summaryrefslogtreecommitdiff
diff options
context:
space:
mode:
author Treehugger Robot <treehugger-gerrit@google.com> 2017-02-02 21:02:50 +0000
committer Gerrit Code Review <noreply-gerritcodereview@google.com> 2017-02-02 21:02:50 +0000
commit4f5dfb392559feca746ec558e268ce490dcbb88c (patch)
tree50787cf64a7db57c33a2dbbd81e98ec896ed7a22
parentde2e1a69edc4eee833c924f9ffa5ccf25479ebcf (diff)
parent1babae0f39c30e699f8580b6c28b4186aecdf690 (diff)
Merge "Ensure that all redefinition created dex file get on classpath"
-rw-r--r--runtime/openjdkjvmti/ti_class_loader.cc28
-rw-r--r--runtime/openjdkjvmti/ti_class_loader.h5
-rw-r--r--runtime/openjdkjvmti/ti_redefine.cc61
-rw-r--r--runtime/openjdkjvmti/ti_redefine.h7
-rwxr-xr-xtest/944-transform-classloaders/build17
-rw-r--r--test/944-transform-classloaders/classloader.cc44
-rw-r--r--test/944-transform-classloaders/expected.txt5
-rw-r--r--test/944-transform-classloaders/info.txt7
-rwxr-xr-xtest/944-transform-classloaders/run17
-rw-r--r--test/944-transform-classloaders/src/CommonClassDefinition.java27
-rw-r--r--test/944-transform-classloaders/src/Main.java265
-rw-r--r--test/944-transform-classloaders/src/Transform.java28
-rw-r--r--test/944-transform-classloaders/src/Transform2.java21
-rw-r--r--test/Android.bp1
-rw-r--r--test/ti-agent/common_load.cc1
15 files changed, 516 insertions, 18 deletions
diff --git a/runtime/openjdkjvmti/ti_class_loader.cc b/runtime/openjdkjvmti/ti_class_loader.cc
index c2f17924da..afec0bfac0 100644
--- a/runtime/openjdkjvmti/ti_class_loader.cc
+++ b/runtime/openjdkjvmti/ti_class_loader.cc
@@ -62,7 +62,7 @@ bool ClassLoaderHelper::AddToClassLoader(art::Thread* self,
art::Handle<art::mirror::ClassLoader> loader,
const art::DexFile* dex_file) {
art::ScopedObjectAccessUnchecked soa(self);
- art::StackHandleScope<2> hs(self);
+ art::StackHandleScope<3> hs(self);
if (art::ClassLinker::IsBootClassLoader(soa, loader.Get())) {
art::Runtime::Current()->GetClassLinker()->AppendToBootClassPath(self, *dex_file);
return true;
@@ -72,8 +72,9 @@ bool ClassLoaderHelper::AddToClassLoader(art::Thread* self,
if (java_dex_file_obj.IsNull()) {
return false;
}
+ art::Handle<art::mirror::LongArray> old_cookie(hs.NewHandle(GetDexFileCookie(java_dex_file_obj)));
art::Handle<art::mirror::LongArray> cookie(hs.NewHandle(
- AllocateNewDexFileCookie(self, java_dex_file_obj, dex_file)));
+ AllocateNewDexFileCookie(self, old_cookie, dex_file)));
if (cookie.IsNull()) {
return false;
}
@@ -99,12 +100,8 @@ void ClassLoaderHelper::UpdateJavaDexFile(art::ObjPtr<art::mirror::Object> java_
}
}
-// TODO Really wishing I had that mirror of java.lang.DexFile now.
-art::ObjPtr<art::mirror::LongArray> ClassLoaderHelper::AllocateNewDexFileCookie(
- art::Thread* self,
- art::Handle<art::mirror::Object> java_dex_file_obj,
- const art::DexFile* dex_file) {
- art::StackHandleScope<2> hs(self);
+art::ObjPtr<art::mirror::LongArray> ClassLoaderHelper::GetDexFileCookie(
+ art::Handle<art::mirror::Object> java_dex_file_obj) {
// mCookie is nulled out if the DexFile has been closed but mInternalCookie sticks around until
// the object is finalized. Since they always point to the same array if mCookie is not null we
// just use the mInternalCookie field. We will update one or both of these fields later.
