANAAAAAgAO"),
+ Base64.getDecoder().decode(
+ "ZGV4CjAzNQDLV95i5xnv6iUi6uIeDoY5jP5Xe9NP1AiYAgAAcAAAAHhWNBIAAAAAAAAAAAQCAAAL" +
+ "AAAAcAAAAAUAAACcAAAAAgAAALAAAAAAAAAAAAAAAAQAAADIAAAAAQAAAOgAAACQAQAACAEAAEoB" +
+ "AABSAQAAYgEAAHUBAACJAQAAnQEAALABAADHAQAAygEAAM4BAADiAQAAAQAAAAIAAAADAAAABAAA" +
+ "AAcAAAAHAAAABAAAAAAAAAAIAAAABAAAAEQBAAAAAAAAAAAAAAAAAQAKAAAAAQABAAAAAAACAAAA" +
+ "AAAAAAAAAAAAAAAAAgAAAAAAAAAFAAAAAAAAAPQBAAAAAAAAAQABAAEAAADpAQAABAAAAHAQAwAA" +
+ "AA4ABAACAAIAAADuAQAACQAAACIAAQAbAQYAAABwIAIAEAAnAAAAAQAAAAMABjxpbml0PgAOTE5v" +
+ "dFRyYW5zZm9ybTsAEUxqYXZhL2xhbmcvRXJyb3I7ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZh" +
+ "L2xhbmcvU3RyaW5nOwARTm90VHJhbnNmb3JtLmphdmEAFVNob3VsZCBub3QgYmUgY2FsbGVkIQAB" +
+ "VgACVkwAEmVtaXR0ZXI6IGphY2stNC4yMAAFc2F5SGkAAQAHDgADAQAHDgAAAAEBAICABIgCAQGg" +
+ "AgAADAAAAAAAAAABAAAAAAAAAAEAAAALAAAAcAAAAAIAAAAFAAAAnAAAAAMAAAACAAAAsAAAAAUA" +
+ "AAAEAAAAyAAAAAYAAAABAAAA6AAAAAEgAAACAAAACAEAAAEQAAABAAAARAEAAAIgAAALAAAASgEA" +
+ "AAMgAAACAAAA6QEAAAAgAAABAAAA9AEAAAAQAAABAAAABAIAAA=="));
+
+ // Valid redefinition of Transform2
+ // class Transform2 implements Iface1, Iface2 {
+ // public void sayHi(String name) {
+ // throw new Error("Should not be called!");
+ // }
+ // }
+ private static CommonClassDefinition VALID_DEFINITION_T2 = new CommonClassDefinition(
+ Transform2.class,
+ Base64.getDecoder().decode(
+ "yv66vgAAADQAGQoABgARBwASCAATCgACABQHABUHABYHABcHABgBAAY8aW5pdD4BAAMoKVYBAARD" +
+ "b2RlAQAPTGluZU51bWJlclRhYmxlAQAFc2F5SGkBABUoTGphdmEvbGFuZy9TdHJpbmc7KVYBAApT" +
+ "b3VyY2VGaWxlAQAPVHJhbnNmb3JtMi5qYXZhDAAJAAoBAA9qYXZhL2xhbmcvRXJyb3IBABVTaG91" +
+ "bGQgbm90IGJlIGNhbGxlZCEMAAkADgEAClRyYW5zZm9ybTIBABBqYXZhL2xhbmcvT2JqZWN0AQAG" +
+ "SWZhY2UxAQAGSWZhY2UyACAABQAGAAIABwAIAAAAAgAAAAkACgABAAsAAAAdAAEAAQAAAAUqtwAB" +
+ "sQAAAAEADAAAAAYAAQAAAAEAAQANAA4AAQALAAAAIgADAAIAAAAKuwACWRIDtwAEvwAAAAEADAAA" +
+ "AAYAAQAAAAMAAQAPAAAAAgAQ"),
+ Base64.getDecoder().decode(
+ "ZGV4CjAzNQDSWls05CPkX+gbTGMVRvx9dc9vozzVbu7AAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAN" +
+ "AAAAcAAAAAcAAACkAAAAAgAAAMAAAAAAAAAAAAAAAAQAAADYAAAAAQAAAPgAAACoAQAAGAEAAGIB" +
+ "AABqAQAAdAEAAH4BAACMAQAAnwEAALMBAADHAQAA3gEAAO8BAADyAQAA9gEAAAoCAAABAAAAAgAA" +
+ "AAMAAAAEAAAABQAAAAYAAAAJAAAACQAAAAYAAAAAAAAACgAAAAYAAABcAQAAAgAAAAAAAAACAAEA" +
+ "DAAAAAMAAQAAAAAABAAAAAAAAAACAAAAAAAAAAQAAABUAQAACAAAAAAAAAAcAgAAAAAAAAEAAQAB" +
