Merge "Clean up profman arg checking"
diff --git a/build/Android.gtest.mk b/build/Android.gtest.mk
index 5c49f19..d376f29 100644
--- a/build/Android.gtest.mk
+++ b/build/Android.gtest.mk
@@ -92,7 +92,7 @@
ART_GTEST_class_table_test_DEX_DEPS := XandY
ART_GTEST_compiler_driver_test_DEX_DEPS := AbstractMethod StaticLeafMethods ProfileTestMultiDex
ART_GTEST_dex_cache_test_DEX_DEPS := Main Packages MethodTypes
-ART_GTEST_dex_file_test_DEX_DEPS := GetMethodSignature Main Nested
+ART_GTEST_dex_file_test_DEX_DEPS := GetMethodSignature Main Nested MultiDex
ART_GTEST_dex2oat_test_DEX_DEPS := $(ART_GTEST_dex2oat_environment_tests_DEX_DEPS) Statics VerifierDeps
ART_GTEST_exception_test_DEX_DEPS := ExceptionHandle
ART_GTEST_image_test_DEX_DEPS := ImageLayoutA ImageLayoutB
@@ -102,6 +102,7 @@
ART_GTEST_jni_internal_test_DEX_DEPS := AllFields StaticLeafMethods
ART_GTEST_oat_file_assistant_test_DEX_DEPS := $(ART_GTEST_dex2oat_environment_tests_DEX_DEPS)
ART_GTEST_dexoptanalyzer_test_DEX_DEPS := $(ART_GTEST_dex2oat_environment_tests_DEX_DEPS)
+ART_GTEST_image_space_test_DEX_DEPS := $(ART_GTEST_dex2oat_environment_tests_DEX_DEPS)
ART_GTEST_oat_file_test_DEX_DEPS := Main MultiDex
ART_GTEST_oat_test_DEX_DEPS := Main
ART_GTEST_object_test_DEX_DEPS := ProtoCompare ProtoCompare2 StaticsFromCode XandY
@@ -146,6 +147,11 @@
$(ART_GTEST_dex2oat_environment_tests_TARGET_DEPS) \
dexoptanalyzerd
+ART_GTEST_image_space_test_HOST_DEPS := \
+ $(ART_GTEST_dex2oat_environment_tests_HOST_DEPS)
+ART_GTEST_image_space_test_TARGET_DEPS := \
+ $(ART_GTEST_dex2oat_environment_tests_TARGET_DEPS)
+
ART_GTEST_dex2oat_test_HOST_DEPS := \
$(ART_GTEST_dex2oat_environment_tests_HOST_DEPS)
ART_GTEST_dex2oat_test_TARGET_DEPS := \
@@ -627,6 +633,9 @@
ART_GTEST_dexoptanalyzer_test_DEX_DEPS :=
ART_GTEST_dexoptanalyzer_test_HOST_DEPS :=
ART_GTEST_dexoptanalyzer_test_TARGET_DEPS :=
+ART_GTEST_image_space_test_DEX_DEPS :=
+ART_GTEST_image_space_test_HOST_DEPS :=
+ART_GTEST_image_space_test_TARGET_DEPS :=
ART_GTEST_dex2oat_test_DEX_DEPS :=
ART_GTEST_dex2oat_test_HOST_DEPS :=
ART_GTEST_dex2oat_test_TARGET_DEPS :=
diff --git a/compiler/compiler.h b/compiler/compiler.h
index 908d366..2ca0b77 100644
--- a/compiler/compiler.h
+++ b/compiler/compiler.h
@@ -27,7 +27,6 @@
class JitCodeCache;
}
namespace mirror {
- class ClassLoader;
class DexCache;
}
@@ -64,7 +63,7 @@
InvokeType invoke_type,
uint16_t class_def_idx,
uint32_t method_idx,
- Handle<mirror::ClassLoader> class_loader,
+ jobject class_loader,
const DexFile& dex_file,
Handle<mirror::DexCache> dex_cache) const = 0;
diff --git a/compiler/dex/dex_to_dex_compiler.cc b/compiler/dex/dex_to_dex_compiler.cc
index 76aeaa5..d4f6545 100644
--- a/compiler/dex/dex_to_dex_compiler.cc
+++ b/compiler/dex/dex_to_dex_compiler.cc
@@ -284,13 +284,16 @@
}
uint32_t method_idx = is_range ? inst->VRegB_3rc() : inst->VRegB_35c();
ScopedObjectAccess soa(Thread::Current());
+ StackHandleScope<1> hs(soa.Self());
+ Handle<mirror::ClassLoader> class_loader(hs.NewHandle(
+ soa.Decode<mirror::ClassLoader>(unit_.GetClassLoader())));
ClassLinker* class_linker = unit_.GetClassLinker();
ArtMethod* resolved_method = class_linker->ResolveMethod<ClassLinker::kForceICCECheck>(
GetDexFile(),
method_idx,
unit_.GetDexCache(),
- unit_.GetClassLoader(),
+ class_loader,
/* referrer */ nullptr,
kVirtual);
@@ -327,7 +330,7 @@
InvokeType invoke_type ATTRIBUTE_UNUSED,
uint16_t class_def_idx,
uint32_t method_idx,
- Handle<mirror::ClassLoader> class_loader,
+ jobject class_loader,
const DexFile& dex_file,
DexToDexCompilationLevel dex_to_dex_compilation_level) {
DCHECK(driver != nullptr);
diff --git a/compiler/dex/dex_to_dex_compiler.h b/compiler/dex/dex_to_dex_compiler.h
index 00c596d..0a00d45 100644
--- a/compiler/dex/dex_to_dex_compiler.h
+++ b/compiler/dex/dex_to_dex_compiler.h
@@ -18,7 +18,6 @@
#define ART_COMPILER_DEX_DEX_TO_DEX_COMPILER_H_
#include "dex_file.h"
-#include "handle.h"
#include "invoke_type.h"
namespace art {
@@ -26,10 +25,6 @@
class CompiledMethod;
class CompilerDriver;
-namespace mirror {
-class ClassLoader;
-} // namespace mirror
-
namespace optimizer {
enum class DexToDexCompilationLevel {
@@ -45,7 +40,7 @@
InvokeType invoke_type,
uint16_t class_def_idx,
uint32_t method_idx,
- Handle<mirror::ClassLoader> class_loader,
+ jobject class_loader,
const DexFile& dex_file,
DexToDexCompilationLevel dex_to_dex_compilation_level);
diff --git a/compiler/driver/compiler_driver-inl.h b/compiler/driver/compiler_driver-inl.h
index 5823306..f296851 100644
--- a/compiler/driver/compiler_driver-inl.h
+++ b/compiler/driver/compiler_driver-inl.h
@@ -31,12 +31,17 @@
namespace art {
+inline mirror::ClassLoader* CompilerDriver::GetClassLoader(const ScopedObjectAccess& soa,
+ const DexCompilationUnit* mUnit) {
+ return soa.Decode<mirror::ClassLoader>(mUnit->GetClassLoader()).Ptr();
+}
+
inline mirror::Class* CompilerDriver::ResolveClass(
const ScopedObjectAccess& soa, Handle<mirror::DexCache> dex_cache,
Handle<mirror::ClassLoader> class_loader, dex::TypeIndex cls_index,
const DexCompilationUnit* mUnit) {
DCHECK_EQ(dex_cache->GetDexFile(), mUnit->GetDexFile());
- DCHECK_EQ(class_loader.Get(), mUnit->GetClassLoader().Get());
+ DCHECK_EQ(class_loader.Get(), GetClassLoader(soa, mUnit));
mirror::Class* cls = mUnit->GetClassLinker()->ResolveType(
*mUnit->GetDexFile(), cls_index, dex_cache, class_loader);
DCHECK_EQ(cls == nullptr, soa.Self()->IsExceptionPending());
@@ -51,7 +56,7 @@
const ScopedObjectAccess& soa, Handle<mirror::DexCache> dex_cache,
Handle<mirror::ClassLoader> class_loader, const DexCompilationUnit* mUnit) {
DCHECK_EQ(dex_cache->GetDexFile(), mUnit->GetDexFile());
- DCHECK_EQ(class_loader.Get(), mUnit->GetClassLoader().Get());
+ DCHECK_EQ(class_loader.Get(), GetClassLoader(soa, mUnit));
const DexFile::MethodId& referrer_method_id =
mUnit->GetDexFile()->GetMethodId(mUnit->GetDexMethodIndex());
return ResolveClass(soa, dex_cache, class_loader, referrer_method_id.class_idx_, mUnit);
@@ -82,7 +87,7 @@
const ScopedObjectAccess& soa, Handle<mirror::DexCache> dex_cache,
Handle<mirror::ClassLoader> class_loader, const DexCompilationUnit* mUnit,
uint32_t field_idx, bool is_static) {
- DCHECK_EQ(class_loader.Get(), mUnit->GetClassLoader().Get());
+ DCHECK_EQ(class_loader.Get(), GetClassLoader(soa, mUnit));
return ResolveFieldWithDexFile(soa, dex_cache, class_loader, mUnit->GetDexFile(), field_idx,
is_static);
}
@@ -134,7 +139,7 @@
ScopedObjectAccess& soa, Handle<mirror::DexCache> dex_cache,
Handle<mirror::ClassLoader> class_loader, const DexCompilationUnit* mUnit,
uint32_t method_idx, InvokeType invoke_type, bool check_incompatible_class_change) {
- DCHECK_EQ(class_loader.Get(), mUnit->GetClassLoader().Get());
+ DCHECK_EQ(class_loader.Get(), GetClassLoader(soa, mUnit));
ArtMethod* resolved_method =
check_incompatible_class_change
? mUnit->GetClassLinker()->ResolveMethod<ClassLinker::kForceICCECheck>(
diff --git a/compiler/driver/compiler_driver.cc b/compiler/driver/compiler_driver.cc
index b738d5c..26c0818 100644
--- a/compiler/driver/compiler_driver.cc
+++ b/compiler/driver/compiler_driver.cc
@@ -311,9 +311,6 @@
compiler_->Init();
- if (compiler_options->VerifyOnlyProfile()) {
- CHECK(profile_compilation_info_ != nullptr) << "Requires profile";
- }
if (GetCompilerOptions().IsBootImage()) {
CHECK(image_classes_.get() != nullptr) << "Expected image classes for boot image";
}
@@ -583,7 +580,7 @@
InvokeType invoke_type,
uint16_t class_def_idx,
uint32_t method_idx,
- Handle<mirror::ClassLoader> class_loader,
+ jobject class_loader,
const DexFile& dex_file,
optimizer::DexToDexCompilationLevel dex_to_dex_compilation_level,
bool compilation_enabled,
@@ -624,6 +621,9 @@
// Look-up the ArtMethod associated with this code_item (if any)
// -- It is later used to lookup any [optimization] annotations for this method.
ScopedObjectAccess soa(self);
+ StackHandleScope<1> hs(soa.Self());
+ Handle<mirror::ClassLoader> class_loader_handle(hs.NewHandle(
+ soa.Decode<mirror::ClassLoader>(class_loader)));
// TODO: Lookup annotation from DexFile directly without resolving method.
ArtMethod* method =
@@ -631,7 +631,7 @@
dex_file,
method_idx,
dex_cache,
- class_loader,
+ class_loader_handle,
/* referrer */ nullptr,
invoke_type);
@@ -678,14 +678,9 @@
if (compile) {
// NOTE: if compiler declines to compile this method, it will return null.
- compiled_method = driver->GetCompiler()->Compile(code_item,
- access_flags,
- invoke_type,
- class_def_idx,
- method_idx,
- class_loader,
- dex_file,
- dex_cache);
+ compiled_method = driver->GetCompiler()->Compile(code_item, access_flags, invoke_type,
+ class_def_idx, method_idx, class_loader,
+ dex_file, dex_cache);
}
if (compiled_method == nullptr &&
dex_to_dex_compilation_level != optimizer::DexToDexCompilationLevel::kDontDexToDexCompile) {
@@ -732,14 +727,12 @@
uint32_t method_idx = method->GetDexMethodIndex();
uint32_t access_flags = method->GetAccessFlags();
InvokeType invoke_type = method->GetInvokeType();
- StackHandleScope<2> hs(self);
+ StackHandleScope<1> hs(self);
Handle<mirror::DexCache> dex_cache(hs.NewHandle(method->GetDexCache()));
- Handle<mirror::ClassLoader> class_loader(
- hs.NewHandle(method->GetDeclaringClass()->GetClassLoader()));
{
ScopedObjectAccessUnchecked soa(self);
ScopedLocalRef<jobject> local_class_loader(
- soa.Env(), soa.AddLocalReference<jobject>(class_loader.Get()));
+ soa.Env(), soa.AddLocalReference<jobject>(method->GetDeclaringClass()->GetClassLoader()));
jclass_loader = soa.Env()->NewGlobalRef(local_class_loader.get());
// Find the dex_file
dex_file = method->GetDexFile();
@@ -773,7 +766,7 @@
invoke_type,
class_def_idx,
method_idx,
- class_loader,
+ jclass_loader,
*dex_file,
dex_to_dex_compilation_level,
true,
@@ -799,7 +792,7 @@
invoke_type,
class_def_idx,
method_idx,
- class_loader,
+ jclass_loader,
*dex_file,
dex_to_dex_compilation_level,
true,
@@ -964,7 +957,7 @@
const DexFile::ClassDef& class_def = dex_file->GetClassDef(i);
const char* descriptor = dex_file->GetClassDescriptor(class_def);
cls.Assign(class_linker->FindClass(soa.Self(), descriptor, class_loader));
- if (cls.Get() == nullptr) {
+ if (cls == nullptr) {
soa.Self()->ClearException();
} else if (&cls->GetDexFile() == dex_file) {
DCHECK(cls->IsErroneous() || cls->IsVerified() || cls->IsCompileTimeVerified())
@@ -1074,30 +1067,22 @@
class ResolveCatchBlockExceptionsClassVisitor : public ClassVisitor {
public:
- ResolveCatchBlockExceptionsClassVisitor() : classes_() {}
+ explicit ResolveCatchBlockExceptionsClassVisitor(
+ std::set<std::pair<dex::TypeIndex, const DexFile*>>& exceptions_to_resolve)
+ : exceptions_to_resolve_(exceptions_to_resolve) {}
virtual bool operator()(ObjPtr<mirror::Class> c) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_) {
- classes_.push_back(c);
+ const auto pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
+ for (auto& m : c->GetMethods(pointer_size)) {
+ ResolveExceptionsForMethod(&m);
+ }
return true;
}
- void FindExceptionTypesToResolve(
- std::set<std::pair<dex::TypeIndex, const DexFile*>>* exceptions_to_resolve)
- REQUIRES_SHARED(Locks::mutator_lock_) {
- const auto pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
- for (ObjPtr<mirror::Class> klass : classes_) {
- for (ArtMethod& method : klass->GetMethods(pointer_size)) {
- FindExceptionTypesToResolveForMethod(&method, exceptions_to_resolve);
- }
- }
- }
-
private:
- void FindExceptionTypesToResolveForMethod(
- ArtMethod* method,
- std::set<std::pair<dex::TypeIndex, const DexFile*>>* exceptions_to_resolve)
+ void ResolveExceptionsForMethod(ArtMethod* method_handle)
REQUIRES_SHARED(Locks::mutator_lock_) {
- const DexFile::CodeItem* code_item = method->GetCodeItem();
+ const DexFile::CodeItem* code_item = method_handle->GetCodeItem();
if (code_item == nullptr) {
return; // native or abstract method
}
@@ -1117,9 +1102,9 @@
dex::TypeIndex encoded_catch_handler_handlers_type_idx =
dex::TypeIndex(DecodeUnsignedLeb128(&encoded_catch_handler_list));
// Add to set of types to resolve if not already in the dex cache resolved types
- if (!method->IsResolvedTypeIdx(encoded_catch_handler_handlers_type_idx)) {
- exceptions_to_resolve->emplace(encoded_catch_handler_handlers_type_idx,
- method->GetDexFile());
+ if (!method_handle->IsResolvedTypeIdx(encoded_catch_handler_handlers_type_idx)) {
+ exceptions_to_resolve_.emplace(encoded_catch_handler_handlers_type_idx,
+ method_handle->GetDexFile());
}
// ignore address associated with catch handler
DecodeUnsignedLeb128(&encoded_catch_handler_list);
@@ -1131,7 +1116,7 @@
}
}
- std::vector<ObjPtr<mirror::Class>> classes_;
+ std::set<std::pair<dex::TypeIndex, const DexFile*>>& exceptions_to_resolve_;
};
class RecordImageClassesVisitor : public ClassVisitor {
@@ -1167,7 +1152,7 @@
StackHandleScope<1> hs(self);
Handle<mirror::Class> klass(
hs.NewHandle(class_linker->FindSystemClass(self, descriptor.c_str())));
- if (klass.Get() == nullptr) {
+ if (klass == nullptr) {
VLOG(compiler) << "Failed to find class " << descriptor;
image_classes_->erase(it++);
self->ClearException();
@@ -1185,14 +1170,8 @@
hs.NewHandle(class_linker->FindSystemClass(self, "Ljava/lang/Throwable;")));
do {
unresolved_exception_types.clear();
- {
- // Thread suspension is not allowed while ResolveCatchBlockExceptionsClassVisitor
- // is using a std::vector<ObjPtr<mirror::Class>>.
- ScopedAssertNoThreadSuspension ants(__FUNCTION__);
- ResolveCatchBlockExceptionsClassVisitor visitor;
- class_linker->VisitClasses(&visitor);
- visitor.FindExceptionTypesToResolve(&unresolved_exception_types);
- }
+ ResolveCatchBlockExceptionsClassVisitor visitor(unresolved_exception_types);
+ class_linker->VisitClasses(&visitor);
for (const auto& exception_type : unresolved_exception_types) {
dex::TypeIndex exception_type_idx = exception_type.first;
const DexFile* dex_file = exception_type.second;
@@ -1200,13 +1179,13 @@
Handle<mirror::DexCache> dex_cache(hs2.NewHandle(class_linker->RegisterDexFile(*dex_file,
nullptr)));
Handle<mirror::Class> klass(hs2.NewHandle(
- (dex_cache.Get() != nullptr)
+ (dex_cache != nullptr)
? class_linker->ResolveType(*dex_file,
exception_type_idx,
dex_cache,
ScopedNullHandle<mirror::ClassLoader>())
: nullptr));
- if (klass.Get() == nullptr) {
+ if (klass == nullptr) {
const DexFile::TypeId& type_id = dex_file->GetTypeId(exception_type_idx);
const char* descriptor = dex_file->GetTypeDescriptor(type_id);
LOG(FATAL) << "Failed to resolve class " << descriptor;
@@ -1443,14 +1422,19 @@
dex_to_dex_references_.back().GetMethodIndexes().SetBit(method_ref.dex_method_index);
}
-bool CompilerDriver::CanAccessTypeWithoutChecks(ObjPtr<mirror::Class> referrer_class,
- ObjPtr<mirror::Class> resolved_class) {
+bool CompilerDriver::CanAccessTypeWithoutChecks(uint32_t referrer_idx,
+ Handle<mirror::DexCache> dex_cache,
+ dex::TypeIndex type_idx) {
+ // Get type from dex cache assuming it was populated by the verifier
+ mirror::Class* resolved_class = dex_cache->GetResolvedType(type_idx);
if (resolved_class == nullptr) {
stats_->TypeNeedsAccessCheck();
return false; // Unknown class needs access checks.
}
+ const DexFile::MethodId& method_id = dex_cache->GetDexFile()->GetMethodId(referrer_idx);
bool is_accessible = resolved_class->IsPublic(); // Public classes are always accessible.
if (!is_accessible) {
+ mirror::Class* referrer_class = dex_cache->GetResolvedType(method_id.class_idx_);
if (referrer_class == nullptr) {
stats_->TypeNeedsAccessCheck();
return false; // Incomplete referrer knowledge needs access check.
@@ -1467,9 +1451,12 @@
return is_accessible;
}
-bool CompilerDriver::CanAccessInstantiableTypeWithoutChecks(ObjPtr<mirror::Class> referrer_class,
- ObjPtr<mirror::Class> resolved_class,
+bool CompilerDriver::CanAccessInstantiableTypeWithoutChecks(uint32_t referrer_idx,
+ Handle<mirror::DexCache> dex_cache,
+ dex::TypeIndex type_idx,
bool* finalizable) {
+ // Get type from dex cache assuming it was populated by the verifier.
+ mirror::Class* resolved_class = dex_cache->GetResolvedType(type_idx);
if (resolved_class == nullptr) {
stats_->TypeNeedsAccessCheck();
// Be conservative.
@@ -1477,8 +1464,10 @@
return false; // Unknown class needs access checks.
}
*finalizable = resolved_class->IsFinalizable();
+ const DexFile::MethodId& method_id = dex_cache->GetDexFile()->GetMethodId(referrer_idx);
bool is_accessible = resolved_class->IsPublic(); // Public classes are always accessible.
if (!is_accessible) {
+ mirror::Class* referrer_class = dex_cache->GetResolvedType(method_id.class_idx_);
if (referrer_class == nullptr) {
stats_->TypeNeedsAccessCheck();
return false; // Incomplete referrer knowledge needs access check.
@@ -1522,7 +1511,9 @@
mirror::Class* referrer_class;
Handle<mirror::DexCache> dex_cache(mUnit->GetDexCache());
{
- Handle<mirror::ClassLoader> class_loader_handle = mUnit->GetClassLoader();
+ StackHandleScope<1> hs(soa.Self());
+ Handle<mirror::ClassLoader> class_loader_handle(
+ hs.NewHandle(soa.Decode<mirror::ClassLoader>(mUnit->GetClassLoader())));
resolved_field = ResolveField(soa, dex_cache, class_loader_handle, mUnit, field_idx, false);
referrer_class = resolved_field != nullptr
? ResolveCompilingMethodsClass(soa, dex_cache, class_loader_handle, mUnit) : nullptr;
@@ -1883,7 +1874,7 @@
Handle<mirror::DexCache> dex_cache(hs.NewHandle(class_linker->RegisterDexFile(
dex_file,
class_loader.Get())));
- ObjPtr<mirror::Class> klass = (dex_cache.Get() != nullptr)
+ ObjPtr<mirror::Class> klass = (dex_cache != nullptr)
? class_linker->ResolveType(dex_file, dex::TypeIndex(type_idx), dex_cache, class_loader)
: nullptr;
@@ -1984,7 +1975,7 @@
ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
Handle<mirror::Class> cls(hs.NewHandle<mirror::Class>(
class_linker->FindClass(self, descriptor, class_loader)));
- if (cls.Get() != nullptr) {
+ if (cls != nullptr) {
// Check that the class is resolved with the current dex file. We might get
// a boot image class, or a class in a different dex file for multidex, and
// we should not update the status in that case.
@@ -2132,7 +2123,7 @@
Handle<mirror::Class> klass(
hs.NewHandle(class_linker->FindClass(soa.Self(), descriptor, class_loader)));
verifier::MethodVerifier::FailureKind failure_kind;
- if (klass.Get() == nullptr) {
+ if (klass == nullptr) {
CHECK(soa.Self()->IsExceptionPending());
soa.Self()->ClearException();
@@ -2234,7 +2225,7 @@
Handle<mirror::Class> klass(
hs.NewHandle(class_linker->FindClass(soa.Self(), descriptor, class_loader)));
// Class might have failed resolution. Then don't set it to verified.
- if (klass.Get() != nullptr) {
+ if (klass != nullptr) {
// Only do this if the class is resolved. If even resolution fails, quickening will go very,
// very wrong.
if (klass->IsResolved() && !klass->IsErroneousResolved()) {
@@ -2296,7 +2287,7 @@
Handle<mirror::Class> klass(
hs.NewHandle(manager_->GetClassLinker()->FindClass(soa.Self(), descriptor, class_loader)));
- if (klass.Get() != nullptr && !SkipClass(jclass_loader, dex_file, klass.Get())) {
+ if (klass != nullptr && !SkipClass(jclass_loader, dex_file, klass.Get())) {
// Only try to initialize classes that were successfully verified.
if (klass->IsVerified()) {
// Attempt to initialize the class but bail if we either need to initialize the super-class
@@ -2546,7 +2537,7 @@
Handle<mirror::Class> klass(
hs.NewHandle(class_linker->FindClass(soa.Self(), descriptor, class_loader)));
Handle<mirror::DexCache> dex_cache;
- if (klass.Get() == nullptr) {
+ if (klass == nullptr) {
soa.Self()->AssertPendingException();
soa.Self()->ClearException();
dex_cache = hs.NewHandle(class_linker->FindDexCache(soa.Self(), dex_file));
@@ -2594,18 +2585,10 @@
continue;
}
previous_direct_method_idx = method_idx;
- CompileMethod(soa.Self(),
- driver,
- it.GetMethodCodeItem(),
- it.GetMethodAccessFlags(),
- it.GetMethodInvokeType(class_def),
- class_def_index,
- method_idx,
- class_loader,
- dex_file,
- dex_to_dex_compilation_level,
- compilation_enabled,
- dex_cache);
+ CompileMethod(soa.Self(), driver, it.GetMethodCodeItem(), it.GetMethodAccessFlags(),
+ it.GetMethodInvokeType(class_def), class_def_index,
+ method_idx, jclass_loader, dex_file, dex_to_dex_compilation_level,
+ compilation_enabled, dex_cache);
it.Next();
}
// Compile virtual methods
@@ -2619,17 +2602,10 @@
continue;
}
previous_virtual_method_idx = method_idx;
- CompileMethod(soa.Self(),
- driver, it.GetMethodCodeItem(),
- it.GetMethodAccessFlags(),
- it.GetMethodInvokeType(class_def),
- class_def_index,
- method_idx,
- class_loader,
- dex_file,
- dex_to_dex_compilation_level,
- compilation_enabled,
- dex_cache);
+ CompileMethod(soa.Self(), driver, it.GetMethodCodeItem(), it.GetMethodAccessFlags(),
+ it.GetMethodInvokeType(class_def), class_def_index,
+ method_idx, jclass_loader, dex_file, dex_to_dex_compilation_level,
+ compilation_enabled, dex_cache);
it.Next();
}
DCHECK(!it.HasNext());
diff --git a/compiler/driver/compiler_driver.h b/compiler/driver/compiler_driver.h
index 1e5c43d..5b4c751 100644
--- a/compiler/driver/compiler_driver.h
+++ b/compiler/driver/compiler_driver.h
@@ -187,14 +187,16 @@
REQUIRES(!requires_constructor_barrier_lock_);
// Are runtime access checks necessary in the compiled code?
- bool CanAccessTypeWithoutChecks(ObjPtr<mirror::Class> referrer_class,
- ObjPtr<mirror::Class> resolved_class)
+ bool CanAccessTypeWithoutChecks(uint32_t referrer_idx,
+ Handle<mirror::DexCache> dex_cache,
+ dex::TypeIndex type_idx)
REQUIRES_SHARED(Locks::mutator_lock_);
// Are runtime access and instantiable checks necessary in the code?
// out_is_finalizable is set to whether the type is finalizable.
- bool CanAccessInstantiableTypeWithoutChecks(ObjPtr<mirror::Class> referrer_class,
- ObjPtr<mirror::Class> resolved_class,
+ bool CanAccessInstantiableTypeWithoutChecks(uint32_t referrer_idx,
+ Handle<mirror::DexCache> dex_cache,
+ dex::TypeIndex type_idx,
bool* out_is_finalizable)
REQUIRES_SHARED(Locks::mutator_lock_);
@@ -368,6 +370,10 @@
uint32_t field_idx)
REQUIRES_SHARED(Locks::mutator_lock_);
+ mirror::ClassLoader* GetClassLoader(const ScopedObjectAccess& soa,
+ const DexCompilationUnit* mUnit)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
private:
void PreCompile(jobject class_loader,
const std::vector<const DexFile*>& dex_files,
diff --git a/compiler/driver/compiler_driver_test.cc b/compiler/driver/compiler_driver_test.cc
index e4b66eb..1e4ca16 100644
--- a/compiler/driver/compiler_driver_test.cc
+++ b/compiler/driver/compiler_driver_test.cc
@@ -101,7 +101,6 @@
};
// Disabled due to 10 second runtime on host
-// TODO: Update the test for hash-based dex cache arrays. Bug: 30627598
TEST_F(CompilerDriverTest, DISABLED_LARGE_CompileDexLibCore) {
CompileAll(nullptr);
diff --git a/compiler/driver/dex_compilation_unit.cc b/compiler/driver/dex_compilation_unit.cc
index 7e8e812..47b1929 100644
--- a/compiler/driver/dex_compilation_unit.cc
+++ b/compiler/driver/dex_compilation_unit.cc
@@ -21,7 +21,7 @@
namespace art {
-DexCompilationUnit::DexCompilationUnit(Handle<mirror::ClassLoader> class_loader,
+DexCompilationUnit::DexCompilationUnit(jobject class_loader,
ClassLinker* class_linker,
const DexFile& dex_file,
const DexFile::CodeItem* code_item,
diff --git a/compiler/driver/dex_compilation_unit.h b/compiler/driver/dex_compilation_unit.h
index 24a9a5b..854927d 100644
--- a/compiler/driver/dex_compilation_unit.h
+++ b/compiler/driver/dex_compilation_unit.h
@@ -34,7 +34,7 @@
class DexCompilationUnit : public DeletableArenaObject<kArenaAllocMisc> {
public:
- DexCompilationUnit(Handle<mirror::ClassLoader> class_loader,
+ DexCompilationUnit(jobject class_loader,
ClassLinker* class_linker,
const DexFile& dex_file,
const DexFile::CodeItem* code_item,
@@ -44,7 +44,7 @@
const VerifiedMethod* verified_method,
Handle<mirror::DexCache> dex_cache);
- Handle<mirror::ClassLoader> GetClassLoader() const {
+ jobject GetClassLoader() const {
return class_loader_;
}
@@ -113,7 +113,7 @@
}
private:
- const Handle<mirror::ClassLoader> class_loader_;
+ const jobject class_loader_;
ClassLinker* const class_linker_;
@@ -125,7 +125,7 @@
const uint32_t access_flags_;
const VerifiedMethod* verified_method_;
- const Handle<mirror::DexCache> dex_cache_;
+ Handle<mirror::DexCache> dex_cache_;
std::string symbol_;
};
diff --git a/compiler/image_writer.cc b/compiler/image_writer.cc
index 3e9ae08..d2dd30d 100644
--- a/compiler/image_writer.cc
+++ b/compiler/image_writer.cc
@@ -940,11 +940,9 @@
}
ObjPtr<mirror::DexCache> dex_cache = self->DecodeJObject(data.weak_root)->AsDexCache();
for (size_t i = 0; i < dex_cache->NumResolvedTypes(); i++) {
- mirror::TypeDexCachePair pair =
- dex_cache->GetResolvedTypes()[i].load(std::memory_order_relaxed);
- mirror::Class* klass = pair.object.Read();
+ Class* klass = dex_cache->GetResolvedType(dex::TypeIndex(i));
if (klass != nullptr && !KeepClass(klass)) {
- dex_cache->ClearResolvedType(dex::TypeIndex(pair.index));
+ dex_cache->SetResolvedType(dex::TypeIndex(i), nullptr);
}
}
ArtMethod** resolved_methods = dex_cache->GetResolvedMethods();
@@ -1080,7 +1078,7 @@
}
Handle<ObjectArray<Object>> dex_caches(
hs.NewHandle(ObjectArray<Object>::Alloc(self, object_array_class.Get(), dex_cache_count)));
- CHECK(dex_caches.Get() != nullptr) << "Failed to allocate a dex cache array.";
+ CHECK(dex_caches != nullptr) << "Failed to allocate a dex cache array.";
{
ReaderMutexLock mu(self, *Locks::dex_lock_);
size_t non_image_dex_caches = 0;
@@ -1924,7 +1922,8 @@
// above comment for intern tables.
ClassTable temp_class_table;
temp_class_table.ReadFromMemory(class_table_memory_ptr);
- ObjPtr<mirror::ClassLoader> class_loader = GetClassLoader();
+ CHECK_EQ(class_loaders_.size(), compile_app_image_ ? 1u : 0u);
+ mirror::ClassLoader* class_loader = compile_app_image_ ? *class_loaders_.begin() : nullptr;
CHECK_EQ(temp_class_table.NumZygoteClasses(class_loader),
table->NumNonZygoteClasses(class_loader) + table->NumZygoteClasses(class_loader));
UnbufferedRootVisitor visitor(&root_visitor, RootInfo(kRootUnknown));
@@ -2214,7 +2213,7 @@
orig_dex_cache->FixupStrings(NativeCopyLocation(orig_strings, orig_dex_cache),
ImageAddressVisitor(this));
}
- mirror::TypeDexCacheType* orig_types = orig_dex_cache->GetResolvedTypes();
+ GcRoot<mirror::Class>* orig_types = orig_dex_cache->GetResolvedTypes();
if (orig_types != nullptr) {
copy_dex_cache->SetFieldPtrWithSize<false>(mirror::DexCache::ResolvedTypesOffset(),
NativeLocationInImage(orig_types),
@@ -2255,6 +2254,14 @@
orig_dex_cache->FixupResolvedMethodTypes(NativeCopyLocation(orig_method_types, orig_dex_cache),
ImageAddressVisitor(this));
}
+ GcRoot<mirror::CallSite>* orig_call_sites = orig_dex_cache->GetResolvedCallSites();
+ if (orig_call_sites != nullptr) {
+ copy_dex_cache->SetFieldPtrWithSize<false>(mirror::DexCache::ResolvedCallSitesOffset(),
+ NativeLocationInImage(orig_call_sites),
+ PointerSize::k64);
+ orig_dex_cache->FixupResolvedCallSites(NativeCopyLocation(orig_call_sites, orig_dex_cache),
+ ImageAddressVisitor(this));
+ }
// Remove the DexFile pointers. They will be fixed up when the runtime loads the oat file. Leaving
// compiler pointers in here will make the output non-deterministic.
diff --git a/compiler/image_writer.h b/compiler/image_writer.h
index bdc7146..cc7df1c 100644
--- a/compiler/image_writer.h
+++ b/compiler/image_writer.h
@@ -51,13 +51,8 @@
} // namespace space
} // namespace gc
-namespace mirror {
-class ClassLoader;
-} // namespace mirror
-
class ClassLoaderVisitor;
class ClassTable;
-class ImtConflictTable;
static constexpr int kInvalidFd = -1;
@@ -84,11 +79,6 @@
return true;
}
- ObjPtr<mirror::ClassLoader> GetClassLoader() {
- CHECK_EQ(class_loaders_.size(), compile_app_image_ ? 1u : 0u);
- return compile_app_image_ ? *class_loaders_.begin() : nullptr;
- }
-
template <typename T>
T* GetImageAddress(T* object) const REQUIRES_SHARED(Locks::mutator_lock_) {
if (object == nullptr || IsInBootImage(object)) {
diff --git a/compiler/oat_writer.cc b/compiler/oat_writer.cc
index 0ea1125..7c0cdbf 100644
--- a/compiler/oat_writer.cc
+++ b/compiler/oat_writer.cc
@@ -1060,7 +1060,6 @@
WriteCodeMethodVisitor(OatWriter* writer, OutputStream* out, const size_t file_offset,
size_t relative_offset) SHARED_LOCK_FUNCTION(Locks::mutator_lock_)
: OatDexMethodVisitor(writer, relative_offset),
- class_loader_(writer->HasImage() ? writer->image_writer_->GetClassLoader() : nullptr),
out_(out),
file_offset_(file_offset),
soa_(Thread::Current()),
@@ -1246,7 +1245,6 @@
}
private:
- ObjPtr<mirror::ClassLoader> class_loader_;
OutputStream* const out_;
const size_t file_offset_;
const ScopedObjectAccess soa_;
@@ -1305,12 +1303,10 @@
}
mirror::Class* GetTargetType(const LinkerPatch& patch) REQUIRES_SHARED(Locks::mutator_lock_) {
- DCHECK(writer_->HasImage());
ObjPtr<mirror::DexCache> dex_cache = GetDexCache(patch.TargetTypeDexFile());
- ObjPtr<mirror::Class> type =
- ClassLinker::LookupResolvedType(patch.TargetTypeIndex(), dex_cache, class_loader_);
+ mirror::Class* type = dex_cache->GetResolvedType(patch.TargetTypeIndex());
CHECK(type != nullptr);
- return type.Ptr();
+ return type;
}
mirror::String* GetTargetString(const LinkerPatch& patch) REQUIRES_SHARED(Locks::mutator_lock_) {
diff --git a/compiler/optimizing/builder.h b/compiler/optimizing/builder.h
index 3a4c9db..e4ad422 100644
--- a/compiler/optimizing/builder.h
+++ b/compiler/optimizing/builder.h
@@ -54,10 +54,7 @@
compiler_driver_(driver),
compilation_stats_(compiler_stats),
block_builder_(graph, dex_file, code_item),
- ssa_builder_(graph,
- dex_compilation_unit->GetClassLoader(),
- dex_compilation_unit->GetDexCache(),
- handles),
+ ssa_builder_(graph, dex_compilation_unit->GetDexCache(), handles),
instruction_builder_(graph,
&block_builder_,
&ssa_builder_,
@@ -83,12 +80,10 @@
code_item_(code_item),
dex_compilation_unit_(nullptr),
compiler_driver_(nullptr),
+ null_dex_cache_(),
compilation_stats_(nullptr),
block_builder_(graph, nullptr, code_item),
- ssa_builder_(graph,
- handles->NewHandle<mirror::ClassLoader>(nullptr),
- handles->NewHandle<mirror::DexCache>(nullptr),
- handles),
+ ssa_builder_(graph, null_dex_cache_, handles),
instruction_builder_(graph,
&block_builder_,
&ssa_builder_,
@@ -101,7 +96,7 @@
/* code_generator */ nullptr,
/* interpreter_metadata */ nullptr,
/* compiler_stats */ nullptr,
- handles->NewHandle<mirror::DexCache>(nullptr),
+ null_dex_cache_,
handles) {}
GraphAnalysisResult BuildGraph();
@@ -122,6 +117,8 @@
CompilerDriver* const compiler_driver_;
+ ScopedNullHandle<mirror::DexCache> null_dex_cache_;
+
OptimizingCompilerStats* compilation_stats_;
HBasicBlockBuilder block_builder_;
diff --git a/compiler/optimizing/code_generator.cc b/compiler/optimizing/code_generator.cc
index d68aa51..bac16cd 100644
--- a/compiler/optimizing/code_generator.cc
+++ b/compiler/optimizing/code_generator.cc
@@ -1419,7 +1419,7 @@
QuickEntrypointEnum CodeGenerator::GetArrayAllocationEntrypoint(Handle<mirror::Class> array_klass) {
ScopedObjectAccess soa(Thread::Current());
- if (array_klass.Get() == nullptr) {
+ if (array_klass == nullptr) {
// This can only happen for non-primitive arrays, as primitive arrays can always
// be resolved.
return kQuickAllocArrayResolved32;
diff --git a/compiler/optimizing/inliner.cc b/compiler/optimizing/inliner.cc
index b56ef0f..e012a42 100644
--- a/compiler/optimizing/inliner.cc
+++ b/compiler/optimizing/inliner.cc
@@ -69,38 +69,32 @@
// doing some logic in the runtime to discover if a method could have been inlined.
return;
}
- const ArenaVector<HBasicBlock*>& blocks = graph_->GetReversePostOrder();
+ // Keep a copy of all blocks when starting the visit.
+ ArenaVector<HBasicBlock*> blocks = graph_->GetReversePostOrder();
DCHECK(!blocks.empty());
- HBasicBlock* next_block = blocks[0];
- for (size_t i = 0; i < blocks.size(); ++i) {
- // Because we are changing the graph when inlining, we need to remember the next block.
- // This avoids doing the inlining work again on the inlined blocks.
- if (blocks[i] != next_block) {
- continue;
- }
- HBasicBlock* block = next_block;
- next_block = (i == blocks.size() - 1) ? nullptr : blocks[i + 1];
+ // Because we are changing the graph when inlining,
+ // we just iterate over the blocks of the outer method.
+ // This avoids doing the inlining work again on the inlined blocks.
+ for (HBasicBlock* block : blocks) {
for (HInstruction* instruction = block->GetFirstInstruction(); instruction != nullptr;) {
HInstruction* next = instruction->GetNext();
HInvoke* call = instruction->AsInvoke();
// As long as the call is not intrinsified, it is worth trying to inline.
if (call != nullptr && call->GetIntrinsic() == Intrinsics::kNone) {
- // We use the original invoke type to ensure the resolution of the called method
- // works properly.
- if (!TryInline(call)) {
- if (kIsDebugBuild && IsCompilingWithCoreImage()) {
- std::string callee_name =
- outer_compilation_unit_.GetDexFile()->PrettyMethod(call->GetDexMethodIndex());
- bool should_inline = callee_name.find("$inline$") != std::string::npos;
- CHECK(!should_inline) << "Could not inline " << callee_name;
+ if (kIsDebugBuild && IsCompilingWithCoreImage()) {
+ // Debugging case: directives in method names control or assert on inlining.
+ std::string callee_name = outer_compilation_unit_.GetDexFile()->PrettyMethod(
+ call->GetDexMethodIndex(), /* with_signature */ false);
+ // Tests prevent inlining by having $noinline$ in their method names.
+ if (callee_name.find("$noinline$") == std::string::npos) {
+ if (!TryInline(call)) {
+ bool should_have_inlined = (callee_name.find("$inline$") != std::string::npos);
+ CHECK(!should_have_inlined) << "Could not inline " << callee_name;
+ }
}
} else {
- if (kIsDebugBuild && IsCompilingWithCoreImage()) {
- std::string callee_name =
- outer_compilation_unit_.GetDexFile()->PrettyMethod(call->GetDexMethodIndex());
- bool must_not_inline = callee_name.find("$noinline$") != std::string::npos;
- CHECK(!must_not_inline) << "Should not have inlined " << callee_name;
- }
+ // Normal case: try to inline.
+ TryInline(call);
}
}
instruction = next;
@@ -198,9 +192,9 @@
}
static dex::TypeIndex FindClassIndexIn(mirror::Class* cls,
- const DexCompilationUnit& compilation_unit)
+ const DexFile& dex_file,
+ Handle<mirror::DexCache> dex_cache)
REQUIRES_SHARED(Locks::mutator_lock_) {
- const DexFile& dex_file = *compilation_unit.GetDexFile();
dex::TypeIndex index;
if (cls->GetDexCache() == nullptr) {
DCHECK(cls->IsArrayClass()) << cls->PrettyClass();
@@ -209,19 +203,22 @@
DCHECK(cls->IsProxyClass()) << cls->PrettyClass();
// TODO: deal with proxy classes.
} else if (IsSameDexFile(cls->GetDexFile(), dex_file)) {
- DCHECK_EQ(cls->GetDexCache(), compilation_unit.GetDexCache().Get());
+ DCHECK_EQ(cls->GetDexCache(), dex_cache.Get());
index = cls->GetDexTypeIndex();
+ // Update the dex cache to ensure the class is in. The generated code will
+ // consider it is. We make it safe by updating the dex cache, as other
+ // dex files might also load the class, and there is no guarantee the dex
+ // cache of the dex file of the class will be updated.
+ if (dex_cache->GetResolvedType(index) == nullptr) {
+ dex_cache->SetResolvedType(index, cls);
+ }
} else {
index = cls->FindTypeIndexInOtherDexFile(dex_file);
- // We cannot guarantee the entry will resolve to the same class,
+ // We cannot guarantee the entry in the dex cache will resolve to the same class,
// as there may be different class loaders. So only return the index if it's
- // the right class already resolved with the class loader.
- if (index.IsValid()) {
- ObjPtr<mirror::Class> resolved = ClassLinker::LookupResolvedType(
- index, compilation_unit.GetDexCache().Get(), compilation_unit.GetClassLoader().Get());
- if (resolved != cls) {
- index = dex::TypeIndex::Invalid();
- }
+ // the right class in the dex cache already.
+ if (index.IsValid() && dex_cache->GetResolvedType(index) != cls) {
+ index = dex::TypeIndex::Invalid();
}
}
@@ -377,7 +374,7 @@
soa.Self(),
class_linker->GetClassRoot(ClassLinker::kClassArrayClass),
InlineCache::kIndividualCacheSize));
- if (inline_cache.Get() == nullptr) {
+ if (inline_cache == nullptr) {
// We got an OOME. Just clear the exception, and don't inline.
DCHECK(soa.Self()->IsExceptionPending());
soa.Self()->ClearException();
@@ -448,8 +445,9 @@
DCHECK(invoke_instruction->IsInvokeVirtual() || invoke_instruction->IsInvokeInterface())
<< invoke_instruction->DebugName();
+ const DexFile& caller_dex_file = *caller_compilation_unit_.GetDexFile();
dex::TypeIndex class_index = FindClassIndexIn(
- GetMonomorphicType(classes), caller_compilation_unit_);
+ GetMonomorphicType(classes), caller_dex_file, caller_compilation_unit_.GetDexCache());
if (!class_index.IsValid()) {
VLOG(compiler) << "Call to " << ArtMethod::PrettyMethod(resolved_method)
<< " from inline cache is not inlined because its class is not"
@@ -492,7 +490,6 @@
// Run type propagation to get the guard typed, and eventually propagate the
// type of the receiver.
ReferenceTypePropagation rtp_fixup(graph_,
- outer_compilation_unit_.GetClassLoader(),
outer_compilation_unit_.GetDexCache(),
handles_,
/* is_first_run */ false);
@@ -563,7 +560,6 @@
bb_cursor->InsertInstructionAfter(load_class, receiver_class);
load_class->SetLoadKind(kind);
- // TODO: Extend reference type propagation to understand the guard.
HNotEqual* compare = new (graph_->GetArena()) HNotEqual(load_class, receiver_class);
bb_cursor->InsertInstructionAfter(compare, load_class);
if (with_deoptimization) {
@@ -587,6 +583,7 @@
ClassLinker* class_linker = caller_compilation_unit_.GetClassLinker();
PointerSize pointer_size = class_linker->GetImagePointerSize();
+ const DexFile& caller_dex_file = *caller_compilation_unit_.GetDexFile();
bool all_targets_inlined = true;
bool one_target_inlined = false;
@@ -608,7 +605,8 @@
HInstruction* cursor = invoke_instruction->GetPrevious();
HBasicBlock* bb_cursor = invoke_instruction->GetBlock();
- dex::TypeIndex class_index = FindClassIndexIn(handle.Get(), caller_compilation_unit_);
+ dex::TypeIndex class_index = FindClassIndexIn(
+ handle.Get(), caller_dex_file, caller_compilation_unit_.GetDexCache());
HInstruction* return_replacement = nullptr;
if (!class_index.IsValid() ||
!TryBuildAndInline(invoke_instruction,
@@ -664,7 +662,6 @@
// Run type propagation to get the guards typed.