@@ -113,9 +110,15 @@ art::ObjPtr<art::mirror::LongArray> ClassLoaderHelper::AllocateNewDexFileCookie(
"mInternalCookie", "Ljava/lang/Object;");
// TODO Add check that mCookie is either null or same as mInternalCookie
CHECK(internal_cookie_field != nullptr);
- art::Handle<art::mirror::LongArray> cookie(
- hs.NewHandle(internal_cookie_field->GetObject(java_dex_file_obj.Get())->AsLongArray()));
- // TODO Maybe make these non-fatal.
+ return internal_cookie_field->GetObject(java_dex_file_obj.Get())->AsLongArray();
+}
+
+// TODO Really wishing I had that mirror of java.lang.DexFile now.
+art::ObjPtr<art::mirror::LongArray> ClassLoaderHelper::AllocateNewDexFileCookie(
+ art::Thread* self,
+ art::Handle<art::mirror::LongArray> cookie,
+ const art::DexFile* dex_file) {
+ art::StackHandleScope<1> hs(self);
CHECK(cookie.Get() != nullptr);
CHECK_GE(cookie->GetLength(), 1);
art::Handle<art::mirror::LongArray> new_cookie(
@@ -128,8 +131,9 @@ art::ObjPtr<art::mirror::LongArray> ClassLoaderHelper::AllocateNewDexFileCookie(
// TODO Should I clear this field?
// TODO This is a really crappy thing here with the first element being different.
new_cookie->SetWithoutChecks<false>(0, cookie->GetWithoutChecks(0));
+ // This must match the casts in runtime/native/dalvik_system_DexFile.cc:ConvertDexFilesToJavaArray
new_cookie->SetWithoutChecks<false>(
- 1, static_cast<int64_t>(reinterpret_cast<intptr_t>(dex_file)));
+ 1, static_cast<int64_t>(reinterpret_cast<uintptr_t>(dex_file)));
new_cookie->Memcpy(2, cookie.Get(), 1, cookie->GetLength() - 1);
return new_cookie.Get();
}
diff --git a/runtime/openjdkjvmti/ti_class_loader.h b/runtime/openjdkjvmti/ti_class_loader.h
index 17ed0eb196..1ac49886cb 100644
--- a/runtime/openjdkjvmti/ti_class_loader.h
+++ b/runtime/openjdkjvmti/ti_class_loader.h
@@ -82,9 +82,12 @@ class ClassLoaderHelper {
art::Thread* self, art::Handle<art::mirror::ClassLoader> loader)
REQUIRES_SHARED(art::Locks::mutator_lock_);
+ static art::ObjPtr<art::mirror::LongArray> GetDexFileCookie(
+ art::Handle<art::mirror::Object> java_dex_file) REQUIRES_SHARED(art::Locks::mutator_lock_);
+
static art::ObjPtr<art::mirror::LongArray> AllocateNewDexFileCookie(
art::Thread* self,
- art::Handle<art::mirror::Object> java_dex_file,
+ art::Handle<art::mirror::LongArray> old_dex_file_cookie,
const art::DexFile* new_dex_file) REQUIRES_SHARED(art::Locks::mutator_lock_);
static void UpdateJavaDexFile(art::ObjPtr<art::mirror::Object> java_dex_file,
diff --git a/runtime/openjdkjvmti/ti_redefine.cc b/runtime/openjdkjvmti/ti_redefine.cc
index 4b8108accf..eb4c2f9f21 100644
--- a/runtime/openjdkjvmti/ti_redefine.cc
+++ b/runtime/openjdkjvmti/ti_redefine.cc
@@ -701,6 +701,60 @@ class RedefinitionDataHolder {
DISALLOW_COPY_AND_ASSIGN(RedefinitionDataHolder);
};
+// Looks through the previously allocated cookies to see if we need to update them with another new
+// dexfile. This is so that even if multiple classes with the same classloader are redefined at
+// once they are all added to the classloader.
+bool Redefiner::ClassRedefinition::AllocateAndRememberNewDexFileCookie(
+ int32_t klass_index,
+ art::Handle<art::mirror::ClassLoader> source_class_loader,
+ art::Handle<art::mirror::Object> dex_file_obj,
+ /*out*/RedefinitionDataHolder* holder) {
+ art::StackHandleScope<2> hs(driver_->self_);
+ art::MutableHandle<art::mirror::LongArray> old_cookie(
+ hs.NewHandle<art::mirror::LongArray>(nullptr));
+ bool has_older_cookie = false;
+ // See if we already have a cookie that a previous redefinition got from the same classloader.