+ "AAAAEQIAAAQAAABwEAMAAAAOAAQAAgACAAAAFgIAAAkAAAAiAAMAGwEHAAAAcCACABAAJwAAAAIA" +
+ "AAAAAAEAAQAAAAUABjxpbml0PgAITElmYWNlMTsACExJZmFjZTI7AAxMVHJhbnNmb3JtMjsAEUxq" +
+ "YXZhL2xhbmcvRXJyb3I7ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwAV" +
+ "U2hvdWxkIG5vdCBiZSBjYWxsZWQhAA9UcmFuc2Zvcm0yLmphdmEAAVYAAlZMABJlbWl0dGVyOiBq" +
+ "YWNrLTQuMjAABXNheUhpAAEABw4AAwEABw4AAAABAQCAgASYAgEBsAIAAAwAAAAAAAAAAQAAAAAA" +
+ "AAABAAAADQAAAHAAAAACAAAABwAAAKQAAAADAAAAAgAAAMAAAAAFAAAABAAAANgAAAAGAAAAAQAA" +
+ "APgAAAABIAAAAgAAABgBAAABEAAAAgAAAFQBAAACIAAADQAAAGIBAAADIAAAAgAAABECAAAAIAAA" +
+ "AQAAABwCAAAAEAAAAQAAACwCAAA="));
+
+ public static void doTest(Transform t1, Transform2 t2) {
+ t1.sayHi("MultiRetrans");
+ t2.sayHi("MultiRetrans");
+ try {
+ Main.addMultiTransformationResults(VALID_DEFINITION_T2, INVALID_DEFINITION_T1);
+ Main.enableCommonRetransformation(true);
+ Main.doCommonClassRetransformation(Transform2.class, Transform.class);
+ } catch (Exception e) {
+ System.out.println(
+ "Transformation error : " + e.getClass().getName() + "(" + e.getMessage() + ")");
+ } finally {
+ Main.enableCommonRetransformation(false);
+ }
+ t1.sayHi("MultiRetrans");
+ t2.sayHi("MultiRetrans");
+ try {
+ Main.addMultiTransformationResults(VALID_DEFINITION_T2, INVALID_DEFINITION_T1);
+ Main.enableCommonRetransformation(true);
+ Main.doCommonClassRetransformation(Transform.class, Transform2.class);
+ } catch (Exception e) {
+ System.out.println(
+ "Transformation error : " + e.getClass().getName() + "(" + e.getMessage() + ")");
+ } finally {
+ Main.enableCommonRetransformation(false);
+ }
+ t1.sayHi("MultiRetrans");
+ t2.sayHi("MultiRetrans");
+ }
+}
diff --git a/test/930-hello-retransform/build b/test/930-hello-retransform/build
new file mode 100755
index 0000000000..898e2e54a2
--- /dev/null
+++ b/test/930-hello-retransform/build
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-build "$@" --experimental agents
diff --git a/test/930-hello-retransform/expected.txt b/test/930-hello-retransform/expected.txt
new file mode 100644
index 0000000000..4774b81b49
--- /dev/null
+++ b/test/930-hello-retransform/expected.txt
@@ -0,0 +1,2 @@
+hello
+Goodbye
diff --git a/test/930-hello-retransform/info.txt b/test/930-hello-retransform/info.txt
new file mode 100644
index 0000000000..875a5f6ec1
--- /dev/null
+++ b/test/930-hello-retransform/info.txt
@@ -0,0 +1 @@
+Tests basic functions in the jvmti plugin.