ReferenceTypePropagation rtp_fixup(graph_,
- outer_compilation_unit_.GetClassLoader(),
outer_compilation_unit_.GetDexCache(),
handles_,
/* is_first_run */ false);
@@ -846,7 +843,6 @@
if (outermost_graph_->IsCompilingOsr()) {
CreateDiamondPatternForPolymorphicInline(compare, return_replacement, invoke_instruction);
} else {
- // TODO: Extend reference type propagation to understand the guard.
HDeoptimize* deoptimize = new (graph_->GetArena()) HDeoptimize(
compare, invoke_instruction->GetDexPc());
bb_cursor->InsertInstructionAfter(deoptimize, compare);
@@ -859,7 +855,6 @@
// Run type propagation to get the guard typed.
ReferenceTypePropagation rtp_fixup(graph_,
- outer_compilation_unit_.GetClassLoader(),
outer_compilation_unit_.GetDexCache(),
handles_,
/* is_first_run */ false);
@@ -928,7 +923,6 @@
// Actual return value has a more specific type than the method's declared
// return type. Run RTP again on the outer graph to propagate it.
ReferenceTypePropagation(graph_,
- outer_compilation_unit_.GetClassLoader(),
outer_compilation_unit_.GetDexCache(),
handles_,
/* is_first_run */ false).Run();
@@ -1181,11 +1175,7 @@
/* dex_pc */ 0);
if (iget->GetType() == Primitive::kPrimNot) {
// Use the same dex_cache that we used for field lookup as the hint_dex_cache.
- ReferenceTypePropagation rtp(graph_,
- outer_compilation_unit_.GetClassLoader(),
- dex_cache,
- handles_,
- /* is_first_run */ false);
+ ReferenceTypePropagation rtp(graph_, dex_cache, handles_, /* is_first_run */ false);
rtp.Visit(iget);
}
return iget;
@@ -1231,7 +1221,7 @@
resolved_method->GetDeclaringClass()->GetClassLoader()));
DexCompilationUnit dex_compilation_unit(
- class_loader,
+ class_loader.ToJObject(),
class_linker,
callee_dex_file,
code_item,
@@ -1348,7 +1338,6 @@
// are more specific than the declared ones, run RTP again on the inner graph.
if (run_rtp || ArgumentTypesMoreSpecific(invoke_instruction, resolved_method)) {
ReferenceTypePropagation(callee_graph,
- outer_compilation_unit_.GetClassLoader(),
dex_compilation_unit.GetDexCache(),
handles_,
/* is_first_run */ false).Run();
@@ -1359,9 +1348,6 @@
RunOptimizations(callee_graph, code_item, dex_compilation_unit);
number_of_instructions_budget += number_of_inlined_instructions;
- // TODO: We should abort only if all predecessors throw. However,
- // HGraph::InlineInto currently does not handle an exit block with
- // a throw predecessor.
HBasicBlock* exit_block = callee_graph->GetExitBlock();
if (exit_block == nullptr) {
VLOG(compiler) << "Method " << callee_dex_file.PrettyMethod(method_index)
@@ -1369,16 +1355,30 @@
return false;
}
- bool has_throw_predecessor = false;
+ bool has_one_return = false;
for (HBasicBlock* predecessor : exit_block->GetPredecessors()) {
if (predecessor->GetLastInstruction()->IsThrow()) {
- has_throw_predecessor = true;
- break;
+ if (invoke_instruction->GetBlock()->IsTryBlock()) {
+ // TODO(ngeoffray): Support adding HTryBoundary in Hgraph::InlineInto.
+ VLOG(compiler) << "Method " << callee_dex_file.PrettyMethod(method_index)
+ << " could not be inlined because one branch always throws and"
+ << " caller is in a try/catch block";
+ return false;
+ } else if (graph_->GetExitBlock() == nullptr) {
+ // TODO(ngeoffray): Support adding HExit in the caller graph.
+ VLOG(compiler) << "Method " << callee_dex_file.PrettyMethod(method_index)
+ << " could not be inlined because one branch always throws and"
+ << " caller does not have an exit block";
+ return false;
+ }
+ } else {
+ has_one_return = true;
}
}
- if (has_throw_predecessor) {
+
+ if (!has_one_return) {
VLOG(compiler) << "Method " << callee_dex_file.PrettyMethod(method_index)
- << " could not be inlined because one branch always throws";
+ << " could not be inlined because it always throws";
return false;
}
diff --git a/compiler/optimizing/instruction_builder.cc b/compiler/optimizing/instruction_builder.cc
index 3aaf2ca..3374e42 100644
--- a/compiler/optimizing/instruction_builder.cc
+++ b/compiler/optimizing/instruction_builder.cc
@@ -669,17 +669,18 @@
ArtMethod* HInstructionBuilder::ResolveMethod(uint16_t method_idx, InvokeType invoke_type) {
ScopedObjectAccess soa(Thread::Current());
- StackHandleScope<2> hs(soa.Self());
+ StackHandleScope<3> hs(soa.Self());
ClassLinker* class_linker = dex_compilation_unit_->GetClassLinker();
- Handle<mirror::ClassLoader> class_loader = dex_compilation_unit_->GetClassLoader();
+ Handle<mirror::ClassLoader> class_loader(hs.NewHandle(
+ soa.Decode<mirror::ClassLoader>(dex_compilation_unit_->GetClassLoader())));
Handle<mirror::Class> compiling_class(hs.NewHandle(GetCompilingClass()));
// We fetch the referenced class eagerly (that is, the class pointed by in the MethodId
// at method_idx), as `CanAccessResolvedMethod` expects it be be in the dex cache.
Handle<mirror::Class> methods_class(hs.NewHandle(class_linker->ResolveReferencedClassOfMethod(
method_idx, dex_compilation_unit_->GetDexCache(), class_loader)));
- if (UNLIKELY(methods_class.Get() == nullptr)) {
+ if (UNLIKELY(methods_class == nullptr)) {
// Clean up any exception left by type resolution.
soa.Self()->ClearException();
return nullptr;
@@ -701,7 +702,7 @@
// Check access. The class linker has a fast path for looking into the dex cache
// and does not check the access if it hits it.
- if (compiling_class.Get() == nullptr) {
+ if (compiling_class == nullptr) {
if (!resolved_method->IsPublic()) {
return nullptr;
}
@@ -717,7 +718,7 @@
// make this an invoke-unresolved to handle cross-dex invokes or abstract super methods, both of
// which require runtime handling.
if (invoke_type == kSuper) {
- if (compiling_class.Get() == nullptr) {
+ if (compiling_class == nullptr) {
// We could not determine the method's class we need to wait until runtime.
DCHECK(Runtime::Current()->IsAotCompiler());
return nullptr;
@@ -953,7 +954,7 @@
}
// Consider classes we haven't resolved as potentially finalizable.
- bool finalizable = (klass.Get() == nullptr) || klass->IsFinalizable();
+ bool finalizable = (klass == nullptr) || klass->IsFinalizable();
AppendInstruction(new (arena_) HNewInstance(
cls,
@@ -971,7 +972,7 @@
}
bool HInstructionBuilder::IsInitialized(Handle<mirror::Class> cls) const {
- if (cls.Get() == nullptr) {
+ if (cls == nullptr) {
return false;
}
@@ -1259,7 +1260,9 @@
static mirror::Class* GetClassFrom(CompilerDriver* driver,
const DexCompilationUnit& compilation_unit) {
ScopedObjectAccess soa(Thread::Current());
- Handle<mirror::ClassLoader> class_loader = compilation_unit.GetClassLoader();
+ StackHandleScope<1> hs(soa.Self());
+ Handle<mirror::ClassLoader> class_loader(hs.NewHandle(
+ soa.Decode<mirror::ClassLoader>(compilation_unit.GetClassLoader())));
Handle<mirror::DexCache> dex_cache = compilation_unit.GetDexCache();
return driver->ResolveCompilingMethodsClass(soa, dex_cache, class_loader, &compilation_unit);
@@ -1275,9 +1278,10 @@
bool HInstructionBuilder::IsOutermostCompilingClass(dex::TypeIndex type_index) const {
ScopedObjectAccess soa(Thread::Current());
- StackHandleScope<2> hs(soa.Self());
+ StackHandleScope<3> hs(soa.Self());
Handle<mirror::DexCache> dex_cache = dex_compilation_unit_->GetDexCache();
- Handle<mirror::ClassLoader> class_loader = dex_compilation_unit_->GetClassLoader();
+ Handle<mirror::ClassLoader> class_loader(hs.NewHandle(
+ soa.Decode<mirror::ClassLoader>(dex_compilation_unit_->GetClassLoader())));
Handle<mirror::Class> cls(hs.NewHandle(compiler_driver_->ResolveClass(
soa, dex_cache, class_loader, type_index, dex_compilation_unit_)));
Handle<mirror::Class> outer_class(hs.NewHandle(GetOutermostCompilingClass()));
@@ -1288,7 +1292,7 @@
// When this happens we cannot establish a direct relation between the current
// class and the outer class, so we return false.
// (Note that this is only used for optimizing invokes and field accesses)
- return (cls.Get() != nullptr) && (outer_class.Get() == cls.Get());
+ return (cls != nullptr) && (outer_class.Get() == cls.Get());
}
void HInstructionBuilder::BuildUnresolvedStaticFieldAccess(const Instruction& instruction,
@@ -1313,7 +1317,8 @@
StackHandleScope<2> hs(soa.Self());
ClassLinker* class_linker = dex_compilation_unit_->GetClassLinker();
- Handle<mirror::ClassLoader> class_loader = dex_compilation_unit_->GetClassLoader();
+ Handle<mirror::ClassLoader> class_loader(hs.NewHandle(
+ soa.Decode<mirror::ClassLoader>(dex_compilation_unit_->GetClassLoader())));
Handle<mirror::Class> compiling_class(hs.NewHandle(GetCompilingClass()));
ArtField* resolved_field = class_linker->ResolveField(*dex_compilation_unit_->GetDexFile(),
@@ -1335,7 +1340,7 @@
}
// Check access.
- if (compiling_class.Get() == nullptr) {
+ if (compiling_class == nullptr) {
if (!resolved_field->IsPublic()) {
return nullptr;
}
@@ -1607,7 +1612,7 @@
static TypeCheckKind ComputeTypeCheckKind(Handle<mirror::Class> cls)
REQUIRES_SHARED(Locks::mutator_lock_) {
- if (cls.Get() == nullptr) {
+ if (cls == nullptr) {
return TypeCheckKind::kUnresolvedCheck;
} else if (cls->IsInterface()) {
return TypeCheckKind::kInterfaceCheck;
@@ -1630,13 +1635,15 @@
HLoadClass* HInstructionBuilder::BuildLoadClass(dex::TypeIndex type_index, uint32_t dex_pc) {
ScopedObjectAccess soa(Thread::Current());
+ StackHandleScope<2> hs(soa.Self());
const DexFile& dex_file = *dex_compilation_unit_->GetDexFile();
- Handle<mirror::ClassLoader> class_loader = dex_compilation_unit_->GetClassLoader();
+ Handle<mirror::ClassLoader> class_loader(hs.NewHandle(
+ soa.Decode<mirror::ClassLoader>(dex_compilation_unit_->GetClassLoader())));
Handle<mirror::Class> klass = handles_->NewHandle(compiler_driver_->ResolveClass(
soa, dex_compilation_unit_->GetDexCache(), class_loader, type_index, dex_compilation_unit_));
bool needs_access_check = true;
- if (klass.Get() != nullptr) {
+ if (klass != nullptr) {
if (klass->IsPublic()) {
needs_access_check = false;
} else {
@@ -1672,7 +1679,7 @@
type_index,
*actual_dex_file,
klass,
- klass.Get() != nullptr && (klass.Get() == GetOutermostCompilingClass()),
+ klass != nullptr && (klass.Get() == GetOutermostCompilingClass()),
dex_pc,
needs_access_check);
@@ -1715,9 +1722,17 @@
}
}
-bool HInstructionBuilder::NeedsAccessCheck(dex::TypeIndex type_index, bool* finalizable) const {
+bool HInstructionBuilder::NeedsAccessCheck(dex::TypeIndex type_index,
+ Handle<mirror::DexCache> dex_cache,
+ bool* finalizable) const {
return !compiler_driver_->CanAccessInstantiableTypeWithoutChecks(
- LookupReferrerClass(), LookupResolvedType(type_index, *dex_compilation_unit_), finalizable);
+ dex_compilation_unit_->GetDexMethodIndex(), dex_cache, type_index, finalizable);
+}
+
+bool HInstructionBuilder::NeedsAccessCheck(dex::TypeIndex type_index, bool* finalizable) const {
+ ScopedObjectAccess soa(Thread::Current());
+ Handle<mirror::DexCache> dex_cache = dex_compilation_unit_->GetDexCache();
+ return NeedsAccessCheck(type_index, dex_cache, finalizable);
}
bool HInstructionBuilder::CanDecodeQuickenedInfo() const {
@@ -2757,18 +2772,4 @@
return true;
} // NOLINT(readability/fn_size)
-ObjPtr<mirror::Class> HInstructionBuilder::LookupResolvedType(
- dex::TypeIndex type_index,
- const DexCompilationUnit& compilation_unit) const {
- return ClassLinker::LookupResolvedType(
- type_index, compilation_unit.GetDexCache().Get(), compilation_unit.GetClassLoader().Get());
-}
-
-ObjPtr<mirror::Class> HInstructionBuilder::LookupReferrerClass() const {
- // TODO: Cache the result in a Handle<mirror::Class>.
- const DexFile::MethodId& method_id =
- dex_compilation_unit_->GetDexFile()->GetMethodId(dex_compilation_unit_->GetDexMethodIndex());
- return LookupResolvedType(method_id.class_idx_, *dex_compilation_unit_);
-}
-
} // namespace art
diff --git a/compiler/optimizing/instruction_builder.h b/compiler/optimizing/instruction_builder.h
index e735a0c..3bb680c 100644
--- a/compiler/optimizing/instruction_builder.h
+++ b/compiler/optimizing/instruction_builder.h
@@ -106,8 +106,11 @@
// Returns whether the current method needs access check for the type.
// Output parameter finalizable is set to whether the type is finalizable.
- bool NeedsAccessCheck(dex::TypeIndex type_index, /*out*/bool* finalizable) const
+ bool NeedsAccessCheck(dex::TypeIndex type_index,
+ Handle<mirror::DexCache> dex_cache,
+ /*out*/bool* finalizable) const
REQUIRES_SHARED(Locks::mutator_lock_);
+ bool NeedsAccessCheck(dex::TypeIndex type_index, /*out*/bool* finalizable) const;
template<typename T>
void Unop_12x(const Instruction& instruction, Primitive::Type type, uint32_t dex_pc);
@@ -297,12 +300,6 @@
// be found.
ArtField* ResolveField(uint16_t field_idx, bool is_static, bool is_put);
- ObjPtr<mirror::Class> LookupResolvedType(dex::TypeIndex type_index,
- const DexCompilationUnit& compilation_unit) const
- REQUIRES_SHARED(Locks::mutator_lock_);
-
- ObjPtr<mirror::Class> LookupReferrerClass() const REQUIRES_SHARED(Locks::mutator_lock_);
-
ArenaAllocator* const arena_;
HGraph* const graph_;
VariableSizedHandleScope* handles_;
diff --git a/compiler/optimizing/intrinsics_arm64.cc b/compiler/optimizing/intrinsics_arm64.cc
index 1047d3b..86e5429 100644
--- a/compiler/optimizing/intrinsics_arm64.cc
+++ b/compiler/optimizing/intrinsics_arm64.cc
@@ -23,7 +23,7 @@
#include "entrypoints/quick/quick_entrypoints.h"
#include "intrinsics.h"
#include "mirror/array-inl.h"
-#include "mirror/string.h"
+#include "mirror/string-inl.h"
#include "thread.h"
#include "utils/arm64/assembler_arm64.h"
@@ -1450,16 +1450,47 @@
}
}
+// The cut off for unrolling the loop in String.equals() intrinsic for const strings.
+// The normal loop plus the pre-header is 9 instructions without string compression and 12
+// instructions with string compression. We can compare up to 8 bytes in 4 instructions
+// (LDR+LDR+CMP+BNE) and up to 16 bytes in 5 instructions (LDP+LDP+CMP+CCMP+BNE). Allow up
+// to 10 instructions for the unrolled loop.
+constexpr size_t kShortConstStringEqualsCutoffInBytes = 32;
+
+static const char* GetConstString(HInstruction* candidate, uint32_t* utf16_length) {
+ if (candidate->IsLoadString()) {
+ HLoadString* load_string = candidate->AsLoadString();
+ const DexFile& dex_file = load_string->GetDexFile();
+ return dex_file.StringDataAndUtf16LengthByIdx(load_string->GetStringIndex(), utf16_length);
+ }
+ return nullptr;
+}
+
void IntrinsicLocationsBuilderARM64::VisitStringEquals(HInvoke* invoke) {
LocationSummary* locations = new (arena_) LocationSummary(invoke,
LocationSummary::kNoCall,
kIntrinsified);
locations->SetInAt(0, Location::RequiresRegister());
locations->SetInAt(1, Location::RequiresRegister());
- // Temporary registers to store lengths of strings and for calculations.
- locations->AddTemp(Location::RequiresRegister());
- locations->AddTemp(Location::RequiresRegister());
+ // For the generic implementation and for long const strings we need a temporary.
+ // We do not need it for short const strings, up to 8 bytes, see code generation below.
+ uint32_t const_string_length = 0u;
+ const char* const_string = GetConstString(invoke->InputAt(0), &const_string_length);
+ if (const_string == nullptr) {
+ const_string = GetConstString(invoke->InputAt(1), &const_string_length);
+ }
+ bool is_compressed =
+ mirror::kUseStringCompression &&
+ const_string != nullptr &&
+ mirror::String::DexFileStringAllASCII(const_string, const_string_length);
+ if (const_string == nullptr || const_string_length > (is_compressed ? 8u : 4u)) {
+ locations->AddTemp(Location::RequiresRegister());
+ }
+
+ // TODO: If the String.equals() is used only for an immediately following HIf, we can
+ // mark it as emitted-at-use-site and emit branches directly to the appropriate blocks.
+ // Then we shall need an extra temporary register instead of the output register.
locations->SetOut(Location::RequiresRegister(), Location::kOutputOverlap);
}
@@ -1473,8 +1504,7 @@
UseScratchRegisterScope scratch_scope(masm);
Register temp = scratch_scope.AcquireW();
- Register temp1 = WRegisterFrom(locations->GetTemp(0));
- Register temp2 = WRegisterFrom(locations->GetTemp(1));
+ Register temp1 = scratch_scope.AcquireW();
vixl::aarch64::Label loop;
vixl::aarch64::Label end;
@@ -1510,47 +1540,99 @@
__ B(&return_false, ne);
}
- // Load `count` fields of this and argument strings.
- __ Ldr(temp, MemOperand(str.X(), count_offset));
- __ Ldr(temp1, MemOperand(arg.X(), count_offset));
- // Check if `count` fields are equal, return false if they're not.
- // Also compares the compression style, if differs return false.
- __ Cmp(temp, temp1);
- __ B(&return_false, ne);
- // Return true if both strings are empty. Even with string compression `count == 0` means empty.
- static_assert(static_cast<uint32_t>(mirror::StringCompressionFlag::kCompressed) == 0u,
- "Expecting 0=compressed, 1=uncompressed");
- __ Cbz(temp, &return_true);
+ // Check if one of the inputs is a const string. Do not special-case both strings
+ // being const, such cases should be handled by constant folding if needed.
+ uint32_t const_string_length = 0u;
+ const char* const_string = GetConstString(invoke->InputAt(0), &const_string_length);
+ if (const_string == nullptr) {
+ const_string = GetConstString(invoke->InputAt(1), &const_string_length);
+ if (const_string != nullptr) {
+ std::swap(str, arg); // Make sure the const string is in `str`.
+ }
+ }
+ bool is_compressed =
+ mirror::kUseStringCompression &&
+ const_string != nullptr &&
+ mirror::String::DexFileStringAllASCII(const_string, const_string_length);
+
+ if (const_string != nullptr) {
+ // Load `count` field of the argument string and check if it matches the const string.
+ // Also compares the compression style, if differs return false.
+ __ Ldr(temp, MemOperand(arg.X(), count_offset));
+ __ Cmp(temp, Operand(mirror::String::GetFlaggedCount(const_string_length, is_compressed)));
+ __ B(&return_false, ne);
+ } else {
+ // Load `count` fields of this and argument strings.
+ __ Ldr(temp, MemOperand(str.X(), count_offset));
+ __ Ldr(temp1, MemOperand(arg.X(), count_offset));
+ // Check if `count` fields are equal, return false if they're not.
+ // Also compares the compression style, if differs return false.
+ __ Cmp(temp, temp1);
+ __ B(&return_false, ne);
+ }
// Assertions that must hold in order to compare strings 8 bytes at a time.
DCHECK_ALIGNED(value_offset, 8);
static_assert(IsAligned<8>(kObjectAlignment), "String of odd length is not zero padded");
- if (mirror::kUseStringCompression) {
- // For string compression, calculate the number of bytes to compare (not chars).
- // This could in theory exceed INT32_MAX, so treat temp as unsigned.
- __ Lsr(temp, temp, 1u); // Extract length.
- __ And(temp1, temp1, Operand(1)); // Extract compression flag.
- __ Lsl(temp, temp, temp1); // Calculate number of bytes to compare.
+ if (const_string != nullptr &&
+ const_string_length < (is_compressed ? kShortConstStringEqualsCutoffInBytes
+ : kShortConstStringEqualsCutoffInBytes / 2u)) {
+ // Load and compare the contents. Though we know the contents of the short const string
+ // at compile time, materializing constants may be more code than loading from memory.
+ int32_t offset = value_offset;
+ size_t remaining_bytes =
+ RoundUp(is_compressed ? const_string_length : const_string_length * 2u, 8u);
+ temp = temp.X();
+ temp1 = temp1.X();
+ while (remaining_bytes > 8u) {
+ Register temp2 = XRegisterFrom(locations->GetTemp(0));
+ __ Ldp(temp, temp1, MemOperand(str.X(), offset));
+ __ Ldp(temp2, out, MemOperand(arg.X(), offset));
+ __ Cmp(temp, temp2);
+ __ Ccmp(temp1, out, NoFlag, eq);
+ __ B(&return_false, ne);
+ offset += 2u * sizeof(uint64_t);
+ remaining_bytes -= 2u * sizeof(uint64_t);
+ }
+ if (remaining_bytes != 0u) {
+ __ Ldr(temp, MemOperand(str.X(), offset));
+ __ Ldr(temp1, MemOperand(arg.X(), offset));
+ __ Cmp(temp, temp1);
+ __ B(&return_false, ne);
+ }
+ } else {
+ // Return true if both strings are empty. Even with string compression `count == 0` means empty.
+ static_assert(static_cast<uint32_t>(mirror::StringCompressionFlag::kCompressed) == 0u,
+ "Expecting 0=compressed, 1=uncompressed");
+ __ Cbz(temp, &return_true);
+
+ if (mirror::kUseStringCompression) {
+ // For string compression, calculate the number of bytes to compare (not chars).
+ // This could in theory exceed INT32_MAX, so treat temp as unsigned.
+ __ And(temp1, temp, Operand(1)); // Extract compression flag.
+ __ Lsr(temp, temp, 1u); // Extract length.
+ __ Lsl(temp, temp, temp1); // Calculate number of bytes to compare.
+ }
+
+ // Store offset of string value in preparation for comparison loop
+ __ Mov(temp1, value_offset);
+
+ temp1 = temp1.X();
+ Register temp2 = XRegisterFrom(locations->GetTemp(0));
+ // Loop to compare strings 8 bytes at a time starting at the front of the string.
+ // Ok to do this because strings are zero-padded to kObjectAlignment.
+ __ Bind(&loop);
+ __ Ldr(out, MemOperand(str.X(), temp1));
+ __ Ldr(temp2, MemOperand(arg.X(), temp1));
+ __ Add(temp1, temp1, Operand(sizeof(uint64_t)));
+ __ Cmp(out, temp2);
+ __ B(&return_false, ne);
+ // With string compression, we have compared 8 bytes, otherwise 4 chars.
+ __ Sub(temp, temp, Operand(mirror::kUseStringCompression ? 8 : 4), SetFlags);
+ __ B(&loop, hi);
}
- // Store offset of string value in preparation for comparison loop
- __ Mov(temp1, value_offset);
-
- temp1 = temp1.X();
- temp2 = temp2.X();
- // Loop to compare strings 8 bytes at a time starting at the front of the string.
- // Ok to do this because strings are zero-padded to kObjectAlignment.
- __ Bind(&loop);
- __ Ldr(out, MemOperand(str.X(), temp1));
- __ Ldr(temp2, MemOperand(arg.X(), temp1));
- __ Add(temp1, temp1, Operand(sizeof(uint64_t)));
- __ Cmp(out, temp2);
- __ B(&return_false, ne);
- // With string compression, we have compared 8 bytes, otherwise 4 chars.
- __ Sub(temp, temp, Operand(mirror::kUseStringCompression ? 8 : 4), SetFlags);
- __ B(&loop, hi);
-
// Return true and exit the function.
// If loop does not result in returning false, we return true.
__ Bind(&return_true);
diff --git a/compiler/optimizing/nodes.cc b/compiler/optimizing/nodes.cc
index abbb91a..71a26eb 100644
--- a/compiler/optimizing/nodes.cc
+++ b/compiler/optimizing/nodes.cc
@@ -2038,6 +2038,8 @@
HInstruction* return_value = nullptr;
if (GetBlocks().size() == 3) {
+ // Inliner already made sure we don't inline methods that always throw.
+ DCHECK(!GetBlocks()[1]->GetLastInstruction()->IsThrow());
// Simple case of an entry block, a body block, and an exit block.
// Put the body block's instruction into `invoke`'s block.
HBasicBlock* body = GetBlocks()[1];
@@ -2119,33 +2121,60 @@
UpdateLoopAndTryInformationOfNewBlock(to, at, /* replace_if_back_edge */ true);
// Update all predecessors of the exit block (now the `to` block)
- // to not `HReturn` but `HGoto` instead.
- bool returns_void = to->GetPredecessors()[0]->GetLastInstruction()->IsReturnVoid();
- if (to->GetPredecessors().size() == 1) {
- HBasicBlock* predecessor = to->GetPredecessors()[0];
+ // to not `HReturn` but `HGoto` instead. Special case throwing blocks
+ // to now get the outer graph exit block as successor. Note that the inliner
+ // currently doesn't support inlining methods with try/catch.
+ HPhi* return_value_phi = nullptr;
+ bool rerun_dominance = false;
+ bool rerun_loop_analysis = false;
+ for (size_t pred = 0; pred < to->GetPredecessors().size(); ++pred) {
+ HBasicBlock* predecessor = to->GetPredecessors()[pred];
HInstruction* last = predecessor->GetLastInstruction();
- if (!returns_void) {
- return_value = last->InputAt(0);
- }
- predecessor->AddInstruction(new (allocator) HGoto(last->GetDexPc()));
- predecessor->RemoveInstruction(last);
- } else {
- if (!returns_void) {
- // There will be multiple returns.
- return_value = new (allocator) HPhi(
- allocator, kNoRegNumber, 0, HPhi::ToPhiType(invoke->GetType()), to->GetDexPc());
- to->AddPhi(return_value->AsPhi());
- }
- for (HBasicBlock* predecessor : to->GetPredecessors()) {
- HInstruction* last = predecessor->GetLastInstruction();
- if (!returns_void) {
+ if (last->IsThrow()) {
+ DCHECK(!at->IsTryBlock());
+ predecessor->ReplaceSuccessor(to, outer_graph->GetExitBlock());
+ --pred;
+ // We need to re-run dominance information, as the exit block now has
+ // a new dominator.
+ rerun_dominance = true;
+ if (predecessor->GetLoopInformation() != nullptr) {
+ // The exit block and blocks post dominated by the exit block do not belong
+ // to any loop. Because we do not compute the post dominators, we need to re-run
+ // loop analysis to get the loop information correct.
+ rerun_loop_analysis = true;
+ }
+ } else {
+ if (last->IsReturnVoid()) {
+ DCHECK(return_value == nullptr);
+ DCHECK(return_value_phi == nullptr);
+ } else {
DCHECK(last->IsReturn());
- return_value->AsPhi()->AddInput(last->InputAt(0));
+ if (return_value_phi != nullptr) {
+ return_value_phi->AddInput(last->InputAt(0));
+ } else if (return_value == nullptr) {
+ return_value = last->InputAt(0);
+ } else {
+ // There will be multiple returns.
+ return_value_phi = new (allocator) HPhi(
+ allocator, kNoRegNumber, 0, HPhi::ToPhiType(invoke->GetType()), to->GetDexPc());
+ to->AddPhi(return_value_phi);
+ return_value_phi->AddInput(return_value);
+ return_value_phi->AddInput(last->InputAt(0));
+ return_value = return_value_phi;
+ }
}
predecessor->AddInstruction(new (allocator) HGoto(last->GetDexPc()));
predecessor->RemoveInstruction(last);
}
}
+ if (rerun_loop_analysis) {
+ outer_graph->ClearLoopInformation();
+ outer_graph->ClearDominanceInformation();
+ outer_graph->BuildDominatorTree();
+ } else if (rerun_dominance) {
+ outer_graph->ClearDominanceInformation();
+ outer_graph->ComputeDominanceInformation();
+ }
}
// Walk over the entry block and:
diff --git a/compiler/optimizing/optimizing_compiler.cc b/compiler/optimizing/optimizing_compiler.cc
index 0375c66..8638e34 100644
--- a/compiler/optimizing/optimizing_compiler.cc
+++ b/compiler/optimizing/optimizing_compiler.cc
@@ -306,7 +306,7 @@
InvokeType invoke_type,
uint16_t class_def_idx,
uint32_t method_idx,
- Handle<mirror::ClassLoader> class_loader,
+ jobject class_loader,
const DexFile& dex_file,
Handle<mirror::DexCache> dex_cache) const OVERRIDE;
@@ -375,7 +375,7 @@
InvokeType invoke_type,
uint16_t class_def_idx,
uint32_t method_idx,
- Handle<mirror::ClassLoader> class_loader,
+ jobject class_loader,
const DexFile& dex_file,
Handle<mirror::DexCache> dex_cache,
ArtMethod* method,
@@ -875,7 +875,7 @@
InvokeType invoke_type,
uint16_t class_def_idx,
uint32_t method_idx,
- Handle<mirror::ClassLoader> class_loader,
+ jobject class_loader,
const DexFile& dex_file,
Handle<mirror::DexCache> dex_cache,
ArtMethod* method,
@@ -946,8 +946,11 @@
const uint8_t* interpreter_metadata = nullptr;
if (method == nullptr) {
ScopedObjectAccess soa(Thread::Current());
+ StackHandleScope<1> hs(soa.Self());
+ Handle<mirror::ClassLoader> loader(hs.NewHandle(
+ soa.Decode<mirror::ClassLoader>(class_loader)));
method = compiler_driver->ResolveMethod(
- soa, dex_cache, class_loader, &dex_compilation_unit, method_idx, invoke_type);
+ soa, dex_cache, loader, &dex_compilation_unit, method_idx, invoke_type);
}
// For AOT compilation, we may not get a method, for example if its class is erroneous.
// JIT should always have a method.
@@ -956,6 +959,16 @@
graph->SetArtMethod(method);
ScopedObjectAccess soa(Thread::Current());
interpreter_metadata = method->GetQuickenedInfo(class_linker->GetImagePointerSize());
+ dex::TypeIndex type_index = method->GetDeclaringClass()->GetDexTypeIndex();
+
+ // Update the dex cache if the type is not in it yet. Note that under AOT,
+ // the verifier must have set it, but under JIT, there's no guarantee, as we
+ // don't necessarily run the verifier.
+ // The compiler and the compiler driver assume the compiling class is
+ // in the dex cache.
+ if (dex_cache->GetResolvedType(type_index) == nullptr) {
+ dex_cache->SetResolvedType(type_index, method->GetDeclaringClass());
+ }
}
std::unique_ptr<CodeGenerator> codegen(
@@ -1036,7 +1049,7 @@
InvokeType invoke_type,
uint16_t class_def_idx,
uint32_t method_idx,
- Handle<mirror::ClassLoader> jclass_loader,
+ jobject jclass_loader,
const DexFile& dex_file,
Handle<mirror::DexCache> dex_cache) const {
CompilerDriver* compiler_driver = GetCompilerDriver();
@@ -1150,6 +1163,7 @@
Handle<mirror::DexCache> dex_cache(hs.NewHandle(method->GetDexCache()));
DCHECK(method->IsCompilable());
+ jobject jclass_loader = class_loader.ToJObject();
const DexFile* dex_file = method->GetDexFile();
const uint16_t class_def_idx = method->GetClassDefIndex();
const DexFile::CodeItem* code_item = dex_file->GetCodeItem(method->GetCodeItemOffset());
@@ -1173,7 +1187,7 @@
invoke_type,
class_def_idx,
method_idx,
- class_loader,
+ jclass_loader,
*dex_file,
dex_cache,
method,
@@ -1200,7 +1214,7 @@
Handle<mirror::ObjectArray<mirror::Object>> roots(
hs.NewHandle(mirror::ObjectArray<mirror::Object>::Alloc(
self, class_linker->GetClassRoot(ClassLinker::kObjectArrayClass), number_of_roots)));
- if (roots.Get() == nullptr) {
+ if (roots == nullptr) {
// Out of memory, just clear the exception to avoid any Java exception uncaught problems.
DCHECK(self->IsExceptionPending());
self->ClearException();
diff --git a/compiler/optimizing/reference_type_propagation.cc b/compiler/optimizing/reference_type_propagation.cc
index 6e332ca..c55fccc 100644
--- a/compiler/optimizing/reference_type_propagation.cc
+++ b/compiler/optimizing/reference_type_propagation.cc
@@ -65,13 +65,11 @@
class ReferenceTypePropagation::RTPVisitor : public HGraphDelegateVisitor {
public:
RTPVisitor(HGraph* graph,
- Handle<mirror::ClassLoader> class_loader,
Handle<mirror::DexCache> hint_dex_cache,
HandleCache* handle_cache,
ArenaVector<HInstruction*>* worklist,
bool is_first_run)
: HGraphDelegateVisitor(graph),
- class_loader_(class_loader),
hint_dex_cache_(hint_dex_cache),
handle_cache_(handle_cache),
worklist_(worklist),
@@ -103,7 +101,6 @@
bool is_exact);
private:
- Handle<mirror::ClassLoader> class_loader_;
Handle<mirror::DexCache> hint_dex_cache_;
HandleCache* handle_cache_;
ArenaVector<HInstruction*>* worklist_;
@@ -111,13 +108,11 @@
};
ReferenceTypePropagation::ReferenceTypePropagation(HGraph* graph,
- Handle<mirror::ClassLoader> class_loader,
Handle<mirror::DexCache> hint_dex_cache,
VariableSizedHandleScope* handles,
bool is_first_run,
const char* name)
: HOptimization(graph, name),
- class_loader_(class_loader),
hint_dex_cache_(hint_dex_cache),
handle_cache_(handles),
worklist_(graph->GetArena()->Adapter(kArenaAllocReferenceTypePropagation)),
@@ -152,12 +147,7 @@
}
void ReferenceTypePropagation::Visit(HInstruction* instruction) {
- RTPVisitor visitor(graph_,
- class_loader_,
- hint_dex_cache_,
- &handle_cache_,
- &worklist_,
- is_first_run_);
+ RTPVisitor visitor(graph_, hint_dex_cache_, &handle_cache_, &worklist_, is_first_run_);
instruction->Accept(&visitor);
}
@@ -331,12 +321,7 @@
}
void ReferenceTypePropagation::VisitBasicBlock(HBasicBlock* block) {
- RTPVisitor visitor(graph_,
- class_loader_,
- hint_dex_cache_,
- &handle_cache_,
- &worklist_,
- is_first_run_);
+ RTPVisitor visitor(graph_, hint_dex_cache_, &handle_cache_, &worklist_, is_first_run_);
// Handle Phis first as there might be instructions in the same block who depend on them.
for (HInstructionIterator it(block->GetPhis()); !it.Done(); it.Advance()) {
VisitPhi(it.Current()->AsPhi());
@@ -557,9 +542,8 @@
ScopedObjectAccess soa(Thread::Current());
ObjPtr<mirror::DexCache> dex_cache = FindDexCacheWithHint(soa.Self(), dex_file, hint_dex_cache_);
- ObjPtr<mirror::Class> klass =
- ClassLinker::LookupResolvedType(type_idx, dex_cache, class_loader_.Get());
- SetClassAsTypeInfo(instr, klass, is_exact);
+ // Get type from dex cache assuming it was populated by the verifier.
+ SetClassAsTypeInfo(instr, dex_cache->GetResolvedType(type_idx), is_exact);
}
void ReferenceTypePropagation::RTPVisitor::VisitNewInstance(HNewInstance* instr) {
@@ -572,13 +556,25 @@
SetClassAsTypeInfo(instr, instr->GetLoadClass()->GetClass().Get(), /* is_exact */ true);
}
+static mirror::Class* GetClassFromDexCache(Thread* self,
+ const DexFile& dex_file,
+ dex::TypeIndex type_idx,
+ Handle<mirror::DexCache> hint_dex_cache)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ ObjPtr<mirror::DexCache> dex_cache = FindDexCacheWithHint(self, dex_file, hint_dex_cache);
+ // Get type from dex cache assuming it was populated by the verifier.
+ return dex_cache->GetResolvedType(type_idx);
+}
+
void ReferenceTypePropagation::RTPVisitor::VisitParameterValue(HParameterValue* instr) {
// We check if the existing type is valid: the inliner may have set it.
if (instr->GetType() == Primitive::kPrimNot && !instr->GetReferenceTypeInfo().IsValid()) {
- UpdateReferenceTypeInfo(instr,
- instr->GetTypeIndex(),
- instr->GetDexFile(),
- /* is_exact */ false);
+ ScopedObjectAccess soa(Thread::Current());
+ mirror::Class* resolved_class = GetClassFromDexCache(soa.Self(),
+ instr->GetDexFile(),
+ instr->GetTypeIndex(),
+ hint_dex_cache_);
+ SetClassAsTypeInfo(instr, resolved_class, /* is_exact */ false);
}
}
diff --git a/compiler/optimizing/reference_type_propagation.h b/compiler/optimizing/reference_type_propagation.h
index 215e967..4663471 100644
--- a/compiler/optimizing/reference_type_propagation.h
+++ b/compiler/optimizing/reference_type_propagation.h
@@ -33,7 +33,6 @@
class ReferenceTypePropagation : public HOptimization {
public:
ReferenceTypePropagation(HGraph* graph,
- Handle<mirror::ClassLoader> class_loader,
Handle<mirror::DexCache> hint_dex_cache,
VariableSizedHandleScope* handles,
bool is_first_run,
@@ -106,8 +105,6 @@
void ValidateTypes();
- Handle<mirror::ClassLoader> class_loader_;
-
// Note: hint_dex_cache_ is usually, but not necessarily, the dex cache associated with
// graph_->GetDexFile(). Since we may look up also in other dex files, it's used only
// as a hint, to reduce the number of calls to the costly ClassLinker::FindDexCache().
diff --git a/compiler/optimizing/reference_type_propagation_test.cc b/compiler/optimizing/reference_type_propagation_test.cc
index 84a4bab..b061c87 100644
--- a/compiler/optimizing/reference_type_propagation_test.cc
+++ b/compiler/optimizing/reference_type_propagation_test.cc
@@ -38,7 +38,6 @@
void SetupPropagation(VariableSizedHandleScope* handles) {
graph_->InitializeInexactObjectRTI(handles);
propagation_ = new (&allocator_) ReferenceTypePropagation(graph_,
- Handle<mirror::ClassLoader>(),
Handle<mirror::DexCache>(),
handles,
true,
diff --git a/compiler/optimizing/sharpening.cc b/compiler/optimizing/sharpening.cc
index f07f02a..be40092 100644
--- a/compiler/optimizing/sharpening.cc
+++ b/compiler/optimizing/sharpening.cc
@@ -163,7 +163,7 @@
if (!compiler_driver->GetSupportBootImageFixup()) {
// compiler_driver_test. Do not sharpen.
desired_load_kind = HLoadClass::LoadKind::kDexCacheViaMethod;
- } else if ((klass.Get() != nullptr) && compiler_driver->IsImageClass(
+ } else if ((klass != nullptr) && compiler_driver->IsImageClass(
dex_file.StringDataByIdx(dex_file.GetTypeId(type_index).descriptor_idx_))) {
is_in_boot_image = true;
desired_load_kind = codegen->GetCompilerOptions().GetCompilePic()
@@ -175,7 +175,7 @@
desired_load_kind = HLoadClass::LoadKind::kBssEntry;
}
} else {
- is_in_boot_image = (klass.Get() != nullptr) &&
+ is_in_boot_image = (klass != nullptr) &&
runtime->GetHeap()->ObjectIsInBootImageSpace(klass.Get());
if (runtime->UseJitCompilation()) {
// TODO: Make sure we don't set the "compile PIC" flag for JIT as that's bogus.
@@ -183,7 +183,7 @@
if (is_in_boot_image) {
// TODO: Use direct pointers for all non-moving spaces, not just boot image. Bug: 29530787
desired_load_kind = HLoadClass::LoadKind::kBootImageAddress;
- } else if (klass.Get() != nullptr) {
+ } else if (klass != nullptr) {
desired_load_kind = HLoadClass::LoadKind::kJitTableAddress;
} else {
// Class not loaded yet. This happens when the dex code requesting
diff --git a/compiler/optimizing/ssa_builder.cc b/compiler/optimizing/ssa_builder.cc
index 50ab11b..487e4dd 100644
--- a/compiler/optimizing/ssa_builder.cc
+++ b/compiler/optimizing/ssa_builder.cc
@@ -499,11 +499,7 @@
// 4) Compute type of reference type instructions. The pass assumes that
// NullConstant has been fixed up.
- ReferenceTypePropagation(graph_,
- class_loader_,
- dex_cache_,
- handles_,
- /* is_first_run */ true).Run();
+ ReferenceTypePropagation(graph_, dex_cache_, handles_, /* is_first_run */ true).Run();
// 5) HInstructionBuilder duplicated ArrayGet instructions with ambiguous type
// (int/float or long/double) and marked ArraySets with ambiguous input type.
diff --git a/compiler/optimizing/ssa_builder.h b/compiler/optimizing/ssa_builder.h
index 978f113..45dac54 100644
--- a/compiler/optimizing/ssa_builder.h
+++ b/compiler/optimizing/ssa_builder.h
@@ -48,11 +48,9 @@
class SsaBuilder : public ValueObject {
public:
SsaBuilder(HGraph* graph,
- Handle<mirror::ClassLoader> class_loader,
Handle<mirror::DexCache> dex_cache,
VariableSizedHandleScope* handles)
: graph_(graph),
- class_loader_(class_loader),
dex_cache_(dex_cache),
handles_(handles),
agets_fixed_(false),
@@ -117,7 +115,6 @@
void RemoveRedundantUninitializedStrings();
HGraph* graph_;
- Handle<mirror::ClassLoader> class_loader_;
Handle<mirror::DexCache> dex_cache_;
VariableSizedHandleScope* const handles_;
diff --git a/compiler/optimizing/stack_map_stream.cc b/compiler/optimizing/stack_map_stream.cc
index f8e01b7..1bcc8e1 100644
--- a/compiler/optimizing/stack_map_stream.cc
+++ b/compiler/optimizing/stack_map_stream.cc
@@ -38,19 +38,14 @@
current_entry_.native_pc_code_offset = CodeOffset::FromOffset(native_pc_offset, instruction_set_);
current_entry_.register_mask = register_mask;
current_entry_.sp_mask = sp_mask;
- current_entry_.num_dex_registers = num_dex_registers;
current_entry_.inlining_depth = inlining_depth;
- current_entry_.dex_register_locations_start_index = dex_register_locations_.size();
current_entry_.inline_infos_start_index = inline_infos_.size();
- current_entry_.dex_register_map_hash = 0;
- current_entry_.same_dex_register_map_as_ = kNoSameDexMapFound;
current_entry_.stack_mask_index = 0;
- if (num_dex_registers != 0) {
- current_entry_.live_dex_registers_mask =
- ArenaBitVector::Create(allocator_, num_dex_registers, true, kArenaAllocStackMapStream);
- } else {
- current_entry_.live_dex_registers_mask = nullptr;
- }
+ current_entry_.dex_register_entry.num_dex_registers = num_dex_registers;
+ current_entry_.dex_register_entry.locations_start_index = dex_register_locations_.size();
+ current_entry_.dex_register_entry.live_dex_registers_mask = (num_dex_registers != 0)
+ ? ArenaBitVector::Create(allocator_, num_dex_registers, true, kArenaAllocStackMapStream)
+ : nullptr;
if (sp_mask != nullptr) {
stack_mask_max_ = std::max(stack_mask_max_, sp_mask->GetHighestBitSet());
@@ -65,7 +60,7 @@
}
void StackMapStream::EndStackMapEntry() {
- current_entry_.same_dex_register_map_as_ = FindEntryWithTheSameDexMap();
+ current_entry_.dex_register_map_index = AddDexRegisterMapEntry(current_entry_.dex_register_entry);
stack_maps_.push_back(current_entry_);
current_entry_ = StackMapEntry();
}
@@ -91,19 +86,15 @@
dex_register_locations_.push_back(index);
location_catalog_entries_indices_.Insert(std::make_pair(location, index));
}
-
- if (in_inline_frame_) {
- // TODO: Support sharing DexRegisterMap across InlineInfo.