+ for (int32_t i = 0; i < klass_index; i++) {
+ if (holder->GetSourceClassLoader(i) == source_class_loader.Get()) {
+ // Since every instance of this classloader should have the same cookie associated with it we
+ // can stop looking here.
+ has_older_cookie = true;
+ old_cookie.Assign(holder->GetNewDexFileCookie(i));
+ break;
+ }
+ }
+ if (old_cookie.IsNull()) {
+ // No older cookie. Get it directly from the dex_file_obj
+ // We should not have seen this classloader elsewhere.
+ CHECK(!has_older_cookie);
+ old_cookie.Assign(ClassLoaderHelper::GetDexFileCookie(dex_file_obj));
+ }
+ // Use the old cookie to generate the new one with the new DexFile* added in.
+ art::Handle<art::mirror::LongArray>
+ new_cookie(hs.NewHandle(ClassLoaderHelper::AllocateNewDexFileCookie(driver_->self_,
+ old_cookie,
+ dex_file_.get())));
+ // Make sure the allocation worked.
+ if (new_cookie.IsNull()) {
+ return false;
+ }
+
+ // Save the cookie.
+ holder->SetNewDexFileCookie(klass_index, new_cookie.Get());
+ // If there are other copies of this same classloader we need to make sure that we all have the
+ // same cookie.
+ if (has_older_cookie) {
+ for (int32_t i = 0; i < klass_index; i++) {
+ // We will let the GC take care of the cookie we allocated for this one.
+ if (holder->GetSourceClassLoader(i) == source_class_loader.Get()) {
+ holder->SetNewDexFileCookie(i, new_cookie.Get());
+ }
+ }
+ }
+
+ return true;
+}
+
bool Redefiner::ClassRedefinition::FinishRemainingAllocations(
int32_t klass_index, /*out*/RedefinitionDataHolder* holder) {
art::ScopedObjectAccessUnchecked soa(driver_->self_);
@@ -719,11 +773,8 @@ bool Redefiner::ClassRedefinition::FinishRemainingAllocations(
RecordFailure(ERR(INTERNAL), "Unable to find dex file!");
return false;
}
- holder->SetNewDexFileCookie(klass_index,
- ClassLoaderHelper::AllocateNewDexFileCookie(driver_->self_,
- dex_file_obj,
- dex_file_.get()).Ptr());
- if (holder->GetNewDexFileCookie(klass_index) == nullptr) {
+ // Allocate the new dex file cookie.
+ if (!AllocateAndRememberNewDexFileCookie(klass_index, loader, dex_file_obj, holder)) {
driver_->self_->AssertPendingOOMException();
driver_->self_->ClearException();
RecordFailure(ERR(OUT_OF_MEMORY), "Unable to allocate dex file array for class loader");
diff --git a/runtime/openjdkjvmti/ti_redefine.h b/runtime/openjdkjvmti/ti_redefine.h
index 5bcaef8971..5aa7dde55c 100644
--- a/runtime/openjdkjvmti/ti_redefine.h
+++ b/runtime/openjdkjvmti/ti_redefine.h
@@ -145,6 +145,13 @@ class Redefiner {
bool FinishRemainingAllocations(int32_t klass_index, /*out*/RedefinitionDataHolder* holder)
REQUIRES_SHARED(art::Locks::mutator_lock_);
+ bool AllocateAndRememberNewDexFileCookie(
+ int32_t klass_index,
+ art::Handle<art::mirror::ClassLoader> source_class_loader,
+ art::Handle<art::mirror::Object> dex_file_obj,
+ /*out*/RedefinitionDataHolder* holder)
+ REQUIRES_SHARED(art::Locks::mutator_lock_);
+
void FindAndAllocateObsoleteMethods(art::mirror::Class* art_klass)
REQUIRES(art::Locks::mutator_lock_);
diff --git a/test/944-transform-classloaders/build b/test/944-transform-classloaders/build
new file mode 100755
index 0000000000..898e2e54a2
--- /dev/null
+++ b/test/944-transform-classloaders/build
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-build "$@" --experimental agents
diff --git a/test/944-transform-classloaders/classloader.cc b/test/944-transform-classloaders/classloader.cc
new file mode 100644
index 0000000000..5fbd8e11c9
--- /dev/null
+++ b/test/944-transform-classloaders/classloader.cc
@@ -0,0 +1,44 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "base/macros.h"
+#include "jni.h"
+#include "mirror/class-inl.h"
+#include "openjdkjvmti/jvmti.h"
+#include "ScopedLocalRef.h"
+
+#include "ti-agent/common_helper.h"
+#include "ti-agent/common_load.h"
+
+namespace art {
+namespace Test944TransformClassloaders {
+
+
+extern "C" JNIEXPORT jlong JNICALL Java_Main_getDexFilePointer(JNIEnv* env, jclass, jclass klass) {
+ if (Runtime::Current() == nullptr) {
+ env->ThrowNew(env->FindClass("java/lang/Exception"),
+ "We do not seem to be running in ART! Unable to get dex file.");
+ return 0;
+ }
+ ScopedObjectAccess soa(env);
+ // This sequence of casts must be the same as those done in
+ // runtime/native/dalvik_system_DexFile.cc in order to ensure that we get the same results.