diff --git a/test/930-hello-retransform/run b/test/930-hello-retransform/run
new file mode 100755
index 0000000000..4379349cb2
--- /dev/null
+++ b/test/930-hello-retransform/run
@@ -0,0 +1,19 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-run "$@" --experimental agents \
+ --experimental runtime-plugins \
+ --jvmti
diff --git a/test/930-hello-retransform/src/Main.java b/test/930-hello-retransform/src/Main.java
new file mode 100644
index 0000000000..12194c3235
--- /dev/null
+++ b/test/930-hello-retransform/src/Main.java
@@ -0,0 +1,70 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+public class Main {
+
+ /**
+ * base64 encoded class/dex file for
+ * class Transform {
+ * public void sayHi() {
+ * System.out.println("Goodbye");
+ * }
+ * }
+ */
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+ "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
+ "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
+ "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
+ "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" +
+ "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
+ "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0=");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+ "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+ "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
+ "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+ "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
+ "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
+ "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
+ "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
+ "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
+ "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
+ "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+ "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+ "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
+
+ public static void main(String[] args) {
+ System.loadLibrary(args[1]);
+ doTest(new Transform());
+ }
+
+ public static void doTest(Transform t) {
+ t.sayHi();
+ addCommonTransformationResult("Transform", CLASS_BYTES, DEX_BYTES);
+ enableCommonRetransformation(true);
+ doCommonClassRetransformation(Transform.class);
+ t.sayHi();
+ }
+
+ // Transforms the class
+ private static native void doCommonClassRetransformation(Class<?>... target);
+ private static native void enableCommonRetransformation(boolean enable);
+ private static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/930-hello-retransform/src/Transform.java b/test/930-hello-retransform/src/Transform.java
new file mode 100644
index 0000000000..8e8af355da
--- /dev/null
+++ b/test/930-hello-retransform/src/Transform.java
@@ -0,0 +1,28 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Transform {
+ public void sayHi() {
+ // Use lower 'h' to make sure the string will have a different string id
+ // than the transformation (the transformation code is the same except
+ // the actual printed String, which was making the test inacurately passing
+ // in JIT mode when loading the string from the dex cache, as the string ids
+ // of the two different strings were the same).
+ // We know the string ids will be different because lexicographically:
+ // "Goodbye" < "LTransform;" < "hello".
+ System.out.println("hello");
+ }
+}
diff --git a/test/Android.run-test.mk b/test/Android.run-test.mk
index e604c93c72..38b88e44a6 100644
--- a/test/Android.run-test.mk
+++ b/test/Android.run-test.mk
@@ -309,6 +309,7 @@ TEST_ART_BROKEN_TARGET_TESTS += \
927-timers \
928-jni-table \
929-search \
+ 930-hello-retransform \
ifneq (,$(filter target,$(TARGET_TYPES)))
ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,target,$(RUN_TYPES),$(PREBUILD_TYPES), \
diff --git a/test/ti-agent/common_helper.cc b/test/ti-agent/common_helper.cc
index 2c6d3eda00..8799c9188b 100644
--- a/test/ti-agent/common_helper.cc
+++ b/test/ti-agent/common_helper.cc
@@ -18,6 +18,7 @@
#include <stdio.h>
#include <sstream>
+#include <deque>
#include "art_method.h"
#include "jni.h"
@@ -60,17 +61,17 @@ bool JvmtiErrorToException(JNIEnv* env, jvmtiError error) {
return true;
}
-namespace common_redefine {
-static void throwRedefinitionError(jvmtiEnv* jvmti,
- JNIEnv* env,
- jint num_targets,
- jclass* target,
- jvmtiError res) {
+template <bool is_redefine>
+static void throwCommonRedefinitionError(jvmtiEnv* jvmti,
+ JNIEnv* env,
+ jint num_targets,
+ jclass* target,
+ jvmtiError res) {
std::stringstream err;
char* error = nullptr;
jvmti->GetErrorName(res, &error);
- err << "Failed to redefine class";
+ err << "Failed to " << (is_redefine ? "redefine" : "retransform") << " class";
if (num_targets > 1) {
err << "es";
}
@@ -92,6 +93,16 @@ static void throwRedefinitionError(jvmtiEnv* jvmti,
env->ThrowNew(env->FindClass("java/lang/Exception"), message.c_str());
}
+namespace common_redefine {
+
+static void throwRedefinitionError(jvmtiEnv* jvmti,
+ JNIEnv* env,
+ jint num_targets,
+ jclass* target,
+ jvmtiError res) {
+ return throwCommonRedefinitionError<true>(jvmti, env, num_targets, target, res);
+}
+
static void DoMultiClassRedefine(jvmtiEnv* jvmti_env,
JNIEnv* env,
jint num_redefines,
@@ -161,7 +172,7 @@ extern "C" JNIEXPORT void JNICALL Java_Main_doCommonMultiClassRedefinition(
dex_files.data());
}
-// Don't do anything
+// Get all capabilities except those related to retransformation.