- DCHECK_LT(current_dex_register_, current_inline_info_.num_dex_registers);
- current_inline_info_.live_dex_registers_mask->SetBit(current_dex_register_);
- } else {
- DCHECK_LT(current_dex_register_, current_entry_.num_dex_registers);
- current_entry_.live_dex_registers_mask->SetBit(current_dex_register_);
- current_entry_.dex_register_map_hash += (1 <<
- (current_dex_register_ % (sizeof(current_entry_.dex_register_map_hash) * kBitsPerByte)));
- current_entry_.dex_register_map_hash += static_cast<uint32_t>(value);
- current_entry_.dex_register_map_hash += static_cast<uint32_t>(kind);
- }
+ DexRegisterMapEntry* const entry = in_inline_frame_
+ ? ¤t_inline_info_.dex_register_entry
+ : ¤t_entry_.dex_register_entry;
+ DCHECK_LT(current_dex_register_, entry->num_dex_registers);
+ entry->live_dex_registers_mask->SetBit(current_dex_register_);
+ entry->hash += (1 <<
+ (current_dex_register_ % (sizeof(DexRegisterMapEntry::hash) * kBitsPerByte)));
+ entry->hash += static_cast<uint32_t>(value);
+ entry->hash += static_cast<uint32_t>(kind);
}
current_dex_register_++;
}
@@ -124,20 +115,19 @@
current_inline_info_.method_index = method->GetDexMethodIndexUnchecked();
}
current_inline_info_.dex_pc = dex_pc;
- current_inline_info_.num_dex_registers = num_dex_registers;
- current_inline_info_.dex_register_locations_start_index = dex_register_locations_.size();
- if (num_dex_registers != 0) {
- current_inline_info_.live_dex_registers_mask =
- ArenaBitVector::Create(allocator_, num_dex_registers, true, kArenaAllocStackMapStream);
- } else {
- current_inline_info_.live_dex_registers_mask = nullptr;
- }
+ current_inline_info_.dex_register_entry.num_dex_registers = num_dex_registers;
+ current_inline_info_.dex_register_entry.locations_start_index = dex_register_locations_.size();
+ current_inline_info_.dex_register_entry.live_dex_registers_mask = (num_dex_registers != 0)
+ ? ArenaBitVector::Create(allocator_, num_dex_registers, true, kArenaAllocStackMapStream)
+ : nullptr;
current_dex_register_ = 0;
}
void StackMapStream::EndInlineInfoEntry() {
+ current_inline_info_.dex_register_map_index =
+ AddDexRegisterMapEntry(current_inline_info_.dex_register_entry);
DCHECK(in_inline_frame_);
- DCHECK_EQ(current_dex_register_, current_inline_info_.num_dex_registers)
+ DCHECK_EQ(current_dex_register_, current_inline_info_.dex_register_entry.num_dex_registers)
<< "Inline information contains less registers than expected";
in_inline_frame_ = false;
inline_infos_.push_back(current_inline_info_);
@@ -193,8 +183,7 @@
return size;
}
-size_t StackMapStream::ComputeDexRegisterMapSize(uint32_t num_dex_registers,
- const BitVector* live_dex_registers_mask) const {
+size_t StackMapStream::DexRegisterMapEntry::ComputeSize(size_t catalog_size) const {
// For num_dex_registers == 0u live_dex_registers_mask may be null.
if (num_dex_registers == 0u) {
return 0u; // No register map will be emitted.
@@ -208,8 +197,7 @@
// Compute the size of the set of live Dex register entries.
size_t number_of_live_dex_registers = live_dex_registers_mask->NumSetBits();
size_t map_entries_size_in_bits =
- DexRegisterMap::SingleEntrySizeInBits(location_catalog_entries_.size())
- * number_of_live_dex_registers;
+ DexRegisterMap::SingleEntrySizeInBits(catalog_size) * number_of_live_dex_registers;
size_t map_entries_size_in_bytes =
RoundUp(map_entries_size_in_bits, kBitsPerByte) / kBitsPerByte;
size += map_entries_size_in_bytes;
@@ -218,18 +206,8 @@
size_t StackMapStream::ComputeDexRegisterMapsSize() const {
size_t size = 0;
- size_t inline_info_index = 0;
- for (const StackMapEntry& entry : stack_maps_) {
- if (entry.same_dex_register_map_as_ == kNoSameDexMapFound) {
- size += ComputeDexRegisterMapSize(entry.num_dex_registers, entry.live_dex_registers_mask);
- } else {
- // Entries with the same dex map will have the same offset.
- }
- for (size_t j = 0; j < entry.inlining_depth; ++j) {
- InlineInfoEntry inline_entry = inline_infos_[inline_info_index++];
- size += ComputeDexRegisterMapSize(inline_entry.num_dex_registers,
- inline_entry.live_dex_registers_mask);
- }
+ for (const DexRegisterMapEntry& entry : dex_register_entries_) {
+ size += entry.ComputeSize(location_catalog_entries_.size());
}
return size;
}
@@ -264,6 +242,30 @@
encoding->SetFromSizes(method_index_max, dex_pc_max, extra_data_max, dex_register_maps_bytes);
}
+size_t StackMapStream::MaybeCopyDexRegisterMap(DexRegisterMapEntry& entry,
+ size_t* current_offset,
+ MemoryRegion dex_register_locations_region) {
+ DCHECK(current_offset != nullptr);
+ if ((entry.num_dex_registers == 0) || (entry.live_dex_registers_mask->NumSetBits() == 0)) {
+ // No dex register map needed.
+ return StackMap::kNoDexRegisterMap;
+ }
+ if (entry.offset == DexRegisterMapEntry::kOffsetUnassigned) {
+ // Not already copied, need to copy and and assign an offset.
+ entry.offset = *current_offset;
+ const size_t entry_size = entry.ComputeSize(location_catalog_entries_.size());
+ DexRegisterMap dex_register_map(
+ dex_register_locations_region.Subregion(entry.offset, entry_size));
+ *current_offset += entry_size;
+ // Fill in the map since it was just added.
+ FillInDexRegisterMap(dex_register_map,
+ entry.num_dex_registers,
+ *entry.live_dex_registers_mask,
+ entry.locations_start_index);
+ }
+ return entry.offset;
+}
+
void StackMapStream::FillIn(MemoryRegion region) {
DCHECK_EQ(0u, current_entry_.dex_pc) << "EndStackMapEntry not called after BeginStackMapEntry";
DCHECK_NE(0u, needed_size_) << "PrepareForFillIn not called before FillIn";
@@ -311,35 +313,10 @@
stack_map.SetRegisterMaskIndex(encoding.stack_map.encoding, entry.register_mask_index);
stack_map.SetStackMaskIndex(encoding.stack_map.encoding, entry.stack_mask_index);
- if (entry.num_dex_registers == 0 || (entry.live_dex_registers_mask->NumSetBits() == 0)) {
- // No dex map available.
- stack_map.SetDexRegisterMapOffset(encoding.stack_map.encoding, StackMap::kNoDexRegisterMap);
- } else {
- // Search for an entry with the same dex map.
- if (entry.same_dex_register_map_as_ != kNoSameDexMapFound) {
- // If we have a hit reuse the offset.
- stack_map.SetDexRegisterMapOffset(
- encoding.stack_map.encoding,
- code_info.GetStackMapAt(entry.same_dex_register_map_as_, encoding)
- .GetDexRegisterMapOffset(encoding.stack_map.encoding));
- } else {
- // New dex registers maps should be added to the stack map.
- MemoryRegion register_region = dex_register_locations_region.Subregion(
- next_dex_register_map_offset,
- ComputeDexRegisterMapSize(entry.num_dex_registers, entry.live_dex_registers_mask));
- next_dex_register_map_offset += register_region.size();
- DexRegisterMap dex_register_map(register_region);
- stack_map.SetDexRegisterMapOffset(
- encoding.stack_map.encoding,
- register_region.begin() - dex_register_locations_region.begin());
-
- // Set the dex register location.
- FillInDexRegisterMap(dex_register_map,
- entry.num_dex_registers,
- *entry.live_dex_registers_mask,
- entry.dex_register_locations_start_index);
- }
- }
+ size_t offset = MaybeCopyDexRegisterMap(dex_register_entries_[entry.dex_register_map_index],
+ &next_dex_register_map_offset,
+ dex_register_locations_region);
+ stack_map.SetDexRegisterMapOffset(encoding.stack_map.encoding, offset);
// Set the inlining info.
if (entry.inlining_depth != 0) {
@@ -371,29 +348,13 @@
inline_info.SetExtraDataAtDepth(encoding.inline_info.encoding, depth, 1);
}
inline_info.SetDexPcAtDepth(encoding.inline_info.encoding, depth, inline_entry.dex_pc);
- if (inline_entry.num_dex_registers == 0) {
- // No dex map available.
- inline_info.SetDexRegisterMapOffsetAtDepth(encoding.inline_info.encoding,
- depth,
- StackMap::kNoDexRegisterMap);
- DCHECK(inline_entry.live_dex_registers_mask == nullptr);
- } else {
- MemoryRegion register_region = dex_register_locations_region.Subregion(
- next_dex_register_map_offset,
- ComputeDexRegisterMapSize(inline_entry.num_dex_registers,
- inline_entry.live_dex_registers_mask));
- next_dex_register_map_offset += register_region.size();
- DexRegisterMap dex_register_map(register_region);
- inline_info.SetDexRegisterMapOffsetAtDepth(
- encoding.inline_info.encoding,
- depth,
- register_region.begin() - dex_register_locations_region.begin());
-
- FillInDexRegisterMap(dex_register_map,
- inline_entry.num_dex_registers,
- *inline_entry.live_dex_registers_mask,
- inline_entry.dex_register_locations_start_index);
- }
+ size_t dex_register_map_offset = MaybeCopyDexRegisterMap(
+ dex_register_entries_[inline_entry.dex_register_map_index],
+ &next_dex_register_map_offset,
+ dex_register_locations_region);
+ inline_info.SetDexRegisterMapOffsetAtDepth(encoding.inline_info.encoding,
+ depth,
+ dex_register_map_offset);
}
} else if (encoding.stack_map.encoding.GetInlineInfoEncoding().BitSize() > 0) {
stack_map.SetInlineInfoIndex(encoding.stack_map.encoding, StackMap::kNoInlineInfo);
@@ -448,34 +409,31 @@
}
}
-size_t StackMapStream::FindEntryWithTheSameDexMap() {
- size_t current_entry_index = stack_maps_.size();
- auto entries_it = dex_map_hash_to_stack_map_indices_.find(current_entry_.dex_register_map_hash);
+size_t StackMapStream::AddDexRegisterMapEntry(const DexRegisterMapEntry& entry) {
+ const size_t current_entry_index = dex_register_entries_.size();
+ auto entries_it = dex_map_hash_to_stack_map_indices_.find(entry.hash);
if (entries_it == dex_map_hash_to_stack_map_indices_.end()) {
// We don't have a perfect hash functions so we need a list to collect all stack maps
// which might have the same dex register map.
ArenaVector<uint32_t> stack_map_indices(allocator_->Adapter(kArenaAllocStackMapStream));
stack_map_indices.push_back(current_entry_index);
- dex_map_hash_to_stack_map_indices_.Put(current_entry_.dex_register_map_hash,
- std::move(stack_map_indices));
- return kNoSameDexMapFound;
- }
-
- // We might have collisions, so we need to check whether or not we really have a match.
- for (uint32_t test_entry_index : entries_it->second) {
- if (HaveTheSameDexMaps(GetStackMap(test_entry_index), current_entry_)) {
- return test_entry_index;
+ dex_map_hash_to_stack_map_indices_.Put(entry.hash, std::move(stack_map_indices));
+ } else {
+ // We might have collisions, so we need to check whether or not we really have a match.
+ for (uint32_t test_entry_index : entries_it->second) {
+ if (DexRegisterMapEntryEquals(dex_register_entries_[test_entry_index], entry)) {
+ return test_entry_index;
+ }
}
+ entries_it->second.push_back(current_entry_index);
}
- entries_it->second.push_back(current_entry_index);
- return kNoSameDexMapFound;
+ dex_register_entries_.push_back(entry);
+ return current_entry_index;
}
-bool StackMapStream::HaveTheSameDexMaps(const StackMapEntry& a, const StackMapEntry& b) const {
- if (a.live_dex_registers_mask == nullptr && b.live_dex_registers_mask == nullptr) {
- return true;
- }
- if (a.live_dex_registers_mask == nullptr || b.live_dex_registers_mask == nullptr) {
+bool StackMapStream::DexRegisterMapEntryEquals(const DexRegisterMapEntry& a,
+ const DexRegisterMapEntry& b) const {
+ if ((a.live_dex_registers_mask == nullptr) != (b.live_dex_registers_mask == nullptr)) {
return false;
}
if (a.num_dex_registers != b.num_dex_registers) {
@@ -489,12 +447,12 @@
}
size_t number_of_live_dex_registers = a.live_dex_registers_mask->NumSetBits();
DCHECK_LE(number_of_live_dex_registers, dex_register_locations_.size());
- DCHECK_LE(a.dex_register_locations_start_index,
+ DCHECK_LE(a.locations_start_index,
dex_register_locations_.size() - number_of_live_dex_registers);
- DCHECK_LE(b.dex_register_locations_start_index,
+ DCHECK_LE(b.locations_start_index,
dex_register_locations_.size() - number_of_live_dex_registers);
- auto a_begin = dex_register_locations_.begin() + a.dex_register_locations_start_index;
- auto b_begin = dex_register_locations_.begin() + b.dex_register_locations_start_index;
+ auto a_begin = dex_register_locations_.begin() + a.locations_start_index;
+ auto b_begin = dex_register_locations_.begin() + b.locations_start_index;
if (!std::equal(a_begin, a_begin + number_of_live_dex_registers, b_begin)) {
return false;
}
@@ -597,10 +555,10 @@
CheckDexRegisterMap(code_info,
code_info.GetDexRegisterMapOf(
- stack_map, encoding, entry.num_dex_registers),
- entry.num_dex_registers,
- entry.live_dex_registers_mask,
- entry.dex_register_locations_start_index);
+ stack_map, encoding, entry.dex_register_entry.num_dex_registers),
+ entry.dex_register_entry.num_dex_registers,
+ entry.dex_register_entry.live_dex_registers_mask,
+ entry.dex_register_entry.locations_start_index);
// Check inline info.
DCHECK_EQ(stack_map.HasInlineInfo(stack_map_encoding), (entry.inlining_depth != 0));
@@ -623,10 +581,13 @@
CheckDexRegisterMap(code_info,
code_info.GetDexRegisterMapAtDepth(
- d, inline_info, encoding, inline_entry.num_dex_registers),
- inline_entry.num_dex_registers,
- inline_entry.live_dex_registers_mask,
- inline_entry.dex_register_locations_start_index);
+ d,
+ inline_info,
+ encoding,
+ inline_entry.dex_register_entry.num_dex_registers),
+ inline_entry.dex_register_entry.num_dex_registers,
+ inline_entry.dex_register_entry.live_dex_registers_mask,
+ inline_entry.dex_register_entry.locations_start_index);
}
}
}
diff --git a/compiler/optimizing/stack_map_stream.h b/compiler/optimizing/stack_map_stream.h
index 08c1d3e..bba3d51 100644
--- a/compiler/optimizing/stack_map_stream.h
+++ b/compiler/optimizing/stack_map_stream.h
@@ -70,6 +70,7 @@
inline_infos_(allocator->Adapter(kArenaAllocStackMapStream)),
stack_masks_(allocator->Adapter(kArenaAllocStackMapStream)),
register_masks_(allocator->Adapter(kArenaAllocStackMapStream)),
+ dex_register_entries_(allocator->Adapter(kArenaAllocStackMapStream)),
stack_mask_max_(-1),
dex_pc_max_(0),
register_mask_max_(0),
@@ -89,30 +90,42 @@
code_info_encoding_.reserve(16);
}
+ // A dex register map entry for a single stack map entry, contains what registers are live as
+ // well as indices into the location catalog.
+ class DexRegisterMapEntry {
+ public:
+ static const size_t kOffsetUnassigned = -1;
+
+ BitVector* live_dex_registers_mask;
+ uint32_t num_dex_registers;
+ size_t locations_start_index;
+ // Computed fields
+ size_t hash = 0;
+ size_t offset = kOffsetUnassigned;
+
+ size_t ComputeSize(size_t catalog_size) const;
+ };
+
// See runtime/stack_map.h to know what these fields contain.
struct StackMapEntry {
uint32_t dex_pc;
CodeOffset native_pc_code_offset;
uint32_t register_mask;
BitVector* sp_mask;
- uint32_t num_dex_registers;
uint8_t inlining_depth;
- size_t dex_register_locations_start_index;
size_t inline_infos_start_index;
- BitVector* live_dex_registers_mask;
- uint32_t dex_register_map_hash;
- size_t same_dex_register_map_as_;
uint32_t stack_mask_index;
uint32_t register_mask_index;
+ DexRegisterMapEntry dex_register_entry;
+ size_t dex_register_map_index;
};
struct InlineInfoEntry {
uint32_t dex_pc; // DexFile::kDexNoIndex for intrinsified native methods.
ArtMethod* method;
uint32_t method_index;
- uint32_t num_dex_registers;
- BitVector* live_dex_registers_mask;
- size_t dex_register_locations_start_index;
+ DexRegisterMapEntry dex_register_entry;
+ size_t dex_register_map_index;
};
void BeginStackMapEntry(uint32_t dex_pc,
@@ -140,7 +153,8 @@
}
void SetStackMapNativePcOffset(size_t i, uint32_t native_pc_offset) {
- stack_maps_[i].native_pc_code_offset = CodeOffset::FromOffset(native_pc_offset, instruction_set_);
+ stack_maps_[i].native_pc_code_offset =
+ CodeOffset::FromOffset(native_pc_offset, instruction_set_);
}
// Prepares the stream to fill in a memory region. Must be called before FillIn.
@@ -150,8 +164,6 @@
private:
size_t ComputeDexRegisterLocationCatalogSize() const;
- size_t ComputeDexRegisterMapSize(uint32_t num_dex_registers,
- const BitVector* live_dex_registers_mask) const;
size_t ComputeDexRegisterMapsSize() const;
void ComputeInlineInfoEncoding(InlineInfoEncoding* encoding,
size_t dex_register_maps_bytes);
@@ -164,15 +176,24 @@
// Returns the number of unique register masks.
size_t PrepareRegisterMasks();
- // Returns the index of an entry with the same dex register map as the current_entry,
- // or kNoSameDexMapFound if no such entry exists.
- size_t FindEntryWithTheSameDexMap();
- bool HaveTheSameDexMaps(const StackMapEntry& a, const StackMapEntry& b) const;
+ // Deduplicate entry if possible and return the corresponding index into dex_register_entries_
+ // array. If entry is not a duplicate, a new entry is added to dex_register_entries_.
+ size_t AddDexRegisterMapEntry(const DexRegisterMapEntry& entry);
+
+ // Return true if the two dex register map entries are equal.
+ bool DexRegisterMapEntryEquals(const DexRegisterMapEntry& a, const DexRegisterMapEntry& b) const;
+
+ // Fill in the corresponding entries of a register map.
void FillInDexRegisterMap(DexRegisterMap dex_register_map,
uint32_t num_dex_registers,
const BitVector& live_dex_registers_mask,
uint32_t start_index_in_dex_register_locations) const;
+ // Returns the offset for the dex register inside of the dex register location region. See FillIn.
+ // Only copies the dex register map if the offset for the entry is not already assigned.
+ size_t MaybeCopyDexRegisterMap(DexRegisterMapEntry& entry,
+ size_t* current_offset,
+ MemoryRegion dex_register_locations_region);
void CheckDexRegisterMap(const CodeInfo& code_info,
const DexRegisterMap& dex_register_map,
size_t num_dex_registers,
@@ -199,6 +220,7 @@
ArenaVector<InlineInfoEntry> inline_infos_;
ArenaVector<uint8_t> stack_masks_;
ArenaVector<uint32_t> register_masks_;
+ ArenaVector<DexRegisterMapEntry> dex_register_entries_;
int stack_mask_max_;
uint32_t dex_pc_max_;
uint32_t register_mask_max_;
diff --git a/compiler/optimizing/stack_map_test.cc b/compiler/optimizing/stack_map_test.cc
index bd0aa6d..0416951 100644
--- a/compiler/optimizing/stack_map_test.cc
+++ b/compiler/optimizing/stack_map_test.cc
@@ -410,6 +410,100 @@
}
}
+TEST(StackMapTest, TestDeduplicateInlineInfoDexRegisterMap) {
+ ArenaPool pool;
+ ArenaAllocator arena(&pool);
+ StackMapStream stream(&arena, kRuntimeISA);
+ ArtMethod art_method;
+
+ ArenaBitVector sp_mask1(&arena, 0, true);
+ sp_mask1.SetBit(2);
+ sp_mask1.SetBit(4);
+ const size_t number_of_dex_registers = 2;
+ const size_t number_of_dex_registers_in_inline_info = 2;
+ stream.BeginStackMapEntry(0, 64, 0x3, &sp_mask1, number_of_dex_registers, 1);
+ stream.AddDexRegisterEntry(Kind::kInStack, 0); // Short location.
+ stream.AddDexRegisterEntry(Kind::kConstant, -2); // Large location.
+ stream.BeginInlineInfoEntry(&art_method, 3, number_of_dex_registers_in_inline_info);
+ stream.AddDexRegisterEntry(Kind::kInStack, 0); // Short location.
+ stream.AddDexRegisterEntry(Kind::kConstant, -2); // Large location.
+ stream.EndInlineInfoEntry();
+ stream.EndStackMapEntry();
+
+ size_t size = stream.PrepareForFillIn();
+ void* memory = arena.Alloc(size, kArenaAllocMisc);
+ MemoryRegion region(memory, size);
+ stream.FillIn(region);
+
+ CodeInfo code_info(region);
+ CodeInfoEncoding encoding = code_info.ExtractEncoding();
+ ASSERT_EQ(1u, code_info.GetNumberOfStackMaps(encoding));
+
+ uint32_t number_of_catalog_entries = code_info.GetNumberOfLocationCatalogEntries(encoding);
+ ASSERT_EQ(2u, number_of_catalog_entries);
+ DexRegisterLocationCatalog location_catalog = code_info.GetDexRegisterLocationCatalog(encoding);
+ // The Dex register location catalog contains:
+ // - one 1-byte short Dex register locations, and
+ // - one 5-byte large Dex register location.
+ const size_t expected_location_catalog_size = 1u + 5u;
+ ASSERT_EQ(expected_location_catalog_size, location_catalog.Size());
+
+ // First stack map.
+ {
+ StackMap stack_map = code_info.GetStackMapAt(0, encoding);
+ ASSERT_TRUE(stack_map.Equals(code_info.GetStackMapForDexPc(0, encoding)));
+ ASSERT_TRUE(stack_map.Equals(code_info.GetStackMapForNativePcOffset(64, encoding)));
+ ASSERT_EQ(0u, stack_map.GetDexPc(encoding.stack_map.encoding));
+ ASSERT_EQ(64u, stack_map.GetNativePcOffset(encoding.stack_map.encoding, kRuntimeISA));
+ ASSERT_EQ(0x3u, code_info.GetRegisterMaskOf(encoding, stack_map));
+
+ ASSERT_TRUE(CheckStackMask(code_info, encoding, stack_map, sp_mask1));
+
+ ASSERT_TRUE(stack_map.HasDexRegisterMap(encoding.stack_map.encoding));
+ DexRegisterMap map(code_info.GetDexRegisterMapOf(stack_map, encoding, number_of_dex_registers));
+ ASSERT_TRUE(map.IsDexRegisterLive(0));
+ ASSERT_TRUE(map.IsDexRegisterLive(1));
+ ASSERT_EQ(2u, map.GetNumberOfLiveDexRegisters(number_of_dex_registers));
+ // The Dex register map contains:
+ // - one 1-byte live bit mask, and
+ // - one 1-byte set of location catalog entry indices composed of two 2-bit values.
+ size_t expected_map_size = 1u + 1u;
+ ASSERT_EQ(expected_map_size, map.Size());
+
+ ASSERT_EQ(Kind::kInStack, map.GetLocationKind(0, number_of_dex_registers, code_info, encoding));
+ ASSERT_EQ(Kind::kConstant,
+ map.GetLocationKind(1, number_of_dex_registers, code_info, encoding));
+ ASSERT_EQ(Kind::kInStack,
+ map.GetLocationInternalKind(0, number_of_dex_registers, code_info, encoding));
+ ASSERT_EQ(Kind::kConstantLargeValue,
+ map.GetLocationInternalKind(1, number_of_dex_registers, code_info, encoding));
+ ASSERT_EQ(0, map.GetStackOffsetInBytes(0, number_of_dex_registers, code_info, encoding));
+ ASSERT_EQ(-2, map.GetConstant(1, number_of_dex_registers, code_info, encoding));
+
+ const size_t index0 =
+ map.GetLocationCatalogEntryIndex(0, number_of_dex_registers, number_of_catalog_entries);
+ const size_t index1 =
+ map.GetLocationCatalogEntryIndex(1, number_of_dex_registers, number_of_catalog_entries);
+ ASSERT_EQ(0u, index0);
+ ASSERT_EQ(1u, index1);
+ DexRegisterLocation location0 = location_catalog.GetDexRegisterLocation(index0);
+ DexRegisterLocation location1 = location_catalog.GetDexRegisterLocation(index1);
+ ASSERT_EQ(Kind::kInStack, location0.GetKind());
+ ASSERT_EQ(Kind::kConstant, location1.GetKind());
+ ASSERT_EQ(Kind::kInStack, location0.GetInternalKind());
+ ASSERT_EQ(Kind::kConstantLargeValue, location1.GetInternalKind());
+ ASSERT_EQ(0, location0.GetValue());
+ ASSERT_EQ(-2, location1.GetValue());
+
+ // Test that the inline info dex register map deduplicated to the same offset as the stack map
+ // one.
+ ASSERT_TRUE(stack_map.HasInlineInfo(encoding.stack_map.encoding));
+ InlineInfo inline_info = code_info.GetInlineInfoOf(stack_map, encoding);
+ EXPECT_EQ(inline_info.GetDexRegisterMapOffsetAtDepth(encoding.inline_info.encoding, 0),
+ stack_map.GetDexRegisterMapOffset(encoding.stack_map.encoding));
+ }
+}
+
TEST(StackMapTest, TestNonLiveDexRegisters) {
ArenaPool pool;
ArenaAllocator arena(&pool);
diff --git a/compiler/utils/x86/assembler_x86.cc b/compiler/utils/x86/assembler_x86.cc
index a24d49e..5a466e1 100644
--- a/compiler/utils/x86/assembler_x86.cc
+++ b/compiler/utils/x86/assembler_x86.cc
@@ -783,6 +783,79 @@
}
+void X86Assembler::movdqa(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitUint8(0x0F);
+ EmitUint8(0x6F);
+ EmitXmmRegisterOperand(dst, src);
+}
+
+
+void X86Assembler::movdqa(XmmRegister dst, const Address& src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitUint8(0x0F);
+ EmitUint8(0x6F);
+ EmitOperand(dst, src);
+}
+
+
+void X86Assembler::movdqu(XmmRegister dst, const Address& src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0xF3);
+ EmitUint8(0x0F);
+ EmitUint8(0x6F);
+ EmitOperand(dst, src);
+}
+
+
+void X86Assembler::movdqa(const Address& dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitUint8(0x0F);
+ EmitUint8(0x7F);
+ EmitOperand(src, dst);
+}
+
+
+void X86Assembler::movdqu(const Address& dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0xF3);
+ EmitUint8(0x0F);
+ EmitUint8(0x7F);
+ EmitOperand(src, dst);
+}
+
+
+void X86Assembler::paddd(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitUint8(0x0F);
+ EmitUint8(0xFE);
+ EmitXmmRegisterOperand(dst, src);
+}
+
+
+void X86Assembler::psubd(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitUint8(0x0F);
+ EmitUint8(0xFA);
+ EmitXmmRegisterOperand(dst, src);
+}
+
+
+void X86Assembler::pmulld(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitUint8(0x0F);
+ EmitUint8(0x38);
+ EmitUint8(0x40);
+ EmitXmmRegisterOperand(dst, src);
+}
+
+
void X86Assembler::cvtsi2ss(XmmRegister dst, Register src) {
AssemblerBuffer::EnsureCapacity ensured(&buffer_);
EmitUint8(0xF3);
@@ -990,10 +1063,27 @@
}
-void X86Assembler::andps(XmmRegister dst, XmmRegister src) {
+void X86Assembler::xorps(XmmRegister dst, const Address& src) {
AssemblerBuffer::EnsureCapacity ensured(&buffer_);
EmitUint8(0x0F);
- EmitUint8(0x54);
+ EmitUint8(0x57);
+ EmitOperand(dst, src);
+}
+
+
+void X86Assembler::xorps(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x0F);
+ EmitUint8(0x57);
+ EmitXmmRegisterOperand(dst, src);
+}
+
+
+void X86Assembler::pxor(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitUint8(0x0F);
+ EmitUint8(0xEF);
EmitXmmRegisterOperand(dst, src);
}
@@ -1007,35 +1097,19 @@
}
-void X86Assembler::orpd(XmmRegister dst, XmmRegister src) {
+void X86Assembler::andpd(XmmRegister dst, const Address& src) {
AssemblerBuffer::EnsureCapacity ensured(&buffer_);
EmitUint8(0x66);
EmitUint8(0x0F);
- EmitUint8(0x56);
- EmitXmmRegisterOperand(dst, src);
-}
-
-
-void X86Assembler::xorps(XmmRegister dst, const Address& src) {
- AssemblerBuffer::EnsureCapacity ensured(&buffer_);
- EmitUint8(0x0F);
- EmitUint8(0x57);
+ EmitUint8(0x54);
EmitOperand(dst, src);
}
-void X86Assembler::orps(XmmRegister dst, XmmRegister src) {
+void X86Assembler::andps(XmmRegister dst, XmmRegister src) {
AssemblerBuffer::EnsureCapacity ensured(&buffer_);
EmitUint8(0x0F);
- EmitUint8(0x56);
- EmitXmmRegisterOperand(dst, src);
-}
-
-
-void X86Assembler::xorps(XmmRegister dst, XmmRegister src) {
- AssemblerBuffer::EnsureCapacity ensured(&buffer_);
- EmitUint8(0x0F);
- EmitUint8(0x57);
+ EmitUint8(0x54);
EmitXmmRegisterOperand(dst, src);
}
@@ -1048,12 +1122,38 @@
}
-void X86Assembler::andpd(XmmRegister dst, const Address& src) {
+void X86Assembler::pand(XmmRegister dst, XmmRegister src) {
AssemblerBuffer::EnsureCapacity ensured(&buffer_);
EmitUint8(0x66);
EmitUint8(0x0F);
- EmitUint8(0x54);
- EmitOperand(dst, src);
+ EmitUint8(0xDB);
+ EmitXmmRegisterOperand(dst, src);
+}
+
+
+void X86Assembler::orpd(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitUint8(0x0F);
+ EmitUint8(0x56);
+ EmitXmmRegisterOperand(dst, src);
+}
+
+
+void X86Assembler::orps(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x0F);
+ EmitUint8(0x56);
+ EmitXmmRegisterOperand(dst, src);
+}
+
+
+void X86Assembler::por(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitUint8(0x0F);
+ EmitUint8(0xEB);
+ EmitXmmRegisterOperand(dst, src);
}
@@ -1076,6 +1176,16 @@
}
+void X86Assembler::pshufd(XmmRegister dst, XmmRegister src, const Immediate& imm) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitUint8(0x0F);
+ EmitUint8(0x70);
+ EmitXmmRegisterOperand(dst, src);
+ EmitUint8(imm.value());
+}
+
+
void X86Assembler::fldl(const Address& src) {
AssemblerBuffer::EnsureCapacity ensured(&buffer_);
EmitUint8(0xDD);
diff --git a/compiler/utils/x86/assembler_x86.h b/compiler/utils/x86/assembler_x86.h
index 4056ca6..4343e2e 100644
--- a/compiler/utils/x86/assembler_x86.h
+++ b/compiler/utils/x86/assembler_x86.h
@@ -430,6 +430,16 @@
void mulpd(XmmRegister dst, XmmRegister src);
void divpd(XmmRegister dst, XmmRegister src);
+ void movdqa(XmmRegister dst, XmmRegister src); // move
+ void movdqa(XmmRegister dst, const Address& src); // load aligned
+ void movdqu(XmmRegister dst, const Address& src); // load unaligned
+ void movdqa(const Address& dst, XmmRegister src); // store aligned
+ void movdqu(const Address& dst, XmmRegister src); // store unaligned
+
+ void paddd(XmmRegister dst, XmmRegister src); // no addr variant (for now)
+ void psubd(XmmRegister dst, XmmRegister src);
+ void pmulld(XmmRegister dst, XmmRegister src);
+
void cvtsi2ss(XmmRegister dst, Register src);
void cvtsi2sd(XmmRegister dst, Register src);
@@ -463,17 +473,21 @@
void xorpd(XmmRegister dst, XmmRegister src);
void xorps(XmmRegister dst, const Address& src);
void xorps(XmmRegister dst, XmmRegister src);
+ void pxor(XmmRegister dst, XmmRegister src); // no addr variant (for now)
void andpd(XmmRegister dst, XmmRegister src);
void andpd(XmmRegister dst, const Address& src);
void andps(XmmRegister dst, XmmRegister src);
void andps(XmmRegister dst, const Address& src);
+ void pand(XmmRegister dst, XmmRegister src); // no addr variant (for now)
- void orpd(XmmRegister dst, XmmRegister src);
+ void orpd(XmmRegister dst, XmmRegister src); // no addr variant (for now)
void orps(XmmRegister dst, XmmRegister src);
+ void por(XmmRegister dst, XmmRegister src);
void shufpd(XmmRegister dst, XmmRegister src, const Immediate& imm);
void shufps(XmmRegister dst, XmmRegister src, const Immediate& imm);
+ void pshufd(XmmRegister dst, XmmRegister src, const Immediate& imm);
void flds(const Address& src);
void fstps(const Address& dst);
diff --git a/compiler/utils/x86/assembler_x86_test.cc b/compiler/utils/x86/assembler_x86_test.cc
index 1768d8b..c6ab893 100644
--- a/compiler/utils/x86/assembler_x86_test.cc
+++ b/compiler/utils/x86/assembler_x86_test.cc
@@ -467,6 +467,28 @@
DriverStr(expected, "movupd_address");
}
+TEST_F(AssemblerX86Test, Movdqa) {
+ DriverStr(RepeatFF(&x86::X86Assembler::movdqa, "movdqa %{reg2}, %{reg1}"), "movdqa");
+}
+
+TEST_F(AssemblerX86Test, MovdqaAddr) {
+ GetAssembler()->movdqa(x86::XmmRegister(x86::XMM0), x86::Address(x86::Register(x86::ESP), 4));
+ GetAssembler()->movdqa(x86::Address(x86::Register(x86::ESP), 2), x86::XmmRegister(x86::XMM1));
+ const char* expected =
+ "movdqa 0x4(%ESP), %xmm0\n"
+ "movdqa %xmm1, 0x2(%ESP)\n";
+ DriverStr(expected, "movdqa_address");
+}
+
+TEST_F(AssemblerX86Test, MovdquAddr) {
+ GetAssembler()->movdqu(x86::XmmRegister(x86::XMM0), x86::Address(x86::Register(x86::ESP), 4));
+ GetAssembler()->movdqu(x86::Address(x86::Register(x86::ESP), 2), x86::XmmRegister(x86::XMM1));
+ const char* expected =
+ "movdqu 0x4(%ESP), %xmm0\n"
+ "movdqu %xmm1, 0x2(%ESP)\n";
+ DriverStr(expected, "movdqu_address");
+}
+
TEST_F(AssemblerX86Test, AddPS) {
DriverStr(RepeatFF(&x86::X86Assembler::addps, "addps %{reg2}, %{reg1}"), "addps");
}
@@ -499,6 +521,54 @@
DriverStr(RepeatFF(&x86::X86Assembler::divpd, "divpd %{reg2}, %{reg1}"), "divpd");
}
+TEST_F(AssemblerX86Test, PAddD) {
+ DriverStr(RepeatFF(&x86::X86Assembler::paddd, "paddd %{reg2}, %{reg1}"), "paddd");
+}
+
+TEST_F(AssemblerX86Test, PSubD) {
+ DriverStr(RepeatFF(&x86::X86Assembler::psubd, "psubd %{reg2}, %{reg1}"), "psubd");
+}
+
+TEST_F(AssemblerX86Test, PMullD) {
+ DriverStr(RepeatFF(&x86::X86Assembler::pmulld, "pmulld %{reg2}, %{reg1}"), "pmulld");
+}
+
+TEST_F(AssemblerX86Test, XorPD) {
+ DriverStr(RepeatFF(&x86::X86Assembler::xorpd, "xorpd %{reg2}, %{reg1}"), "xorpd");
+}
+
+TEST_F(AssemblerX86Test, XorPS) {
+ DriverStr(RepeatFF(&x86::X86Assembler::xorps, "xorps %{reg2}, %{reg1}"), "xorps");
+}
+
+TEST_F(AssemblerX86Test, PXor) {
+ DriverStr(RepeatFF(&x86::X86Assembler::pxor, "pxor %{reg2}, %{reg1}"), "pxor");
+}
+
+TEST_F(AssemblerX86Test, AndPD) {
+ DriverStr(RepeatFF(&x86::X86Assembler::andpd, "andpd %{reg2}, %{reg1}"), "andpd");
+}
+
+TEST_F(AssemblerX86Test, AndPS) {
+ DriverStr(RepeatFF(&x86::X86Assembler::andps, "andps %{reg2}, %{reg1}"), "andps");
+}
+
+TEST_F(AssemblerX86Test, PAnd) {
+ DriverStr(RepeatFF(&x86::X86Assembler::pand, "pand %{reg2}, %{reg1}"), "pand");
+}
+
+TEST_F(AssemblerX86Test, OrPD) {
+ DriverStr(RepeatFF(&x86::X86Assembler::orpd, "orpd %{reg2}, %{reg1}"), "orpd");
+}
+
+TEST_F(AssemblerX86Test, OrPS) {
+ DriverStr(RepeatFF(&x86::X86Assembler::orps, "orps %{reg2}, %{reg1}"), "orps");
+}
+
+TEST_F(AssemblerX86Test, POr) {
+ DriverStr(RepeatFF(&x86::X86Assembler::por, "por %{reg2}, %{reg1}"), "por");
+}
+
TEST_F(AssemblerX86Test, ShufPS) {
DriverStr(RepeatFFI(&x86::X86Assembler::shufps, 1, "shufps ${imm}, %{reg2}, %{reg1}"), "shufps");
}
@@ -507,6 +577,10 @@
DriverStr(RepeatFFI(&x86::X86Assembler::shufpd, 1, "shufpd ${imm}, %{reg2}, %{reg1}"), "shufpd");
}
+TEST_F(AssemblerX86Test, PShufD) {
+ DriverStr(RepeatFFI(&x86::X86Assembler::pshufd, 1, "pshufd ${imm}, %{reg2}, %{reg1}"), "pshufd");
+}
+
/////////////////
// Near labels //
/////////////////
diff --git a/compiler/utils/x86_64/assembler_x86_64.cc b/compiler/utils/x86_64/assembler_x86_64.cc
index c2c44ab..b41be80 100644
--- a/compiler/utils/x86_64/assembler_x86_64.cc
+++ b/compiler/utils/x86_64/assembler_x86_64.cc
@@ -832,6 +832,87 @@
}
+void X86_64Assembler::movdqa(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitOptionalRex32(dst, src);
+ EmitUint8(0x0F);
+ EmitUint8(0x6F);
+ EmitXmmRegisterOperand(dst.LowBits(), src);
+}
+
+
+void X86_64Assembler::movdqa(XmmRegister dst, const Address& src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitOptionalRex32(dst, src);
+ EmitUint8(0x0F);
+ EmitUint8(0x6F);
+ EmitOperand(dst.LowBits(), src);
+}
+
+
+void X86_64Assembler::movdqu(XmmRegister dst, const Address& src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0xF3);
+ EmitOptionalRex32(dst, src);
+ EmitUint8(0x0F);
+ EmitUint8(0x6F);
+ EmitOperand(dst.LowBits(), src);
+}
+
+
+void X86_64Assembler::movdqa(const Address& dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitOptionalRex32(src, dst);
+ EmitUint8(0x0F);
+ EmitUint8(0x7F);
+ EmitOperand(src.LowBits(), dst);
+}
+
+
+void X86_64Assembler::movdqu(const Address& dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0xF3);
+ EmitOptionalRex32(src, dst);
+ EmitUint8(0x0F);
+ EmitUint8(0x7F);
+ EmitOperand(src.LowBits(), dst);
+}
+
+
+void X86_64Assembler::paddd(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitOptionalRex32(dst, src);
+ EmitUint8(0x0F);
+ EmitUint8(0xFE);
+ EmitXmmRegisterOperand(dst.LowBits(), src);
+}
+
+
+void X86_64Assembler::psubd(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitOptionalRex32(dst, src);
+ EmitUint8(0x0F);
+ EmitUint8(0xFA);
+ EmitXmmRegisterOperand(dst.LowBits(), src);
+}
+
+
+void X86_64Assembler::pmulld(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitOptionalRex32(dst, src);
+ EmitUint8(0x0F);
+ EmitUint8(0x38);
+ EmitUint8(0x40);
+ EmitXmmRegisterOperand(dst.LowBits(), src);
+}
+
+
void X86_64Assembler::cvtsi2ss(XmmRegister dst, CpuRegister src) {
cvtsi2ss(dst, src, false);
}
@@ -1170,6 +1251,16 @@
}
+void X86_64Assembler::pxor(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitOptionalRex32(dst, src);
+ EmitUint8(0x0F);
+ EmitUint8(0xEF);
+ EmitXmmRegisterOperand(dst.LowBits(), src);
+}
+
+
void X86_64Assembler::andpd(XmmRegister dst, const Address& src) {
AssemblerBuffer::EnsureCapacity ensured(&buffer_);
EmitUint8(0x66);
@@ -1196,6 +1287,15 @@
EmitXmmRegisterOperand(dst.LowBits(), src);
}
+void X86_64Assembler::pand(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitOptionalRex32(dst, src);
+ EmitUint8(0x0F);
+ EmitUint8(0xDB);
+ EmitXmmRegisterOperand(dst.LowBits(), src);
+}
+
void X86_64Assembler::orpd(XmmRegister dst, XmmRegister src) {
AssemblerBuffer::EnsureCapacity ensured(&buffer_);
EmitUint8(0x66);
@@ -1213,6 +1313,14 @@
EmitXmmRegisterOperand(dst.LowBits(), src);
}
+void X86_64Assembler::por(XmmRegister dst, XmmRegister src) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitOptionalRex32(dst, src);
+ EmitUint8(0x0F);
+ EmitUint8(0xEB);
+ EmitXmmRegisterOperand(dst.LowBits(), src);
+}
void X86_64Assembler::shufpd(XmmRegister dst, XmmRegister src, const Immediate& imm) {
AssemblerBuffer::EnsureCapacity ensured(&buffer_);
@@ -1235,6 +1343,17 @@
}
+void X86_64Assembler::pshufd(XmmRegister dst, XmmRegister src, const Immediate& imm) {
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ EmitUint8(0x66);
+ EmitOptionalRex32(dst, src);
+ EmitUint8(0x0F);
+ EmitUint8(0x70);
+ EmitXmmRegisterOperand(dst.LowBits(), src);
+ EmitUint8(imm.value());
+}
+
+
void X86_64Assembler::fldl(const Address& src) {
AssemblerBuffer::EnsureCapacity ensured(&buffer_);
EmitUint8(0xDD);
diff --git a/compiler/utils/x86_64/assembler_x86_64.h b/compiler/utils/x86_64/assembler_x86_64.h
index e140b45..43ea12a 100644
--- a/compiler/utils/x86_64/assembler_x86_64.h
+++ b/compiler/utils/x86_64/assembler_x86_64.h
@@ -446,6 +446,16 @@
void mulpd(XmmRegister dst, XmmRegister src);
void divpd(XmmRegister dst, XmmRegister src);
+ void movdqa(XmmRegister dst, XmmRegister src); // move
+ void movdqa(XmmRegister dst, const Address& src); // load aligned
+ void movdqu(XmmRegister dst, const Address& src); // load unaligned
+ void movdqa(const Address& dst, XmmRegister src); // store aligned
+ void movdqu(const Address& dst, XmmRegister src); // store unaligned
+
+ void paddd(XmmRegister dst, XmmRegister src); // no addr variant (for now)
+ void psubd(XmmRegister dst, XmmRegister src);
+ void pmulld(XmmRegister dst, XmmRegister src);
+
void cvtsi2ss(XmmRegister dst, CpuRegister src); // Note: this is the r/m32 version.