+ return static_cast<jlong>(reinterpret_cast<uintptr_t>(
+ &soa.Decode<mirror::Class>(klass)->GetDexFile()));
+}
+
+} // namespace Test944TransformClassloaders
+} // namespace art
diff --git a/test/944-transform-classloaders/expected.txt b/test/944-transform-classloaders/expected.txt
new file mode 100644
index 0000000000..79522479dd
--- /dev/null
+++ b/test/944-transform-classloaders/expected.txt
@@ -0,0 +1,5 @@
+hello
+hello2
+Goodbye
+Goodbye2
+Passed
diff --git a/test/944-transform-classloaders/info.txt b/test/944-transform-classloaders/info.txt
new file mode 100644
index 0000000000..9155564d62
--- /dev/null
+++ b/test/944-transform-classloaders/info.txt
@@ -0,0 +1,7 @@
+Tests that redefined dex files are stored in the appropriate classloader.
+
+This test cannot run on the RI.
+
+We use reflection with setAccessible(true) to examine the private internals of
+classloaders. Changes to the internal operation or definition of
+dalvik.system.BaseDexClassLoader might cause this test to fail.
diff --git a/test/944-transform-classloaders/run b/test/944-transform-classloaders/run
new file mode 100755
index 0000000000..c6e62ae6cd
--- /dev/null
+++ b/test/944-transform-classloaders/run
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-run "$@" --jvmti
diff --git a/test/944-transform-classloaders/src/CommonClassDefinition.java b/test/944-transform-classloaders/src/CommonClassDefinition.java
new file mode 100644
index 0000000000..62602a02e9
--- /dev/null
+++ b/test/944-transform-classloaders/src/CommonClassDefinition.java
@@ -0,0 +1,27 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class CommonClassDefinition {
+ public final Class<?> target;
+ public final byte[] class_file_bytes;
+ public final byte[] dex_file_bytes;
+
+ CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+ this.target = target;
+ this.class_file_bytes = class_file_bytes;
+ this.dex_file_bytes = dex_file_bytes;
+ }
+}
diff --git a/test/944-transform-classloaders/src/Main.java b/test/944-transform-classloaders/src/Main.java
new file mode 100644
index 0000000000..4911e00a70
--- /dev/null
+++ b/test/944-transform-classloaders/src/Main.java
@@ -0,0 +1,265 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Arrays;
+import java.util.ArrayList;
+import java.util.Base64;
+import java.lang.reflect.*;
+public class Main {
+
+ /**
+ * base64 encoded class/dex file for
+ * class Transform {
+ * public void sayHi() {
+ * System.out.println("Goodbye");
+ * }
+ * }
+ */
+ private static CommonClassDefinition TRANSFORM_DEFINITION = new CommonClassDefinition(
+ Transform.class,
+ Base64.getDecoder().decode(
+ "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+ "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
+ "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
+ "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
+ "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" +
+ "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
+ "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0="),
+ Base64.getDecoder().decode(
+ "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+ "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+ "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
+ "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+ "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
+ "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
+ "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
+ "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
+ "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
+ "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
+ "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+ "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+ "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA="));