jint OnLoad(JavaVM* vm,
char* options ATTRIBUTE_UNUSED,
void* reserved ATTRIBUTE_UNUSED) {
@@ -169,10 +180,148 @@ jint OnLoad(JavaVM* vm,
printf("Unable to get jvmti env!\n");
return 1;
}
- SetAllCapabilities(jvmti_env);
+ jvmtiCapabilities caps;
+ jvmti_env->GetPotentialCapabilities(&caps);
+ caps.can_retransform_classes = 0;
+ caps.can_retransform_any_class = 0;
+ jvmti_env->AddCapabilities(&caps);
return 0;
}
} // namespace common_redefine
+namespace common_retransform {
+
+struct CommonTransformationResult {
+ std::vector<unsigned char> class_bytes;
+ std::vector<unsigned char> dex_bytes;
+
+ CommonTransformationResult(size_t class_size, size_t dex_size)
+ : class_bytes(class_size), dex_bytes(dex_size) {}
+
+ CommonTransformationResult() = default;
+ CommonTransformationResult(CommonTransformationResult&&) = default;
+ CommonTransformationResult(CommonTransformationResult&) = default;
+};
+
+// Map from class name to transformation result.
+std::map<std::string, std::deque<CommonTransformationResult>> gTransformations;
+
+extern "C" JNIEXPORT void JNICALL Java_Main_addCommonTransformationResult(JNIEnv* env,
+ jclass,
+ jstring class_name,
+ jbyteArray class_array,
+ jbyteArray dex_array) {
+ const char* name_chrs = env->GetStringUTFChars(class_name, nullptr);
+ std::string name_str(name_chrs);
+ env->ReleaseStringUTFChars(class_name, name_chrs);
+ CommonTransformationResult trans(env->GetArrayLength(class_array),
+ env->GetArrayLength(dex_array));
+ if (env->ExceptionOccurred()) {
+ return;
+ }
+ env->GetByteArrayRegion(class_array,
+ 0,
+ env->GetArrayLength(class_array),
+ reinterpret_cast<jbyte*>(trans.class_bytes.data()));
+ if (env->ExceptionOccurred()) {
+ return;
+ }
+ env->GetByteArrayRegion(dex_array,
+ 0,
+ env->GetArrayLength(dex_array),
+ reinterpret_cast<jbyte*>(trans.dex_bytes.data()));
+ if (env->ExceptionOccurred()) {
+ return;
+ }
+ if (gTransformations.find(name_str) == gTransformations.end()) {
+ std::deque<CommonTransformationResult> list;
+ gTransformations[name_str] = std::move(list);
+ }
+ gTransformations[name_str].push_back(std::move(trans));
+}
+
+// The hook we are using.