void cvtsi2ss(XmmRegister dst, CpuRegister src, bool is64bit);
void cvtsi2ss(XmmRegister dst, const Address& src, bool is64bit);
@@ -487,16 +497,20 @@
void xorpd(XmmRegister dst, XmmRegister src);
void xorps(XmmRegister dst, const Address& src);
void xorps(XmmRegister dst, XmmRegister src);
+ void pxor(XmmRegister dst, XmmRegister src); // no addr variant (for now)
void andpd(XmmRegister dst, const Address& src);
void andpd(XmmRegister dst, XmmRegister src);
- void andps(XmmRegister dst, XmmRegister src);
+ void andps(XmmRegister dst, XmmRegister src); // no addr variant (for now)
+ void pand(XmmRegister dst, XmmRegister src);
- void orpd(XmmRegister dst, XmmRegister src);
+ void orpd(XmmRegister dst, XmmRegister src); // no addr variant (for now)
void orps(XmmRegister dst, XmmRegister src);
+ void por(XmmRegister dst, XmmRegister src);
void shufpd(XmmRegister dst, XmmRegister src, const Immediate& imm);
void shufps(XmmRegister dst, XmmRegister src, const Immediate& imm);
+ void pshufd(XmmRegister dst, XmmRegister src, const Immediate& imm);
void flds(const Address& src);
void fstps(const Address& dst);
diff --git a/compiler/utils/x86_64/assembler_x86_64_test.cc b/compiler/utils/x86_64/assembler_x86_64_test.cc
index efa5cc9..aeb1911 100644
--- a/compiler/utils/x86_64/assembler_x86_64_test.cc
+++ b/compiler/utils/x86_64/assembler_x86_64_test.cc
@@ -1034,6 +1034,28 @@
DriverStr(RepeatFF(&x86_64::X86_64Assembler::movsd, "movsd %{reg2}, %{reg1}"), "movsd");
}
+TEST_F(AssemblerX86_64Test, Movdqa) {
+ DriverStr(RepeatFF(&x86_64::X86_64Assembler::movdqa, "movdqa %{reg2}, %{reg1}"), "movapd");
+}
+
+TEST_F(AssemblerX86_64Test, MovdqaAddr) {
+ GetAssembler()->movdqa(x86_64::XmmRegister(x86_64::XMM0), x86_64::Address(x86_64::CpuRegister(x86_64::RSP), 4));
+ GetAssembler()->movdqa(x86_64::Address(x86_64::CpuRegister(x86_64::RSP), 2), x86_64::XmmRegister(x86_64::XMM1));
+ const char* expected =
+ "movdqa 0x4(%RSP), %xmm0\n"
+ "movdqa %xmm1, 0x2(%RSP)\n";
+ DriverStr(expected, "movdqa_address");
+}
+
+TEST_F(AssemblerX86_64Test, MovdquAddr) {
+ GetAssembler()->movdqu(x86_64::XmmRegister(x86_64::XMM0), x86_64::Address(x86_64::CpuRegister(x86_64::RSP), 4));
+ GetAssembler()->movdqu(x86_64::Address(x86_64::CpuRegister(x86_64::RSP), 2), x86_64::XmmRegister(x86_64::XMM1));
+ const char* expected =
+ "movdqu 0x4(%RSP), %xmm0\n"
+ "movdqu %xmm1, 0x2(%RSP)\n";
+ DriverStr(expected, "movdqu_address");
+}
+
TEST_F(AssemblerX86_64Test, Movd1) {
DriverStr(RepeatFR(&x86_64::X86_64Assembler::movd, "movd %{reg2}, %{reg1}"), "movd.1");
}
@@ -1106,6 +1128,18 @@
DriverStr(RepeatFF(&x86_64::X86_64Assembler::divpd, "divpd %{reg2}, %{reg1}"), "divpd");
}
+TEST_F(AssemblerX86_64Test, Paddd) {
+ DriverStr(RepeatFF(&x86_64::X86_64Assembler::paddd, "paddd %{reg2}, %{reg1}"), "paddd");
+}
+
+TEST_F(AssemblerX86_64Test, Psubd) {
+ DriverStr(RepeatFF(&x86_64::X86_64Assembler::psubd, "psubd %{reg2}, %{reg1}"), "psubd");
+}
+
+TEST_F(AssemblerX86_64Test, Pmulld) {
+ DriverStr(RepeatFF(&x86_64::X86_64Assembler::pmulld, "pmulld %{reg2}, %{reg1}"), "pmulld");
+}
+
TEST_F(AssemblerX86_64Test, Cvtsi2ss) {
DriverStr(RepeatFr(&x86_64::X86_64Assembler::cvtsi2ss, "cvtsi2ss %{reg2}, %{reg1}"), "cvtsi2ss");
}
@@ -1187,6 +1221,10 @@
DriverStr(RepeatFF(&x86_64::X86_64Assembler::xorpd, "xorpd %{reg2}, %{reg1}"), "xorpd");
}
+TEST_F(AssemblerX86_64Test, Pxor) {
+ DriverStr(RepeatFF(&x86_64::X86_64Assembler::pxor, "pxor %{reg2}, %{reg1}"), "pxor");
+}
+
TEST_F(AssemblerX86_64Test, Andps) {
DriverStr(RepeatFF(&x86_64::X86_64Assembler::andps, "andps %{reg2}, %{reg1}"), "andps");
}
@@ -1195,6 +1233,10 @@
DriverStr(RepeatFF(&x86_64::X86_64Assembler::andpd, "andpd %{reg2}, %{reg1}"), "andpd");
}
+TEST_F(AssemblerX86_64Test, Pand) {
+ DriverStr(RepeatFF(&x86_64::X86_64Assembler::pand, "pand %{reg2}, %{reg1}"), "pand");
+}
+
TEST_F(AssemblerX86_64Test, Orps) {
DriverStr(RepeatFF(&x86_64::X86_64Assembler::orps, "orps %{reg2}, %{reg1}"), "orps");
}
@@ -1203,6 +1245,10 @@
DriverStr(RepeatFF(&x86_64::X86_64Assembler::orpd, "orpd %{reg2}, %{reg1}"), "orpd");
}
+TEST_F(AssemblerX86_64Test, Por) {
+ DriverStr(RepeatFF(&x86_64::X86_64Assembler::por, "por %{reg2}, %{reg1}"), "por");
+}
+
TEST_F(AssemblerX86_64Test, Shufps) {
DriverStr(RepeatFFI(&x86_64::X86_64Assembler::shufps, 1, "shufps ${imm}, %{reg2}, %{reg1}"), "shufps");
}
@@ -1211,6 +1257,10 @@
DriverStr(RepeatFFI(&x86_64::X86_64Assembler::shufpd, 1, "shufpd ${imm}, %{reg2}, %{reg1}"), "shufpd");
}
+TEST_F(AssemblerX86_64Test, PShufd) {
+ DriverStr(RepeatFFI(&x86_64::X86_64Assembler::pshufd, 1, "pshufd ${imm}, %{reg2}, %{reg1}"), "pshufd");
+}
+
TEST_F(AssemblerX86_64Test, UcomissAddress) {
GetAssembler()->ucomiss(x86_64::XmmRegister(x86_64::XMM0), x86_64::Address(
x86_64::CpuRegister(x86_64::RDI), x86_64::CpuRegister(x86_64::RBX), x86_64::TIMES_4, 12));
diff --git a/compiler/verifier_deps_test.cc b/compiler/verifier_deps_test.cc
index 5fc9972..c892b25 100644
--- a/compiler/verifier_deps_test.cc
+++ b/compiler/verifier_deps_test.cc
@@ -233,7 +233,7 @@
const DexFile::ClassDef& class_def = dex_file->GetClassDef(i);
const char* descriptor = dex_file->GetClassDescriptor(class_def);
cls.Assign(class_linker_->FindClass(soa.Self(), descriptor, class_loader_handle));
- if (cls.Get() == nullptr) {
+ if (cls == nullptr) {
CHECK(soa.Self()->IsExceptionPending());
soa.Self()->ClearException();
} else if (set.find(class_def.class_idx_) == set.end()) {
diff --git a/dex2oat/dex2oat.cc b/dex2oat/dex2oat.cc
index 192fc27..026a567 100644
--- a/dex2oat/dex2oat.cc
+++ b/dex2oat/dex2oat.cc
@@ -419,12 +419,9 @@
} while (false)
public:
- explicit WatchDog(bool is_watch_dog_enabled) {
- is_watch_dog_enabled_ = is_watch_dog_enabled;
- if (!is_watch_dog_enabled_) {
- return;
- }
- shutting_down_ = false;
+ explicit WatchDog(int64_t timeout_in_milliseconds)
+ : timeout_in_milliseconds_(timeout_in_milliseconds),
+ shutting_down_(false) {
const char* reason = "dex2oat watch dog thread startup";
CHECK_WATCH_DOG_PTHREAD_CALL(pthread_mutex_init, (&mutex_, nullptr), reason);
CHECK_WATCH_DOG_PTHREAD_CALL(pthread_cond_init, (&cond_, nullptr), reason);
@@ -433,9 +430,6 @@
CHECK_WATCH_DOG_PTHREAD_CALL(pthread_attr_destroy, (&attr_), reason);
}
~WatchDog() {
- if (!is_watch_dog_enabled_) {
- return;
- }
const char* reason = "dex2oat watch dog thread shutdown";
CHECK_WATCH_DOG_PTHREAD_CALL(pthread_mutex_lock, (&mutex_), reason);
shutting_down_ = true;
@@ -448,6 +442,23 @@
CHECK_WATCH_DOG_PTHREAD_CALL(pthread_mutex_destroy, (&mutex_), reason);
}
+ // TODO: tune the multiplier for GC verification, the following is just to make the timeout
+ // large.
+ static constexpr int64_t kWatchdogVerifyMultiplier =
+ kVerifyObjectSupport > kVerifyObjectModeFast ? 100 : 1;
+
+ // When setting timeouts, keep in mind that the build server may not be as fast as your
+ // desktop. Debug builds are slower so they have larger timeouts.
+ static constexpr int64_t kWatchdogSlowdownFactor = kIsDebugBuild ? 5U : 1U;
+
+ // 9.5 minutes scaled by kSlowdownFactor. This is slightly smaller than the Package Manager
+ // watchdog (PackageManagerService.WATCHDOG_TIMEOUT, 10 minutes), so that dex2oat will abort
+ // itself before that watchdog would take down the system server.
+ static constexpr int64_t kWatchDogTimeoutSeconds = kWatchdogSlowdownFactor * (9 * 60 + 30);
+
+ static constexpr int64_t kDefaultWatchdogTimeoutInMS =
+ kWatchdogVerifyMultiplier * kWatchDogTimeoutSeconds * 1000;
+
private:
static void* CallBack(void* arg) {
WatchDog* self = reinterpret_cast<WatchDog*>(arg);
@@ -470,18 +481,15 @@
}
void Wait() {
- // TODO: tune the multiplier for GC verification, the following is just to make the timeout
- // large.
- constexpr int64_t multiplier = kVerifyObjectSupport > kVerifyObjectModeFast ? 100 : 1;
timespec timeout_ts;
- InitTimeSpec(true, CLOCK_REALTIME, multiplier * kWatchDogTimeoutSeconds * 1000, 0, &timeout_ts);
+ InitTimeSpec(true, CLOCK_REALTIME, timeout_in_milliseconds_, 0, &timeout_ts);
const char* reason = "dex2oat watch dog thread waiting";
CHECK_WATCH_DOG_PTHREAD_CALL(pthread_mutex_lock, (&mutex_), reason);
while (!shutting_down_) {
int rc = TEMP_FAILURE_RETRY(pthread_cond_timedwait(&cond_, &mutex_, &timeout_ts));
if (rc == ETIMEDOUT) {
Fatal(StringPrintf("dex2oat did not finish after %" PRId64 " seconds",
- kWatchDogTimeoutSeconds));
+ timeout_in_milliseconds_/1000));
} else if (rc != 0) {
std::string message(StringPrintf("pthread_cond_timedwait failed: %s",
strerror(errno)));
@@ -491,16 +499,7 @@
CHECK_WATCH_DOG_PTHREAD_CALL(pthread_mutex_unlock, (&mutex_), reason);
}
- // When setting timeouts, keep in mind that the build server may not be as fast as your desktop.
- // Debug builds are slower so they have larger timeouts.
- static constexpr int64_t kSlowdownFactor = kIsDebugBuild ? 5U : 1U;
-
- // 9.5 minutes scaled by kSlowdownFactor. This is slightly smaller than the Package Manager
- // watchdog (PackageManagerService.WATCHDOG_TIMEOUT, 10 minutes), so that dex2oat will abort
- // itself before that watchdog would take down the system server.
- static constexpr int64_t kWatchDogTimeoutSeconds = kSlowdownFactor * (9 * 60 + 30);
-
- bool is_watch_dog_enabled_;
+ const int64_t timeout_in_milliseconds_;
bool shutting_down_;
// TODO: Switch to Mutex when we can guarantee it won't prevent shutdown in error cases.
pthread_mutex_t mutex_;
@@ -591,6 +590,7 @@
struct ParserOptions {
std::vector<const char*> oat_symbols;
std::string boot_image_filename;
+ int64_t watch_dog_timeout_in_ms = -1;
bool watch_dog_enabled = true;
bool requested_specific_compiler = false;
std::string error_msg;
@@ -919,7 +919,10 @@
// Done with usage checks, enable watchdog if requested
if (parser_options->watch_dog_enabled) {
- watchdog_.reset(new WatchDog(true));
+ int64_t timeout = parser_options->watch_dog_timeout_in_ms > 0
+ ? parser_options->watch_dog_timeout_in_ms
+ : WatchDog::kDefaultWatchdogTimeoutInMS;
+ watchdog_.reset(new WatchDog(timeout));
}
// Fill some values into the key-value store for the oat header.
@@ -1150,6 +1153,11 @@
parser_options->watch_dog_enabled = true;
} else if (option == "--no-watch-dog") {
parser_options->watch_dog_enabled = false;
+ } else if (option.starts_with("--watchdog-timeout=")) {
+ ParseIntOption(option,
+ "--watchdog-timeout",
+ &parser_options->watch_dog_timeout_in_ms,
+ Usage);
} else if (option.starts_with("-j")) {
ParseJ(option);
} else if (option.starts_with("--image=")) {
diff --git a/dex2oat/dex2oat_test.cc b/dex2oat/dex2oat_test.cc
index 90b4955..5dcdd9e 100644
--- a/dex2oat/dex2oat_test.cc
+++ b/dex2oat/dex2oat_test.cc
@@ -66,7 +66,7 @@
bool success = Dex2Oat(args, &error_msg);
if (expect_success) {
- ASSERT_TRUE(success) << error_msg;
+ ASSERT_TRUE(success) << error_msg << std::endl << output_;
// Verify the odex file was generated as expected.
std::unique_ptr<OatFile> odex_file(OatFile::Open(odex_location.c_str(),
@@ -658,4 +658,41 @@
RunTest();
}
+class Dex2oatWatchdogTest : public Dex2oatTest {
+ protected:
+ void RunTest(bool expect_success, const std::vector<std::string>& extra_args = {}) {
+ std::string dex_location = GetScratchDir() + "/Dex2OatSwapTest.jar";
+ std::string odex_location = GetOdexDir() + "/Dex2OatSwapTest.odex";
+
+ Copy(GetTestDexFileName(), dex_location);
+
+ std::vector<std::string> copy(extra_args);
+
+ std::string swap_location = GetOdexDir() + "/Dex2OatSwapTest.odex.swap";
+ copy.push_back("--swap-file=" + swap_location);
+ GenerateOdexForTest(dex_location,
+ odex_location,
+ CompilerFilter::kSpeed,
+ copy,
+ expect_success);
+ }
+
+ std::string GetTestDexFileName() {
+ return GetDexSrc1();
+ }
+};
+
+TEST_F(Dex2oatWatchdogTest, TestWatchdogOK) {
+ // Check with default.
+ RunTest(true);
+
+ // Check with ten minutes.
+ RunTest(true, { "--watchdog-timeout=600000" });
+}
+
+TEST_F(Dex2oatWatchdogTest, TestWatchdogTrigger) {
+ // Check with ten milliseconds.
+ RunTest(false, { "--watchdog-timeout=10" });
+}
+
} // namespace art
diff --git a/dexdump/dexdump.cc b/dexdump/dexdump.cc
index d5776fa..5656ddd 100644
--- a/dexdump/dexdump.cc
+++ b/dexdump/dexdump.cc
@@ -881,26 +881,30 @@
outSize = snprintf(buf.get(), bufSize, "[obj+%0*x]", width, index);
break;
case Instruction::kIndexMethodAndProtoRef: {
- std::string method("<method?>");
- std::string proto("<proto?>");
- if (index < pDexFile->GetHeader().method_ids_size_) {
- const DexFile::MethodId& pMethodId = pDexFile->GetMethodId(index);
- const char* name = pDexFile->StringDataByIdx(pMethodId.name_idx_);
- const Signature signature = pDexFile->GetMethodSignature(pMethodId);
- const char* backDescriptor = pDexFile->StringByTypeIdx(pMethodId.class_idx_);
- method = android::base::StringPrintf("%s.%s:%s",
- backDescriptor,
- name,
- signature.ToString().c_str());
- }
- if (secondary_index < pDexFile->GetHeader().proto_ids_size_) {
- const DexFile::ProtoId& protoId = pDexFile->GetProtoId(secondary_index);
- const Signature signature = pDexFile->GetProtoSignature(protoId);
- proto = signature.ToString();
- }
- outSize = snprintf(buf.get(), bufSize, "%s, %s // method@%0*x, proto@%0*x",
- method.c_str(), proto.c_str(), width, index, width, secondary_index);
+ std::string method("<method?>");
+ std::string proto("<proto?>");
+ if (index < pDexFile->GetHeader().method_ids_size_) {
+ const DexFile::MethodId& pMethodId = pDexFile->GetMethodId(index);
+ const char* name = pDexFile->StringDataByIdx(pMethodId.name_idx_);
+ const Signature signature = pDexFile->GetMethodSignature(pMethodId);
+ const char* backDescriptor = pDexFile->StringByTypeIdx(pMethodId.class_idx_);
+ method = android::base::StringPrintf("%s.%s:%s",
+ backDescriptor,
+ name,
+ signature.ToString().c_str());
}
+ if (secondary_index < pDexFile->GetHeader().proto_ids_size_) {
+ const DexFile::ProtoId& protoId = pDexFile->GetProtoId(secondary_index);
+ const Signature signature = pDexFile->GetProtoSignature(protoId);
+ proto = signature.ToString();
+ }
+ outSize = snprintf(buf.get(), bufSize, "%s, %s // method@%0*x, proto@%0*x",
+ method.c_str(), proto.c_str(), width, index, width, secondary_index);
+ break;
+ }
+ case Instruction::kIndexCallSiteRef:
+ // Call site information is too large to detail in disassembly so just output the index.
+ outSize = snprintf(buf.get(), bufSize, "call_site@%0*x", width, index);
break;
// SOME NOT SUPPORTED:
// case Instruction::kIndexVaries:
@@ -1581,6 +1585,198 @@
free(accessStr);
}
+static void dumpMethodHandle(const DexFile* pDexFile, u4 idx) {
+ const DexFile::MethodHandleItem& mh = pDexFile->GetMethodHandle(idx);
+ bool is_invoke = false;
+ const char* type;
+ switch (static_cast<DexFile::MethodHandleType>(mh.method_handle_type_)) {
+ case DexFile::MethodHandleType::kStaticPut:
+ type = "put-static";
+ break;
+ case DexFile::MethodHandleType::kStaticGet:
+ type = "get-static";
+ break;
+ case DexFile::MethodHandleType::kInstancePut:
+ type = "put-instance";
+ break;
+ case DexFile::MethodHandleType::kInstanceGet:
+ type = "get-instance";
+ break;
+ case DexFile::MethodHandleType::kInvokeStatic:
+ type = "invoke-static";
+ is_invoke = true;
+ break;
+ case DexFile::MethodHandleType::kInvokeInstance:
+ type = "invoke-instance";
+ is_invoke = true;
+ break;
+ case DexFile::MethodHandleType::kInvokeConstructor:
+ type = "invoke-constructor";
+ is_invoke = true;
+ break;
+ }
+
+ const char* declaring_class;
+ const char* member;
+ std::string member_type;
+ if (is_invoke) {
+ const DexFile::MethodId& method_id = pDexFile->GetMethodId(mh.field_or_method_idx_);
+ declaring_class = pDexFile->GetMethodDeclaringClassDescriptor(method_id);
+ member = pDexFile->GetMethodName(method_id);
+ member_type = pDexFile->GetMethodSignature(method_id).ToString();
+ } else {
+ const DexFile::FieldId& field_id = pDexFile->GetFieldId(mh.field_or_method_idx_);
+ declaring_class = pDexFile->GetFieldDeclaringClassDescriptor(field_id);
+ member = pDexFile->GetFieldName(field_id);
+ member_type = pDexFile->GetFieldTypeDescriptor(field_id);
+ }
+
+ if (gOptions.outputFormat == OUTPUT_PLAIN) {
+ fprintf(gOutFile, "Method handle #%u:\n", idx);
+ fprintf(gOutFile, " type : %s\n", type);
+ fprintf(gOutFile, " target : %s %s\n", declaring_class, member);
+ fprintf(gOutFile, " target_type : %s\n", member_type.c_str());
+ } else {
+ fprintf(gOutFile, "<method_handle index=\"%u\"\n", idx);
+ fprintf(gOutFile, " type=\"%s\"\n", type);
+ fprintf(gOutFile, " target_class=\"%s\"\n", declaring_class);
+ fprintf(gOutFile, " target_member=\"%s\"\n", member);
+ fprintf(gOutFile, " target_member_type=");
+ dumpEscapedString(member_type.c_str());
+ fprintf(gOutFile, "\n>\n</method_handle>\n");
+ }
+}
+
+static void dumpCallSite(const DexFile* pDexFile, u4 idx) {
+ const DexFile::CallSiteIdItem& call_site_id = pDexFile->GetCallSiteId(idx);
+ CallSiteArrayValueIterator it(*pDexFile, call_site_id);
+ if (it.Size() < 3) {
+ fprintf(stderr, "ERROR: Call site %u has too few values.\n", idx);
+ return;
+ }
+
+ uint32_t method_handle_idx = static_cast<uint32_t>(it.GetJavaValue().i);
+ it.Next();
+ dex::StringIndex method_name_idx = static_cast<dex::StringIndex>(it.GetJavaValue().i);
+ const char* method_name = pDexFile->StringDataByIdx(method_name_idx);
+ it.Next();
+ uint32_t method_type_idx = static_cast<uint32_t>(it.GetJavaValue().i);
+ const DexFile::ProtoId& method_type_id = pDexFile->GetProtoId(method_type_idx);
+ std::string method_type = pDexFile->GetProtoSignature(method_type_id).ToString();
+ it.Next();
+
+ if (gOptions.outputFormat == OUTPUT_PLAIN) {
+ fprintf(gOutFile, "Call site #%u:\n", idx);
+ fprintf(gOutFile, " link_argument[0] : %u (MethodHandle)\n", method_handle_idx);
+ fprintf(gOutFile, " link_argument[1] : %s (String)\n", method_name);
+ fprintf(gOutFile, " link_argument[2] : %s (MethodType)\n", method_type.c_str());
+ } else {
+ fprintf(gOutFile, "<call_site index=\"%u\">\n", idx);
+ fprintf(gOutFile,
+ "<link_argument index=\"0\" type=\"MethodHandle\" value=\"%u\"/>\n",
+ method_handle_idx);
+ fprintf(gOutFile,
+ "<link_argument index=\"1\" type=\"String\" values=\"%s\"/>\n",
+ method_name);
+ fprintf(gOutFile,
+ "<link_argument index=\"2\" type=\"MethodType\" value=\"%s\"/>\n",
+ method_type.c_str());
+ }
+
+ size_t argument = 3;
+ while (it.HasNext()) {
+ const char* type;
+ std::string value;
+ switch (it.GetValueType()) {
+ case EncodedArrayValueIterator::ValueType::kByte:
+ type = "byte";
+ value = android::base::StringPrintf("%u", it.GetJavaValue().b);
+ break;
+ case EncodedArrayValueIterator::ValueType::kShort:
+ type = "short";
+ value = android::base::StringPrintf("%d", it.GetJavaValue().s);
+ break;
+ case EncodedArrayValueIterator::ValueType::kChar:
+ type = "char";
+ value = android::base::StringPrintf("%u", it.GetJavaValue().c);
+ break;
+ case EncodedArrayValueIterator::ValueType::kInt:
+ type = "int";
+ value = android::base::StringPrintf("%d", it.GetJavaValue().i);
+ break;
+ case EncodedArrayValueIterator::ValueType::kLong:
+ type = "long";
+ value = android::base::StringPrintf("%" PRId64, it.GetJavaValue().j);
+ break;
+ case EncodedArrayValueIterator::ValueType::kFloat:
+ type = "float";
+ value = android::base::StringPrintf("%g", it.GetJavaValue().f);
+ break;
+ case EncodedArrayValueIterator::ValueType::kDouble:
+ type = "double";
+ value = android::base::StringPrintf("%g", it.GetJavaValue().d);
+ break;
+ case EncodedArrayValueIterator::ValueType::kMethodType: {
+ type = "MethodType";
+ uint32_t proto_idx = static_cast<uint32_t>(it.GetJavaValue().i);
+ const DexFile::ProtoId& proto_id = pDexFile->GetProtoId(proto_idx);
+ value = pDexFile->GetProtoSignature(proto_id).ToString();
+ break;
+ }
+ case EncodedArrayValueIterator::ValueType::kMethodHandle:
+ type = "MethodHandle";
+ value = android::base::StringPrintf("%d", it.GetJavaValue().i);
+ break;
+ case EncodedArrayValueIterator::ValueType::kString: {
+ type = "String";
+ dex::StringIndex string_idx = static_cast<dex::StringIndex>(it.GetJavaValue().i);
+ value = pDexFile->StringDataByIdx(string_idx);
+ break;
+ }
+ case EncodedArrayValueIterator::ValueType::kType: {
+ type = "Class";
+ dex::TypeIndex type_idx = static_cast<dex::TypeIndex>(it.GetJavaValue().i);
+ const DexFile::ClassDef* class_def = pDexFile->FindClassDef(type_idx);
+ value = pDexFile->GetClassDescriptor(*class_def);
+ value = descriptorClassToDot(value.c_str()).get();
+ break;
+ }
+ case EncodedArrayValueIterator::ValueType::kField:
+ case EncodedArrayValueIterator::ValueType::kMethod:
+ case EncodedArrayValueIterator::ValueType::kEnum:
+ case EncodedArrayValueIterator::ValueType::kArray:
+ case EncodedArrayValueIterator::ValueType::kAnnotation:
+ // Unreachable based on current EncodedArrayValueIterator::Next().
+ UNIMPLEMENTED(FATAL) << " type " << type;
+ UNREACHABLE();
+ break;
+ case EncodedArrayValueIterator::ValueType::kNull:
+ type = "Null";
+ value = "null";
+ break;
+ case EncodedArrayValueIterator::ValueType::kBoolean:
+ type = "boolean";
+ value = it.GetJavaValue().z ? "true" : "false";
+ break;
+ }
+
+ if (gOptions.outputFormat == OUTPUT_PLAIN) {
+ fprintf(gOutFile, " link_argument[%zu] : %s (%s)\n", argument, value.c_str(), type);
+ } else {
+ fprintf(gOutFile, "<link_argument index=\"%zu\" type=\"%s\" value=", argument, type);
+ dumpEscapedString(value.c_str());
+ fprintf(gOutFile, "/>\n");
+ }
+
+ it.Next();
+ argument++;
+ }
+
+ if (gOptions.outputFormat == OUTPUT_XML) {
+ fprintf(gOutFile, "</call_site>\n");
+ }
+}
+
/*
* Dumps the requested sections of the file.
*/
@@ -1612,6 +1808,16 @@
dumpClass(pDexFile, i, &package);
} // for
+ // Iterate over all method handles.
+ for (u4 i = 0; i < pDexFile->NumMethodHandles(); ++i) {
+ dumpMethodHandle(pDexFile, i);
+ } // for
+
+ // Iterate over all call site ids.
+ for (u4 i = 0; i < pDexFile->NumCallSiteIds(); ++i) {
+ dumpCallSite(pDexFile, i);
+ } // for
+
// Free the last package allocated.
if (package != nullptr) {
fprintf(gOutFile, "</package>\n");
diff --git a/dexlayout/dex_ir.cc b/dexlayout/dex_ir.cc
index b1e66be..43de342 100644
--- a/dexlayout/dex_ir.cc
+++ b/dexlayout/dex_ir.cc
@@ -588,11 +588,14 @@
const uint8_t* debug_info_stream = dex_file.GetDebugInfoStream(&disk_code_item);
DebugInfoItem* debug_info = nullptr;
if (debug_info_stream != nullptr) {
- uint32_t debug_info_size = GetDebugInfoStreamSize(debug_info_stream);
- uint8_t* debug_info_buffer = new uint8_t[debug_info_size];
- memcpy(debug_info_buffer, debug_info_stream, debug_info_size);
- debug_info = new DebugInfoItem(debug_info_size, debug_info_buffer);
- debug_info_items_.AddItem(debug_info, disk_code_item.debug_info_off_);
+ debug_info = debug_info_items_.GetExistingObject(disk_code_item.debug_info_off_);
+ if (debug_info == nullptr) {
+ uint32_t debug_info_size = GetDebugInfoStreamSize(debug_info_stream);
+ uint8_t* debug_info_buffer = new uint8_t[debug_info_size];
+ memcpy(debug_info_buffer, debug_info_stream, debug_info_size);
+ debug_info = new DebugInfoItem(debug_info_size, debug_info_buffer);
+ debug_info_items_.AddItem(debug_info, disk_code_item.debug_info_off_);
+ }
}
uint32_t insns_size = disk_code_item.insns_size_in_code_units_;
@@ -683,8 +686,8 @@
const DexFile& dex_file, const uint8_t* encoded_data, uint32_t offset) {
// Read the fields and methods defined by the class, resolving the circular reference from those
// to classes by setting class at the same time.
- ClassData* class_data = nullptr;
- if (encoded_data != nullptr) {
+ ClassData* class_data = class_datas_.GetExistingObject(offset);
+ if (class_data == nullptr && encoded_data != nullptr) {
ClassDataItemIterator cdii(dex_file, encoded_data);
// Static fields.
FieldItemVector* static_fields = new FieldItemVector();
diff --git a/dexlayout/dex_ir.h b/dexlayout/dex_ir.h
index e2ee940..3a5b644 100644
--- a/dexlayout/dex_ir.h
+++ b/dexlayout/dex_ir.h
@@ -134,9 +134,17 @@
public:
CollectionMap() = default;
+ // Returns the existing item if it is already inserted, null otherwise.
+ T* GetExistingObject(uint32_t offset) {
+ auto it = collection_.find(offset);
+ return it != collection_.end() ? it->second.get() : nullptr;
+ }
+
void AddItem(T* object, uint32_t offset) {
object->SetOffset(offset);
- collection_.emplace(offset, std::unique_ptr<T>(object));
+ auto it = collection_.emplace(offset, std::unique_ptr<T>(object));
+ CHECK(it.second) << "CollectionMap already has an object with offset " << offset << " "
+ << " and address " << it.first->second.get();
}
uint32_t Size() const { return collection_.size(); }
std::map<uint32_t, std::unique_ptr<T>>& Collection() { return collection_; }
diff --git a/disassembler/disassembler_x86.cc b/disassembler/disassembler_x86.cc
index 9f49ec6..ff05733 100644
--- a/disassembler/disassembler_x86.cc
+++ b/disassembler/disassembler_x86.cc
@@ -859,6 +859,22 @@
has_modrm = true;
store = true;
break;
+ case 0x7F:
+ if (prefix[2] == 0x66) {
+ src_reg_file = dst_reg_file = SSE;
+ opcode1 = "movdqa";
+ prefix[2] = 0; // clear prefix now it's served its purpose as part of the opcode
+ } else if (prefix[0] == 0xF3) {
+ src_reg_file = dst_reg_file = SSE;
+ opcode1 = "movdqu";
+ prefix[0] = 0; // clear prefix now it's served its purpose as part of the opcode
+ } else {
+ dst_reg_file = MMX;
+ opcode1 = "movq";
+ }
+ store = true;
+ has_modrm = true;
+ break;
case 0x80: case 0x81: case 0x82: case 0x83: case 0x84: case 0x85: case 0x86: case 0x87:
case 0x88: case 0x89: case 0x8A: case 0x8B: case 0x8C: case 0x8D: case 0x8E: case 0x8F:
opcode1 = "j";
diff --git a/oatdump/oatdump.cc b/oatdump/oatdump.cc
index 147be4a..9a3b28b 100644
--- a/oatdump/oatdump.cc
+++ b/oatdump/oatdump.cc
@@ -1473,7 +1473,7 @@
Runtime* const runtime = Runtime::Current();
Handle<mirror::DexCache> dex_cache(
hs->NewHandle(runtime->GetClassLinker()->RegisterDexFile(*dex_file, nullptr)));
- CHECK(dex_cache.Get() != nullptr);
+ CHECK(dex_cache != nullptr);
DCHECK(options_.class_loader_ != nullptr);
return verifier::MethodVerifier::VerifyMethodAndDump(
soa.Self(), vios, dex_method_idx, dex_file, dex_cache, *options_.class_loader_,
@@ -2235,14 +2235,9 @@
ScopedIndentation indent2(&state->vios_);
auto* resolved_types = dex_cache->GetResolvedTypes();
for (size_t i = 0; i < num_types; ++i) {
- auto pair = resolved_types[i].load(std::memory_order_relaxed);
+ auto* elem = resolved_types[i].Read();
size_t run = 0;
- for (size_t j = i + 1; j != num_types; ++j) {
- auto other_pair = resolved_types[j].load(std::memory_order_relaxed);
- if (pair.index != other_pair.index ||
- pair.object.Read() != other_pair.object.Read()) {
- break;
- }
+ for (size_t j = i + 1; j != num_types && elem == resolved_types[j].Read(); ++j) {
++run;
}
if (run == 0) {
@@ -2252,13 +2247,12 @@
i = i + run;
}
std::string msg;
- auto* elem = pair.object.Read();
if (elem == nullptr) {
msg = "null";
} else {
msg = elem->PrettyClass();
}
- os << StringPrintf("%p %u %s\n", elem, pair.index, msg.c_str());
+ os << StringPrintf("%p %s\n", elem, msg.c_str());
}
}
}
@@ -2956,7 +2950,7 @@
const DexFile::ClassDef& class_def = dex_file->GetClassDef(class_def_index);
const char* descriptor = dex_file->GetClassDescriptor(class_def);
h_klass.Assign(class_linker->FindClass(self, descriptor, h_class_loader));
- if (h_klass.Get() == nullptr) {
+ if (h_klass == nullptr) {
std::cerr << "Warning: could not load " << descriptor << std::endl;
continue;
}
diff --git a/patchoat/patchoat.cc b/patchoat/patchoat.cc
index 2546822..b9be5f2 100644
--- a/patchoat/patchoat.cc
+++ b/patchoat/patchoat.cc
@@ -643,8 +643,8 @@
if (orig_strings != nullptr) {
orig_dex_cache->FixupStrings(RelocatedCopyOf(orig_strings), RelocatedPointerVisitor(this));
}
- mirror::TypeDexCacheType* orig_types = orig_dex_cache->GetResolvedTypes();
- mirror::TypeDexCacheType* relocated_types = RelocatedAddressOfPointer(orig_types);
+ GcRoot<mirror::Class>* orig_types = orig_dex_cache->GetResolvedTypes();
+ GcRoot<mirror::Class>* relocated_types = RelocatedAddressOfPointer(orig_types);
copy_dex_cache->SetField64<false>(
mirror::DexCache::ResolvedTypesOffset(),
static_cast<int64_t>(reinterpret_cast<uintptr_t>(relocated_types)));
@@ -688,6 +688,16 @@
orig_dex_cache->FixupResolvedMethodTypes(RelocatedCopyOf(orig_method_types),
RelocatedPointerVisitor(this));
}
+
+ GcRoot<mirror::CallSite>* orig_call_sites = orig_dex_cache->GetResolvedCallSites();
+ GcRoot<mirror::CallSite>* relocated_call_sites = RelocatedAddressOfPointer(orig_call_sites);
+ copy_dex_cache->SetField64<false>(
+ mirror::DexCache::ResolvedCallSitesOffset(),
+ static_cast<int64_t>(reinterpret_cast<uintptr_t>(relocated_call_sites)));
+ if (orig_call_sites != nullptr) {
+ orig_dex_cache->FixupResolvedCallSites(RelocatedCopyOf(orig_call_sites),
+ RelocatedPointerVisitor(this));
+ }
}
}
diff --git a/runtime/Android.bp b/runtime/Android.bp
index 9585ba2..d3a81a9 100644
--- a/runtime/Android.bp
+++ b/runtime/Android.bp
@@ -123,6 +123,7 @@
"memory_region.cc",
"method_handles.cc",
"mirror/array.cc",
+ "mirror/call_site.cc",
"mirror/class.cc",
"mirror/class_ext.cc",
"mirror/dex_cache.cc",
@@ -131,6 +132,7 @@
"mirror/field.cc",
"mirror/method.cc",
"mirror/method_handle_impl.cc",
+ "mirror/method_handles_lookup.cc",
"mirror/method_type.cc",
"mirror/object.cc",
"mirror/reference.cc",
@@ -546,6 +548,7 @@
"gc/reference_queue_test.cc",
"gc/space/dlmalloc_space_static_test.cc",
"gc/space/dlmalloc_space_random_test.cc",
+ "gc/space/image_space_test.cc",
"gc/space/large_object_space_test.cc",
"gc/space/rosalloc_space_static_test.cc",
"gc/space/rosalloc_space_random_test.cc",
diff --git a/runtime/arch/arm/quick_entrypoints_arm.S b/runtime/arch/arm/quick_entrypoints_arm.S
index cfe8406..8531091 100644
--- a/runtime/arch/arm/quick_entrypoints_arm.S
+++ b/runtime/arch/arm/quick_entrypoints_arm.S
@@ -2049,9 +2049,13 @@
.Lnot_marked_rb_\name:
// Test that both the forwarding state bits are 1.
- mvn ip, ip
- tst ip, #(LOCK_WORD_STATE_FORWARDING_ADDRESS << LOCK_WORD_STATE_SHIFT)
- beq .Lret_forwarding_address\name
+#if (LOCK_WORD_STATE_SHIFT != 30) || (LOCK_WORD_STATE_FORWARDING_ADDRESS != 3)
+ // To use "CMP ip, #modified-immediate; BHS", we need the lock word state in
+ // the highest bits and the "forwarding address" state to have all bits set.
+#error "Unexpected lock word state shift or forwarding address state value."
+#endif
+ cmp ip, #(LOCK_WORD_STATE_FORWARDING_ADDRESS << LOCK_WORD_STATE_SHIFT)
+ bhs .Lret_forwarding_address\name
.Lslow_rb_\name:
// Save IP: The kSaveEverything entrypoint art_quick_resolve_string used to
@@ -2118,7 +2122,6 @@
.Lret_forwarding_address\name:
// Shift left by the forwarding address shift. This clears out the state bits since they are
// in the top 2 bits of the lock word.
- mvn ip, ip
lsl \reg, ip, #LOCK_WORD_STATE_FORWARDING_ADDRESS_SHIFT
bx lr
END \name
diff --git a/runtime/arch/stub_test.cc b/runtime/arch/stub_test.cc
index 0bf08a6..207bf9d 100644
--- a/runtime/arch/stub_test.cc
+++ b/runtime/arch/stub_test.cc
@@ -984,7 +984,7 @@
while (length > 10) {
Handle<mirror::Object> h(hsp->NewHandle<mirror::Object>(
mirror::ObjectArray<mirror::Object>::Alloc(soa.Self(), ca.Get(), length / 4)));
- if (self->IsExceptionPending() || h.Get() == nullptr) {
+ if (self->IsExceptionPending() || h == nullptr) {
self->ClearException();
// Try a smaller length
@@ -1003,7 +1003,7 @@
// Allocate simple objects till it fails.
while (!self->IsExceptionPending()) {
Handle<mirror::Object> h = hsp->NewHandle(c->AllocObject(soa.Self()));
- if (!self->IsExceptionPending() && h.Get() != nullptr) {
+ if (!self->IsExceptionPending() && h != nullptr) {
handles.push_back(h);
}
}
diff --git a/runtime/art_field-inl.h b/runtime/art_field-inl.h
index 16b73c6..80af8e7 100644
--- a/runtime/art_field-inl.h
+++ b/runtime/art_field-inl.h
@@ -311,8 +311,6 @@
template <bool kResolve>
inline ObjPtr<mirror::Class> ArtField::GetType() {
- // TODO: Refactor this function into two functions, ResolveType() and LookupType()
- // so that we can properly annotate it with no-suspension possible / suspension possible.
const uint32_t field_index = GetDexFieldIndex();
ObjPtr<mirror::Class> declaring_class = GetDeclaringClass();
if (UNLIKELY(declaring_class->IsProxyClass())) {
@@ -322,16 +320,9 @@
const DexFile* const dex_file = dex_cache->GetDexFile();
const DexFile::FieldId& field_id = dex_file->GetFieldId(field_index);
ObjPtr<mirror::Class> type = dex_cache->GetResolvedType(field_id.type_idx_);
- if (UNLIKELY(type == nullptr)) {
- ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
- if (kResolve) {
- type = class_linker->ResolveType(*dex_file, field_id.type_idx_, declaring_class);
- CHECK(type != nullptr || Thread::Current()->IsExceptionPending());
- } else {
- type = class_linker->LookupResolvedType(
- *dex_file, field_id.type_idx_, dex_cache, declaring_class->GetClassLoader());
- DCHECK(!Thread::Current()->IsExceptionPending());
- }
+ if (kResolve && UNLIKELY(type == nullptr)) {
+ type = ResolveGetType(field_id.type_idx_);
+ CHECK(type != nullptr || Thread::Current()->IsExceptionPending());
}
return type;
}
diff --git a/runtime/art_field.cc b/runtime/art_field.cc
index 7e13104..a4a6e5a 100644
--- a/runtime/art_field.cc
+++ b/runtime/art_field.cc
@@ -48,6 +48,10 @@
return Runtime::Current()->GetClassLinker()->FindSystemClass(Thread::Current(), descriptor);
}
+ObjPtr<mirror::Class> ArtField::ResolveGetType(dex::TypeIndex type_idx) {
+ return Runtime::Current()->GetClassLinker()->ResolveType(type_idx, this);
+}
+
ObjPtr<mirror::String> ArtField::ResolveGetStringName(Thread* self,
const DexFile& dex_file,
dex::StringIndex string_idx,
diff --git a/runtime/art_field.h b/runtime/art_field.h
index 75dd981..427e103 100644
--- a/runtime/art_field.h
+++ b/runtime/art_field.h
@@ -217,6 +217,8 @@
private:
ObjPtr<mirror::Class> ProxyFindSystemClass(const char* descriptor)
REQUIRES_SHARED(Locks::mutator_lock_);
+ ObjPtr<mirror::Class> ResolveGetType(dex::TypeIndex type_idx)
+ REQUIRES_SHARED(Locks::mutator_lock_);
ObjPtr<mirror::String> ResolveGetStringName(Thread* self,
const DexFile& dex_file,
dex::StringIndex string_idx,
diff --git a/runtime/art_method-inl.h b/runtime/art_method-inl.h
index 473d9cf..950f1aa 100644
--- a/runtime/art_method-inl.h
+++ b/runtime/art_method-inl.h
@@ -175,19 +175,12 @@
}
inline mirror::Class* ArtMethod::GetClassFromTypeIndex(dex::TypeIndex type_idx, bool resolve) {
- // TODO: Refactor this function into two functions, Resolve...() and Lookup...()
- // so that we can properly annotate it with no-suspension possible / suspension possible.
ObjPtr<mirror::DexCache> dex_cache = GetDexCache();
ObjPtr<mirror::Class> type = dex_cache->GetResolvedType(type_idx);
- if (UNLIKELY(type == nullptr)) {
+ if (UNLIKELY(type == nullptr) && resolve) {
ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
- if (resolve) {
- type = class_linker->ResolveType(type_idx, this);
- CHECK(type != nullptr || Thread::Current()->IsExceptionPending());
- } else {
- type = class_linker->LookupResolvedType(
- *dex_cache->GetDexFile(), type_idx, dex_cache, GetClassLoader());
- }
+ type = class_linker->ResolveType(type_idx, this);
+ CHECK(type != nullptr || Thread::Current()->IsExceptionPending());
}
return type.Ptr();
}
diff --git a/runtime/art_method.cc b/runtime/art_method.cc
index 6cb8544..9d74e7c 100644
--- a/runtime/art_method.cc
+++ b/runtime/art_method.cc
@@ -67,7 +67,6 @@
}
ArtMethod* ArtMethod::GetSingleImplementation(PointerSize pointer_size) {
- DCHECK(!IsNative());
if (!IsAbstract()) {
// A non-abstract's single implementation is itself.
return this;
@@ -275,7 +274,7 @@
*has_no_move_exception = (first_catch_instr->Opcode() != Instruction::MOVE_EXCEPTION);
}
// Put the exception back.
- if (exception.Get() != nullptr) {
+ if (exception != nullptr) {
self->SetException(exception.Get());
}
return found_dex_pc;
@@ -442,12 +441,56 @@
UNREACHABLE();
}
+// We use the method's DexFile and declaring class name to find the OatMethod for an obsolete
+// method. This is extremely slow but we need it if we want to be able to have obsolete native
+// methods since we need this to find the size of its stack frames.
+//
+// NB We could (potentially) do this differently and rely on the way the transformation is applied
+// in order to use the entrypoint to find this information. However, for debugging reasons (most
+// notably making sure that new invokes of obsolete methods fail) we choose to instead get the data
+// directly from the dex file.
+static const OatFile::OatMethod FindOatMethodFromDexFileFor(ArtMethod* method, bool* found)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ DCHECK(method->IsObsolete() && method->IsNative());
+ const DexFile* dex_file = method->GetDexFile();
+
+ // recreate the class_def_index from the descriptor.
+ std::string descriptor_storage;
+ const DexFile::TypeId* declaring_class_type_id =
+ dex_file->FindTypeId(method->GetDeclaringClass()->GetDescriptor(&descriptor_storage));
+ CHECK(declaring_class_type_id != nullptr);
+ dex::TypeIndex declaring_class_type_index = dex_file->GetIndexForTypeId(*declaring_class_type_id);
+ const DexFile::ClassDef* declaring_class_type_def =
+ dex_file->FindClassDef(declaring_class_type_index);
+ CHECK(declaring_class_type_def != nullptr);
+ uint16_t declaring_class_def_index = dex_file->GetIndexForClassDef(*declaring_class_type_def);
+
+ size_t oat_method_index = GetOatMethodIndexFromMethodIndex(*dex_file,
+ declaring_class_def_index,
+ method->GetDexMethodIndex());
+
+ OatFile::OatClass oat_class = OatFile::FindOatClass(*dex_file,
+ declaring_class_def_index,
+ found);
+ if (!(*found)) {
+ return OatFile::OatMethod::Invalid();
+ }
+ return oat_class.GetOatMethod(oat_method_index);
+}
+
static const OatFile::OatMethod FindOatMethodFor(ArtMethod* method,
PointerSize pointer_size,
bool* found)
REQUIRES_SHARED(Locks::mutator_lock_) {
- // We shouldn't be calling this with obsolete methods.
- DCHECK(!method->IsObsolete());
+ if (UNLIKELY(method->IsObsolete())) {
+ // We shouldn't be calling this with obsolete methods except for native obsolete methods for
+ // which we need to use the oat method to figure out how large the quick frame is.