+
+ /**
+ * base64 encoded class/dex file for
+ * class Transform2 {
+ * public void sayHi() {
+ * System.out.println("Goodbye2");
+ * }
+ * }
+ */
+ private static CommonClassDefinition TRANSFORM2_DEFINITION = new CommonClassDefinition(
+ Transform2.class,
+ Base64.getDecoder().decode(
+ "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+ "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA9UcmFuc2Zvcm0yLmphdmEM" +
+ "AAcACAcAFgwAFwAYAQAIR29vZGJ5ZTIHABkMABoAGwEAClRyYW5zZm9ybTIBABBqYXZhL2xhbmcv" +
+ "T2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEA" +
+ "E2phdmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAA" +
+ "BQAGAAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAAQABAAsA" +
+ "CAABAAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAADAAgABAABAAwAAAACAA0="),
+ Base64.getDecoder().decode(
+ "ZGV4CjAzNQABX6vL8OT7aGLjbzFBEfCM9Aaz+zzGzVnQAgAAcAAAAHhWNBIAAAAAAAAAADACAAAO" +
+ "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACwAQAAIAEAAGIB" +
+ "AABqAQAAdAEAAIIBAACZAQAArQEAAMEBAADVAQAA5gEAAOkBAADtAQAAAQIAAAYCAAAPAgAAAgAA" +
+ "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+ "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAACECAAAA" +
+ "AAAAAQABAAEAAAAWAgAABAAAAHAQAwAAAA4AAwABAAIAAAAbAgAACQAAAGIAAAAbAQEAAABuIAIA" +
+ "EAAOAAAAAQAAAAMABjxpbml0PgAIR29vZGJ5ZTIADExUcmFuc2Zvcm0yOwAVTGphdmEvaW8vUHJp" +
+ "bnRTdHJlYW07ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwASTGphdmEv" +
+ "bGFuZy9TeXN0ZW07AA9UcmFuc2Zvcm0yLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTQuMjQA" +
+ "A291dAAHcHJpbnRsbgAFc2F5SGkAAQAHDgADAAcOhwAAAAEBAICABKACAQG4AgANAAAAAAAAAAEA" +
+ "AAAAAAAAAQAAAA4AAABwAAAAAgAAAAYAAACoAAAAAwAAAAIAAADAAAAABAAAAAEAAADYAAAABQAA" +
+ "AAQAAADgAAAABgAAAAEAAAAAAQAAASAAAAIAAAAgAQAAARAAAAEAAABcAQAAAiAAAA4AAABiAQAA" +
+ "AyAAAAIAAAAWAgAAACAAAAEAAAAhAgAAABAAAAEAAAAwAgAA"));
+
+ public static void main(String[] args) throws Exception {
+ doTest();
+ System.out.println("Passed");
+ }
+
+ private static void checkIsInstance(Class<?> klass, Object o) throws Exception {
+ if (!klass.isInstance(o)) {
+ throw new Exception(klass + " is not the class of " + o);
+ }
+ }
+
+ private static boolean arrayContains(long[] arr, long value) {
+ if (arr == null) {
+ return false;
+ }
+ for (int i = 0; i < arr.length; i++) {
+ if (arr[i] == value) {
+ return true;
+ }
+ }
+ return false;
+ }
+
+ /**
+ * Checks that we can find the dex-file for the given class in its classloader.
+ *
+ * Throws if it fails.
+ */
+ private static void checkDexFileInClassLoader(Class<?> klass) throws Exception {
+ // If all the android BCP classes were availible when compiling this test and access checks
+ // weren't a thing this function would be written as follows:
+ //
+ // long dexFilePtr = getDexFilePointer(klass);
+ // dalvik.system.BaseDexClassLoader loader =
+ // (dalvik.system.BaseDexClassLoader)klass.getClassLoader();
+ // dalvik.system.DexPathList pathListValue = loader.pathList;
+ // dalvik.system.DexPathList.Element[] elementArrayValue = pathListValue.dexElements;
+ // int array_length = elementArrayValue.length;
+ // for (int i = 0; i < array_length; i++) {
+ // dalvik.system.DexPathList.Element curElement = elementArrayValue[i];
+ // dalvik.system.DexFile curDexFile = curElement.dexFile;
+ // if (curDexFile == null) {
+ // continue;
+ // }
+ // long[] curCookie = (long[])curDexFile.mCookie;
+ // long[] curInternalCookie = (long[])curDexFile.mInternalCookie;
+ // if (arrayContains(curCookie, dexFilePtr) || arrayContains(curInternalCookie, dexFilePtr)) {
+ // return;
+ // }
+ // }
+ // throw new Exception(
+ // "Unable to find dex file pointer " + dexFilePtr + " in class loader for " + klass);
+
+ // Get all the fields and classes we need by reflection.