+void JNICALL CommonClassFileLoadHookRetransformable(jvmtiEnv* jvmti_env,
+ JNIEnv* jni_env ATTRIBUTE_UNUSED,
+ jclass class_being_redefined ATTRIBUTE_UNUSED,
+ jobject loader ATTRIBUTE_UNUSED,
+ const char* name,
+ jobject protection_domain ATTRIBUTE_UNUSED,
+ jint class_data_len ATTRIBUTE_UNUSED,
+ const unsigned char* class_dat ATTRIBUTE_UNUSED,
+ jint* new_class_data_len,
+ unsigned char** new_class_data) {
+ std::string name_str(name);
+ if (gTransformations.find(name_str) != gTransformations.end()) {
+ CommonTransformationResult& res = gTransformations[name_str][0];
+ const std::vector<unsigned char>& desired_array = IsJVM() ? res.class_bytes : res.dex_bytes;
+ unsigned char* new_data;
+ jvmti_env->Allocate(desired_array.size(), &new_data);
+ memcpy(new_data, desired_array.data(), desired_array.size());
+ *new_class_data = new_data;
+ *new_class_data_len = desired_array.size();
+ gTransformations[name_str].pop_front();
+ }
+}
+
+extern "C" JNIEXPORT void Java_Main_enableCommonRetransformation(JNIEnv* env,
+ jclass,
+ jboolean enable) {
+ jvmtiError res = jvmti_env->SetEventNotificationMode(enable ? JVMTI_ENABLE : JVMTI_DISABLE,
+ JVMTI_EVENT_CLASS_FILE_LOAD_HOOK,
+ nullptr);
+ if (res != JVMTI_ERROR_NONE) {
+ JvmtiErrorToException(env, res);
+ }
+}
+
+static void throwRetransformationError(jvmtiEnv* jvmti,
+ JNIEnv* env,
+ jint num_targets,
+ jclass* targets,
+ jvmtiError res) {
+ return throwCommonRedefinitionError<false>(jvmti, env, num_targets, targets, res);
+}
+
+static void DoClassRetransformation(jvmtiEnv* jvmti_env, JNIEnv* env, jobjectArray targets) {
+ std::vector<jclass> classes;
+ jint len = env->GetArrayLength(targets);
+ for (jint i = 0; i < len; i++) {
+ classes.push_back(static_cast<jclass>(env->GetObjectArrayElement(targets, i)));
+ }
+ jvmtiError res = jvmti_env->RetransformClasses(len, classes.data());
+ if (res != JVMTI_ERROR_NONE) {
+ throwRetransformationError(jvmti_env, env, len, classes.data(), res);
+ }
+}
+
+// TODO Write something useful.
+extern "C" JNIEXPORT void JNICALL Java_Main_doCommonClassRetransformation(JNIEnv* env,
+ jclass,
+ jobjectArray targets) {
+ DoClassRetransformation(jvmti_env, env, targets);
+}
+
+// Get all capabilities except those related to retransformation.
+jint OnLoad(JavaVM* vm,
+ char* options ATTRIBUTE_UNUSED,
+ void* reserved ATTRIBUTE_UNUSED) {
+ if (vm->GetEnv(reinterpret_cast<void**>(&jvmti_env), JVMTI_VERSION_1_0)) {
+ printf("Unable to get jvmti env!\n");
+ return 1;
+ }
+ SetAllCapabilities(jvmti_env);
+ jvmtiEventCallbacks cb;
+ memset(&cb, 0, sizeof(cb));
+ cb.ClassFileLoadHook = CommonClassFileLoadHookRetransformable;
+ if (jvmti_env->SetEventCallbacks(&cb, sizeof(cb)) != JVMTI_ERROR_NONE) {
+ printf("Unable to set class file load hook cb!\n");
+ return 1;
+ }
+ return 0;
+}
+
+} // namespace common_retransform
+
} // namespace art
diff --git a/test/ti-agent/common_helper.h b/test/ti-agent/common_helper.h
index 642ca03274..8599fc4d6c 100644
--- a/test/ti-agent/common_helper.h
+++ b/test/ti-agent/common_helper.h
@@ -27,6 +27,10 @@ namespace common_redefine {
jint OnLoad(JavaVM* vm, char* options, void* reserved);
} // namespace common_redefine
+namespace common_retransform {
+jint OnLoad(JavaVM* vm, char* options, void* reserved);
+} // namespace common_retransform
+
extern bool RuntimeIsJVM;
diff --git a/test/ti-agent/common_load.cc b/test/ti-agent/common_load.cc
index 521e672330..1b11442092 100644
--- a/test/ti-agent/common_load.cc
+++ b/test/ti-agent/common_load.cc
@@ -64,8 +64,9 @@ AgentLib agents[] = {
{ "916-obsolete-jit", common_redefine::OnLoad, nullptr },
{ "917-fields-transformation", common_redefine::OnLoad, nullptr },
{ "919-obsolete-fields", common_redefine::OnLoad, nullptr },
- { "921-hello-failure", common_redefine::OnLoad, nullptr },
+ { "921-hello-failure", common_retransform::OnLoad, nullptr },
{ "926-multi-obsolescence", common_redefine::OnLoad, nullptr },
+ { "930-hello-retransform", common_retransform::OnLoad, nullptr },
};
static AgentLib* FindAgent(char* name) {