+ DCHECK(method->IsNative()) << "We should only be finding the OatMethod of obsolete methods in "
+ << "order to allow stack walking. Other obsolete methods should "
+ << "never need to access this information.";
+ DCHECK_EQ(pointer_size, kRuntimePointerSize) << "Obsolete method in compiler!";
+ return FindOatMethodFromDexFileFor(method, found);
+ }
// Although we overwrite the trampoline of non-static methods, we may get here via the resolution
// method for direct methods (or virtual methods made direct).
mirror::Class* declaring_class = method->GetDeclaringClass();
@@ -490,7 +533,7 @@
const auto& proto_id = dex_file->GetMethodPrototype(method_id);
const DexFile::TypeList* proto_params = dex_file->GetProtoParameters(proto_id);
auto count = proto_params != nullptr ? proto_params->Size() : 0u;
- auto param_len = params.Get() != nullptr ? params->GetLength() : 0u;
+ auto param_len = params != nullptr ? params->GetLength() : 0u;
if (param_len != count) {
return false;
}
diff --git a/runtime/art_method.h b/runtime/art_method.h
index 3836303..3d51fdd 100644
--- a/runtime/art_method.h
+++ b/runtime/art_method.h
@@ -432,6 +432,7 @@
}
ProfilingInfo* GetProfilingInfo(PointerSize pointer_size) {
+ DCHECK(!IsNative());
return reinterpret_cast<ProfilingInfo*>(GetDataPtrSize(pointer_size));
}
diff --git a/runtime/cha.cc b/runtime/cha.cc
index d11b12f..eaba01b 100644
--- a/runtime/cha.cc
+++ b/runtime/cha.cc
@@ -200,7 +200,8 @@
if (verify_method != excluded_method) {
DCHECK(!verify_method->HasSingleImplementation())
<< "class: " << verify_class->PrettyClass()
- << " verify_method: " << verify_method->PrettyMethod(true);
+ << " verify_method: " << verify_method->PrettyMethod(true)
+ << " excluded_method: " << excluded_method->PrettyMethod(true);
if (verify_method->IsAbstract()) {
DCHECK(verify_method->GetSingleImplementation(image_pointer_size) == nullptr);
}
@@ -257,9 +258,6 @@
return;
}
- // Native methods don't have single-implementation flag set.
- DCHECK(!method_in_super->IsNative());
-
uint16_t method_index = method_in_super->GetMethodIndex();
if (method_in_super->IsAbstract()) {
if (kIsDebugBuild) {
@@ -374,12 +372,12 @@
// used for static methods or methods of final classes.
return;
}
- if (method->IsNative()) {
- // Native method's invocation overhead is already high and it
- // cannot be inlined. It's not worthwhile to devirtualize the
- // call which can add a deoptimization point.
- DCHECK(!method->HasSingleImplementation());
- } else if (method->IsAbstract()) {
+ if (method->IsAbstract()) {
+ // single-implementation of abstract method shares the same field
+ // that's used for JNI function of native method. It's fine since a method
+ // cannot be both abstract and native.
+ DCHECK(!method->IsNative()) << "Abstract method cannot be native";
+
if (method->GetDeclaringClass()->IsInstantiable()) {
// Rare case, but we do accept it (such as 800-smali/smali/b_26143249.smali).
// Do not attempt to devirtualize it.
diff --git a/runtime/class_linker-inl.h b/runtime/class_linker-inl.h
index bd510ca..3438810 100644
--- a/runtime/class_linker-inl.h
+++ b/runtime/class_linker-inl.h
@@ -78,18 +78,6 @@
return string.Ptr();
}
-inline ObjPtr<mirror::Class> ClassLinker::LookupResolvedType(
- dex::TypeIndex type_idx,
- ObjPtr<mirror::DexCache> dex_cache,
- ObjPtr<mirror::ClassLoader> class_loader) {
- ObjPtr<mirror::Class> type = dex_cache->GetResolvedType(type_idx);
- if (type == nullptr) {
- type = Runtime::Current()->GetClassLinker()->LookupResolvedType(
- *dex_cache->GetDexFile(), type_idx, dex_cache, class_loader);
- }
- return type;
-}
-
inline mirror::Class* ClassLinker::ResolveType(dex::TypeIndex type_idx, ArtMethod* referrer) {
Thread::PoisonObjectPointersIfDebug();
if (kIsDebugBuild) {
@@ -103,6 +91,25 @@
Handle<mirror::ClassLoader> class_loader(hs.NewHandle(declaring_class->GetClassLoader()));
const DexFile& dex_file = *dex_cache->GetDexFile();
resolved_type = ResolveType(dex_file, type_idx, dex_cache, class_loader);
+ // Note: We cannot check here to see whether we added the type to the cache. The type
+ // might be an erroneous class, which results in it being hidden from us.
+ }
+ return resolved_type.Ptr();
+}
+
+inline mirror::Class* ClassLinker::ResolveType(dex::TypeIndex type_idx, ArtField* referrer) {
+ Thread::PoisonObjectPointersIfDebug();
+ ObjPtr<mirror::Class> declaring_class = referrer->GetDeclaringClass();
+ ObjPtr<mirror::DexCache> dex_cache_ptr = declaring_class->GetDexCache();
+ ObjPtr<mirror::Class> resolved_type = dex_cache_ptr->GetResolvedType(type_idx);
+ if (UNLIKELY(resolved_type == nullptr)) {
+ StackHandleScope<2> hs(Thread::Current());
+ Handle<mirror::DexCache> dex_cache(hs.NewHandle(dex_cache_ptr));
+ Handle<mirror::ClassLoader> class_loader(hs.NewHandle(declaring_class->GetClassLoader()));
+ const DexFile& dex_file = *dex_cache->GetDexFile();
+ resolved_type = ResolveType(dex_file, type_idx, dex_cache, class_loader);
+ // Note: We cannot check here to see whether we added the type to the cache. The type
+ // might be an erroneous class, which results in it being hidden from us.
}
return resolved_type.Ptr();
}
diff --git a/runtime/class_linker.cc b/runtime/class_linker.cc
index 9380588..d02cf17 100644
--- a/runtime/class_linker.cc
+++ b/runtime/class_linker.cc
@@ -70,6 +70,7 @@
#include "jni_internal.h"
#include "leb128.h"
#include "linear_alloc.h"
+#include "mirror/call_site.h"
#include "mirror/class.h"
#include "mirror/class-inl.h"
#include "mirror/class_ext.h"
@@ -82,6 +83,7 @@
#include "mirror/method.h"
#include "mirror/method_type.h"
#include "mirror/method_handle_impl.h"
+#include "mirror/method_handles_lookup.h"
#include "mirror/object-inl.h"
#include "mirror/object_array-inl.h"
#include "mirror/proxy.h"
@@ -405,7 +407,7 @@
auto class_class_size = mirror::Class::ClassClassSize(image_pointer_size_);
Handle<mirror::Class> java_lang_Class(hs.NewHandle(down_cast<mirror::Class*>(
heap->AllocNonMovableObject<true>(self, nullptr, class_class_size, VoidFunctor()))));
- CHECK(java_lang_Class.Get() != nullptr);
+ CHECK(java_lang_Class != nullptr);
mirror::Class::SetClassClass(java_lang_Class.Get());
java_lang_Class->SetClass(java_lang_Class.Get());
if (kUseBakerReadBarrier) {
@@ -425,7 +427,7 @@
// java_lang_Object comes next so that object_array_class can be created.
Handle<mirror::Class> java_lang_Object(hs.NewHandle(
AllocClass(self, java_lang_Class.Get(), mirror::Object::ClassSize(image_pointer_size_))));
- CHECK(java_lang_Object.Get() != nullptr);
+ CHECK(java_lang_Object != nullptr);
// backfill Object as the super class of Class.
java_lang_Class->SetSuperClass(java_lang_Object.Get());
mirror::Class::SetStatus(java_lang_Object, mirror::Class::kStatusLoaded, self);
@@ -624,9 +626,9 @@
// Setup the single, global copy of "iftable".
auto java_lang_Cloneable = hs.NewHandle(FindSystemClass(self, "Ljava/lang/Cloneable;"));
- CHECK(java_lang_Cloneable.Get() != nullptr);
+ CHECK(java_lang_Cloneable != nullptr);
auto java_io_Serializable = hs.NewHandle(FindSystemClass(self, "Ljava/io/Serializable;"));
- CHECK(java_io_Serializable.Get() != nullptr);
+ CHECK(java_io_Serializable != nullptr);
// We assume that Cloneable/Serializable don't have superinterfaces -- normally we'd have to
// crawl up and explicitly list all of the supers as well.
array_iftable_.Read()->SetInterface(0, java_lang_Cloneable.Get());
@@ -695,6 +697,18 @@
SetClassRoot(kJavaLangInvokeMethodHandleImpl, class_root);
mirror::MethodHandleImpl::SetClass(class_root);
+ // Create java.lang.invoke.MethodHandles.Lookup.class root
+ class_root = FindSystemClass(self, "Ljava/lang/invoke/MethodHandles$Lookup;");
+ CHECK(class_root != nullptr);
+ SetClassRoot(kJavaLangInvokeMethodHandlesLookup, class_root);
+ mirror::MethodHandlesLookup::SetClass(class_root);
+
+ // Create java.lang.invoke.CallSite.class root
+ class_root = FindSystemClass(self, "Ljava/lang/invoke/CallSite;");
+ CHECK(class_root != nullptr);
+ SetClassRoot(kJavaLangInvokeCallSite, class_root);
+ mirror::CallSite::SetClass(class_root);
+
class_root = FindSystemClass(self, "Ldalvik/system/EmulatedStackFrame;");
CHECK(class_root != nullptr);
SetClassRoot(kDalvikSystemEmulatedStackFrame, class_root);
@@ -981,6 +995,8 @@
mirror::Method::SetArrayClass(GetClassRoot(kJavaLangReflectMethodArrayClass));
mirror::MethodType::SetClass(GetClassRoot(kJavaLangInvokeMethodType));
mirror::MethodHandleImpl::SetClass(GetClassRoot(kJavaLangInvokeMethodHandleImpl));
+ mirror::MethodHandlesLookup::SetClass(GetClassRoot(kJavaLangInvokeMethodHandlesLookup));
+ mirror::CallSite::SetClass(GetClassRoot(kJavaLangInvokeCallSite));
mirror::Reference::SetClass(GetClassRoot(kJavaLangRefReference));
mirror::BooleanArray::SetArrayClass(GetClassRoot(kBooleanArrayClass));
mirror::ByteArray::SetArrayClass(GetClassRoot(kByteArrayClass));
@@ -1171,23 +1187,6 @@
}
}
-template <typename T>
-static void CopyDexCachePairs(const std::atomic<mirror::DexCachePair<T>>* src,
- size_t count,
- std::atomic<mirror::DexCachePair<T>>* dst) {
- DCHECK_NE(count, 0u);
- DCHECK(!src[0].load(std::memory_order_relaxed).object.IsNull() ||
- src[0].load(std::memory_order_relaxed).index != 0u);
- for (size_t i = 0; i < count; ++i) {
- DCHECK_EQ(dst[i].load(std::memory_order_relaxed).index, 0u);
- DCHECK(dst[i].load(std::memory_order_relaxed).object.IsNull());
- mirror::DexCachePair<T> source = src[i].load(std::memory_order_relaxed);
- if (source.index != 0u || !source.object.IsNull()) {
- dst[i].store(source, std::memory_order_relaxed);
- }
- }
-}
-
bool ClassLinker::UpdateAppImageClassLoadersAndDexCaches(
gc::space::ImageSpace* space,
Handle<mirror::ClassLoader> class_loader,
@@ -1241,36 +1240,48 @@
if (dex_file->NumStringIds() < num_strings) {
num_strings = dex_file->NumStringIds();
}
- size_t num_types = mirror::DexCache::kDexCacheTypeCacheSize;
- if (dex_file->NumTypeIds() < num_types) {
- num_types = dex_file->NumTypeIds();
- }
+ const size_t num_types = dex_file->NumTypeIds();
const size_t num_methods = dex_file->NumMethodIds();
const size_t num_fields = dex_file->NumFieldIds();
size_t num_method_types = mirror::DexCache::kDexCacheMethodTypeCacheSize;
if (dex_file->NumProtoIds() < num_method_types) {
num_method_types = dex_file->NumProtoIds();
}
-
+ const size_t num_call_sites = dex_file->NumCallSiteIds();
CHECK_EQ(num_strings, dex_cache->NumStrings());
CHECK_EQ(num_types, dex_cache->NumResolvedTypes());
CHECK_EQ(num_methods, dex_cache->NumResolvedMethods());
CHECK_EQ(num_fields, dex_cache->NumResolvedFields());
CHECK_EQ(num_method_types, dex_cache->NumResolvedMethodTypes());
+ CHECK_EQ(num_call_sites, dex_cache->NumResolvedCallSites());
DexCacheArraysLayout layout(image_pointer_size_, dex_file);
uint8_t* const raw_arrays = oat_dex_file->GetDexCacheArrays();
if (num_strings != 0u) {
mirror::StringDexCacheType* const image_resolved_strings = dex_cache->GetStrings();
mirror::StringDexCacheType* const strings =
reinterpret_cast<mirror::StringDexCacheType*>(raw_arrays + layout.StringsOffset());
- CopyDexCachePairs(image_resolved_strings, num_strings, strings);
+ for (size_t j = 0; j < num_strings; ++j) {
+ DCHECK_EQ(strings[j].load(std::memory_order_relaxed).index, 0u);
+ DCHECK(strings[j].load(std::memory_order_relaxed).object.IsNull());
+ strings[j].store(image_resolved_strings[j].load(std::memory_order_relaxed),
+ std::memory_order_relaxed);
+ }
+ mirror::StringDexCachePair::Initialize(strings);
dex_cache->SetStrings(strings);
}
if (num_types != 0u) {
- mirror::TypeDexCacheType* const image_resolved_types = dex_cache->GetResolvedTypes();
- mirror::TypeDexCacheType* const types =
- reinterpret_cast<mirror::TypeDexCacheType*>(raw_arrays + layout.TypesOffset());
- CopyDexCachePairs(image_resolved_types, num_types, types);
+ GcRoot<mirror::Class>* const image_resolved_types = dex_cache->GetResolvedTypes();
+ GcRoot<mirror::Class>* const types =
+ reinterpret_cast<GcRoot<mirror::Class>*>(raw_arrays + layout.TypesOffset());
+ for (size_t j = 0; kIsDebugBuild && j < num_types; ++j) {
+ DCHECK(types[j].IsNull());
+ }
+ CopyNonNull(image_resolved_types,
+ num_types,
+ types,
+ [](const GcRoot<mirror::Class>& elem) {
+ return elem.IsNull();
+ });
dex_cache->SetResolvedTypes(types);
}
if (num_methods != 0u) {
@@ -1311,9 +1322,33 @@
mirror::MethodTypeDexCacheType* const method_types =
reinterpret_cast<mirror::MethodTypeDexCacheType*>(
raw_arrays + layout.MethodTypesOffset());
- CopyDexCachePairs(image_resolved_method_types, num_method_types, method_types);
+ for (size_t j = 0; j < num_method_types; ++j) {
+ DCHECK_EQ(method_types[j].load(std::memory_order_relaxed).index, 0u);
+ DCHECK(method_types[j].load(std::memory_order_relaxed).object.IsNull());
+ method_types[j].store(
+ image_resolved_method_types[j].load(std::memory_order_relaxed),
+ std::memory_order_relaxed);
+ }
+
+ mirror::MethodTypeDexCachePair::Initialize(method_types);
dex_cache->SetResolvedMethodTypes(method_types);
}
+ if (num_call_sites != 0u) {
+ GcRoot<mirror::CallSite>* const image_resolved_call_sites =
+ dex_cache->GetResolvedCallSites();
+ GcRoot<mirror::CallSite>* const call_sites =
+ reinterpret_cast<GcRoot<mirror::CallSite>*>(raw_arrays + layout.CallSitesOffset());
+ for (size_t j = 0; kIsDebugBuild && j < num_call_sites; ++j) {
+ DCHECK(call_sites[j].IsNull());
+ }
+ CopyNonNull(image_resolved_call_sites,
+ num_call_sites,
+ call_sites,
+ [](const GcRoot<mirror::CallSite>& elem) {
+ return elem.IsNull();
+ });
+ dex_cache->SetResolvedCallSites(call_sites);
+ }
}
{
WriterMutexLock mu2(self, *Locks::dex_lock_);
@@ -1325,11 +1360,11 @@
}
if (kIsDebugBuild) {
CHECK(new_class_set != nullptr);
- mirror::TypeDexCacheType* const types = dex_cache->GetResolvedTypes();
+ GcRoot<mirror::Class>* const types = dex_cache->GetResolvedTypes();
const size_t num_types = dex_cache->NumResolvedTypes();
- for (size_t j = 0; j != num_types; ++j) {
+ for (int32_t j = 0; j < static_cast<int32_t>(num_types); j++) {
// The image space is not yet added to the heap, avoid read barriers.
- ObjPtr<mirror::Class> klass = types[j].load(std::memory_order_relaxed).object.Read();
+ ObjPtr<mirror::Class> klass = types[j].Read();
if (space->HasAddress(klass.Ptr())) {
DCHECK(!klass->IsErroneous()) << klass->GetStatus();
auto it = new_class_set->Find(ClassTable::TableSlot(klass));
@@ -1613,7 +1648,7 @@
DCHECK(out_dex_files != nullptr);
DCHECK(error_msg != nullptr);
const uint64_t start_time = NanoTime();
- const bool app_image = class_loader.Get() != nullptr;
+ const bool app_image = class_loader != nullptr;
const ImageHeader& header = space->GetImageHeader();
ObjPtr<mirror::Object> dex_caches_object = header.GetImageRoot(ImageHeader::kDexCaches);
DCHECK(dex_caches_object != nullptr);
@@ -1643,7 +1678,7 @@
"Class loader should be the last image root.");
MutableHandle<mirror::ClassLoader> image_class_loader(hs.NewHandle(
app_image ? header.GetImageRoot(ImageHeader::kClassLoader)->AsClassLoader() : nullptr));
- DCHECK(class_roots.Get() != nullptr);
+ DCHECK(class_roots != nullptr);
if (class_roots->GetLength() != static_cast<int32_t>(kClassRootsMax)) {
*error_msg = StringPrintf("Expected %d class roots but got %d",
class_roots->GetLength(),
@@ -1688,9 +1723,9 @@
// The current dex file field is bogus, overwrite it so that we can get the dex file in the
// loop below.
dex_cache->SetDexFile(dex_file.get());
- mirror::TypeDexCacheType* const types = dex_cache->GetResolvedTypes();
+ GcRoot<mirror::Class>* const types = dex_cache->GetResolvedTypes();
for (int32_t j = 0, num_types = dex_cache->NumResolvedTypes(); j < num_types; j++) {
- ObjPtr<mirror::Class> klass = types[j].load(std::memory_order_relaxed).object.Read();
+ ObjPtr<mirror::Class> klass = types[j].Read();
if (klass != nullptr) {
DCHECK(!klass->IsErroneous()) << klass->GetStatus();
}
@@ -2072,7 +2107,7 @@
ObjPtr<mirror::Class> array_of_class = FindArrayClass(self, &class_type);
classes.Assign(
mirror::ObjectArray<mirror::Class>::Alloc(self, array_of_class, class_table_size));
- CHECK(classes.Get() != nullptr); // OOME.
+ CHECK(classes != nullptr); // OOME.
GetClassInToObjectArray accumulator(classes.Get());
VisitClasses(&accumulator);
if (accumulator.Succeeded()) {
@@ -2113,6 +2148,8 @@
mirror::ShortArray::ResetArrayClass();
mirror::MethodType::ResetClass();
mirror::MethodHandleImpl::ResetClass();
+ mirror::MethodHandlesLookup::ResetClass();
+ mirror::CallSite::ResetClass();
mirror::EmulatedStackFrame::ResetClass();
Thread* const self = Thread::Current();
for (const ClassLoaderData& data : class_loaders_) {
@@ -2150,7 +2187,7 @@
DCHECK(out_location != nullptr);
auto dex_cache(hs.NewHandle(ObjPtr<mirror::DexCache>::DownCast(
GetClassRoot(kJavaLangDexCache)->AllocObject(self))));
- if (dex_cache.Get() == nullptr) {
+ if (dex_cache == nullptr) {
self->AssertPendingOOMException();
return nullptr;
}
@@ -2451,7 +2488,7 @@
return EnsureResolved(self, descriptor, klass);
}
// Class is not yet loaded.
- if (descriptor[0] != '[' && class_loader.Get() == nullptr) {
+ if (descriptor[0] != '[' && class_loader == nullptr) {
// Non-array class and the boot class loader, search the boot class path.
ClassPathEntry pair = FindInClassPath(descriptor, hash, boot_class_path_);
if (pair.second != nullptr) {
@@ -2614,14 +2651,14 @@
}
}
- if (klass.Get() == nullptr) {
+ if (klass == nullptr) {
// Allocate a class with the status of not ready.
// Interface object should get the right size here. Regular class will
// figure out the right size later and be replaced with one of the right
// size when the class becomes resolved.
klass.Assign(AllocClass(self, SizeOfClassWithoutEmbeddedTables(dex_file, dex_class_def)));
}
- if (UNLIKELY(klass.Get() == nullptr)) {
+ if (UNLIKELY(klass == nullptr)) {
self->AssertPendingOOMException();
return nullptr;
}
@@ -2714,7 +2751,7 @@
return nullptr;
}
self->AssertNoPendingException();
- CHECK(h_new_class.Get() != nullptr) << descriptor;
+ CHECK(h_new_class != nullptr) << descriptor;
CHECK(h_new_class->IsResolved() && !h_new_class->IsErroneousResolved()) << descriptor;
// Instrumentation may have updated entrypoints for all methods of all
@@ -2995,7 +3032,7 @@
const DexFile::ClassDef& dex_class_def,
Handle<mirror::Class> klass,
ObjPtr<mirror::ClassLoader> class_loader) {
- CHECK(klass.Get() != nullptr);
+ CHECK(klass != nullptr);
CHECK(klass->GetDexCache() != nullptr);
CHECK_EQ(mirror::Class::kStatusNotReady, klass->GetStatus());
const char* descriptor = dex_file.GetClassDescriptor(dex_class_def);
@@ -3110,6 +3147,7 @@
last_field_idx = field_idx;
}
}
+
// Load instance fields.
LengthPrefixedArray<ArtField>* ifields = AllocArtFieldArray(self,
allocator,
@@ -3126,6 +3164,7 @@
last_field_idx = field_idx;
}
}
+
if (UNLIKELY(num_sfields != it.NumStaticFields()) ||
UNLIKELY(num_ifields != it.NumInstanceFields())) {
LOG(WARNING) << "Duplicate fields in class " << klass->PrettyDescriptor()
@@ -3365,7 +3404,7 @@
WriterMutexLock mu(self, *Locks::dex_lock_);
old_data = FindDexCacheDataLocked(dex_file);
old_dex_cache = DecodeDexCache(self, old_data);
- if (old_dex_cache == nullptr && h_dex_cache.Get() != nullptr) {
+ if (old_dex_cache == nullptr && h_dex_cache != nullptr) {
// Do InitializeDexCache while holding dex lock to make sure two threads don't call it at the
// same time with the same dex cache. Since the .bss is shared this can cause failing DCHECK
// that the arrays are null.
@@ -3381,12 +3420,12 @@
if (old_dex_cache != nullptr) {
// Another thread managed to initialize the dex cache faster, so use that DexCache.
// If this thread encountered OOME, ignore it.
- DCHECK_EQ(h_dex_cache.Get() == nullptr, self->IsExceptionPending());
+ DCHECK_EQ(h_dex_cache == nullptr, self->IsExceptionPending());
self->ClearException();
// We cannot call EnsureSameClassLoader() while holding the dex_lock_.
return EnsureSameClassLoader(self, old_dex_cache, old_data, h_class_loader.Get());
}
- if (h_dex_cache.Get() == nullptr) {
+ if (h_dex_cache == nullptr) {
self->AssertPendingOOMException();
return nullptr;
}
@@ -3515,12 +3554,12 @@
StackHandleScope<2> hs(self);
MutableHandle<mirror::Class> component_type(hs.NewHandle(FindClass(self, descriptor + 1,
class_loader)));
- if (component_type.Get() == nullptr) {
+ if (component_type == nullptr) {
DCHECK(self->IsExceptionPending());
// We need to accept erroneous classes as component types.
const size_t component_hash = ComputeModifiedUtf8Hash(descriptor + 1);
component_type.Assign(LookupClass(self, descriptor + 1, component_hash, class_loader.Get()));
- if (component_type.Get() == nullptr) {
+ if (component_type == nullptr) {
DCHECK(self->IsExceptionPending());
return nullptr;
} else {
@@ -3581,9 +3620,9 @@
new_class.Assign(GetClassRoot(kLongArrayClass));
}
}
- if (new_class.Get() == nullptr) {
+ if (new_class == nullptr) {
new_class.Assign(AllocClass(self, mirror::Array::ClassSize(image_pointer_size_)));
- if (new_class.Get() == nullptr) {
+ if (new_class == nullptr) {
self->AssertPendingOOMException();
return nullptr;
}
@@ -3816,8 +3855,8 @@
Handle<mirror::Class> klass,
Handle<mirror::Class> supertype) {
DCHECK(self != nullptr);
- DCHECK(klass.Get() != nullptr);
- DCHECK(supertype.Get() != nullptr);
+ DCHECK(klass != nullptr);
+ DCHECK(supertype != nullptr);
if (!supertype->IsVerified() && !supertype->IsErroneous()) {
VerifyClass(self, supertype);
@@ -3834,13 +3873,13 @@
LOG(WARNING) << error_msg << " in " << klass->GetDexCache()->GetLocation()->ToModifiedUtf8();
StackHandleScope<1> hs(self);
Handle<mirror::Throwable> cause(hs.NewHandle(self->GetException()));
- if (cause.Get() != nullptr) {
+ if (cause != nullptr) {
// Set during VerifyClass call (if at all).
self->ClearException();
}
// Change into a verify error.
ThrowVerifyError(klass.Get(), "%s", error_msg.c_str());
- if (cause.Get() != nullptr) {
+ if (cause != nullptr) {
self->GetException()->SetCause(cause.Get());
}
ClassReference ref(klass->GetDexCache()->GetDexFile(), klass->GetDexClassDefIndex());
@@ -3919,7 +3958,7 @@
StackHandleScope<2> hs(self);
MutableHandle<mirror::Class> supertype(hs.NewHandle(klass->GetSuperClass()));
// If we have a superclass and we get a hard verification failure we can return immediately.
- if (supertype.Get() != nullptr && !AttemptSupertypeVerification(self, klass, supertype)) {
+ if (supertype != nullptr && !AttemptSupertypeVerification(self, klass, supertype)) {
CHECK(self->IsExceptionPending()) << "Verification error should be pending.";
return verifier::MethodVerifier::kHardFailure;
}
@@ -3934,14 +3973,14 @@
// but choose not to for an optimization. If the interfaces is being verified due to a class
// initialization (which would need all the default interfaces to be verified) the class code
// will trigger the recursive verification anyway.
- if ((supertype.Get() == nullptr || supertype->IsVerified()) // See (1)
+ if ((supertype == nullptr || supertype->IsVerified()) // See (1)
&& !klass->IsInterface()) { // See (2)
int32_t iftable_count = klass->GetIfTableCount();
MutableHandle<mirror::Class> iface(hs.NewHandle<mirror::Class>(nullptr));
// Loop through all interfaces this class has defined. It doesn't matter the order.
for (int32_t i = 0; i < iftable_count; i++) {
iface.Assign(klass->GetIfTable()->GetInterface(i));
- DCHECK(iface.Get() != nullptr);
+ DCHECK(iface != nullptr);
// We only care if we have default interfaces and can skip if we are already verified...
if (LIKELY(!iface->HasDefaultMethods() || iface->IsVerified())) {
continue;
@@ -3961,7 +4000,7 @@
// At this point if verification failed, then supertype is the "first" supertype that failed
// verification (without a specific order). If verification succeeded, then supertype is either
// null or the original superclass of klass and is verified.
- DCHECK(supertype.Get() == nullptr ||
+ DCHECK(supertype == nullptr ||
supertype.Get() == klass->GetSuperClass() ||
!supertype->IsVerified());
@@ -4002,7 +4041,7 @@
if (verifier_failure == verifier::MethodVerifier::kNoFailure) {
// Even though there were no verifier failures we need to respect whether the super-class and
// super-default-interfaces were verified or requiring runtime reverification.
- if (supertype.Get() == nullptr || supertype->IsVerified()) {
+ if (supertype == nullptr || supertype->IsVerified()) {
mirror::Class::SetStatus(klass, mirror::Class::kStatusVerified, self);
} else {
CHECK_EQ(supertype->GetStatus(), mirror::Class::kStatusRetryVerificationAtRuntime);
@@ -4185,7 +4224,7 @@
StackHandleScope<10> hs(self);
MutableHandle<mirror::Class> klass(hs.NewHandle(
AllocClass(self, GetClassRoot(kJavaLangClass), sizeof(mirror::Class))));
- if (klass.Get() == nullptr) {
+ if (klass == nullptr) {
CHECK(self->IsExceptionPending()); // OOME.
return nullptr;
}
@@ -4609,7 +4648,7 @@
MutableHandle<mirror::Class> handle_scope_iface(hs_iface.NewHandle<mirror::Class>(nullptr));
for (size_t i = 0; i < num_direct_interfaces; i++) {
handle_scope_iface.Assign(mirror::Class::GetDirectInterface(self, klass.Get(), i));
- CHECK(handle_scope_iface.Get() != nullptr);
+ CHECK(handle_scope_iface != nullptr);
CHECK(handle_scope_iface->IsInterface());
if (handle_scope_iface->HasBeenRecursivelyInitialized()) {
// We have already done this for this interface. Skip it.
@@ -4888,7 +4927,7 @@
{
StackHandleScope<1> hs(self);
Handle<mirror::Class> return_type(hs.NewHandle(method1->GetReturnType(true /* resolve */)));
- if (UNLIKELY(return_type.Get() == nullptr)) {
+ if (UNLIKELY(return_type == nullptr)) {
ThrowSignatureCheckResolveReturnTypeException(klass, super_klass, method1, method1);
return false;
}
@@ -4938,7 +4977,7 @@
dex::TypeIndex param_type_idx = types1->GetTypeItem(i).type_idx_;
Handle<mirror::Class> param_type(hs.NewHandle(
method1->GetClassFromTypeIndex(param_type_idx, true /* resolve */)));
- if (UNLIKELY(param_type.Get() == nullptr)) {
+ if (UNLIKELY(param_type == nullptr)) {
ThrowSignatureCheckResolveArgException(klass, super_klass, method1,
method1, i, param_type_idx);
return false;
@@ -5020,7 +5059,7 @@
Handle<mirror::Class> c,
bool can_init_fields,
bool can_init_parents) {
- DCHECK(c.Get() != nullptr);
+ DCHECK(c != nullptr);
if (c->IsInitialized()) {
EnsureSkipAccessChecksMethods(c, image_pointer_size_);
self->AssertNoPendingException();
@@ -5200,7 +5239,7 @@
klass->SetMethodsPtrUnchecked(nullptr, 0, 0);
klass->SetSFieldsPtrUnchecked(nullptr);
klass->SetIFieldsPtrUnchecked(nullptr);
- if (UNLIKELY(h_new_class.Get() == nullptr)) {
+ if (UNLIKELY(h_new_class == nullptr)) {
self->AssertPendingOOMException();
mirror::Class::SetStatus(klass, mirror::Class::kStatusErrorUnresolved, self);
return false;
@@ -5744,7 +5783,7 @@
MutableHandle<mirror::PointerArray> vtable;
if (super_class->ShouldHaveEmbeddedVTable()) {
vtable = hs.NewHandle(AllocPointerArray(self, max_count));
- if (UNLIKELY(vtable.Get() == nullptr)) {
+ if (UNLIKELY(vtable == nullptr)) {
self->AssertPendingOOMException();
return false;
}
@@ -5773,7 +5812,7 @@
}
vtable = hs.NewHandle(down_cast<mirror::PointerArray*>(
super_vtable->CopyOf(self, max_count)));
- if (UNLIKELY(vtable.Get() == nullptr)) {
+ if (UNLIKELY(vtable == nullptr)) {
self->AssertPendingOOMException();
return false;
}
@@ -5909,7 +5948,7 @@
CHECK_LE(actual_count, max_count);
if (actual_count < max_count) {
vtable.Assign(down_cast<mirror::PointerArray*>(vtable->CopyOf(self, actual_count)));
- if (UNLIKELY(vtable.Get() == nullptr)) {
+ if (UNLIKELY(vtable == nullptr)) {
self->AssertPendingOOMException();
return false;
}
@@ -5962,8 +6001,8 @@
PointerSize image_pointer_size)
REQUIRES_SHARED(Locks::mutator_lock_) {
DCHECK(self != nullptr);
- DCHECK(iface.Get() != nullptr);
- DCHECK(iftable.Get() != nullptr);
+ DCHECK(iface != nullptr);
+ DCHECK(iftable != nullptr);
DCHECK_GE(ifstart, 0u);
DCHECK_LT(ifstart, iftable->Count());
DCHECK_EQ(iface.Get(), iftable->GetInterface(ifstart));
@@ -6048,7 +6087,7 @@
<< "This will be a fatal error in subsequent versions of android. "
<< "Continuing anyway.";
}
- if (UNLIKELY(chosen_iface.Get() != nullptr)) {
+ if (UNLIKELY(chosen_iface != nullptr)) {
// We have multiple default impls of the same method. This is a potential default conflict.
// We need to check if this possibly conflicting method is either a superclass of the chosen
// default implementation or is overridden by a non-default interface method. In either case
@@ -6503,7 +6542,7 @@
StackHandleScope<1> hs(self);
const bool has_superclass = klass->HasSuperClass();
const size_t super_ifcount = has_superclass ? klass->GetSuperClass()->GetIfTableCount() : 0U;
- const bool have_interfaces = interfaces.Get() != nullptr;
+ const bool have_interfaces = interfaces != nullptr;
const size_t num_interfaces =
have_interfaces ? interfaces->GetLength() : klass->NumDirectInterfaces();
if (num_interfaces == 0) {
@@ -6549,7 +6588,7 @@
}
// Create the interface function table.
MutableHandle<mirror::IfTable> iftable(hs.NewHandle(AllocIfTable(self, ifcount)));
- if (UNLIKELY(iftable.Get() == nullptr)) {
+ if (UNLIKELY(iftable == nullptr)) {
self->AssertPendingOOMException();
return false;
}
@@ -6587,7 +6626,7 @@
DCHECK_NE(num_interfaces, 0U);
iftable.Assign(down_cast<mirror::IfTable*>(
iftable->CopyOf(self, new_ifcount * mirror::IfTable::kMax)));
- if (UNLIKELY(iftable.Get() == nullptr)) {
+ if (UNLIKELY(iftable == nullptr)) {
self->AssertPendingOOMException();
return false;
}
@@ -6628,7 +6667,7 @@
Handle<mirror::PointerArray> check_vtable(hs.NewHandle(klass->GetVTableDuringLinking()));
ObjPtr<mirror::Class> super_temp = (klass->HasSuperClass()) ? klass->GetSuperClass() : nullptr;
Handle<mirror::Class> superclass(hs.NewHandle(super_temp));
- int32_t super_vtable_length = (superclass.Get() != nullptr) ? superclass->GetVTableLength() : 0;
+ int32_t super_vtable_length = (superclass != nullptr) ? superclass->GetVTableLength() : 0;
for (int32_t i = 0; i < check_vtable->GetLength(); ++i) {
ArtMethod* m = check_vtable->GetElementPtrSize<ArtMethod*>(i, pointer_size);
CHECK(m != nullptr);
@@ -7287,7 +7326,7 @@
// For a new interface, however, we need the whole vtable in case a new
// interface method is implemented in the whole superclass.
using_virtuals = false;
- DCHECK(vtable.Get() != nullptr);
+ DCHECK(vtable != nullptr);
input_vtable_array = vtable;
input_array_length = input_vtable_array->GetLength();
}
@@ -7430,7 +7469,7 @@
if (fill_tables) {
vtable.Assign(helper.UpdateVtable(default_translations, vtable.Get()));
- if (UNLIKELY(vtable.Get() == nullptr)) {
+ if (UNLIKELY(vtable == nullptr)) {
// The helper has already called self->AssertPendingOOMException();
return false;
}
@@ -7450,12 +7489,12 @@
}
bool ClassLinker::LinkInstanceFields(Thread* self, Handle<mirror::Class> klass) {
- CHECK(klass.Get() != nullptr);
+ CHECK(klass != nullptr);
return LinkFields(self, klass, false, nullptr);
}
bool ClassLinker::LinkStaticFields(Thread* self, Handle<mirror::Class> klass, size_t* class_size) {
- CHECK(klass.Get() != nullptr);
+ CHECK(klass != nullptr);
return LinkFields(self, klass, true, class_size);
}
@@ -7711,7 +7750,7 @@
mirror::String* ClassLinker::ResolveString(const DexFile& dex_file,
dex::StringIndex string_idx,
Handle<mirror::DexCache> dex_cache) {
- DCHECK(dex_cache.Get() != nullptr);
+ DCHECK(dex_cache != nullptr);
Thread::PoisonObjectPointersIfDebug();
ObjPtr<mirror::String> resolved = dex_cache->GetResolvedString(string_idx);
if (resolved != nullptr) {
@@ -7720,16 +7759,14 @@
uint32_t utf16_length;
const char* utf8_data = dex_file.StringDataAndUtf16LengthByIdx(string_idx, &utf16_length);
ObjPtr<mirror::String> string = intern_table_->InternStrong(utf16_length, utf8_data);
- if (string != nullptr) {
- dex_cache->SetResolvedString(string_idx, string);
- }
+ dex_cache->SetResolvedString(string_idx, string);
return string.Ptr();
}
mirror::String* ClassLinker::LookupString(const DexFile& dex_file,
dex::StringIndex string_idx,
Handle<mirror::DexCache> dex_cache) {
- DCHECK(dex_cache.Get() != nullptr);
+ DCHECK(dex_cache != nullptr);
ObjPtr<mirror::String> resolved = dex_cache->GetResolvedString(string_idx);
if (resolved != nullptr) {
return resolved.Ptr();
@@ -7763,16 +7800,11 @@
// Find the class in the loaded classes table.
type = LookupClass(self, descriptor, hash, class_loader.Ptr());
}
- if (type != nullptr) {
- if (type->IsResolved()) {
- dex_cache->SetResolvedType(type_idx, type);
- } else {
- type = nullptr;
- }
- }
}
- DCHECK(type == nullptr || type->IsResolved());
- return type;
+ if (type != nullptr && type->IsResolved()) {
+ return type.Ptr();
+ }
+ return nullptr;
}
mirror::Class* ClassLinker::ResolveType(const DexFile& dex_file,
@@ -7788,16 +7820,10 @@
dex::TypeIndex type_idx,
Handle<mirror::DexCache> dex_cache,
Handle<mirror::ClassLoader> class_loader) {
- DCHECK(dex_cache.Get() != nullptr);
+ DCHECK(dex_cache != nullptr);
Thread::PoisonObjectPointersIfDebug();
ObjPtr<mirror::Class> resolved = dex_cache->GetResolvedType(type_idx);
if (resolved == nullptr) {
- // TODO: Avoid this lookup as it duplicates work done in FindClass(). It is here
- // as a workaround for FastNative JNI to avoid AssertNoPendingException() when
- // trying to resolve annotations while an exception may be pending. Bug: 34659969
- resolved = LookupResolvedType(dex_file, type_idx, dex_cache.Get(), class_loader.Get());
- }
- if (resolved == nullptr) {
Thread* self = Thread::Current();
const char* descriptor = dex_file.StringByTypeIdx(type_idx);
resolved = FindClass(self, descriptor, class_loader);
@@ -7832,7 +7858,7 @@
Handle<mirror::ClassLoader> class_loader,
ArtMethod* referrer,
InvokeType type) {
- DCHECK(dex_cache.Get() != nullptr);
+ DCHECK(dex_cache != nullptr);
// Check for hit in the dex cache.
ArtMethod* resolved = dex_cache->GetResolvedMethod(method_idx, image_pointer_size_);
Thread::PoisonObjectPointersIfDebug();
@@ -8071,7 +8097,7 @@
Handle<mirror::DexCache> dex_cache,
Handle<mirror::ClassLoader> class_loader,
bool is_static) {
- DCHECK(dex_cache.Get() != nullptr);
+ DCHECK(dex_cache != nullptr);
ArtField* resolved = dex_cache->GetResolvedField(field_idx, image_pointer_size_);
Thread::PoisonObjectPointersIfDebug();
if (resolved != nullptr) {
@@ -8112,7 +8138,7 @@
uint32_t field_idx,
Handle<mirror::DexCache> dex_cache,
Handle<mirror::ClassLoader> class_loader) {
- DCHECK(dex_cache.Get() != nullptr);
+ DCHECK(dex_cache != nullptr);
ArtField* resolved = dex_cache->GetResolvedField(field_idx, image_pointer_size_);
Thread::PoisonObjectPointersIfDebug();
if (resolved != nullptr) {
@@ -8143,7 +8169,7 @@
Handle<mirror::DexCache> dex_cache,
Handle<mirror::ClassLoader> class_loader) {
DCHECK(Runtime::Current()->IsMethodHandlesEnabled());
- DCHECK(dex_cache.Get() != nullptr);
+ DCHECK(dex_cache != nullptr);
ObjPtr<mirror::MethodType> resolved = dex_cache->GetResolvedMethodType(proto_idx);
if (resolved != nullptr) {
@@ -8157,7 +8183,7 @@
const DexFile::ProtoId& proto_id = dex_file.GetProtoId(proto_idx);
Handle<mirror::Class> return_type(hs.NewHandle(
ResolveType(dex_file, proto_id.return_type_idx_, dex_cache, class_loader)));
- if (return_type.Get() == nullptr) {
+ if (return_type == nullptr) {
DCHECK(self->IsExceptionPending());
return nullptr;
}
@@ -8172,7 +8198,7 @@
ObjPtr<mirror::Class> array_of_class = FindArrayClass(self, &class_type);
Handle<mirror::ObjectArray<mirror::Class>> method_params(hs.NewHandle(
mirror::ObjectArray<mirror::Class>::Alloc(self, array_of_class, num_method_args)));
- if (method_params.Get() == nullptr) {
+ if (method_params == nullptr) {
DCHECK(self->IsExceptionPending());
return nullptr;
}
@@ -8183,7 +8209,7 @@
for (; it.HasNext(); it.Next()) {
const dex::TypeIndex type_idx = it.GetTypeIdx();
param_class.Assign(ResolveType(dex_file, type_idx, dex_cache, class_loader));
- if (param_class.Get() == nullptr) {
+ if (param_class == nullptr) {
DCHECK(self->IsExceptionPending());
return nullptr;
}
@@ -8200,6 +8226,148 @@
return type.Get();
}
+mirror::MethodHandle* ClassLinker::ResolveMethodHandle(uint32_t method_handle_idx,
+ ArtMethod* referrer)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ Thread* const self = Thread::Current();
+ const DexFile* const dex_file = referrer->GetDexFile();
+ const DexFile::MethodHandleItem& mh = dex_file->GetMethodHandle(method_handle_idx);
+
+ union {
+ ArtField* field;
+ ArtMethod* method;
+ uintptr_t field_or_method;
+ } target;
+ uint32_t num_params;
+ mirror::MethodHandle::Kind kind;
+ DexFile::MethodHandleType handle_type =
+ static_cast<DexFile::MethodHandleType>(mh.method_handle_type_);
+ switch (handle_type) {
+ case DexFile::MethodHandleType::kStaticPut: {
+ kind = mirror::MethodHandle::Kind::kStaticPut;
+ target.field = ResolveField(mh.field_or_method_idx_, referrer, true /* is_static */);
+ num_params = 1;
+ break;
+ }
+ case DexFile::MethodHandleType::kStaticGet: {
+ kind = mirror::MethodHandle::Kind::kStaticGet;
+ target.field = ResolveField(mh.field_or_method_idx_, referrer, true /* is_static */);
+ num_params = 0;
+ break;
+ }
+ case DexFile::MethodHandleType::kInstancePut: {
+ kind = mirror::MethodHandle::Kind::kInstancePut;
+ target.field = ResolveField(mh.field_or_method_idx_, referrer, false /* is_static */);
+ num_params = 2;
+ break;
+ }
+ case DexFile::MethodHandleType::kInstanceGet: {
+ kind = mirror::MethodHandle::Kind::kInstanceGet;
+ target.field = ResolveField(mh.field_or_method_idx_, referrer, false /* is_static */);
+ num_params = 1;
+ break;
+ }
+ case DexFile::MethodHandleType::kInvokeStatic: {
+ kind = mirror::MethodHandle::Kind::kInvokeStatic;
+ target.method = ResolveMethod<kNoICCECheckForCache>(self,
+ mh.field_or_method_idx_,
+ referrer,
+ InvokeType::kStatic);
+ uint32_t shorty_length;
+ target.method->GetShorty(&shorty_length);
+ num_params = shorty_length - 1; // Remove 1 for return value.
+ break;
+ }
+ case DexFile::MethodHandleType::kInvokeInstance: {
+ kind = mirror::MethodHandle::Kind::kInvokeVirtual;
+ target.method = ResolveMethod<kNoICCECheckForCache>(self,
+ mh.field_or_method_idx_,
+ referrer,
+ InvokeType::kVirtual);
+ uint32_t shorty_length;
+ target.method->GetShorty(&shorty_length);
+ num_params = shorty_length - 1; // Remove 1 for return value.