+ Class<?> baseDexClassLoaderClass = Class.forName("dalvik.system.BaseDexClassLoader");
+ Field pathListField = baseDexClassLoaderClass.getDeclaredField("pathList");
+
+ Class<?> dexPathListClass = Class.forName("dalvik.system.DexPathList");
+ Field elementArrayField = dexPathListClass.getDeclaredField("dexElements");
+
+ Class<?> dexPathListElementClass = Class.forName("dalvik.system.DexPathList$Element");
+ Field dexFileField = dexPathListElementClass.getDeclaredField("dexFile");
+
+ Class<?> dexFileClass = Class.forName("dalvik.system.DexFile");
+ Field dexFileCookieField = dexFileClass.getDeclaredField("mCookie");
+ Field dexFileInternalCookieField = dexFileClass.getDeclaredField("mInternalCookie");
+
+ // Make all the fields accessible
+ AccessibleObject.setAccessible(new AccessibleObject[] { pathListField,
+ elementArrayField,
+ dexFileField,
+ dexFileCookieField,
+ dexFileInternalCookieField }, true);
+
+ long dexFilePtr = getDexFilePointer(klass);
+
+ ClassLoader loader = klass.getClassLoader();
+ checkIsInstance(baseDexClassLoaderClass, loader);
+ // DexPathList pathListValue = ((BaseDexClassLoader) loader).pathList;
+ Object pathListValue = pathListField.get(loader);
+
+ checkIsInstance(dexPathListClass, pathListValue);
+
+ // DexPathList.Element[] elementArrayValue = pathListValue.dexElements;
+ Object elementArrayValue = elementArrayField.get(pathListValue);
+ if (!elementArrayValue.getClass().isArray() ||
+ elementArrayValue.getClass().getComponentType() != dexPathListElementClass) {
+ throw new Exception("elementArrayValue is not an " + dexPathListElementClass + " array!");
+ }
+ // int array_length = elementArrayValue.length;
+ int array_length = Array.getLength(elementArrayValue);
+ for (int i = 0; i < array_length; i++) {
+ // DexPathList.Element curElement = elementArrayValue[i];
+ Object curElement = Array.get(elementArrayValue, i);
+ checkIsInstance(dexPathListElementClass, curElement);
+
+ // DexFile curDexFile = curElement.dexFile;
+ Object curDexFile = dexFileField.get(curElement);
+ if (curDexFile == null) {
+ continue;
+ }
+ checkIsInstance(dexFileClass, curDexFile);
+
+ // long[] curCookie = (long[])curDexFile.mCookie;
+ long[] curCookie = (long[])dexFileCookieField.get(curDexFile);
+ // long[] curInternalCookie = (long[])curDexFile.mInternalCookie;
+ long[] curInternalCookie = (long[])dexFileInternalCookieField.get(curDexFile);
+
+ if (arrayContains(curCookie, dexFilePtr) || arrayContains(curInternalCookie, dexFilePtr)) {
+ return;
+ }
+ }
+ throw new Exception(
+ "Unable to find dex file pointer " + dexFilePtr + " in class loader for " + klass);
+ }
+
+ private static void doTest() throws Exception {
+ Transform t = new Transform();
+ Transform2 t2 = new Transform2();
+
+ long initial_t1_dex = getDexFilePointer(Transform.class);
+ long initial_t2_dex = getDexFilePointer(Transform2.class);
+ if (initial_t2_dex != initial_t1_dex) {
+ throw new Exception("The classes " + Transform.class + " and " + Transform2.class + " " +
+ "have different initial dex files!");
+ }
+ checkDexFileInClassLoader(Transform.class);
+ checkDexFileInClassLoader(Transform2.class);
+
+ // Make sure they are loaded
+ t.sayHi();
+ t2.sayHi();
+ // Redefine both of the classes.
+ doMultiClassRedefinition(TRANSFORM_DEFINITION, TRANSFORM2_DEFINITION);
+ // Make sure we actually transformed them!
+ t.sayHi();
+ t2.sayHi();
+
+ long final_t1_dex = getDexFilePointer(Transform.class);
+ long final_t2_dex = getDexFilePointer(Transform2.class);
+ if (final_t2_dex == final_t1_dex) {
+ throw new Exception("The classes " + Transform.class + " and " + Transform2.class + " " +
+ "have the same initial dex files!");
+ } else if (final_t1_dex == initial_t1_dex) {
+ throw new Exception("The class " + Transform.class + " did not get a new dex file!");
+ } else if (final_t2_dex == initial_t2_dex) {
+ throw new Exception("The class " + Transform2.class + " did not get a new dex file!");
+ }
+ // Check to make sure the new dex files are in the class loader.
+ checkDexFileInClassLoader(Transform.class);
+ checkDexFileInClassLoader(Transform2.class);
+ }
+
+ private static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+ ArrayList<Class<?>> classes = new ArrayList<>();
+ ArrayList<byte[]> class_files = new ArrayList<>();
+ ArrayList<byte[]> dex_files = new ArrayList<>();
+
+ for (CommonClassDefinition d : defs) {
+ classes.add(d.target);
+ class_files.add(d.class_file_bytes);
+ dex_files.add(d.dex_file_bytes);
+ }
+ doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+ class_files.toArray(new byte[0][]),
+ dex_files.toArray(new byte[0][]));
+ }
+
+ // Gets the 'long' (really a native pointer) that is stored in the ClassLoader representing the
+ // DexFile a class is loaded from. This is converted from the DexFile* in the same way it is done
+ // in runtime/native/dalvik_system_DexFile.cc
+ private static native long getDexFilePointer(Class<?> target);
+ // Transforms the classes
+ private static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+ byte[][] classfiles,
+ byte[][] dexfiles);
+}
diff --git a/test/944-transform-classloaders/src/Transform.java b/test/944-transform-classloaders/src/Transform.java
new file mode 100644
index 0000000000..8e8af355da
--- /dev/null
+++ b/test/944-transform-classloaders/src/Transform.java
@@ -0,0 +1,28 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Transform {
+ public void sayHi() {
+ // Use lower 'h' to make sure the string will have a different string id
+ // than the transformation (the transformation code is the same except
+ // the actual printed String, which was making the test inacurately passing
+ // in JIT mode when loading the string from the dex cache, as the string ids
+ // of the two different strings were the same).
+ // We know the string ids will be different because lexicographically:
+ // "Goodbye" < "LTransform;" < "hello".
+ System.out.println("hello");
+ }
+}
diff --git a/test/944-transform-classloaders/src/Transform2.java b/test/944-transform-classloaders/src/Transform2.java
new file mode 100644
index 0000000000..eb22842184
--- /dev/null
+++ b/test/944-transform-classloaders/src/Transform2.java
@@ -0,0 +1,21 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Transform2 {
+ public void sayHi() {
+ System.out.println("hello2");
+ }
+}
diff --git a/test/Android.bp b/test/Android.bp
index 1070645040..d3244a683a 100644
--- a/test/Android.bp
+++ b/test/Android.bp
@@ -273,6 +273,7 @@ art_cc_defaults {
"931-agent-thread/agent_thread.cc",
"933-misc-events/misc_events.cc",
"936-search-onload/search_onload.cc",
+ "944-transform-classloaders/classloader.cc",
],
shared_libs: [
"libbase",
diff --git a/test/ti-agent/common_load.cc b/test/ti-agent/common_load.cc
index 008e2e5672..c5a93568c6 100644
--- a/test/ti-agent/common_load.cc
+++ b/test/ti-agent/common_load.cc
@@ -121,6 +121,7 @@ static AgentLib agents[] = {
{ "941-recursive-obsolete-jit", common_redefine::OnLoad, nullptr },
{ "942-private-recursive", common_redefine::OnLoad, nullptr },
{ "943-private-recursive-jit", common_redefine::OnLoad, nullptr },
+ { "944-transform-classloaders", common_redefine::OnLoad, nullptr },
};
static AgentLib* FindAgent(char* name) {