+ break;
+ }
+ case DexFile::MethodHandleType::kInvokeConstructor: {
+ UNIMPLEMENTED(FATAL) << "Invoke constructor is implemented as a transform.";
+ num_params = 0;
+ }
+ }
+
+ StackHandleScope<5> hs(self);
+ ObjPtr<mirror::Class> class_type = mirror::Class::GetJavaLangClass();
+ ObjPtr<mirror::Class> array_of_class = FindArrayClass(self, &class_type);
+ Handle<mirror::ObjectArray<mirror::Class>> method_params(hs.NewHandle(
+ mirror::ObjectArray<mirror::Class>::Alloc(self, array_of_class, num_params)));
+ if (method_params.Get() == nullptr) {
+ DCHECK(self->IsExceptionPending());
+ return nullptr;
+ }
+
+ Handle<mirror::Class> return_type;
+ switch (handle_type) {
+ case DexFile::MethodHandleType::kStaticPut: {
+ method_params->Set(0, target.field->GetType<true>());
+ return_type = hs.NewHandle(FindPrimitiveClass('V'));
+ break;
+ }
+ case DexFile::MethodHandleType::kStaticGet: {
+ return_type = hs.NewHandle(target.field->GetType<true>());
+ break;
+ }
+ case DexFile::MethodHandleType::kInstancePut: {
+ method_params->Set(0, target.field->GetDeclaringClass());
+ method_params->Set(1, target.field->GetType<true>());
+ return_type = hs.NewHandle(FindPrimitiveClass('V'));
+ break;
+ }
+ case DexFile::MethodHandleType::kInstanceGet: {
+ method_params->Set(0, target.field->GetDeclaringClass());
+ return_type = hs.NewHandle(target.field->GetType<true>());
+ break;
+ }
+ case DexFile::MethodHandleType::kInvokeStatic:
+ case DexFile::MethodHandleType::kInvokeInstance: {
+ // TODO(oth): This will not work for varargs methods as this
+ // requires instantiating a Transformer. This resolution step
+ // would be best done in managed code rather than in the run
+ // time (b/35235705)
+ Handle<mirror::DexCache> dex_cache(hs.NewHandle(referrer->GetDexCache()));
+ Handle<mirror::ClassLoader> class_loader(hs.NewHandle(referrer->GetClassLoader()));
+ DexFileParameterIterator it(*dex_file, target.method->GetPrototype());
+ for (int32_t i = 0; it.HasNext(); i++, it.Next()) {
+ const dex::TypeIndex type_idx = it.GetTypeIdx();
+ mirror::Class* klass = ResolveType(*dex_file, type_idx, dex_cache, class_loader);
+ if (nullptr == klass) {
+ DCHECK(self->IsExceptionPending());
+ return nullptr;
+ }
+ method_params->Set(i, klass);
+ }
+ return_type = hs.NewHandle(target.method->GetReturnType(true));
+ break;
+ }
+ case DexFile::MethodHandleType::kInvokeConstructor: {
+ // TODO(oth): b/35235705
+ UNIMPLEMENTED(FATAL) << "Invoke constructor is implemented as a transform.";
+ }
+ }
+
+ if (return_type.IsNull()) {
+ DCHECK(self->IsExceptionPending());
+ return nullptr;
+ }
+
+ Handle<mirror::MethodType>
+ mt(hs.NewHandle(mirror::MethodType::Create(self, return_type, method_params)));
+ if (mt.IsNull()) {
+ DCHECK(self->IsExceptionPending());
+ return nullptr;
+ }
+ return mirror::MethodHandleImpl::Create(self, target.field_or_method, kind, mt);
+}
+
bool ClassLinker::IsQuickResolutionStub(const void* entry_point) const {
return (entry_point == GetQuickResolutionStub()) ||
(quick_resolution_trampoline_ == entry_point);
@@ -8315,7 +8483,9 @@
"[Ljava/lang/reflect/Constructor;",
"[Ljava/lang/reflect/Field;",
"[Ljava/lang/reflect/Method;",
+ "Ljava/lang/invoke/CallSite;",
"Ljava/lang/invoke/MethodHandleImpl;",
+ "Ljava/lang/invoke/MethodHandles$Lookup;",
"Ljava/lang/invoke/MethodType;",
"Ljava/lang/ClassLoader;",
"Ljava/lang/Throwable;",
@@ -8363,7 +8533,7 @@
jni::DecodeArtField(WellKnownClasses::dalvik_system_DexPathList_dexElements);
Handle<mirror::Class> dex_elements_class(hs.NewHandle(dex_elements_field->GetType<true>()));
- DCHECK(dex_elements_class.Get() != nullptr);
+ DCHECK(dex_elements_class != nullptr);
DCHECK(dex_elements_class->IsArrayClass());
Handle<mirror::ObjectArray<mirror::Object>> h_dex_elements(hs.NewHandle(
mirror::ObjectArray<mirror::Object>::Alloc(self,
@@ -8392,21 +8562,21 @@
Handle<mirror::LongArray> h_long_array = hs2.NewHandle(mirror::LongArray::Alloc(
self,
kDexFileIndexStart + 1));
- DCHECK(h_long_array.Get() != nullptr);
+ DCHECK(h_long_array != nullptr);
h_long_array->Set(kDexFileIndexStart, reinterpret_cast<intptr_t>(dex_file));
Handle<mirror::Object> h_dex_file = hs2.NewHandle(
cookie_field->GetDeclaringClass()->AllocObject(self));
- DCHECK(h_dex_file.Get() != nullptr);
+ DCHECK(h_dex_file != nullptr);
cookie_field->SetObject<false>(h_dex_file.Get(), h_long_array.Get());
Handle<mirror::String> h_file_name = hs2.NewHandle(
mirror::String::AllocFromModifiedUtf8(self, dex_file->GetLocation().c_str()));
- DCHECK(h_file_name.Get() != nullptr);
+ DCHECK(h_file_name != nullptr);
file_name_field->SetObject<false>(h_dex_file.Get(), h_file_name.Get());
Handle<mirror::Object> h_element = hs2.NewHandle(h_dex_element_class->AllocObject(self));
- DCHECK(h_element.Get() != nullptr);
+ DCHECK(h_element != nullptr);
element_file_field->SetObject<false>(h_element.Get(), h_dex_file.Get());
h_dex_elements->Set(index, h_element.Get());
@@ -8417,7 +8587,7 @@
// Create DexPathList.
Handle<mirror::Object> h_dex_path_list = hs.NewHandle(
dex_elements_field->GetDeclaringClass()->AllocObject(self));
- DCHECK(h_dex_path_list.Get() != nullptr);
+ DCHECK(h_dex_path_list != nullptr);
// Set elements.
dex_elements_field->SetObject<false>(h_dex_path_list.Get(), h_dex_elements.Get());
@@ -8426,7 +8596,7 @@
soa.Decode<mirror::Class>(WellKnownClasses::dalvik_system_PathClassLoader));
Handle<mirror::Object> h_path_class_loader = hs.NewHandle(
h_path_class_class->AllocObject(self));
- DCHECK(h_path_class_loader.Get() != nullptr);
+ DCHECK(h_path_class_loader != nullptr);
// Set DexPathList.
ArtField* path_list_field =
jni::DecodeArtField(WellKnownClasses::dalvik_system_BaseDexClassLoader_pathList);
diff --git a/runtime/class_linker.h b/runtime/class_linker.h
index a880a10..e27a53d 100644
--- a/runtime/class_linker.h
+++ b/runtime/class_linker.h
@@ -55,6 +55,8 @@
class DexCacheMethodHandlesTest_Open_Test;
class DexCacheTest_Open_Test;
class IfTable;
+ class MethodHandle;
+ class MethodHandlesLookup;
class MethodType;
template<class T> class ObjectArray;
class StackTraceElement;
@@ -106,7 +108,9 @@
kJavaLangReflectConstructorArrayClass,
kJavaLangReflectFieldArrayClass,
kJavaLangReflectMethodArrayClass,
+ kJavaLangInvokeCallSite,
kJavaLangInvokeMethodHandleImpl,
+ kJavaLangInvokeMethodHandlesLookup,
kJavaLangInvokeMethodType,
kJavaLangClassLoader,
kJavaLangThrowable,
@@ -262,6 +266,10 @@
REQUIRES_SHARED(Locks::mutator_lock_)
REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_);
+ mirror::Class* ResolveType(dex::TypeIndex type_idx, ArtField* referrer)
+ REQUIRES_SHARED(Locks::mutator_lock_)
+ REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_);
+
// Look up a resolved type with the given ID from the DexFile. The ClassLoader is used to search
// for the type, since it may be referenced from but not contained within the given DexFile.
ObjPtr<mirror::Class> LookupResolvedType(const DexFile& dex_file,
@@ -269,10 +277,6 @@
ObjPtr<mirror::DexCache> dex_cache,
ObjPtr<mirror::ClassLoader> class_loader)
REQUIRES_SHARED(Locks::mutator_lock_);
- static ObjPtr<mirror::Class> LookupResolvedType(dex::TypeIndex type_idx,
- ObjPtr<mirror::DexCache> dex_cache,
- ObjPtr<mirror::ClassLoader> class_loader)
- REQUIRES_SHARED(Locks::mutator_lock_);
// Resolve a type with the given ID from the DexFile, storing the
// result in DexCache. The ClassLoader is used to search for the
@@ -366,6 +370,12 @@
REQUIRES_SHARED(Locks::mutator_lock_)
REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_);
+ // Resolve a method handle with a given ID from the DexFile. The
+ // result is not cached in the DexCache as the instance will only be
+ // used once in most circumstances.
+ mirror::MethodHandle* ResolveMethodHandle(uint32_t method_handle_idx, ArtMethod* referrer)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
// Returns true on success, false if there's an exception pending.
// can_run_clinit=false allows the compiler to attempt to init a class,
// given the restriction that no <clinit> execution is possible.
diff --git a/runtime/class_linker_test.cc b/runtime/class_linker_test.cc
index de1cd6d..07f3744 100644
--- a/runtime/class_linker_test.cc
+++ b/runtime/class_linker_test.cc
@@ -32,6 +32,7 @@
#include "entrypoints/entrypoint_utils-inl.h"
#include "gc/heap.h"
#include "mirror/accessible_object.h"
+#include "mirror/call_site.h"
#include "mirror/class-inl.h"
#include "mirror/class_ext.h"
#include "mirror/dex_cache.h"
@@ -40,6 +41,7 @@
#include "mirror/field.h"
#include "mirror/method_type.h"
#include "mirror/method_handle_impl.h"
+#include "mirror/method_handles_lookup.h"
#include "mirror/object-inl.h"
#include "mirror/object_array-inl.h"
#include "mirror/proxy.h"
@@ -185,7 +187,7 @@
void AssertArrayClass(const std::string& array_descriptor, Handle<mirror::Class> array)
REQUIRES_SHARED(Locks::mutator_lock_) {
- ASSERT_TRUE(array.Get() != nullptr);
+ ASSERT_TRUE(array != nullptr);
ASSERT_TRUE(array->GetClass() != nullptr);
ASSERT_EQ(array->GetClass(), array->GetClass()->GetClass());
EXPECT_TRUE(array->GetClass()->GetSuperClass() != nullptr);
@@ -409,7 +411,7 @@
StackHandleScope<1> hs(self);
Handle<mirror::Class> klass(
hs.NewHandle(class_linker_->FindSystemClass(self, descriptor.c_str())));
- ASSERT_TRUE(klass.Get() != nullptr);
+ ASSERT_TRUE(klass != nullptr);
std::string temp;
EXPECT_STREQ(descriptor.c_str(), klass.Get()->GetDescriptor(&temp));
EXPECT_EQ(class_loader, klass->GetClassLoader());
@@ -669,11 +671,13 @@
addOffset(OFFSETOF_MEMBER(mirror::DexCache, dex_), "dex");
addOffset(OFFSETOF_MEMBER(mirror::DexCache, dex_file_), "dexFile");
addOffset(OFFSETOF_MEMBER(mirror::DexCache, location_), "location");
+ addOffset(OFFSETOF_MEMBER(mirror::DexCache, num_resolved_call_sites_), "numResolvedCallSites");
addOffset(OFFSETOF_MEMBER(mirror::DexCache, num_resolved_fields_), "numResolvedFields");
addOffset(OFFSETOF_MEMBER(mirror::DexCache, num_resolved_method_types_), "numResolvedMethodTypes");
addOffset(OFFSETOF_MEMBER(mirror::DexCache, num_resolved_methods_), "numResolvedMethods");
addOffset(OFFSETOF_MEMBER(mirror::DexCache, num_resolved_types_), "numResolvedTypes");
addOffset(OFFSETOF_MEMBER(mirror::DexCache, num_strings_), "numStrings");
+ addOffset(OFFSETOF_MEMBER(mirror::DexCache, resolved_call_sites_), "resolvedCallSites");
addOffset(OFFSETOF_MEMBER(mirror::DexCache, resolved_fields_), "resolvedFields");
addOffset(OFFSETOF_MEMBER(mirror::DexCache, resolved_method_types_), "resolvedMethodTypes");
addOffset(OFFSETOF_MEMBER(mirror::DexCache, resolved_methods_), "resolvedMethods");
@@ -762,6 +766,14 @@
}
};
+struct MethodHandlesLookupOffsets : public CheckOffsets<mirror::MethodHandlesLookup> {
+ MethodHandlesLookupOffsets() : CheckOffsets<mirror::MethodHandlesLookup>(
+ false, "Ljava/lang/invoke/MethodHandles$Lookup;") {
+ addOffset(OFFSETOF_MEMBER(mirror::MethodHandlesLookup, allowed_modes_), "allowedModes");
+ addOffset(OFFSETOF_MEMBER(mirror::MethodHandlesLookup, lookup_class_), "lookupClass");
+ }
+};
+
struct EmulatedStackFrameOffsets : public CheckOffsets<mirror::EmulatedStackFrame> {
EmulatedStackFrameOffsets() : CheckOffsets<mirror::EmulatedStackFrame>(
false, "Ldalvik/system/EmulatedStackFrame;") {
@@ -772,6 +784,13 @@
}
};
+struct CallSiteOffsets : public CheckOffsets<mirror::CallSite> {
+ CallSiteOffsets() : CheckOffsets<mirror::CallSite>(
+ false, "Ljava/lang/invoke/CallSite;") {
+ addOffset(OFFSETOF_MEMBER(mirror::CallSite, target_), "target");
+ }
+};
+
// C++ fields must exactly match the fields in the Java classes. If this fails,
// reorder the fields in the C++ class. Managed class fields are ordered by
// ClassLinker::LinkFields.
@@ -794,7 +813,9 @@
EXPECT_TRUE(MethodTypeOffsets().Check());
EXPECT_TRUE(MethodHandleOffsets().Check());
EXPECT_TRUE(MethodHandleImplOffsets().Check());
+ EXPECT_TRUE(MethodHandlesLookupOffsets().Check());
EXPECT_TRUE(EmulatedStackFrameOffsets().Check());
+ EXPECT_TRUE(CallSiteOffsets().Check());
}
TEST_F(ClassLinkerTest, FindClassNonexistent) {
@@ -914,7 +935,7 @@
class_linker_->LookupResolvedType(dex_file, type_idx, dex_cache, class_loader.Get()),
klass);
// Zero out the resolved type and make sure LookupResolvedType still finds it.
- dex_cache->ClearResolvedType(type_idx);
+ dex_cache->SetResolvedType(type_idx, nullptr);
EXPECT_TRUE(dex_cache->GetResolvedType(type_idx) == nullptr);
EXPECT_OBJ_PTR_EQ(
class_linker_->LookupResolvedType(dex_file, type_idx, dex_cache, class_loader.Get()),
@@ -949,7 +970,7 @@
class_linker_->LookupResolvedType(dex_file, array_idx, dex_cache.Get(), class_loader.Get()),
array_klass);
// Zero out the resolved type and make sure LookupResolvedType() still finds it.
- dex_cache->ClearResolvedType(array_idx);
+ dex_cache->SetResolvedType(array_idx, nullptr);
EXPECT_TRUE(dex_cache->GetResolvedType(array_idx) == nullptr);
EXPECT_OBJ_PTR_EQ(
class_linker_->LookupResolvedType(dex_file, array_idx, dex_cache.Get(), class_loader.Get()),
@@ -972,7 +993,7 @@
class_linker_->LookupResolvedType(dex_file, type_idx, dex_cache.Get(), class_loader.Get()),
klass.Get());
// Zero out the resolved type and make sure LookupResolvedType still finds it.
- dex_cache->ClearResolvedType(type_idx);
+ dex_cache->SetResolvedType(type_idx, nullptr);
EXPECT_TRUE(dex_cache->GetResolvedType(type_idx) == nullptr);
EXPECT_OBJ_PTR_EQ(
class_linker_->LookupResolvedType(dex_file, type_idx, dex_cache.Get(), class_loader.Get()),
@@ -990,7 +1011,7 @@
class_linker_->LookupResolvedType(dex_file, type_idx, dex_cache.Get(), class_loader.Get()),
klass.Get());
// Zero out the resolved type and make sure LookupResolvedType() still finds it.
- dex_cache->ClearResolvedType(type_idx);
+ dex_cache->SetResolvedType(type_idx, nullptr);
EXPECT_TRUE(dex_cache->GetResolvedType(type_idx) == nullptr);
EXPECT_OBJ_PTR_EQ(
class_linker_->LookupResolvedType(dex_file, type_idx, dex_cache.Get(), class_loader.Get()),
@@ -1411,13 +1432,13 @@
// java.lang.Object is a bootstrap class.
Handle<mirror::Class> jlo_class(
hs.NewHandle(class_linker_->FindSystemClass(soa.Self(), "Ljava/lang/Object;")));
- ASSERT_TRUE(jlo_class.Get() != nullptr);
+ ASSERT_TRUE(jlo_class != nullptr);
EXPECT_TRUE(jlo_class.Get()->IsBootStrapClassLoaded());
// Statics is not a bootstrap class.
Handle<mirror::Class> statics(
hs.NewHandle(class_linker_->FindClass(soa.Self(), "LStatics;", class_loader)));
- ASSERT_TRUE(statics.Get() != nullptr);
+ ASSERT_TRUE(statics != nullptr);
EXPECT_FALSE(statics.Get()->IsBootStrapClassLoaded());
}
@@ -1431,11 +1452,11 @@
ReaderMutexLock mu(soa.Self(), *Locks::dex_lock_);
for (const ClassLinker::DexCacheData& data : class_linker->GetDexCachesData()) {
dex_cache.Assign(soa.Self()->DecodeJObject(data.weak_root)->AsDexCache());
- if (dex_cache.Get() != nullptr) {
+ if (dex_cache != nullptr) {
break;
}
}
- ASSERT_TRUE(dex_cache.Get() != nullptr);
+ ASSERT_TRUE(dex_cache != nullptr);
}
// Make a copy of the dex cache and change the name.
dex_cache.Assign(dex_cache->Clone(soa.Self())->AsDexCache());
@@ -1487,7 +1508,7 @@
class_linker_->ResolveMethodType(dex_file, method1_id.proto_idx_, dex_cache, class_loader));
// Assert that the method type was resolved successfully.
- ASSERT_TRUE(method1_type.Get() != nullptr);
+ ASSERT_TRUE(method1_type != nullptr);
// Assert that the return type and the method arguments are as we expect.
Handle<mirror::Class> string_class(
diff --git a/runtime/class_table_test.cc b/runtime/class_table_test.cc
index f1248eb..18c2b82 100644
--- a/runtime/class_table_test.cc
+++ b/runtime/class_table_test.cc
@@ -80,7 +80,7 @@
Handle<mirror::Class> h_Y(
hs.NewHandle(class_linker_->FindClass(soa.Self(), descriptor_y, class_loader)));
Handle<mirror::Object> obj_X = hs.NewHandle(h_X->AllocObject(soa.Self()));
- ASSERT_TRUE(obj_X.Get() != nullptr);
+ ASSERT_TRUE(obj_X != nullptr);
ClassTable table;
EXPECT_EQ(table.NumZygoteClasses(class_loader.Get()), 0u);
EXPECT_EQ(table.NumNonZygoteClasses(class_loader.Get()), 0u);
diff --git a/runtime/common_throws.cc b/runtime/common_throws.cc
index a44f79e..4f4bed0 100644
--- a/runtime/common_throws.cc
+++ b/runtime/common_throws.cc
@@ -126,6 +126,22 @@
mirror::Class::PrettyDescriptor(array_class).c_str()).c_str());
}
+// BootstrapMethodError
+
+void ThrowBootstrapMethodError(const char* fmt, ...) {
+ va_list args;
+ va_start(args, fmt);
+ ThrowException("Ljava/lang/BootstrapMethodError;", nullptr, fmt, &args);
+ va_end(args);
+}
+
+void ThrowWrappedBootstrapMethodError(const char* fmt, ...) {
+ va_list args;
+ va_start(args, fmt);
+ ThrowWrappedException("Ljava/lang/BootstrapMethodError;", nullptr, fmt, &args);
+ va_end(args);
+}
+
// ClassCastException
void ThrowClassCastException(ObjPtr<mirror::Class> dest_type, ObjPtr<mirror::Class> src_type) {
diff --git a/runtime/common_throws.h b/runtime/common_throws.h
index 76ea2ae..55a8938 100644
--- a/runtime/common_throws.h
+++ b/runtime/common_throws.h
@@ -56,6 +56,14 @@
ObjPtr<mirror::Class> array_class)
REQUIRES_SHARED(Locks::mutator_lock_) COLD_ATTR;
+// BootstrapMethodError
+
+void ThrowBootstrapMethodError(const char* fmt, ...)
+ REQUIRES_SHARED(Locks::mutator_lock_) COLD_ATTR;
+
+void ThrowWrappedBootstrapMethodError(const char* fmt, ...)
+ REQUIRES_SHARED(Locks::mutator_lock_) COLD_ATTR;
+
// ClassCircularityError
void ThrowClassCircularityError(ObjPtr<mirror::Class> c)
@@ -236,7 +244,7 @@
__attribute__((__format__(__printf__, 2, 3)))
REQUIRES_SHARED(Locks::mutator_lock_) COLD_ATTR;
-// WrontMethodTypeException
+// WrongMethodTypeException
void ThrowWrongMethodTypeException(mirror::MethodType* callee_type,
mirror::MethodType* callsite_type)
REQUIRES_SHARED(Locks::mutator_lock_) COLD_ATTR;
diff --git a/runtime/compiler_filter.cc b/runtime/compiler_filter.cc
index cb8c11d..dc55ab8 100644
--- a/runtime/compiler_filter.cc
+++ b/runtime/compiler_filter.cc
@@ -113,7 +113,10 @@
case CompilerFilter::kSpeed:
case CompilerFilter::kEverything: return false;
- case CompilerFilter::kVerifyProfile:
+ // verify-profile doesn't look at profiles anymore.
+ // TODO(ngeoffray): this will be cleaned up with b/34715556.
+ case CompilerFilter::kVerifyProfile: return false;
+
case CompilerFilter::kSpaceProfile:
case CompilerFilter::kSpeedProfile:
case CompilerFilter::kEverythingProfile: return true;
@@ -134,7 +137,9 @@
return filter;
case CompilerFilter::kVerifyProfile:
- return CompilerFilter::kInterpretOnly;
+ // verify-profile doesn't look at profiles anymore.
+ // TODO(ngeoffray): this will be cleaned up with b/34715556.
+ return filter;
case CompilerFilter::kSpaceProfile:
return CompilerFilter::kSpace;
diff --git a/runtime/debugger.cc b/runtime/debugger.cc
index 1a0cec0..b2fba67 100644
--- a/runtime/debugger.cc
+++ b/runtime/debugger.cc
@@ -800,14 +800,14 @@
monitor_info = MonitorInfo(o);
}
if (monitor_info.owner_ != nullptr) {
- expandBufAddObjectId(reply, gRegistry->Add(monitor_info.owner_->GetPeer()));
+ expandBufAddObjectId(reply, gRegistry->Add(monitor_info.owner_->GetPeerFromOtherThread()));
} else {
expandBufAddObjectId(reply, gRegistry->Add(nullptr));
}
expandBufAdd4BE(reply, monitor_info.entry_count_);
expandBufAdd4BE(reply, monitor_info.waiters_.size());
for (size_t i = 0; i < monitor_info.waiters_.size(); ++i) {
- expandBufAddObjectId(reply, gRegistry->Add(monitor_info.waiters_[i]->GetPeer()));
+ expandBufAddObjectId(reply, gRegistry->Add(monitor_info.waiters_[i]->GetPeerFromOtherThread()));
}
return JDWP::ERR_NONE;
}
@@ -1352,7 +1352,7 @@
JDWP::JdwpError error;
mirror::Object* expected_thread_peer = gRegistry->Get<mirror::Object*>(
expected_thread_id, &error);
- return expected_thread_peer == event_thread->GetPeer();
+ return expected_thread_peer == event_thread->GetPeerFromOtherThread();
}
bool Dbg::MatchLocation(const JDWP::JdwpLocation& expected_location,
@@ -1765,13 +1765,13 @@
StackHandleScope<2> hs(self);
MutableHandle<mirror::Object>
o(hs.NewHandle(Dbg::GetObjectRegistry()->Get<mirror::Object*>(object_id, &error)));
- if ((!is_static && o.Get() == nullptr) || error != JDWP::ERR_NONE) {
+ if ((!is_static && o == nullptr) || error != JDWP::ERR_NONE) {
return JDWP::ERR_INVALID_OBJECT;
}
ArtField* f = FromFieldId(field_id);
mirror::Class* receiver_class = c;
- if (receiver_class == nullptr && o.Get() != nullptr) {
+ if (receiver_class == nullptr && o != nullptr) {
receiver_class = o->GetClass();
}
@@ -1899,7 +1899,7 @@
StackHandleScope<2> hs(self);
MutableHandle<mirror::Object>
o(hs.NewHandle(Dbg::GetObjectRegistry()->Get<mirror::Object*>(object_id, &error)));
- if ((!is_static && o.Get() == nullptr) || error != JDWP::ERR_NONE) {
+ if ((!is_static && o == nullptr) || error != JDWP::ERR_NONE) {
return JDWP::ERR_INVALID_OBJECT;
}
ArtField* f = FromFieldId(field_id);
@@ -2273,7 +2273,7 @@
// not completely started yet so we must ignore it.
continue;
}
- mirror::Object* peer = t->GetPeer();
+ mirror::Object* peer = t->GetPeerFromOtherThread();
if (peer == nullptr) {
// peer might be null if the thread is still starting up. We can't tell the debugger about
// this thread yet.
@@ -2386,7 +2386,7 @@
JDWP::ObjectId Dbg::GetThreadId(Thread* thread) {
ScopedObjectAccessUnchecked soa(Thread::Current());
- return gRegistry->Add(thread->GetPeer());
+ return gRegistry->Add(thread->GetPeerFromOtherThread());
}
void Dbg::SuspendVM() {
@@ -2867,7 +2867,7 @@
StackHandleScope<1> hs(self);
Handle<mirror::Throwable> pending_exception(hs.NewHandle(self->GetException()));
self->ClearException();
- if (kIsDebugBuild && pending_exception.Get() != nullptr) {
+ if (kIsDebugBuild && pending_exception != nullptr) {
const DexFile::CodeItem* code_item = location.method->GetCodeItem();
const Instruction* instr = Instruction::At(&code_item->insns_[location.dex_pc]);
CHECK_EQ(Instruction::MOVE_EXCEPTION, instr->Opcode());
@@ -2875,7 +2875,7 @@
gJdwpState->PostLocationEvent(&location, this_object, event_flags, return_value);
- if (pending_exception.Get() != nullptr) {
+ if (pending_exception != nullptr) {
self->SetException(pending_exception.Get());
}
}
@@ -4027,7 +4027,7 @@
ExecuteMethodWithoutPendingException(soa, pReq);
// If an exception was pending before the invoke, restore it now.
- if (old_exception.Get() != nullptr) {
+ if (old_exception != nullptr) {
soa.Self()->SetException(old_exception.Get());
}
}
@@ -4356,9 +4356,9 @@
ScopedObjectAccessUnchecked soa(Thread::Current());
StackHandleScope<1> hs(soa.Self());
Handle<mirror::String> name(hs.NewHandle(t->GetThreadName()));
- size_t char_count = (name.Get() != nullptr) ? name->GetLength() : 0;
- const jchar* chars = (name.Get() != nullptr) ? name->GetValue() : nullptr;
- bool is_compressed = (name.Get() != nullptr) ? name->IsCompressed() : false;
+ size_t char_count = (name != nullptr) ? name->GetLength() : 0;
+ const jchar* chars = (name != nullptr) ? name->GetValue() : nullptr;
+ bool is_compressed = (name != nullptr) ? name->IsCompressed() : false;
std::vector<uint8_t> bytes;
JDWP::Append4BE(bytes, t->GetThreadId());
diff --git a/runtime/dex2oat_environment_test.h b/runtime/dex2oat_environment_test.h
index 8b0c51c..e58c6f5 100644
--- a/runtime/dex2oat_environment_test.h
+++ b/runtime/dex2oat_environment_test.h
@@ -53,7 +53,7 @@
ASSERT_EQ(0, mkdir(odex_dir_.c_str(), 0700));
// Verify the environment is as we expect
- uint32_t checksum;
+ std::vector<uint32_t> checksums;
std::string error_msg;
ASSERT_TRUE(OS::FileExists(GetSystemImageFile().c_str()))
<< "Expected pre-compiled boot image to be at: " << GetSystemImageFile();
@@ -61,7 +61,7 @@
<< "Expected dex file to be at: " << GetDexSrc1();
ASSERT_TRUE(OS::FileExists(GetStrippedDexSrc1().c_str()))
<< "Expected stripped dex file to be at: " << GetStrippedDexSrc1();
- ASSERT_FALSE(DexFile::GetChecksum(GetStrippedDexSrc1().c_str(), &checksum, &error_msg))
+ ASSERT_FALSE(DexFile::GetMultiDexChecksums(GetStrippedDexSrc1().c_str(), &checksums, &error_msg))
<< "Expected stripped dex file to be stripped: " << GetStrippedDexSrc1();
ASSERT_TRUE(OS::FileExists(GetDexSrc2().c_str()))
<< "Expected dex file to be at: " << GetDexSrc2();
diff --git a/runtime/dex_file.cc b/runtime/dex_file.cc
index f59420d..b6a2e09 100644
--- a/runtime/dex_file.cc
+++ b/runtime/dex_file.cc
@@ -72,23 +72,13 @@
uint8_t type_;
};
-bool DexFile::GetChecksum(const char* filename, uint32_t* checksum, std::string* error_msg) {
- CHECK(checksum != nullptr);
+bool DexFile::GetMultiDexChecksums(const char* filename,
+ std::vector<uint32_t>* checksums,
+ std::string* error_msg) {
+ CHECK(checksums != nullptr);
uint32_t magic;
- // Strip ":...", which is the location
- const char* zip_entry_name = kClassesDex;
- const char* file_part = filename;
- std::string file_part_storage;
-
- if (DexFile::IsMultiDexLocation(filename)) {
- file_part_storage = GetBaseLocation(filename);
- file_part = file_part_storage.c_str();
- zip_entry_name = filename + file_part_storage.size() + 1;
- DCHECK_EQ(zip_entry_name[-1], kMultiDexSeparator);
- }
-
- File fd = OpenAndReadMagic(file_part, &magic, error_msg);
+ File fd = OpenAndReadMagic(filename, &magic, error_msg);
if (fd.Fd() == -1) {
DCHECK(!error_msg->empty());
return false;
@@ -97,17 +87,25 @@
std::unique_ptr<ZipArchive> zip_archive(
ZipArchive::OpenFromFd(fd.Release(), filename, error_msg));
if (zip_archive.get() == nullptr) {
- *error_msg = StringPrintf("Failed to open zip archive '%s' (error msg: %s)", file_part,
+ *error_msg = StringPrintf("Failed to open zip archive '%s' (error msg: %s)", filename,
error_msg->c_str());
return false;
}
- std::unique_ptr<ZipEntry> zip_entry(zip_archive->Find(zip_entry_name, error_msg));
+
+ uint32_t i = 0;
+ std::string zip_entry_name = GetMultiDexClassesDexName(i++);
+ std::unique_ptr<ZipEntry> zip_entry(zip_archive->Find(zip_entry_name.c_str(), error_msg));
if (zip_entry.get() == nullptr) {
- *error_msg = StringPrintf("Zip archive '%s' doesn't contain %s (error msg: %s)", file_part,
- zip_entry_name, error_msg->c_str());
+ *error_msg = StringPrintf("Zip archive '%s' doesn't contain %s (error msg: %s)", filename,
+ zip_entry_name.c_str(), error_msg->c_str());
return false;
}
- *checksum = zip_entry->GetCrc32();
+
+ do {
+ checksums->push_back(zip_entry->GetCrc32());
+ zip_entry_name = DexFile::GetMultiDexClassesDexName(i++);
+ zip_entry.reset(zip_archive->Find(zip_entry_name.c_str(), error_msg));
+ } while (zip_entry.get() != nullptr);
return true;
}
if (IsDexMagic(magic)) {
@@ -116,7 +114,7 @@
if (dex_file.get() == nullptr) {
return false;
}
- *checksum = dex_file->GetHeader().checksum_;
+ checksums->push_back(dex_file->GetHeader().checksum_);
return true;
}
*error_msg = StringPrintf("Expected valid zip or dex file: '%s'", filename);
@@ -333,7 +331,32 @@
*error_code = ZipOpenErrorCode::kDexFileError;
return nullptr;
}
- std::unique_ptr<MemMap> map(zip_entry->ExtractToMemMap(location.c_str(), entry_name, error_msg));
+
+ std::unique_ptr<MemMap> map;
+ if (zip_entry->IsUncompressed()) {
+ if (!zip_entry->IsAlignedTo(alignof(Header))) {
+ // Do not mmap unaligned ZIP entries because
+ // doing so would fail dex verification which requires 4 byte alignment.
+ LOG(WARNING) << "Can't mmap dex file " << location << "!" << entry_name << " directly; "
+ << "please zipalign to " << alignof(Header) << " bytes. "
+ << "Falling back to extracting file.";
+ } else {
+ // Map uncompressed files within zip as file-backed to avoid a dirty copy.
+ map.reset(zip_entry->MapDirectlyFromFile(location.c_str(), /*out*/error_msg));
+ if (map == nullptr) {
+ LOG(WARNING) << "Can't mmap dex file " << location << "!" << entry_name << " directly; "
+ << "is your ZIP file corrupted? Falling back to extraction.";
+ // Try again with Extraction which still has a chance of recovery.
+ }
+ }
+ }
+
+ if (map == nullptr) {
+ // Default path for compressed ZIP entries,
+ // and fallback for stored ZIP entries.
+ map.reset(zip_entry->ExtractToMemMap(location.c_str(), entry_name, error_msg));
+ }
+
if (map == nullptr) {
*error_msg = StringPrintf("Failed to extract '%s' from '%s': %s", entry_name, location.c_str(),
error_msg->c_str());
@@ -415,7 +438,7 @@
&error_code));
if (next_dex_file.get() == nullptr) {
if (error_code != ZipOpenErrorCode::kEntryNotFound) {
- LOG(WARNING) << error_msg;
+ LOG(WARNING) << "Zip open failed: " << *error_msg;
}
break;
} else {
@@ -497,9 +520,19 @@
method_ids_(reinterpret_cast<const MethodId*>(base + header_->method_ids_off_)),
proto_ids_(reinterpret_cast<const ProtoId*>(base + header_->proto_ids_off_)),
class_defs_(reinterpret_cast<const ClassDef*>(base + header_->class_defs_off_)),
+ method_handles_(nullptr),
+ num_method_handles_(0),
+ call_site_ids_(nullptr),
+ num_call_site_ids_(0),
oat_dex_file_(oat_dex_file) {
CHECK(begin_ != nullptr) << GetLocation();
CHECK_GT(size_, 0U) << GetLocation();
+ // Check base (=header) alignment.
+ // Must be 4-byte aligned to avoid undefined behavior when accessing
+ // any of the sections via a pointer.
+ CHECK_ALIGNED(begin_, alignof(Header));
+
+ InitializeSectionsFromMapList();
}
DexFile::~DexFile() {
@@ -540,6 +573,29 @@
return true;
}
+void DexFile::InitializeSectionsFromMapList() {
+ const MapList* map_list = reinterpret_cast<const MapList*>(begin_ + header_->map_off_);
+ const size_t count = map_list->size_;
+
+ size_t map_limit = header_->map_off_ + count * sizeof(MapItem);
+ if (header_->map_off_ >= map_limit || map_limit > size_) {
+ // Overflow or out out of bounds. The dex file verifier runs after
+ // this method and will reject the file as it is malformed.
+ return;
+ }
+
+ for (size_t i = 0; i < count; ++i) {
+ const MapItem& map_item = map_list->list_[i];
+ if (map_item.type_ == kDexTypeMethodHandleItem) {
+ method_handles_ = reinterpret_cast<const MethodHandleItem*>(begin_ + map_item.offset_);
+ num_method_handles_ = map_item.size_;
+ } else if (map_item.type_ == kDexTypeCallSiteIdItem) {
+ call_site_ids_ = reinterpret_cast<const CallSiteIdItem*>(begin_ + map_item.offset_);
+ num_call_site_ids_ = map_item.size_;
+ }
+ }
+}
+
bool DexFile::IsMagicValid(const uint8_t* magic) {
return (memcmp(magic, kDexMagic, sizeof(kDexMagic)) == 0);
}
@@ -1339,24 +1395,20 @@
}
}
-EncodedStaticFieldValueIterator::EncodedStaticFieldValueIterator(const DexFile& dex_file,
- const DexFile::ClassDef& class_def)
+EncodedArrayValueIterator::EncodedArrayValueIterator(const DexFile& dex_file,
+ const uint8_t* array_data)
: dex_file_(dex_file),
array_size_(),
pos_(-1),
+ ptr_(array_data),
type_(kByte) {
- ptr_ = dex_file_.GetEncodedStaticFieldValuesArray(class_def);
- if (ptr_ == nullptr) {
- array_size_ = 0;
- } else {
- array_size_ = DecodeUnsignedLeb128(&ptr_);
- }
+ array_size_ = (ptr_ != nullptr) ? DecodeUnsignedLeb128(&ptr_) : 0;
if (array_size_ > 0) {
Next();
}
}
-void EncodedStaticFieldValueIterator::Next() {
+void EncodedArrayValueIterator::Next() {
pos_++;
if (pos_ >= array_size_) {
return;
@@ -1396,6 +1448,8 @@
break;
case kString:
case kType:
+ case kMethodType:
+ case kMethodHandle:
jval_.i = DexFile::ReadUnsignedInt(ptr_, value_arg, false);
break;
case kField:
diff --git a/runtime/dex_file.h b/runtime/dex_file.h
index cb7f174..58b8e79 100644
--- a/runtime/dex_file.h
+++ b/runtime/dex_file.h
@@ -103,7 +103,7 @@
};
// Map item type codes.
- enum {
+ enum MapItemType : uint16_t { // private
kDexTypeHeaderItem = 0x0000,
kDexTypeStringIdItem = 0x0001,
kDexTypeTypeIdItem = 0x0002,
@@ -111,6 +111,8 @@
kDexTypeFieldIdItem = 0x0004,
kDexTypeMethodIdItem = 0x0005,
kDexTypeClassDefItem = 0x0006,
+ kDexTypeCallSiteIdItem = 0x0007,
+ kDexTypeMethodHandleItem = 0x0008,
kDexTypeMapList = 0x1000,
kDexTypeTypeList = 0x1001,
kDexTypeAnnotationSetRefList = 0x1002,
@@ -260,6 +262,37 @@
DISALLOW_COPY_AND_ASSIGN(TypeList);
};
+ // MethodHandle Types
+ enum class MethodHandleType : uint16_t { // private
+ kStaticPut = 0x0000, // a setter for a given static field.
+ kStaticGet = 0x0001, // a getter for a given static field.
+ kInstancePut = 0x0002, // a setter for a given instance field.
+ kInstanceGet = 0x0003, // a getter for a given instance field.
+ kInvokeStatic = 0x0004, // an invoker for a given static method.
+ kInvokeInstance = 0x0005, // invoke_instance : an invoker for a given instance method. This
+ // can be any non-static method on any class (or interface) except
+ // for “<init>”.
+ kInvokeConstructor = 0x0006, // an invoker for a given constructor.
+ kLast = kInvokeConstructor
+ };
+
+ // raw method_handle_item
+ struct MethodHandleItem {
+ uint16_t method_handle_type_;
+ uint16_t reserved1_; // Reserved for future use.
+ uint16_t field_or_method_idx_; // Field index for accessors, method index otherwise.
+ uint16_t reserved2_; // Reserved for future use.
+ private:
+ DISALLOW_COPY_AND_ASSIGN(MethodHandleItem);
+ };
+
+ // raw call_site_id_item
+ struct CallSiteIdItem {
+ uint32_t data_off_; // Offset into data section pointing to encoded array items.
+ private:
+ DISALLOW_COPY_AND_ASSIGN(CallSiteIdItem);
+ };
+
// Raw code_item.
struct CodeItem {
uint16_t registers_size_; // the number of registers used by this code
@@ -302,6 +335,8 @@
kDexAnnotationLong = 0x06,
kDexAnnotationFloat = 0x10,
kDexAnnotationDouble = 0x11,
+ kDexAnnotationMethodType = 0x15,
+ kDexAnnotationMethodHandle = 0x16,
kDexAnnotationString = 0x17,
kDexAnnotationType = 0x18,
kDexAnnotationField = 0x19,
@@ -389,11 +424,18 @@
struct AnnotationValue;
- // Returns the checksum of a file for comparison with GetLocationChecksum().
- // For .dex files, this is the header checksum.
- // For zip files, this is the classes.dex zip entry CRC32 checksum.
- // Return true if the checksum could be found, false otherwise.
- static bool GetChecksum(const char* filename, uint32_t* checksum, std::string* error_msg);
+ // Returns the checksums of a file for comparison with GetLocationChecksum().
+ // For .dex files, this is the single header checksum.
+ // For zip files, this is the zip entry CRC32 checksum for classes.dex and
+ // each additional multidex entry classes2.dex, classes3.dex, etc.
+ // Return true if the checksums could be found, false otherwise.
+ static bool GetMultiDexChecksums(const char* filename,
+ std::vector<uint32_t>* checksums,
+ std::string* error_msg);
+
+ // Check whether a location denotes a multidex dex file. This is a very simple check: returns
+ // whether the string contains the separator character.
+ static bool IsMultiDexLocation(const char* location);
// Opens .dex file, backed by existing memory
static std::unique_ptr<const DexFile> Open(const uint8_t* base,
@@ -683,6 +725,24 @@
}
}
+ uint32_t NumMethodHandles() const {
+ return num_method_handles_;
+ }
+
+ const MethodHandleItem& GetMethodHandle(uint32_t idx) const {
+ CHECK_LT(idx, NumMethodHandles());
+ return method_handles_[idx];
+ }
+
+ uint32_t NumCallSiteIds() const {
+ return num_call_site_ids_;
+ }
+
+ const CallSiteIdItem& GetCallSiteId(uint32_t idx) const {
+ CHECK_LT(idx, NumCallSiteIds());
+ return call_site_ids_[idx];
+ }
+
// Returns a pointer to the raw memory mapped class_data_item
const uint8_t* GetClassData(const ClassDef& class_def) const {
if (class_def.class_data_off_ == 0) {
@@ -761,6 +821,10 @@
}
}
+ const uint8_t* GetCallSiteEncodedValuesArray(const CallSiteIdItem& call_site_id) const {
+ return begin_ + call_site_id.data_off_;
+ }
+
static const TryItem* GetTryItems(const CodeItem& code_item, uint32_t offset);
// Get the base of the encoded data for the given DexCode.
@@ -1101,9 +1165,8 @@
// Returns true if the header magic and version numbers are of the expected values.
bool CheckMagicAndVersion(std::string* error_msg) const;
- // Check whether a location denotes a multidex dex file. This is a very simple check: returns
- // whether the string contains the separator character.
- static bool IsMultiDexLocation(const char* location);
+ // Initialize section info for sections only found in map. Returns true on success.
+ void InitializeSectionsFromMapList();
// The base address of the memory mapping.
const uint8_t* const begin_;
@@ -1143,6 +1206,18 @@
// Points to the base of the class definition list.
const ClassDef* const class_defs_;
+ // Points to the base of the method handles list.
+ const MethodHandleItem* method_handles_;
+
+ // Number of elements in the method handles list.
+ size_t num_method_handles_;
+
+ // Points to the base of the call sites id list.
+ const CallSiteIdItem* call_site_ids_;
+
+ // Number of elements in the call sites list.
+ size_t num_call_site_ids_;
+
// If this dex file was loaded from an oat file, oat_dex_file_ contains a
// pointer to the OatDexFile it was loaded from. Otherwise oat_dex_file_ is
// null.
@@ -1409,32 +1484,33 @@
DISALLOW_IMPLICIT_CONSTRUCTORS(ClassDataItemIterator);
};
-class EncodedStaticFieldValueIterator {
+class EncodedArrayValueIterator {
public:
- EncodedStaticFieldValueIterator(const DexFile& dex_file,
- const DexFile::ClassDef& class_def);
+ EncodedArrayValueIterator(const DexFile& dex_file, const uint8_t* array_data);
bool HasNext() const { return pos_ < array_size_; }
void Next();
enum ValueType {
- kByte = 0x00,
- kShort = 0x02,
- kChar = 0x03,
- kInt = 0x04,
- kLong = 0x06,
- kFloat = 0x10,
- kDouble = 0x11,
- kString = 0x17,
- kType = 0x18,
- kField = 0x19,
- kMethod = 0x1a,
- kEnum = 0x1b,
- kArray = 0x1c,
- kAnnotation = 0x1d,
- kNull = 0x1e,
- kBoolean = 0x1f
+ kByte = 0x00,
+ kShort = 0x02,
+ kChar = 0x03,
+ kInt = 0x04,
+ kLong = 0x06,
+ kFloat = 0x10,
+ kDouble = 0x11,
+ kMethodType = 0x15,
+ kMethodHandle = 0x16,
+ kString = 0x17,
+ kType = 0x18,
+ kField = 0x19,
+ kMethod = 0x1a,
+ kEnum = 0x1b,
+ kArray = 0x1c,
+ kAnnotation = 0x1d,
+ kNull = 0x1e,
+ kBoolean = 0x1f,
};
ValueType GetValueType() const { return type_; }
@@ -1452,10 +1528,38 @@
jvalue jval_; // Value of current encoded value.
private:
+ DISALLOW_IMPLICIT_CONSTRUCTORS(EncodedArrayValueIterator);
+};
+std::ostream& operator<<(std::ostream& os, const EncodedArrayValueIterator::ValueType& code);
+
+class EncodedStaticFieldValueIterator : public EncodedArrayValueIterator {
+ public:
+ EncodedStaticFieldValueIterator(const DexFile& dex_file,
+ const DexFile::ClassDef& class_def)
+ : EncodedArrayValueIterator(dex_file,
+ dex_file.GetEncodedStaticFieldValuesArray(class_def))
+ {}
+
+ private:
DISALLOW_IMPLICIT_CONSTRUCTORS(EncodedStaticFieldValueIterator);
};
std::ostream& operator<<(std::ostream& os, const EncodedStaticFieldValueIterator::ValueType& code);
+class CallSiteArrayValueIterator : public EncodedArrayValueIterator {
+ public:
+ CallSiteArrayValueIterator(const DexFile& dex_file,
+ const DexFile::CallSiteIdItem& call_site_id)
+ : EncodedArrayValueIterator(dex_file,
+ dex_file.GetCallSiteEncodedValuesArray(call_site_id))
+ {}
+
+ uint32_t Size() const { return array_size_; }
+
+ private:
+ DISALLOW_IMPLICIT_CONSTRUCTORS(CallSiteArrayValueIterator);
+};
+std::ostream& operator<<(std::ostream& os, const CallSiteArrayValueIterator::ValueType& code);
+
class CatchHandlerIterator {
public:
CatchHandlerIterator(const DexFile::CodeItem& code_item, uint32_t address);
diff --git a/runtime/dex_file_annotations.cc b/runtime/dex_file_annotations.cc
index 16a447b..a95f94c 100644
--- a/runtime/dex_file_annotations.cc
+++ b/runtime/dex_file_annotations.cc
@@ -252,7 +252,7 @@
ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
Handle<mirror::Class> annotation_class(hs.NewHandle(
class_linker->ResolveType(klass->GetDexFile(), dex::TypeIndex(type_index), klass.Get())));
- if (annotation_class.Get() == nullptr) {
+ if (annotation_class == nullptr) {
LOG(INFO) << "Unable to resolve " << klass->PrettyClass() << " annotation class " << type_index;
DCHECK(Thread::Current()->IsExceptionPending());
Thread::Current()->ClearException();
@@ -481,7 +481,7 @@
break;
}
case DexFile::kDexAnnotationArray:
- if (result_style == DexFile::kAllRaw || array_class.Get() == nullptr) {
+ if (result_style == DexFile::kAllRaw || array_class == nullptr) {
return false;
} else {
ScopedObjectAccessUnchecked soa(self);
@@ -491,7 +491,7 @@
Handle<mirror::Array> new_array(hs.NewHandle(mirror::Array::Alloc<true>(
self, array_class.Get(), size, array_class->GetComponentSizeShift(),
Runtime::Current()->GetHeap()->GetCurrentAllocator())));
- if (new_array.Get() == nullptr) {
+ if (new_array == nullptr) {
LOG(ERROR) << "Annotation element array allocation failed with size " << size;
return false;
}
@@ -631,8 +631,8 @@
}
Handle<mirror::Method> method_object(hs.NewHandle(method_obj_ptr));
- if (new_member.Get() == nullptr || string_name.Get() == nullptr ||
- method_object.Get() == nullptr || method_return.Get() == nullptr) {
+ if (new_member == nullptr || string_name == nullptr ||
+ method_object == nullptr || method_return == nullptr) {
LOG(ERROR) << StringPrintf("Failed creating annotation element (m=%p n=%p a=%p r=%p",
new_member.Get(), string_name.Get(), method_object.Get(), method_return.Get());
return nullptr;
@@ -740,7 +740,7 @@
ObjPtr<mirror::Class> string_class = mirror::String::GetJavaLangString();
Handle<mirror::Class> string_array_class(hs.NewHandle(
Runtime::Current()->GetClassLinker()->FindArrayClass(Thread::Current(), &string_class)));
- if (string_array_class.Get() == nullptr) {
+ if (string_array_class == nullptr) {
return nullptr;
}
mirror::Object* obj =
@@ -766,7 +766,7 @@
ObjPtr<mirror::Class> class_class = mirror::Class::GetJavaLangClass();
Handle<mirror::Class> class_array_class(hs.NewHandle(
Runtime::Current()->GetClassLinker()->FindArrayClass(Thread::Current(), &class_class)));
- if (class_array_class.Get() == nullptr) {
+ if (class_array_class == nullptr) {
return nullptr;
}
mirror::Object* obj =
@@ -796,7 +796,7 @@
uint32_t size = annotation_set->size_;
Handle<mirror::ObjectArray<mirror::Object>> result(hs.NewHandle(
mirror::ObjectArray<mirror::Object>::Alloc(self, annotation_array_class.Get(), size)));
- if (result.Get() == nullptr) {
+ if (result == nullptr) {
return nullptr;
}
@@ -854,7 +854,7 @@
}
Handle<mirror::ObjectArray<mirror::Object>> annotation_array_array(hs.NewHandle(
mirror::ObjectArray<mirror::Object>::Alloc(self, annotation_array_array_class, size)));
- if (annotation_array_array.Get() == nullptr) {
+ if (annotation_array_array == nullptr) {
LOG(ERROR) << "Annotation set ref array allocation failed";
return nullptr;
}
@@ -1056,7 +1056,7 @@
ObjPtr<mirror::Class> string_class = mirror::String::GetJavaLangString();
Handle<mirror::Class> string_array_class(hs.NewHandle(
Runtime::Current()->GetClassLinker()->FindArrayClass(Thread::Current(), &string_class)));
- if (UNLIKELY(string_array_class.Get() == nullptr)) {
+ if (UNLIKELY(string_array_class == nullptr)) {
return false;
}
@@ -1067,13 +1067,13 @@
"names",
string_array_class,
DexFile::kDexAnnotationArray));
- if (names_obj.Get() == nullptr) {
+ if (names_obj == nullptr) {
return false;
}
// Extract the parameters' access flags int[].
Handle<mirror::Class> int_array_class(hs.NewHandle(mirror::IntArray::GetArrayClass()));
- if (UNLIKELY(int_array_class.Get() == nullptr)) {
+ if (UNLIKELY(int_array_class == nullptr)) {
return false;
}
Handle<mirror::Object> access_flags_obj =
@@ -1082,7 +1082,7 @@
"accessFlags",
int_array_class,
DexFile::kDexAnnotationArray));
- if (access_flags_obj.Get() == nullptr) {
+ if (access_flags_obj == nullptr) {
return false;
}
@@ -1146,7 +1146,7 @@
ObjPtr<mirror::Class> class_class = mirror::Class::GetJavaLangClass();
Handle<mirror::Class> class_array_class(hs.NewHandle(
Runtime::Current()->GetClassLinker()->FindArrayClass(hs.Self(), &class_class)));
- if (class_array_class.Get() == nullptr) {
+ if (class_array_class == nullptr) {
return nullptr;
}
mirror::Object* obj =
diff --git a/runtime/dex_file_test.cc b/runtime/dex_file_test.cc
index 9dca4c0..9131715 100644
--- a/runtime/dex_file_test.cc
+++ b/runtime/dex_file_test.cc
@@ -326,12 +326,32 @@
}
TEST_F(DexFileTest, GetChecksum) {
- uint32_t checksum;
+ std::vector<uint32_t> checksums;
ScopedObjectAccess soa(Thread::Current());
std::string error_msg;
- EXPECT_TRUE(DexFile::GetChecksum(GetLibCoreDexFileNames()[0].c_str(), &checksum, &error_msg))
+ EXPECT_TRUE(DexFile::GetMultiDexChecksums(GetLibCoreDexFileNames()[0].c_str(), &checksums, &error_msg))
<< error_msg;
- EXPECT_EQ(java_lang_dex_file_->GetLocationChecksum(), checksum);
+ ASSERT_EQ(1U, checksums.size());
+ EXPECT_EQ(java_lang_dex_file_->GetLocationChecksum(), checksums[0]);
+}
+
+TEST_F(DexFileTest, GetMultiDexChecksums) {
+ std::string error_msg;
+ std::vector<uint32_t> checksums;
+ std::string multidex_file = GetTestDexFileName("MultiDex");
+ EXPECT_TRUE(DexFile::GetMultiDexChecksums(multidex_file.c_str(),
+ &checksums,
+ &error_msg)) << error_msg;
+
+ std::vector<std::unique_ptr<const DexFile>> dexes = OpenTestDexFiles("MultiDex");
+ ASSERT_EQ(2U, dexes.size());
+ ASSERT_EQ(2U, checksums.size());
+
+ EXPECT_EQ(dexes[0]->GetLocation(), DexFile::GetMultiDexLocation(0, multidex_file.c_str()));
+ EXPECT_EQ(dexes[0]->GetLocationChecksum(), checksums[0]);
+
+ EXPECT_EQ(dexes[1]->GetLocation(), DexFile::GetMultiDexLocation(1, multidex_file.c_str()));
+ EXPECT_EQ(dexes[1]->GetLocationChecksum(), checksums[1]);
}
TEST_F(DexFileTest, ClassDefs) {
diff --git a/runtime/dex_file_verifier.cc b/runtime/dex_file_verifier.cc
index 318123e..0b3f16a 100644
--- a/runtime/dex_file_verifier.cc
+++ b/runtime/dex_file_verifier.cc
@@ -46,8 +46,8 @@
return (high == 0);
}
-static uint32_t MapTypeToBitMask(uint32_t map_type) {
- switch (map_type) {
+static uint32_t MapTypeToBitMask(DexFile::MapItemType map_item_type) {
+ switch (map_item_type) {
case DexFile::kDexTypeHeaderItem: return 1 << 0;
case DexFile::kDexTypeStringIdItem: return 1 << 1;
case DexFile::kDexTypeTypeIdItem: return 1 << 2;
@@ -55,23 +55,25 @@
case DexFile::kDexTypeFieldIdItem: return 1 << 4;
case DexFile::kDexTypeMethodIdItem: return 1 << 5;
case DexFile::kDexTypeClassDefItem: return 1 << 6;
- case DexFile::kDexTypeMapList: return 1 << 7;
- case DexFile::kDexTypeTypeList: return 1 << 8;
- case DexFile::kDexTypeAnnotationSetRefList: return 1 << 9;
- case DexFile::kDexTypeAnnotationSetItem: return 1 << 10;
- case DexFile::kDexTypeClassDataItem: return 1 << 11;
- case DexFile::kDexTypeCodeItem: return 1 << 12;
- case DexFile::kDexTypeStringDataItem: return 1 << 13;
- case DexFile::kDexTypeDebugInfoItem: return 1 << 14;
- case DexFile::kDexTypeAnnotationItem: return 1 << 15;
- case DexFile::kDexTypeEncodedArrayItem: return 1 << 16;
- case DexFile::kDexTypeAnnotationsDirectoryItem: return 1 << 17;
+ case DexFile::kDexTypeCallSiteIdItem: return 1 << 7;
+ case DexFile::kDexTypeMethodHandleItem: return 1 << 8;
+ case DexFile::kDexTypeMapList: return 1 << 9;
+ case DexFile::kDexTypeTypeList: return 1 << 10;
+ case DexFile::kDexTypeAnnotationSetRefList: return 1 << 11;
+ case DexFile::kDexTypeAnnotationSetItem: return 1 << 12;
+ case DexFile::kDexTypeClassDataItem: return 1 << 13;
+ case DexFile::kDexTypeCodeItem: return 1 << 14;
+ case DexFile::kDexTypeStringDataItem: return 1 << 15;
+ case DexFile::kDexTypeDebugInfoItem: return 1 << 16;
+ case DexFile::kDexTypeAnnotationItem: return 1 << 17;
+ case DexFile::kDexTypeEncodedArrayItem: return 1 << 18;
+ case DexFile::kDexTypeAnnotationsDirectoryItem: return 1 << 19;
}
return 0;
}
-static bool IsDataSectionType(uint32_t map_type) {
- switch (map_type) {
+static bool IsDataSectionType(DexFile::MapItemType map_item_type) {
+ switch (map_item_type) {
case DexFile::kDexTypeHeaderItem:
case DexFile::kDexTypeStringIdItem:
case DexFile::kDexTypeTypeIdItem:
@@ -80,6 +82,20 @@
case DexFile::kDexTypeMethodIdItem:
case DexFile::kDexTypeClassDefItem:
return false;
+ case DexFile::kDexTypeCallSiteIdItem:
+ case DexFile::kDexTypeMethodHandleItem:
+ case DexFile::kDexTypeMapList:
+ case DexFile::kDexTypeTypeList:
+ case DexFile::kDexTypeAnnotationSetRefList:
+ case DexFile::kDexTypeAnnotationSetItem:
+ case DexFile::kDexTypeClassDataItem:
+ case DexFile::kDexTypeCodeItem:
+ case DexFile::kDexTypeStringDataItem:
+ case DexFile::kDexTypeDebugInfoItem:
+ case DexFile::kDexTypeAnnotationItem:
+ case DexFile::kDexTypeEncodedArrayItem:
+ case DexFile::kDexTypeAnnotationsDirectoryItem:
+ return true;
}
return true;
}
@@ -455,7 +471,8 @@
return false;
}
- if (IsDataSectionType(item->type_)) {
+ DexFile::MapItemType item_type = static_cast<DexFile::MapItemType>(item->type_);
+ if (IsDataSectionType(item_type)) {
uint32_t icount = item->size_;
if (UNLIKELY(icount > data_items_left)) {
ErrorStringPrintf("Too many items in data section: %ud", data_item_count + icount);
@@ -465,7 +482,7 @@
data_item_count += icount;
}
- uint32_t bit = MapTypeToBitMask(item->type_);
+ uint32_t bit = MapTypeToBitMask(item_type);
if (UNLIKELY(bit == 0)) {
ErrorStringPrintf("Unknown map section type %x", item->type_);
@@ -837,6 +854,28 @@
return false;
}
break;
+ case DexFile::kDexAnnotationMethodType: {
+ if (UNLIKELY(value_arg > 3)) {
+ ErrorStringPrintf("Bad encoded_value method type size %x", value_arg);
+ return false;
+ }
+ uint32_t idx = ReadUnsignedLittleEndian(value_arg + 1);
+ if (!CheckIndex(idx, header_->proto_ids_size_, "method_type value")) {
+ return false;
+ }
+ break;
+ }
+ case DexFile::kDexAnnotationMethodHandle: {
+ if (UNLIKELY(value_arg > 3)) {
+ ErrorStringPrintf("Bad encoded_value method handle size %x", value_arg);
+ return false;
+ }
+ uint32_t idx = ReadUnsignedLittleEndian(value_arg + 1);
+ if (!CheckIndex(idx, dex_file_->NumMethodHandles(), "method_handle value")) {
+ return false;
+ }
+ break;
+ }
default:
ErrorStringPrintf("Bogus encoded_value value_type %x", value_type);
return false;
@@ -1455,7 +1494,7 @@
}
bool DexFileVerifier::CheckIntraSectionIterate(size_t offset, uint32_t section_count,
- uint16_t type) {
+ DexFile::MapItemType type) {
// Get the right alignment mask for the type of section.
size_t alignment_mask;
switch (type) {
@@ -1481,6 +1520,7 @@
}
// Check depending on the section type.
+ const uint8_t* start_ptr = ptr_;
switch (type) {
case DexFile::kDexTypeStringIdItem: {
if (!CheckListSize(ptr_, 1, sizeof(DexFile::StringId), "string_ids")) {
@@ -1524,6 +1564,20 @@
ptr_ += sizeof(DexFile::ClassDef);
break;
}
+ case DexFile::kDexTypeCallSiteIdItem: {
+ if (!CheckListSize(ptr_, 1, sizeof(DexFile::CallSiteIdItem), "call_site_ids")) {
+ return false;
+ }
+ ptr_ += sizeof(DexFile::CallSiteIdItem);
+ break;
+ }
+ case DexFile::kDexTypeMethodHandleItem: {
+ if (!CheckListSize(ptr_, 1, sizeof(DexFile::MethodHandleItem), "method_handles")) {
+ return false;
+ }
+ ptr_ += sizeof(DexFile::MethodHandleItem);
+ break;
+ }
case DexFile::kDexTypeTypeList: {
if (!CheckList(sizeof(DexFile::TypeItem), "type_list", &ptr_)) {
return false;
@@ -1584,9 +1638,14 @@
}
break;
}
- default:
- ErrorStringPrintf("Unknown map item type %x", type);
- return false;
+ case DexFile::kDexTypeHeaderItem:
+ case DexFile::kDexTypeMapList:
+ break;
+ }
+
+ if (start_ptr == ptr_) {
+ ErrorStringPrintf("Unknown map item type %x", type);
+ return false;
}
if (IsDataSectionType(type)) {
@@ -1610,7 +1669,9 @@
return true;
}
-bool DexFileVerifier::CheckIntraIdSection(size_t offset, uint32_t count, uint16_t type) {
+bool DexFileVerifier::CheckIntraIdSection(size_t offset,
+ uint32_t count,
+ DexFile::MapItemType type) {
uint32_t expected_offset;
uint32_t expected_size;
@@ -1658,7 +1719,9 @@
return CheckIntraSectionIterate(offset, count, type);
}
-bool DexFileVerifier::CheckIntraDataSection(size_t offset, uint32_t count, uint16_t type) {
+bool DexFileVerifier::CheckIntraDataSection(size_t offset,
+ uint32_t count,
+ DexFile::MapItemType type) {
size_t data_start = header_->data_off_;
size_t data_end = data_start + header_->data_size_;
@@ -1684,16 +1747,16 @@
bool DexFileVerifier::CheckIntraSection() {
const DexFile::MapList* map = reinterpret_cast<const DexFile::MapList*>(begin_ + header_->map_off_);
const DexFile::MapItem* item = map->list_;
-
- uint32_t count = map->size_;
size_t offset = 0;
+ uint32_t count = map->size_;
ptr_ = begin_;
// Check the items listed in the map.
while (count--) {
+ const size_t current_offset = offset;
uint32_t section_offset = item->offset_;
uint32_t section_count = item->size_;
- uint16_t type = item->type_;
+ DexFile::MapItemType type = static_cast<DexFile::MapItemType>(item->type_);
// Check for padding and overlap between items.
if (!CheckPadding(offset, section_offset)) {
@@ -1741,6 +1804,11 @@
ptr_ += sizeof(uint32_t) + (map->size_ * sizeof(DexFile::MapItem));
offset = section_offset + sizeof(uint32_t) + (map->size_ * sizeof(DexFile::MapItem));
break;
+ case DexFile::kDexTypeMethodHandleItem:
+ case DexFile::kDexTypeCallSiteIdItem:
+ CheckIntraSectionIterate(section_offset, section_count, type);
+ offset = ptr_ - begin_;
+ break;
case DexFile::kDexTypeTypeList:
case DexFile::kDexTypeAnnotationSetRefList:
case DexFile::kDexTypeAnnotationSetItem:
@@ -1756,7 +1824,9 @@
}
offset = ptr_ - begin_;
break;
- default:
+ }
+
+ if (offset == current_offset) {
ErrorStringPrintf("Unknown map item type %x", type);
return false;
}
@@ -2237,6 +2307,92 @@
return true;
}
+bool DexFileVerifier::CheckInterCallSiteIdItem() {
+ const DexFile::CallSiteIdItem* item = reinterpret_cast<const DexFile::CallSiteIdItem*>(ptr_);
+
+ // Check call site referenced by item is in encoded array section.
+ if (!CheckOffsetToTypeMap(item->data_off_, DexFile::kDexTypeEncodedArrayItem)) {
+ ErrorStringPrintf("Invalid offset in CallSideIdItem");
+ return false;
+ }
+
+ CallSiteArrayValueIterator it(*dex_file_, *item);
+
+ // Check Method Handle
+ if (!it.HasNext() || it.GetValueType() != EncodedArrayValueIterator::ValueType::kMethodHandle) {
+ ErrorStringPrintf("CallSiteArray missing method handle");
+ return false;
+ }
+
+ uint32_t handle_index = static_cast<uint32_t>(it.GetJavaValue().i);
+ if (handle_index >= dex_file_->NumMethodHandles()) {
+ ErrorStringPrintf("CallSite has bad method handle id: %x", handle_index);
+ return false;
+ }
+
+ // Check target method name.
+ it.Next();
+ if (!it.HasNext() ||
+ it.GetValueType() != EncodedArrayValueIterator::ValueType::kString) {
+ ErrorStringPrintf("CallSiteArray missing target method name");
+ return false;
+ }
+
+ uint32_t name_index = static_cast<uint32_t>(it.GetJavaValue().i);
+ if (name_index >= dex_file_->NumStringIds()) {
+ ErrorStringPrintf("CallSite has bad method name id: %x", name_index);
+ return false;
+ }
+
+ // Check method type.
+ it.Next();
+ if (!it.HasNext() ||
+ it.GetValueType() != EncodedArrayValueIterator::ValueType::kMethodType) {
+ ErrorStringPrintf("CallSiteArray missing method type");
+ return false;
+ }
+
+ uint32_t proto_index = static_cast<uint32_t>(it.GetJavaValue().i);
+ if (proto_index >= dex_file_->NumProtoIds()) {
+ ErrorStringPrintf("CallSite has bad method type: %x", proto_index);
+ return false;
+ }
+
+ ptr_ += sizeof(DexFile::CallSiteIdItem);
+ return true;
+}
+
+bool DexFileVerifier::CheckInterMethodHandleItem() {
+ const DexFile::MethodHandleItem* item = reinterpret_cast<const DexFile::MethodHandleItem*>(ptr_);
+
+ DexFile::MethodHandleType method_handle_type =
+ static_cast<DexFile::MethodHandleType>(item->method_handle_type_);
+ if (method_handle_type > DexFile::MethodHandleType::kLast) {
+ ErrorStringPrintf("Bad method handle type %x", item->method_handle_type_);
+ return false;
+ }
+
+ uint32_t index = item->field_or_method_idx_;
+ switch (method_handle_type) {
+ case DexFile::MethodHandleType::kStaticPut:
+ case DexFile::MethodHandleType::kStaticGet:
+ case DexFile::MethodHandleType::kInstancePut:
+ case DexFile::MethodHandleType::kInstanceGet: {
+ LOAD_FIELD(field, index, "method_handle_item field_idx", return false);
+ break;
+ }
+ case DexFile::MethodHandleType::kInvokeStatic:
+ case DexFile::MethodHandleType::kInvokeInstance:
+ case DexFile::MethodHandleType::kInvokeConstructor: {
+ LOAD_METHOD(method, index, "method_handle_item method_idx", return false);
+ break;
+ }
+ }
+
+ ptr_ += sizeof(DexFile::MethodHandleItem);
+ return true;
+}
+
bool DexFileVerifier::CheckInterAnnotationSetRefList() {
const DexFile::AnnotationSetRefList* list =
reinterpret_cast<const DexFile::AnnotationSetRefList*>(ptr_);
@@ -2386,7 +2542,9 @@
return true;
}
-bool DexFileVerifier::CheckInterSectionIterate(size_t offset, uint32_t count, uint16_t type) {
+bool DexFileVerifier::CheckInterSectionIterate(size_t offset,
+ uint32_t count,
+ DexFile::MapItemType type) {
// Get the right alignment mask for the type of section.
size_t alignment_mask;
switch (type) {
@@ -2405,8 +2563,22 @@
ptr_ = begin_ + new_offset;
const uint8_t* prev_ptr = ptr_;
+ if (MapTypeToBitMask(type) == 0) {
+ ErrorStringPrintf("Unknown map item type %x", type);
+ return false;
+ }
+
// Check depending on the section type.
switch (type) {
+ case DexFile::kDexTypeHeaderItem:
+ case DexFile::kDexTypeMapList:
+ case DexFile::kDexTypeTypeList:
+ case DexFile::kDexTypeCodeItem:
+ case DexFile::kDexTypeStringDataItem:
+ case DexFile::kDexTypeDebugInfoItem:
+ case DexFile::kDexTypeAnnotationItem:
+ case DexFile::kDexTypeEncodedArrayItem:
+ break;
case DexFile::kDexTypeStringIdItem: {
if (!CheckInterStringIdItem()) {
return false;
@@ -2451,6 +2623,18 @@
}
break;
}
+ case DexFile::kDexTypeCallSiteIdItem: {
+ if (!CheckInterCallSiteIdItem()) {
+ return false;
+ }
+ break;
+ }
+ case DexFile::kDexTypeMethodHandleItem: {
+ if (!CheckInterMethodHandleItem()) {
+ return false;
+ }
+ break;
+ }
case DexFile::kDexTypeAnnotationSetRefList: {
if (!CheckInterAnnotationSetRefList()) {
return false;
@@ -2483,9 +2667,6 @@
}
break;
}
- default:
- ErrorStringPrintf("Unknown map item type %x", type);
- return false;
}
previous_item_ = prev_ptr;
@@ -2504,7 +2685,8 @@
while (count--) {
uint32_t section_offset = item->offset_;
uint32_t section_count = item->size_;
- uint16_t type = item->type_;
+ DexFile::MapItemType type = static_cast<DexFile::MapItemType>(item->type_);
+ bool found = false;
switch (type) {
case DexFile::kDexTypeHeaderItem:
@@ -2515,6 +2697,7 @@
case DexFile::kDexTypeDebugInfoItem:
case DexFile::kDexTypeAnnotationItem:
case DexFile::kDexTypeEncodedArrayItem:
+ found = true;
break;
case DexFile::kDexTypeStringIdItem:
case DexFile::kDexTypeTypeIdItem:
@@ -2522,6 +2705,8 @@
case DexFile::kDexTypeFieldIdItem:
case DexFile::kDexTypeMethodIdItem:
case DexFile::kDexTypeClassDefItem:
+ case DexFile::kDexTypeCallSiteIdItem:
+ case DexFile::kDexTypeMethodHandleItem:
case DexFile::kDexTypeAnnotationSetRefList:
case DexFile::kDexTypeAnnotationSetItem:
case DexFile::kDexTypeClassDataItem:
@@ -2529,11 +2714,14 @@
if (!CheckInterSectionIterate(section_offset, section_count, type)) {
return false;
}
+ found = true;
break;
}
- default:
- ErrorStringPrintf("Unknown map item type %x", type);
- return false;
+ }
+
+ if (!found) {
+ ErrorStringPrintf("Unknown map item type %x", item->type_);
+ return false;
}
item++;
diff --git a/runtime/dex_file_verifier.h b/runtime/dex_file_verifier.h
index ae20613..71b316c 100644
--- a/runtime/dex_file_verifier.h
+++ b/runtime/dex_file_verifier.h
@@ -122,9 +122,9 @@
bool CheckIntraAnnotationItem();
bool CheckIntraAnnotationsDirectoryItem();
- bool CheckIntraSectionIterate(size_t offset, uint32_t count, uint16_t type);
- bool CheckIntraIdSection(size_t offset, uint32_t count, uint16_t type);
- bool CheckIntraDataSection(size_t offset, uint32_t count, uint16_t type);
+ bool CheckIntraSectionIterate(size_t offset, uint32_t count, DexFile::MapItemType type);
+ bool CheckIntraIdSection(size_t offset, uint32_t count, DexFile::MapItemType type);
+ bool CheckIntraDataSection(size_t offset, uint32_t count, DexFile::MapItemType type);
bool CheckIntraSection();
bool CheckOffsetToTypeMap(size_t offset, uint16_t type);
@@ -140,12 +140,14 @@
bool CheckInterFieldIdItem();
bool CheckInterMethodIdItem();
bool CheckInterClassDefItem();
+ bool CheckInterCallSiteIdItem();
+ bool CheckInterMethodHandleItem();
bool CheckInterAnnotationSetRefList();
bool CheckInterAnnotationSetItem();
bool CheckInterClassDataItem();
bool CheckInterAnnotationsDirectoryItem();
- bool CheckInterSectionIterate(size_t offset, uint32_t count, uint16_t type);
+ bool CheckInterSectionIterate(size_t offset, uint32_t count, DexFile::MapItemType type);
bool CheckInterSection();
// Load a string by (type) index. Checks whether the index is in bounds, printing the error if
diff --git a/runtime/dex_file_verifier_test.cc b/runtime/dex_file_verifier_test.cc
index c56b200..7736f3d 100644
--- a/runtime/dex_file_verifier_test.cc
+++ b/runtime/dex_file_verifier_test.cc
@@ -1885,4 +1885,209 @@
&error_msg));
}
+static const char* kInvokeCustomDexFiles[] = {
+ // TODO(oth): Revisit this test when we have smali / dx support.
+ // https://cs.corp.google.com/android/toolchain/jack/jack-tests/tests/com/android/jack/java7/invokecustom/test001/Tests.java
+ "ZGV4CjAzOAAEj12s/acmmdGuDL92SWSBh6iLBjxgomWkCAAAcAAAAHhWNBIAAAAAAAAAALwHAAAx"
+ "AAAAcAAAABYAAAA0AQAACQAAAIwBAAADAAAA+AEAAAsAAAAQAgAAAQAAAHACAAAMBgAAmAIAAMID"
+ "AADKAwAAzQMAANIDAADhAwAA5AMAAOoDAAAfBAAAUgQAAIMEAAC4BAAA1AQAAOsEAAD+BAAAEgUA"
+ "ACYFAAA6BQAAUQUAAG4FAACTBQAAtAUAAN0FAAD/BQAAHgYAADgGAABKBgAAVgYAAFkGAABdBgAA"
+ "YgYAAGYGAAB7BgAAgAYAAI8GAACdBgAAtAYAAMMGAADSBgAA3gYAAPIGAAD4BgAABgcAAA4HAAAU"
+ "BwAAGgcAAB8HAAAoBwAANAcAADoHAAABAAAABgAAAAcAAAAIAAAACQAAAAoAAAALAAAADAAAAA0A"
+ "AAAOAAAADwAAABAAAAARAAAAEgAAABMAAAAUAAAAFQAAABYAAAAXAAAAGAAAABoAAAAeAAAAAgAA"
+ "AAAAAACMAwAABQAAAAwAAACUAwAABQAAAA4AAACgAwAABAAAAA8AAAAAAAAAGgAAABQAAAAAAAAA"
+ "GwAAABQAAACsAwAAHAAAABQAAACMAwAAHQAAABQAAAC0AwAAHQAAABQAAAC8AwAAAwADAAMAAAAE"
+ "AAwAJAAAAAoABgAsAAAABAAEAAAAAAAEAAAAHwAAAAQAAQAoAAAABAAIACoAAAAEAAQALwAAAAYA"
+ "BQAtAAAACAAEAAAAAAANAAcAAAAAAA8AAgAlAAAAEAADACkAAAASAAYAIQAAAJYHAACWBwAABAAA"
+ "AAEAAAAIAAAAAAAAABkAAABkAwAAnQcAAAAAAAAEAAAAAgAAAAEAAABjBwAAAQAAAIsHAAACAAAA"
+ "iwcAAJMHAAABAAEAAQAAAEEHAAAEAAAAcBAGAAAADgADAAIAAAAAAEYHAAADAAAAkAABAg8AAAAF"
+ "AAMABAAAAE0HAAAQAAAAcQAJAAAADAAcAQQAbkAIABBDDAAiAQ0AcCAHAAEAEQEEAAEAAgAAAFYH"
+ "AAAMAAAAYgACABIhEjL8IAAAIQAKAW4gBQAQAA4AAwABAAIAAABdBwAACwAAABIgEjH8IAEAEAAK"
+ "ABJRcSAKAAEADgAAAAAAAAAAAAAAAwAAAAAAAAABAAAAmAIAAAIAAACgAgAABAAAAKgCAAACAAAA"
+ "AAAAAAMAAAAPAAkAEQAAAAMAAAAHAAkAEQAAAAEAAAAAAAAAAQAAAA4AAAABAAAAFQAGPGluaXQ+"
+ "AAFJAANJSUkADUlOVk9LRV9TVEFUSUMAAUwABExMTEwAM0xjb20vYW5kcm9pZC9qYWNrL2Fubm90"
+ "YXRpb25zL0NhbGxlZEJ5SW52b2tlQ3VzdG9tOwAxTGNvbS9hbmRyb2lkL2phY2svYW5ub3RhdGlv"
+ "bnMvTGlua2VyTWV0aG9kSGFuZGxlOwAvTGNvbS9hbmRyb2lkL2phY2svYW5ub3RhdGlvbnMvTWV0"
+ "aG9kSGFuZGxlS2luZDsAM0xjb20vYW5kcm9pZC9qYWNrL2phdmE3L2ludm9rZWN1c3RvbS90ZXN0"
+ "MDAxL1Rlc3RzOwAaTGRhbHZpay9hbm5vdGF0aW9uL1Rocm93czsAFUxqYXZhL2lvL1ByaW50U3Ry"
+ "ZWFtOwARTGphdmEvbGFuZy9DbGFzczsAEkxqYXZhL2xhbmcvT2JqZWN0OwASTGphdmEvbGFuZy9T"
+ "dHJpbmc7ABJMamF2YS9sYW5nL1N5c3RlbTsAFUxqYXZhL2xhbmcvVGhyb3dhYmxlOwAbTGphdmEv"
+ "bGFuZy9pbnZva2UvQ2FsbFNpdGU7ACNMamF2YS9sYW5nL2ludm9rZS9Db25zdGFudENhbGxTaXRl"
+ "OwAfTGphdmEvbGFuZy9pbnZva2UvTWV0aG9kSGFuZGxlOwAnTGphdmEvbGFuZy9pbnZva2UvTWV0"
+ "aG9kSGFuZGxlcyRMb29rdXA7ACBMamF2YS9sYW5nL2ludm9rZS9NZXRob2RIYW5kbGVzOwAdTGph"
+ "dmEvbGFuZy9pbnZva2UvTWV0aG9kVHlwZTsAGExqdW5pdC9mcmFtZXdvcmsvQXNzZXJ0OwAQTG9y"
+ "Zy9qdW5pdC9UZXN0OwAKVGVzdHMuamF2YQABVgACVkkAA1ZJSQACVkwAE1tMamF2YS9sYW5nL1N0"
+ "cmluZzsAA2FkZAANYXJndW1lbnRUeXBlcwAMYXNzZXJ0RXF1YWxzABVlbWl0dGVyOiBqYWNrLTQu"
+ "MC1lbmcADWVuY2xvc2luZ1R5cGUADWZpZWxkQ2FsbFNpdGUACmZpbmRTdGF0aWMAEmludm9rZU1l"
+ "dGhvZEhhbmRsZQAEa2luZAAMbGlua2VyTWV0aG9kAAZsb29rdXAABG1haW4ABG5hbWUAA291dAAH"
+ "cHJpbnRsbgAKcmV0dXJuVHlwZQAEdGVzdAAFdmFsdWUAIgAHDgAvAgAABw4ANQMAAAAHDqUAPwEA"
+ "Bw60ADsABw6lAAABBCAcAhgAGAAmHAEdAgQgHAMYDxgJGBEjGAQnGwArFygrFx8uGAACBQEwHAEY"
+ "CwETAAMWABcfFQABAAQBAQkAgYAEtAUBCswFAQrkBQEJlAYEAbwGAAAAEwAAAAAAAAABAAAAAAAA"
+ "AAEAAAAxAAAAcAAAAAIAAAAWAAAANAEAAAMAAAAJAAAAjAEAAAQAAAADAAAA+AEAAAUAAAALAAAA"
+ "EAIAAAcAAAACAAAAaAIAAAYAAAABAAAAcAIAAAgAAAABAAAAkAIAAAMQAAADAAAAmAIAAAEgAAAF"
+ "AAAAtAIAAAYgAAABAAAAZAMAAAEQAAAGAAAAjAMAAAIgAAAxAAAAwgMAAAMgAAAFAAAAQQcAAAQg"
+ "AAADAAAAYwcAAAUgAAABAAAAlgcAAAAgAAABAAAAnQcAAAAQAAABAAAAvAcAAA==",
+ // https://cs.corp.google.com/android/toolchain/jack/jack-tests/tests/com/android/jack/java7/invokecustom/test002/Tests.java
+ "ZGV4CjAzOAAzq3aGAwKhT4QQj4lqNfZJAO8Tm24uTyNICQAAcAAAAHhWNBIAAAAAAAAAAGAIAAA2"
+ "AAAAcAAAABgAAABIAQAACQAAAKgBAAAEAAAAFAIAAA0AAAA0AgAAAQAAAKQCAAB8BgAAzAIAACYE"
+ "AAAwBAAAOAQAAEQEAABHBAAATAQAAE8EAABVBAAAigQAALwEAADtBAAAIgUAAD4FAABVBQAAaAUA"
+ "AH0FAACRBQAApQUAALkFAADQBQAA7QUAABIGAAAzBgAAXAYAAH4GAACdBgAAtwYAAMkGAADPBgAA"
+ "2wYAAN4GAADiBgAA5wYAAOsGAAD/BgAAFAcAABkHAAAoBwAANgcAAE0HAABcBwAAawcAAH4HAACK"
+ "BwAAkAcAAJgHAACeBwAAqgcAALAHAAC1BwAAxgcAAM8HAADbBwAA4QcAAAMAAAAHAAAACAAAAAkA"
+ "AAAKAAAACwAAAAwAAAANAAAADgAAAA8AAAAQAAAAEQAAABIAAAATAAAAFAAAABUAAAAWAAAAFwAA"
+ "ABgAAAAZAAAAGgAAAB0AAAAhAAAAIgAAAAQAAAAAAAAA8AMAAAYAAAAPAAAA+AMAAAUAAAAQAAAA"
+ "AAAAAAYAAAASAAAABAQAAB0AAAAVAAAAAAAAAB4AAAAVAAAAEAQAAB8AAAAVAAAA8AMAACAAAAAV"
+ "AAAAGAQAACAAAAAVAAAAIAQAAAMAAwACAAAABAANACgAAAAIAAcAGwAAAAsABgAwAAAABAAEAAAA"
+ "AAAEAAQAAQAAAAQAAAAjAAAABAAIAC0AAAAEAAQANAAAAAYABQAyAAAACQAEAAEAAAAMAAQAMQAA"
+ "AA4ABwABAAAAEAABACoAAAARAAIALAAAABIAAwAuAAAAEwAGACUAAAA4CAAAOAgAAAQAAAABAAAA"
+ "CQAAAAAAAAAcAAAA0AMAAD8IAAAAAAAAAQAAAAEAAAABAAAADggAAAIAAAAtCAAANQgAAAgAAAAE"
+ "AAEA6AcAACoAAABxAAoAAAAMABwBBAAbAiMAAABiAwIAYgQCABIVI1UWAGIGAgASB00GBQdxMAsA"
+ "QwUMA25ACQAQMgwAIgEOAHAgCAABAGkBAQAOAA0AbhAHAAAAKPsAAAAAJAABAAEBDCUBAAEAAQAA"
+ "APUHAAAEAAAAcBAGAAAADgADAAIAAAAAAPoHAAADAAAAkAABAg8AAAAEAAEAAgAAAAEIAAAMAAAA"
+ "YgADABIhEjL8IAAAIQAKAW4gBQAQAA4AAwABAAIAAAAICAAACwAAABIgEjH8IAEAEAAKABJRcSAM"
+ "AAEADgAAAAAAAAAAAAAAAgAAAAAAAAACAAAAzAIAAAQAAADUAgAAAgAAAAAAAAADAAAABwAKABIA"
+ "AAADAAAABwAHABYAAAABAAAAAAAAAAEAAAAPAAAAAQAAABcACDxjbGluaXQ+AAY8aW5pdD4ACkdF"
+ "VF9TVEFUSUMAAUkAA0lJSQABTAAETExMTAAzTGNvbS9hbmRyb2lkL2phY2svYW5ub3RhdGlvbnMv"
+ "Q2FsbGVkQnlJbnZva2VDdXN0b207ADBMY29tL2FuZHJvaWQvamFjay9hbm5vdGF0aW9ucy9MaW5r"
+ "ZXJGaWVsZEhhbmRsZTsAL0xjb20vYW5kcm9pZC9qYWNrL2Fubm90YXRpb25zL01ldGhvZEhhbmRs"
+ "ZUtpbmQ7ADNMY29tL2FuZHJvaWQvamFjay9qYXZhNy9pbnZva2VjdXN0b20vdGVzdDAwMi9UZXN0"
+ "czsAGkxkYWx2aWsvYW5ub3RhdGlvbi9UaHJvd3M7ABVMamF2YS9pby9QcmludFN0cmVhbTsAEUxq"
+ "YXZhL2xhbmcvQ2xhc3M7ABNMamF2YS9sYW5nL0ludGVnZXI7ABJMamF2YS9sYW5nL09iamVjdDsA"
+ "EkxqYXZhL2xhbmcvU3RyaW5nOwASTGphdmEvbGFuZy9TeXN0ZW07ABVMamF2YS9sYW5nL1Rocm93"
+ "YWJsZTsAG0xqYXZhL2xhbmcvaW52b2tlL0NhbGxTaXRlOwAjTGphdmEvbGFuZy9pbnZva2UvQ29u"
+ "c3RhbnRDYWxsU2l0ZTsAH0xqYXZhL2xhbmcvaW52b2tlL01ldGhvZEhhbmRsZTsAJ0xqYXZhL2xh"
+ "bmcvaW52b2tlL01ldGhvZEhhbmRsZXMkTG9va3VwOwAgTGphdmEvbGFuZy9pbnZva2UvTWV0aG9k"
+ "SGFuZGxlczsAHUxqYXZhL2xhbmcvaW52b2tlL01ldGhvZFR5cGU7ABhManVuaXQvZnJhbWV3b3Jr"
+ "L0Fzc2VydDsAEExvcmcvanVuaXQvVGVzdDsABFRZUEUAClRlc3RzLmphdmEAAVYAAlZJAANWSUkA"
+ "AlZMABJbTGphdmEvbGFuZy9DbGFzczsAE1tMamF2YS9sYW5nL1N0cmluZzsAA2FkZAANYXJndW1l"
+ "bnRUeXBlcwAMYXNzZXJ0RXF1YWxzABVlbWl0dGVyOiBqYWNrLTQuMC1lbmcADWVuY2xvc2luZ1R5"
+ "cGUADWZpZWxkQ2FsbFNpdGUAEWZpZWxkTWV0aG9kSGFuZGxlAApmaW5kU3RhdGljAARraW5kAAZs"
+ "b29rdXAABG1haW4ACm1ldGhvZFR5cGUABG5hbWUAA291dAAPcHJpbnRTdGFja1RyYWNlAAdwcmlu"
+ "dGxuAApyZXR1cm5UeXBlAAR0ZXN0AAV2YWx1ZQAoAAcOAR0PAnh3Jh4AIQAHDgA2AgAABw4APwEA"
+ "Bw60ADsABw6lAAABBCQcAhgAGAApHAEdAgMnGAQrGwAvFygvFyMzGAACBQE1HAEYDAEUAAMWABcj"
+ "FQABAAQBAQkAiIAE4AUBgYAE0AYBCugGAQmABwQBqAcAAAATAAAAAAAAAAEAAAAAAAAAAQAAADYA"
+ "AABwAAAAAgAAABgAAABIAQAAAwAAAAkAAACoAQAABAAAAAQAAAAUAgAABQAAAA0AAAA0AgAABwAA"
+ "AAIAAACcAgAABgAAAAEAAACkAgAACAAAAAEAAADEAgAAAxAAAAIAAADMAgAAASAAAAUAAADgAgAA"
+ "BiAAAAEAAADQAwAAARAAAAYAAADwAwAAAiAAADYAAAAmBAAAAyAAAAUAAADoBwAABCAAAAMAAAAO"
+ "CAAABSAAAAEAAAA4CAAAACAAAAEAAAA/CAAAABAAAAEAAABgCAAA",
+ // https://cs.corp.google.com/android/toolchain/jack/jack-tests/tests/com/android/jack/java7/invokecustom/test003/Tests.java
+ "ZGV4CjAzOABjnhkFatj30/7cHTCJsfr7vAjz9/p+Y+TcCAAAcAAAAHhWNBIAAAAAAAAAAPQHAAAx"
+ "AAAAcAAAABYAAAA0AQAACQAAAIwBAAADAAAA+AEAAAsAAAAQAgAAAQAAAHACAABEBgAAmAIAAOoD"
+ "AADyAwAA9QMAAP4DAAANBAAAEAQAABYEAABLBAAAfgQAAK8EAADkBAAAAAUAABcFAAAqBQAAPgUA"
+ "AFIFAABmBQAAfQUAAJoFAAC/BQAA4AUAAAkGAAArBgAASgYAAGQGAAB2BgAAggYAAIUGAACJBgAA"
+ "jgYAAJIGAACnBgAArAYAALsGAADJBgAA4AYAAO8GAAD+BgAACgcAAB4HAAAkBwAAMgcAADoHAABA"
+ "BwAARgcAAEsHAABUBwAAYAcAAGYHAAABAAAABgAAAAcAAAAIAAAACQAAAAoAAAALAAAADAAAAA0A"
+ "AAAOAAAADwAAABAAAAARAAAAEgAAABMAAAAUAAAAFQAAABYAAAAXAAAAGAAAABoAAAAeAAAAAgAA"
+ "AAAAAACkAwAABQAAAAwAAAC0AwAABQAAAA4AAADAAwAABAAAAA8AAAAAAAAAGgAAABQAAAAAAAAA"
+ "GwAAABQAAADMAwAAHAAAABQAAADUAwAAHQAAABQAAADcAwAAHQAAABQAAADkAwAAAwADAAMAAAAE"
+ "AAwAJAAAAAoABgAsAAAABAAEAAAAAAAEAAAAHwAAAAQAAQAoAAAABAAIACoAAAAEAAQALwAAAAYA"
+ "BQAtAAAACAAEAAAAAAANAAcAAAAAAA8AAgAlAAAAEAADACkAAAASAAYAIQAAAM4HAADOBwAABAAA"
+ "AAEAAAAIAAAAAAAAABkAAAB8AwAA1QcAAAAAAAAEAAAAAgAAAAEAAACTBwAAAQAAAMMHAAACAAAA"
+ "wwcAAMsHAAABAAEAAQAAAG0HAAAEAAAAcBAGAAAADgAHAAYAAAAAAHIHAAAHAAAAkAABArAwsECw"
+ "ULBgDwAAAAUAAwAEAAAAfQcAABAAAABxAAkAAAAMABwBBABuQAgAEEMMACIBDQBwIAcAAQARAQgA"
+ "AQACAAAAhgcAABAAAABiBgIAEhASIRIyEkMSVBJl/QYAAAAACgBuIAUABgAOAAcAAQACAAAAjQcA"
+ "ABAAAAASEBIhEjISQxJUEmX9BgEAAAAKABMBFQBxIAoAAQAOAAAAAAAAAAAAAwAAAAAAAAABAAAA"
+ "mAIAAAIAAACgAgAABAAAAKgCAAAGAAAAAAAAAAAAAAAAAAAAAwAAAA8ACQARAAAAAwAAAAcACQAR"
+ "AAAAAQAAAAAAAAACAAAAAAAAAAEAAAAOAAAAAQAAABUABjxpbml0PgABSQAHSUlJSUlJSQANSU5W"
+ "T0tFX1NUQVRJQwABTAAETExMTAAzTGNvbS9hbmRyb2lkL2phY2svYW5ub3RhdGlvbnMvQ2FsbGVk"
+ "QnlJbnZva2VDdXN0b207ADFMY29tL2FuZHJvaWQvamFjay9hbm5vdGF0aW9ucy9MaW5rZXJNZXRo"
+ "b2RIYW5kbGU7AC9MY29tL2FuZHJvaWQvamFjay9hbm5vdGF0aW9ucy9NZXRob2RIYW5kbGVLaW5k"
+ "OwAzTGNvbS9hbmRyb2lkL2phY2svamF2YTcvaW52b2tlY3VzdG9tL3Rlc3QwMDMvVGVzdHM7ABpM"
+ "ZGFsdmlrL2Fubm90YXRpb24vVGhyb3dzOwAVTGphdmEvaW8vUHJpbnRTdHJlYW07ABFMamF2YS9s"
+ "YW5nL0NsYXNzOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZh"
+ "L2xhbmcvU3lzdGVtOwAVTGphdmEvbGFuZy9UaHJvd2FibGU7ABtMamF2YS9sYW5nL2ludm9rZS9D"
+ "YWxsU2l0ZTsAI0xqYXZhL2xhbmcvaW52b2tlL0NvbnN0YW50Q2FsbFNpdGU7AB9MamF2YS9sYW5n"
+ "L2ludm9rZS9NZXRob2RIYW5kbGU7ACdMamF2YS9sYW5nL2ludm9rZS9NZXRob2RIYW5kbGVzJExv"
+ "b2t1cDsAIExqYXZhL2xhbmcvaW52b2tlL01ldGhvZEhhbmRsZXM7AB1MamF2YS9sYW5nL2ludm9r"
+ "ZS9NZXRob2RUeXBlOwAYTGp1bml0L2ZyYW1ld29yay9Bc3NlcnQ7ABBMb3JnL2p1bml0L1Rlc3Q7"
+ "AApUZXN0cy5qYXZhAAFWAAJWSQADVklJAAJWTAATW0xqYXZhL2xhbmcvU3RyaW5nOwADYWRkAA1h"
+ "cmd1bWVudFR5cGVzAAxhc3NlcnRFcXVhbHMAFWVtaXR0ZXI6IGphY2stNC4wLWVuZwANZW5jbG9z"
+ "aW5nVHlwZQANZmllbGRDYWxsU2l0ZQAKZmluZFN0YXRpYwASaW52b2tlTWV0aG9kSGFuZGxlAARr"
+ "aW5kAAxsaW5rZXJNZXRob2QABmxvb2t1cAAEbWFpbgAEbmFtZQADb3V0AAdwcmludGxuAApyZXR1"
+ "cm5UeXBlAAR0ZXN0AAV2YWx1ZQAiAAcOAC8GAAAAAAAABw4ANQMAAAAHDqUAPwEABw7wADsABw7w"
+ "AAABBCAcBhgAGAAYABgAGAAYACYcAR0CBCAcAxgPGAkYESMYBCcbACsXKCsXHy4YAAIFATAcARgL"
+ "ARMAAxYAFx8VAAEABAEBCQCBgAS0BQEKzAUBCuwFAQmcBgQBzAYAAAATAAAAAAAAAAEAAAAAAAAA"
+ "AQAAADEAAABwAAAAAgAAABYAAAA0AQAAAwAAAAkAAACMAQAABAAAAAMAAAD4AQAABQAAAAsAAAAQ"
+ "AgAABwAAAAIAAABoAgAABgAAAAEAAABwAgAACAAAAAEAAACQAgAAAxAAAAMAAACYAgAAASAAAAUA"
+ "AAC0AgAABiAAAAEAAAB8AwAAARAAAAcAAACkAwAAAiAAADEAAADqAwAAAyAAAAUAAABtBwAABCAA"
+ "AAMAAACTBwAABSAAAAEAAADOBwAAACAAAAEAAADVBwAAABAAAAEAAAD0BwAA",
+ // https://cs.corp.google.com/android/toolchain/jack/jack-tests/tests/com/android/jack/java7/invokecustom/test004/Tests.java
+ "ZGV4CjAzOABvUVfbV74qWbSOEsgKP+EzahlNQLW2/8TMDAAAcAAAAHhWNBIAAAAAAAAAAOQLAABS"
+ "AAAAcAAAAB8AAAC4AQAAEAAAADQCAAADAAAA9AIAABIAAAAMAwAAAQAAAKQDAAAACQAAzAMAANYF"
+ "AADZBQAA4QUAAOkFAADsBQAA7wUAAPIFAAD1BQAA/AUAAP8FAAAEBgAAEwYAABYGAAAZBgAAHwYA"
+ "AC8GAABkBgAAjQYAAMAGAADxBgAAJgcAAEUHAABhBwAAeAcAAIoHAACdBwAAsQcAAMUHAADZBwAA"
+ "8AcAAA0IAAAyCAAAUwgAAHwIAACeCAAAvQgAANcIAADpCAAA7AgAAPgIAAD7CAAAAAkAAAYJAAAM"
+ "CQAAEAkAABUJAAAaCQAAHgkAACMJAAAnCQAAKgkAADMJAABICQAATQkAAFwJAABqCQAAdgkAAIQJ"
+ "AACPCQAAmgkAAKYJAACzCQAAygkAANkJAADoCQAA9AkAAAAKAAAKCgAAHgoAACQKAAAyCgAAPQoA"
+ "AEUKAABLCgAAYgoAAGgKAABtCgAAdgoAAIIKAACOCgAAmwoAAKEKAAADAAAABAAAAAUAAAAGAAAA"
+ "CAAAAAsAAAAPAAAAEAAAABEAAAASAAAAEwAAABQAAAAVAAAAFgAAABgAAAAZAAAAGgAAABsAAAAc"
+ "AAAAHQAAAB4AAAAfAAAAIAAAACEAAAAiAAAAIwAAACQAAAAlAAAAJwAAADEAAAAzAAAACQAAAAQA"
+ "AABMBQAADgAAABMAAABUBQAADQAAABUAAAB0BQAADAAAABYAAAAAAAAAJwAAABwAAAAAAAAAKAAA"
+ "ABwAAACABQAAKQAAABwAAACIBQAAKgAAABwAAACUBQAAKwAAABwAAACgBQAALAAAABwAAABMBQAA"
+ "LQAAABwAAACoBQAALwAAABwAAACwBQAALwAAABwAAAC4BQAALgAAABwAAADABQAAMAAAABwAAADI"
+ "BQAALgAAABwAAADQBQAACQAJAAoAAAAKABMAPwAAABEADQBLAAAACgAEAAIAAAAKAAAANAAAAAoA"
+ "AQBFAAAACgAPAEgAAAAKAAQAUAAAAA0ACABMAAAADwAEAAIAAAAUAA0AAgAAABYAAgBAAAAAFwAD"
+ "AEcAAAAZAAUANgAAABkABgA2AAAAGQAHADYAAAAZAAkANgAAABkACgA2AAAAGQALADYAAAAZAAwA"
+ "NgAAABkADgA3AAAAnQsAAJ0LAAAKAAAAAQAAAA8AAAAAAAAAJgAAACQFAADGCwAAAAAAAAQAAAAC"
+ "AAAAAQAAAN4KAAACAAAAegsAAJILAAACAAAAkgsAAJoLAAABAAEAAQAAAKgKAAAEAAAAcBAGAAAA"
+ "DgADAAIAAAAAAK0KAAADAAAAkAABAg8AAAAYAA8ABgAAALQKAABTAAAAcRARAAwAEhJxIA0A0gAT"
+ "AmEAcSAKAOIAEwIABHEgDQDyABISAgAQAHEgDQACABICFAOamTFBAgARAHEwDAADAhYGAAAYApqZ"
+ "mZmZmQFABQQSAHcGCwACABsCBwAAAAgAFABxIBAAAgAcAgoACAAVAHEgDwACABcCFc1bBwUAFgBx"
+ "QA4AMhBxAAkAAAAMAhwDCgBuQAgAMroMAiIDFABwIAcAIwARAwAABAABAAIAAADRCgAADAAAAGIA"
+ "AgASIRIy/CAAACEACgFuIAUAEAAOAAMAAQACAAAA2AoAAAsAAAASIBIx/CABABAACgASUXEgDQAB"
+ "AA4AAAAAAAAAAAAAAAMAAAAAAAAAAQAAAMwDAAACAAAA1AMAAAQAAADgAwAAAgAAAAQABAANAAAA"
+ "FgAQABgAHQAAAAEAGwAEAAMAAgAQAA4ABQAAAAMAAAAOABAAGAAAAAIAAAABAAEAAwAAAAIAAgAC"
+ "AAAAAwAAAAMAAwADAAAAAQAAAAQAAAACAAAABQAFAAIAAAAPAA8AAgAAABAAEAABAAAAFQAAAAEA"
+ "AAAdAAAAAQAAAB4AASgABjwqPjtKKQAGPGluaXQ+AAFCAAFDAAFEAAFGAAVIZWxsbwABSQADSUlJ"
+ "AA1JTlZPS0VfU1RBVElDAAFKAAFMAARMTExMAA5MTExMWkJDU0lGRExMSgAzTGNvbS9hbmRyb2lk"
+ "L2phY2svYW5ub3RhdGlvbnMvQ2FsbGVkQnlJbnZva2VDdXN0b207ACdMY29tL2FuZHJvaWQvamFj"
+ "ay9hbm5vdGF0aW9ucy9Db25zdGFudDsAMUxjb20vYW5kcm9pZC9qYWNrL2Fubm90YXRpb25zL0xp"
+ "bmtlck1ldGhvZEhhbmRsZTsAL0xjb20vYW5kcm9pZC9qYWNrL2Fubm90YXRpb25zL01ldGhvZEhh"
+ "bmRsZUtpbmQ7ADNMY29tL2FuZHJvaWQvamFjay9qYXZhNy9pbnZva2VjdXN0b20vdGVzdDAwNC9U"
+ "ZXN0czsAHUxkYWx2aWsvYW5ub3RhdGlvbi9TaWduYXR1cmU7ABpMZGFsdmlrL2Fubm90YXRpb24v"
+ "VGhyb3dzOwAVTGphdmEvaW8vUHJpbnRTdHJlYW07ABBMamF2YS9sYW5nL0NsYXNzABFMamF2YS9s"
+ "YW5nL0NsYXNzOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZh"
+ "L2xhbmcvU3lzdGVtOwAVTGphdmEvbGFuZy9UaHJvd2FibGU7ABtMamF2YS9sYW5nL2ludm9rZS9D"
+ "YWxsU2l0ZTsAI0xqYXZhL2xhbmcvaW52b2tlL0NvbnN0YW50Q2FsbFNpdGU7AB9MamF2YS9sYW5n"
+ "L2ludm9rZS9NZXRob2RIYW5kbGU7ACdMamF2YS9sYW5nL2ludm9rZS9NZXRob2RIYW5kbGVzJExv"
+ "b2t1cDsAIExqYXZhL2xhbmcvaW52b2tlL01ldGhvZEhhbmRsZXM7AB1MamF2YS9sYW5nL2ludm9r"
+ "ZS9NZXRob2RUeXBlOwAYTGp1bml0L2ZyYW1ld29yay9Bc3NlcnQ7ABBMb3JnL2p1bml0L1Rlc3Q7"
+ "AAFTAApUZXN0cy5qYXZhAAFWAANWQ0MABFZEREQABFZGRkYAAlZJAANWSUkAA1ZKSgACVkwAA1ZM"
+ "TAACVloAAVoAB1pCQ1NJRkQAE1tMamF2YS9sYW5nL1N0cmluZzsAA2FkZAANYXJndW1lbnRUeXBl"
+ "cwAMYXNzZXJ0RXF1YWxzAAphc3NlcnRUcnVlAAxib29sZWFuVmFsdWUACWJ5dGVWYWx1ZQAJY2hh"
+ "clZhbHVlAApjbGFzc1ZhbHVlAAtkb3VibGVWYWx1ZQAVZW1pdHRlcjogamFjay00LjAtZW5nAA1l"
+ "bmNsb3NpbmdUeXBlAA1maWVsZENhbGxTaXRlAApmaW5kU3RhdGljAApmbG9hdFZhbHVlAAhpbnRW"
+ "YWx1ZQASaW52b2tlTWV0aG9kSGFuZGxlAARraW5kAAxsaW5rZXJNZXRob2QACWxvbmdWYWx1ZQAG"
+ "bG9va3VwAARtYWluABVtZXRob2RIYW5kbGVFeHRyYUFyZ3MABG5hbWUAA291dAAHcHJpbnRsbgAK"
+ "cmV0dXJuVHlwZQAKc2hvcnRWYWx1ZQALc3RyaW5nVmFsdWUABHRlc3QABXZhbHVlACMABw4ANwIA"
+ "AAcOAD4NAAAAAAAAAAAAAAAAAAcOPEtaWmmWw4d4h6UAUgEABw60AE4ABw6lAAAGBTUcAhgEGARD"
+ "HAEdCAQ1HA0YFhgQGBgYHRgAGAEYGxgEGAMYAhgQGA4YBT4YCkQbAEoXRUkcCh0HATgcAT8dBwE5"
+ "HAEAAR0HATocAQNhHQcBThwBIgAEHQcBQhwBBAEdBwFBHAFwmpkxQR0HATwcAfGamZmZmZkBQB0H"
+ "AU8cARcHHQcBOxwBGAodBwFGHAFmFc1bB0oXNE0YBAILAVEcCRcAFyAXGhciFzIXGhcXFwEXHQIM"
+ "AVEcARgSARoADRYAFzQVAAQBBAEEYSQABAQBcJqZMUHxmpmZmZmZAUAXBxgKZhXNWwcBAAQBAQkA"
+ "gYAE7AcBCoQIAQqcCAEJ1AkEAfwJAAATAAAAAAAAAAEAAAAAAAAAAQAAAFIAAABwAAAAAgAAAB8A"
+ "AAC4AQAAAwAAABAAAAA0AgAABAAAAAMAAAD0AgAABQAAABIAAAAMAwAABwAAAAIAAACcAwAABgAA"
+ "AAEAAACkAwAACAAAAAEAAADEAwAAAxAAAAMAAADMAwAAASAAAAUAAADsAwAABiAAAAEAAAAkBQAA"
+ "ARAAAA0AAABMBQAAAiAAAFIAAADWBQAAAyAAAAUAAACoCgAABCAAAAQAAADeCgAABSAAAAEAAACd"
+ "CwAAACAAAAEAAADGCwAAABAAAAEAAADkCwAA"
+};
+
+TEST_F(DexFileVerifierTest, InvokeCustomDexSamples) {
+ for (size_t i = 0; i < arraysize(kInvokeCustomDexFiles); ++i) {
+ size_t length;
+ std::unique_ptr<uint8_t[]> dex_bytes(DecodeBase64(kInvokeCustomDexFiles[i], &length));
+ CHECK(dex_bytes != nullptr);
+ // Note: `dex_file` will be destroyed before `dex_bytes`.
+ std::unique_ptr<DexFile> dex_file(GetDexFile(dex_bytes.get(), length));
+ std::string error_msg;
+ EXPECT_TRUE(DexFileVerifier::Verify(dex_file.get(),
+ dex_file->Begin(),
+ dex_file->Size(),
+ "good checksum, verify",
+ /*verify_checksum*/ true,
+ &error_msg));
+ // TODO(oth): Test corruptions (b/35308502)
+ }
+}
+
} // namespace art
diff --git a/runtime/dex_instruction.cc b/runtime/dex_instruction.cc
index 37f3ac9..091085a 100644
--- a/runtime/dex_instruction.cc
+++ b/runtime/dex_instruction.cc
@@ -407,6 +407,20 @@
break;
}
FALLTHROUGH_INTENDED;
+ case INVOKE_CUSTOM:
+ if (file != nullptr) {
+ os << opcode << " {";
+ uint32_t call_site_idx = VRegB_35c();
+ for (size_t i = 0; i < VRegA_35c(); ++i) {
+ if (i != 0) {
+ os << ", ";
+ }
+ os << "v" << arg[i];
+ }
+ os << "}, // call_site@" << call_site_idx;
+ break;
+ }
+ FALLTHROUGH_INTENDED;
default:
os << opcode << " {v" << arg[0] << ", v" << arg[1] << ", v" << arg[2]
<< ", v" << arg[3] << ", v" << arg[4] << "}, thing@" << VRegB_35c();
@@ -415,6 +429,8 @@
break;
}
case k3rc: {
+ uint16_t first_reg = VRegC_3rc();
+ uint16_t last_reg = VRegC_3rc() + VRegA_3rc() - 1;
switch (Opcode()) {
case INVOKE_VIRTUAL_RANGE:
case INVOKE_SUPER_RANGE:
@@ -423,7 +439,7 @@
case INVOKE_INTERFACE_RANGE:
if (file != nullptr) {
uint32_t method_idx = VRegB_3rc();
- os << StringPrintf("%s, {v%d .. v%d}, ", opcode, VRegC_3rc(), (VRegC_3rc() + VRegA_3rc() - 1))
+ os << StringPrintf("%s, {v%d .. v%d}, ", opcode, first_reg, last_reg)
<< file->PrettyMethod(method_idx) << " // method@" << method_idx;
break;
}
@@ -431,14 +447,22 @@
case INVOKE_VIRTUAL_RANGE_QUICK:
if (file != nullptr) {
uint32_t method_idx = VRegB_3rc();
- os << StringPrintf("%s, {v%d .. v%d}, ", opcode, VRegC_3rc(), (VRegC_3rc() + VRegA_3rc() - 1))
+ os << StringPrintf("%s, {v%d .. v%d}, ", opcode, first_reg, last_reg)
<< "// vtable@" << method_idx;
break;
}
FALLTHROUGH_INTENDED;
+ case INVOKE_CUSTOM_RANGE:
+ if (file != nullptr) {
+ uint32_t call_site_idx = VRegB_3rc();
+ os << StringPrintf("%s, {v%d .. v%d}, ", opcode, first_reg, last_reg)
+ << "// call_site@" << call_site_idx;
+ break;
+ }
+ FALLTHROUGH_INTENDED;
default:
- os << StringPrintf("%s, {v%d .. v%d}, thing@%d", opcode, VRegC_3rc(),
- (VRegC_3rc() + VRegA_3rc() - 1), VRegB_3rc());
+ os << StringPrintf("%s, {v%d .. v%d}, ", opcode, first_reg, last_reg)
+ << "thing@" << VRegB_3rc();
break;
}
break;
diff --git a/runtime/dex_instruction.h b/runtime/dex_instruction.h
index 578550c..d269110 100644
--- a/runtime/dex_instruction.h
+++ b/runtime/dex_instruction.h
@@ -126,14 +126,15 @@
enum IndexType {
kIndexUnknown = 0,
- kIndexNone, // has no index
- kIndexTypeRef, // type reference index
- kIndexStringRef, // string reference index
- kIndexMethodRef, // method reference index
- kIndexFieldRef, // field reference index
- kIndexFieldOffset, // field offset (for static linked fields)
- kIndexVtableOffset, // vtable offset (for static linked methods)
- kIndexMethodAndProtoRef // method and a proto reference index (for invoke-polymorphic)
+ kIndexNone, // has no index
+ kIndexTypeRef, // type reference index
+ kIndexStringRef, // string reference index
+ kIndexMethodRef, // method reference index
+ kIndexFieldRef, // field reference index
+ kIndexFieldOffset, // field offset (for static linked fields)
+ kIndexVtableOffset, // vtable offset (for static linked methods)
+ kIndexMethodAndProtoRef, // method and a proto reference index (for invoke-polymorphic)
+ kIndexCallSiteRef, // call site reference index
};
enum Flags {
@@ -165,31 +166,32 @@
};
enum VerifyFlag {
- kVerifyNone = 0x000000,
- kVerifyRegA = 0x000001,
- kVerifyRegAWide = 0x000002,
- kVerifyRegB = 0x000004,
- kVerifyRegBField = 0x000008,
- kVerifyRegBMethod = 0x000010,
- kVerifyRegBNewInstance = 0x000020,
- kVerifyRegBString = 0x000040,
- kVerifyRegBType = 0x000080,
- kVerifyRegBWide = 0x000100,
- kVerifyRegC = 0x000200,
- kVerifyRegCField = 0x000400,
- kVerifyRegCNewArray = 0x000800,
- kVerifyRegCType = 0x001000,
- kVerifyRegCWide = 0x002000,
- kVerifyArrayData = 0x004000,
- kVerifyBranchTarget = 0x008000,
- kVerifySwitchTargets = 0x010000,
- kVerifyVarArg = 0x020000,
- kVerifyVarArgNonZero = 0x040000,
- kVerifyVarArgRange = 0x080000,
- kVerifyVarArgRangeNonZero = 0x100000,
- kVerifyRuntimeOnly = 0x200000,
- kVerifyError = 0x400000,
- kVerifyRegHPrototype = 0x800000
+ kVerifyNone = 0x0000000,
+ kVerifyRegA = 0x0000001,
+ kVerifyRegAWide = 0x0000002,
+ kVerifyRegB = 0x0000004,
+ kVerifyRegBField = 0x0000008,
+ kVerifyRegBMethod = 0x0000010,
+ kVerifyRegBNewInstance = 0x0000020,
+ kVerifyRegBString = 0x0000040,
+ kVerifyRegBType = 0x0000080,
+ kVerifyRegBWide = 0x0000100,
+ kVerifyRegC = 0x0000200,
+ kVerifyRegCField = 0x0000400,
+ kVerifyRegCNewArray = 0x0000800,
+ kVerifyRegCType = 0x0001000,
+ kVerifyRegCWide = 0x0002000,
+ kVerifyArrayData = 0x0004000,
+ kVerifyBranchTarget = 0x0008000,
+ kVerifySwitchTargets = 0x0010000,
+ kVerifyVarArg = 0x0020000,
+ kVerifyVarArgNonZero = 0x0040000,
+ kVerifyVarArgRange = 0x0080000,
+ kVerifyVarArgRangeNonZero = 0x0100000,
+ kVerifyRuntimeOnly = 0x0200000,
+ kVerifyError = 0x0400000,
+ kVerifyRegHPrototype = 0x0800000,
+ kVerifyRegBCallSite = 0x1000000
};
static constexpr uint32_t kMaxVarArgRegs = 5;
diff --git a/runtime/dex_instruction_list.h b/runtime/dex_instruction_list.h
index ca2ce1d..a5ce3c2 100644
--- a/runtime/dex_instruction_list.h
+++ b/runtime/dex_instruction_list.h
@@ -271,8 +271,8 @@
V(0xF9, UNUSED_F9, "unused-f9", k10x, kIndexUnknown, 0, kVerifyError) \
V(0xFA, INVOKE_POLYMORPHIC, "invoke-polymorphic", k45cc, kIndexMethodAndProtoRef, kContinue | kThrow | kInvoke, kVerifyRegBMethod | kVerifyVarArgNonZero | kVerifyRegHPrototype) \
V(0xFB, INVOKE_POLYMORPHIC_RANGE, "invoke-polymorphic/range", k4rcc, kIndexMethodAndProtoRef, kContinue | kThrow | kInvoke, kVerifyRegBMethod | kVerifyVarArgRangeNonZero | kVerifyRegHPrototype) \
- V(0xFC, UNUSED_FC, "unused-fc", k10x, kIndexUnknown, 0, kVerifyError) \
- V(0xFD, UNUSED_FD, "unused-fd", k10x, kIndexUnknown, 0, kVerifyError) \
+ V(0xFC, INVOKE_CUSTOM, "invoke-custom", k35c, kIndexCallSiteRef, kContinue | kThrow, kVerifyRegBCallSite) \
+ V(0xFD, INVOKE_CUSTOM_RANGE, "invoke-custom/range", k3rc, kIndexCallSiteRef, kContinue | kThrow, kVerifyRegBCallSite) \
V(0xFE, UNUSED_FE, "unused-fe", k10x, kIndexUnknown, 0, kVerifyError) \
V(0xFF, UNUSED_FF, "unused-ff", k10x, kIndexUnknown, 0, kVerifyError)
diff --git a/runtime/entrypoints/entrypoint_utils-inl.h b/runtime/entrypoints/entrypoint_utils-inl.h
index 3bc49b8..28aca6c 100644
--- a/runtime/entrypoints/entrypoint_utils-inl.h
+++ b/runtime/entrypoints/entrypoint_utils-inl.h
@@ -709,10 +709,10 @@
return resolved_method;
} else if (type == kSuper) {
// TODO This lookup is rather slow.
- ObjPtr<mirror::DexCache> dex_cache = referrer->GetDexCache();
- dex::TypeIndex method_type_idx = dex_cache->GetDexFile()->GetMethodId(method_idx).class_idx_;
- ObjPtr<mirror::Class> method_reference_class = ClassLinker::LookupResolvedType(
- method_type_idx, dex_cache, referrer->GetClassLoader());
+ dex::TypeIndex method_type_idx =
+ referrer->GetDexFile()->GetMethodId(method_idx).class_idx_;
+ mirror::Class* method_reference_class =
+ referrer->GetDexCache()->GetResolvedType(method_type_idx);
if (method_reference_class == nullptr) {
// Need to do full type resolution...
return nullptr;
diff --git a/runtime/entrypoints/entrypoint_utils.cc b/runtime/entrypoints/entrypoint_utils.cc
index fb8139b..6301362 100644
--- a/runtime/entrypoints/entrypoint_utils.cc
+++ b/runtime/entrypoints/entrypoint_utils.cc
@@ -39,7 +39,7 @@
namespace art {
void CheckReferenceResult(Handle<mirror::Object> o, Thread* self) {
- if (o.Get() == nullptr) {
+ if (o == nullptr) {
return;
}
// Make sure that the result is an instance of the type this method was expected to return.
diff --git a/runtime/entrypoints/quick/quick_field_entrypoints.cc b/runtime/entrypoints/quick/quick_field_entrypoints.cc
index 4544aef..822c5a8 100644
--- a/runtime/entrypoints/quick/quick_field_entrypoints.cc
+++ b/runtime/entrypoints/quick/quick_field_entrypoints.cc
@@ -48,7 +48,7 @@
StackHandleScope<1> hs(self);
HandleWrapper<mirror::Object> h(hs.NewHandleWrapper(obj));
ArtField* field = FindFieldFromCode<type, kAccessCheck>(field_idx, referrer, self, size);
- if (LIKELY(field != nullptr) && UNLIKELY(h.Get() == nullptr)) {
+ if (LIKELY(field != nullptr) && UNLIKELY(h == nullptr)) {
ThrowNullPointerExceptionForFieldAccess(field, /*is_read*/FindFieldTypeIsRead(type));
return nullptr;
}
diff --git a/runtime/entrypoints/quick/quick_trampoline_entrypoints.cc b/runtime/entrypoints/quick/quick_trampoline_entrypoints.cc
index 3ef47c4..c2bca53 100644
--- a/runtime/entrypoints/quick/quick_trampoline_entrypoints.cc
+++ b/runtime/entrypoints/quick/quick_trampoline_entrypoints.cc
@@ -2435,8 +2435,8 @@
// Wrap raw_method_handle in a Handle for safety.
StackHandleScope<5> hs(self);
- Handle<mirror::MethodHandleImpl> method_handle(
- hs.NewHandle(ObjPtr<mirror::MethodHandleImpl>::DownCast(MakeObjPtr(raw_method_handle))));
+ Handle<mirror::MethodHandle> method_handle(
+ hs.NewHandle(ObjPtr<mirror::MethodHandle>::DownCast(MakeObjPtr(raw_method_handle))));
raw_method_handle = nullptr;
self->EndAssertNoThreadSuspension(old_cause);
@@ -2497,15 +2497,14 @@
// consecutive order.
uint32_t unused_args[Instruction::kMaxVarArgRegs] = {};
uint32_t first_callee_arg = first_arg + 1;
- const bool do_assignability_check = false;
- if (!DoInvokePolymorphic<true /* is_range */, do_assignability_check>(self,
- resolved_method,
- *shadow_frame,
- method_handle,
- method_type,
- unused_args,
- first_callee_arg,
- result)) {
+ if (!DoInvokePolymorphic<true /* is_range */>(self,
+ resolved_method,
+ *shadow_frame,
+ method_handle,
+ method_type,
+ unused_args,
+ first_callee_arg,
+ result)) {
DCHECK(self->IsExceptionPending());
}
diff --git a/runtime/gc/reference_queue_test.cc b/runtime/gc/reference_queue_test.cc
index 3ca3353..613b034 100644
--- a/runtime/gc/reference_queue_test.cc
+++ b/runtime/gc/reference_queue_test.cc
@@ -38,11 +38,11 @@
auto ref_class = hs.NewHandle(
Runtime::Current()->GetClassLinker()->FindClass(self, "Ljava/lang/ref/WeakReference;",
ScopedNullHandle<mirror::ClassLoader>()));
- ASSERT_TRUE(ref_class.Get() != nullptr);
+ ASSERT_TRUE(ref_class != nullptr);
auto ref1(hs.NewHandle(ref_class->AllocObject(self)->AsReference()));
- ASSERT_TRUE(ref1.Get() != nullptr);
+ ASSERT_TRUE(ref1 != nullptr);
auto ref2(hs.NewHandle(ref_class->AllocObject(self)->AsReference()));
- ASSERT_TRUE(ref2.Get() != nullptr);
+ ASSERT_TRUE(ref2 != nullptr);
queue.EnqueueReference(ref1.Get());
ASSERT_TRUE(!queue.IsEmpty());
ASSERT_EQ(queue.GetLength(), 1U);
@@ -73,15 +73,15 @@
auto weak_ref_class = hs.NewHandle(
Runtime::Current()->GetClassLinker()->FindClass(self, "Ljava/lang/ref/WeakReference;",
ScopedNullHandle<mirror::ClassLoader>()));
- ASSERT_TRUE(weak_ref_class.Get() != nullptr);
+ ASSERT_TRUE(weak_ref_class != nullptr);
auto finalizer_ref_class = hs.NewHandle(
Runtime::Current()->GetClassLinker()->FindClass(self, "Ljava/lang/ref/FinalizerReference;",
ScopedNullHandle<mirror::ClassLoader>()));
- ASSERT_TRUE(finalizer_ref_class.Get() != nullptr);
+ ASSERT_TRUE(finalizer_ref_class != nullptr);
auto ref1(hs.NewHandle(weak_ref_class->AllocObject(self)->AsReference()));
- ASSERT_TRUE(ref1.Get() != nullptr);
+ ASSERT_TRUE(ref1 != nullptr);
auto ref2(hs.NewHandle(finalizer_ref_class->AllocObject(self)->AsReference()));
- ASSERT_TRUE(ref2.Get() != nullptr);
+ ASSERT_TRUE(ref2 != nullptr);
queue.EnqueueReference(ref1.Get());
oss.str("");
diff --git a/runtime/gc/space/image_space.cc b/runtime/gc/space/image_space.cc
index 4be4ef0..2163a20 100644
--- a/runtime/gc/space/image_space.cc
+++ b/runtime/gc/space/image_space.cc
@@ -692,7 +692,7 @@
if (validate_oat_file) {
TimingLogger::ScopedTiming timing("ValidateOatFile", &logger);
CHECK(space->oat_file_ != nullptr);
- if (!ValidateOatFile(*space, *space->oat_file_, error_msg)) {
+ if (!ImageSpace::ValidateOatFile(*space->oat_file_, error_msg)) {
DCHECK(!error_msg->empty());
return nullptr;
}
@@ -1237,9 +1237,9 @@
}
dex_cache->FixupStrings<kWithoutReadBarrier>(new_strings, fixup_adapter);
}
- mirror::TypeDexCacheType* types = dex_cache->GetResolvedTypes();
+ GcRoot<mirror::Class>* types = dex_cache->GetResolvedTypes();
if (types != nullptr) {
- mirror::TypeDexCacheType* new_types = fixup_adapter.ForwardObject(types);
+ GcRoot<mirror::Class>* new_types = fixup_adapter.ForwardObject(types);
if (types != new_types) {
dex_cache->SetResolvedTypes(new_types);
}
@@ -1283,6 +1283,14 @@
}
dex_cache->FixupResolvedMethodTypes<kWithoutReadBarrier>(new_method_types, fixup_adapter);
}
+ GcRoot<mirror::CallSite>* call_sites = dex_cache->GetResolvedCallSites();
+ if (call_sites != nullptr) {
+ GcRoot<mirror::CallSite>* new_call_sites = fixup_adapter.ForwardObject(call_sites);
+ if (call_sites != new_call_sites) {
+ dex_cache->SetResolvedCallSites(new_call_sites);
+ }
+ dex_cache->FixupResolvedCallSites<kWithoutReadBarrier>(new_call_sites, fixup_adapter);
+ }
}
}
{
@@ -1379,33 +1387,6 @@
return oat_file;
}
-
- static bool ValidateOatFile(const ImageSpace& space,
- const OatFile& oat_file,
- std::string* error_msg) {
- for (const OatFile::OatDexFile* oat_dex_file : oat_file.GetOatDexFiles()) {
- const std::string& dex_file_location = oat_dex_file->GetDexFileLocation();
- uint32_t dex_file_location_checksum;
- if (!DexFile::GetChecksum(dex_file_location.c_str(), &dex_file_location_checksum, error_msg)) {
- *error_msg = StringPrintf("Failed to get checksum of dex file '%s' referenced by image %s: "
- "%s",
- dex_file_location.c_str(),
- space.GetName(),
- error_msg->c_str());
- return false;
- }
- if (dex_file_location_checksum != oat_dex_file->GetDexFileLocationChecksum()) {
- *error_msg = StringPrintf("ValidateOatFile found checksum mismatch between oat file '%s' and "
- "dex file '%s' (0x%x != 0x%x)",
- oat_file.GetLocation().c_str(),
- dex_file_location.c_str(),
- oat_dex_file->GetDexFileLocationChecksum(),
- dex_file_location_checksum);
- return false;
- }
- }
- return true;
- }
};
static constexpr uint64_t kLowSpaceValue = 50 * MB;
@@ -1782,6 +1763,63 @@
return bootcp_oss.str();
}
+bool ImageSpace::ValidateOatFile(const OatFile& oat_file, std::string* error_msg) {
+ for (const OatFile::OatDexFile* oat_dex_file : oat_file.GetOatDexFiles()) {
+ const std::string& dex_file_location = oat_dex_file->GetDexFileLocation();
+
+ // Skip multidex locations - These will be checked when we visit their
+ // corresponding primary non-multidex location.
+ if (DexFile::IsMultiDexLocation(dex_file_location.c_str())) {
+ continue;
+ }
+
+ std::vector<uint32_t> checksums;
+ if (!DexFile::GetMultiDexChecksums(dex_file_location.c_str(), &checksums, error_msg)) {
+ *error_msg = StringPrintf("ValidateOatFile failed to get checksums of dex file '%s' "
+ "referenced by oat file %s: %s",
+ dex_file_location.c_str(),
+ oat_file.GetLocation().c_str(),
+ error_msg->c_str());
+ return false;
+ }
+ CHECK(!checksums.empty());
+ if (checksums[0] != oat_dex_file->GetDexFileLocationChecksum()) {
+ *error_msg = StringPrintf("ValidateOatFile found checksum mismatch between oat file "
+ "'%s' and dex file '%s' (0x%x != 0x%x)",
+ oat_file.GetLocation().c_str(),
+ dex_file_location.c_str(),
+ oat_dex_file->GetDexFileLocationChecksum(),
+ checksums[0]);
+ return false;
+ }
+
+ // Verify checksums for any related multidex entries.
+ for (size_t i = 1; i < checksums.size(); i++) {
+ std::string multi_dex_location = DexFile::GetMultiDexLocation(i, dex_file_location.c_str());
+ const OatFile::OatDexFile* multi_dex = oat_file.GetOatDexFile(multi_dex_location.c_str(),
+ nullptr,
+ error_msg);
+ if (multi_dex == nullptr) {
+ *error_msg = StringPrintf("ValidateOatFile oat file '%s' is missing entry '%s'",
+ oat_file.GetLocation().c_str(),
+ multi_dex_location.c_str());
+ return false;
+ }
+
+ if (checksums[i] != multi_dex->GetDexFileLocationChecksum()) {
+ *error_msg = StringPrintf("ValidateOatFile found checksum mismatch between oat file "
+ "'%s' and dex file '%s' (0x%x != 0x%x)",
+ oat_file.GetLocation().c_str(),
+ multi_dex_location.c_str(),
+ multi_dex->GetDexFileLocationChecksum(),
+ checksums[i]);
+ return false;
+ }
+ }
+ }
+ return true;
+}
+
void ImageSpace::ExtractMultiImageLocations(const std::string& input_image_file_name,
const std::string& boot_classpath,
std::vector<std::string>* image_file_names) {
diff --git a/runtime/gc/space/image_space.h b/runtime/gc/space/image_space.h
index 489a289..199bbdd 100644
--- a/runtime/gc/space/image_space.h
+++ b/runtime/gc/space/image_space.h
@@ -131,6 +131,17 @@
const std::vector<const char*>& oat_filenames,
const std::vector<const char*>& image_filenames);
+ // Returns true if the dex checksums in the given oat file match the
+ // checksums of the original dex files on disk. This is intended to be used
+ // to validate the boot image oat file, which may contain dex entries from
+ // multiple different (possibly multidex) dex files on disk. Prefer the
+ // OatFileAssistant for validating regular app oat files because the
+ // OatFileAssistant caches dex checksums that are reused to check both the
+ // oat and odex file.
+ //
+ // This function is exposed for testing purposes.
+ static bool ValidateOatFile(const OatFile& oat_file, std::string* error_msg);
+
// Return the end of the image which includes non-heap objects such as ArtMethods and ArtFields.
uint8_t* GetImageEnd() const {
return Begin() + GetImageHeader().GetImageSize();
diff --git a/runtime/gc/space/image_space_test.cc b/runtime/gc/space/image_space_test.cc
new file mode 100644
index 0000000..7a38074
--- /dev/null
+++ b/runtime/gc/space/image_space_test.cc
@@ -0,0 +1,111 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include <gtest/gtest.h>
+
+#include "dexopt_test.h"
+
+namespace art {
+namespace gc {
+namespace space {
+
+TEST_F(DexoptTest, ValidateOatFile) {
+ std::string dex1 = GetScratchDir() + "/Dex1.jar";
+ std::string multidex1 = GetScratchDir() + "/MultiDex1.jar";
+ std::string dex2 = GetScratchDir() + "/Dex2.jar";
+ std::string oat_location = GetScratchDir() + "/Oat.oat";
+
+ Copy(GetDexSrc1(), dex1);
+ Copy(GetMultiDexSrc1(), multidex1);
+ Copy(GetDexSrc2(), dex2);
+
+ std::string error_msg;
+ std::vector<std::string> args;
+ args.push_back("--dex-file=" + dex1);
+ args.push_back("--dex-file=" + multidex1);
+ args.push_back("--dex-file=" + dex2);
+ args.push_back("--oat-file=" + oat_location);
+ ASSERT_TRUE(OatFileAssistant::Dex2Oat(args, &error_msg)) << error_msg;
+
+ std::unique_ptr<OatFile> oat(OatFile::Open(oat_location.c_str(),
+ oat_location.c_str(),
+ nullptr,
+ nullptr,
+ false,
+ /*low_4gb*/false,
+ nullptr,
+ &error_msg));
+ ASSERT_TRUE(oat != nullptr) << error_msg;
+
+ // Originally all the dex checksums should be up to date.
+ EXPECT_TRUE(ImageSpace::ValidateOatFile(*oat, &error_msg)) << error_msg;
+
+ // Invalidate the dex1 checksum.
+ Copy(GetDexSrc2(), dex1);
+ EXPECT_FALSE(ImageSpace::ValidateOatFile(*oat, &error_msg));
+
+ // Restore the dex1 checksum.
+ Copy(GetDexSrc1(), dex1);
+ EXPECT_TRUE(ImageSpace::ValidateOatFile(*oat, &error_msg)) << error_msg;
+
+ // Invalidate the non-main multidex checksum.
+ Copy(GetMultiDexSrc2(), multidex1);
+ EXPECT_FALSE(ImageSpace::ValidateOatFile(*oat, &error_msg));
+
+ // Restore the multidex checksum.
+ Copy(GetMultiDexSrc1(), multidex1);
+ EXPECT_TRUE(ImageSpace::ValidateOatFile(*oat, &error_msg)) << error_msg;
+
+ // Invalidate the dex2 checksum.
+ Copy(GetDexSrc1(), dex2);
+ EXPECT_FALSE(ImageSpace::ValidateOatFile(*oat, &error_msg));
+
+ // restore the dex2 checksum.
+ Copy(GetDexSrc2(), dex2);
+ EXPECT_TRUE(ImageSpace::ValidateOatFile(*oat, &error_msg)) << error_msg;
+
+ // Replace the multidex file with a non-multidex file.
+ Copy(GetDexSrc1(), multidex1);
+ EXPECT_FALSE(ImageSpace::ValidateOatFile(*oat, &error_msg));
+
+ // Restore the multidex file
+ Copy(GetMultiDexSrc1(), multidex1);
+ EXPECT_TRUE(ImageSpace::ValidateOatFile(*oat, &error_msg)) << error_msg;
+
+ // Replace dex1 with a multidex file.
+ Copy(GetMultiDexSrc1(), dex1);
+ EXPECT_FALSE(ImageSpace::ValidateOatFile(*oat, &error_msg));
+
+ // Restore the dex1 file.
+ Copy(GetDexSrc1(), dex1);
+ EXPECT_TRUE(ImageSpace::ValidateOatFile(*oat, &error_msg)) << error_msg;
+
+ // Remove the dex2 file.
+ EXPECT_EQ(0, unlink(dex2.c_str()));
+ EXPECT_FALSE(ImageSpace::ValidateOatFile(*oat, &error_msg));
+
+ // Restore the dex2 file.
+ Copy(GetDexSrc2(), dex2);
+ EXPECT_TRUE(ImageSpace::ValidateOatFile(*oat, &error_msg)) << error_msg;
+
+ // Remove the multidex file.
+ EXPECT_EQ(0, unlink(multidex1.c_str()));
+ EXPECT_FALSE(ImageSpace::ValidateOatFile(*oat, &error_msg));
+}
+
+} // namespace space
+} // namespace gc
+} // namespace art
diff --git a/runtime/gc/space/space_create_test.cc b/runtime/gc/space/space_create_test.cc
index 7bc4dc4..ca5f306 100644
--- a/runtime/gc/space/space_create_test.cc
+++ b/runtime/gc/space/space_create_test.cc
@@ -108,7 +108,7 @@
&ptr1_bytes_allocated,
&ptr1_usable_size,
&ptr1_bytes_tl_bulk_allocated)));
- EXPECT_TRUE(ptr1.Get() != nullptr);
+ EXPECT_TRUE(ptr1 != nullptr);
EXPECT_LE(1U * MB, ptr1_bytes_allocated);
EXPECT_LE(1U * MB, ptr1_usable_size);
EXPECT_LE(ptr1_usable_size, ptr1_bytes_allocated);
@@ -126,7 +126,7 @@
&ptr3_bytes_allocated,
&ptr3_usable_size,
&ptr3_bytes_tl_bulk_allocated)));
- EXPECT_TRUE(ptr3.Get() != nullptr);
+ EXPECT_TRUE(ptr3 != nullptr);
EXPECT_LE(8U * MB, ptr3_bytes_allocated);
EXPECT_LE(8U * MB, ptr3_usable_size);
EXPECT_LE(ptr3_usable_size, ptr3_bytes_allocated);
@@ -154,7 +154,7 @@
&ptr6_bytes_allocated,
&ptr6_usable_size,
&ptr6_bytes_tl_bulk_allocated)));
- EXPECT_TRUE(ptr6.Get() != nullptr);
+ EXPECT_TRUE(ptr6 != nullptr);
EXPECT_LE(9U * MB, ptr6_bytes_allocated);
EXPECT_LE(9U * MB, ptr6_usable_size);
EXPECT_LE(ptr6_usable_size, ptr6_bytes_allocated);
@@ -193,7 +193,7 @@
&ptr1_bytes_allocated,
&ptr1_usable_size,
&ptr1_bytes_tl_bulk_allocated));
- EXPECT_TRUE(ptr1.Get() != nullptr);
+ EXPECT_TRUE(ptr1 != nullptr);
EXPECT_LE(1U * MB, ptr1_bytes_allocated);
EXPECT_LE(1U * MB, ptr1_usable_size);
EXPECT_LE(ptr1_usable_size, ptr1_bytes_allocated);
@@ -210,7 +210,7 @@
&ptr3_bytes_allocated,
&ptr3_usable_size,
&ptr3_bytes_tl_bulk_allocated));
- EXPECT_TRUE(ptr3.Get() != nullptr);
+ EXPECT_TRUE(ptr3 != nullptr);
EXPECT_LE(2U * MB, ptr3_bytes_allocated);
EXPECT_LE(2U * MB, ptr3_usable_size);
EXPECT_LE(ptr3_usable_size, ptr3_bytes_allocated);
@@ -242,7 +242,7 @@
&ptr1_bytes_allocated,
&ptr1_usable_size,
&ptr1_bytes_tl_bulk_allocated)));
- EXPECT_TRUE(ptr1.Get() != nullptr);
+ EXPECT_TRUE(ptr1 != nullptr);
EXPECT_LE(1U * MB, ptr1_bytes_allocated);
EXPECT_LE(1U * MB, ptr1_usable_size);
EXPECT_LE(ptr1_usable_size, ptr1_bytes_allocated);
@@ -260,7 +260,7 @@
&ptr3_bytes_allocated,
&ptr3_usable_size,
&ptr3_bytes_tl_bulk_allocated)));
- EXPECT_TRUE(ptr3.Get() != nullptr);
+ EXPECT_TRUE(ptr3 != nullptr);
EXPECT_LE(8U * MB, ptr3_bytes_allocated);
EXPECT_LE(8U * MB, ptr3_usable_size);
EXPECT_LE(ptr3_usable_size, ptr3_bytes_allocated);
@@ -288,7 +288,7 @@
&ptr6_bytes_allocated,
&ptr6_usable_size,
&ptr6_bytes_tl_bulk_allocated)));
- EXPECT_TRUE(ptr6.Get() != nullptr);
+ EXPECT_TRUE(ptr6 != nullptr);
EXPECT_LE(9U * MB, ptr6_bytes_allocated);
EXPECT_LE(9U * MB, ptr6_usable_size);
EXPECT_LE(ptr6_usable_size, ptr6_bytes_allocated);
diff --git a/runtime/gc/space/space_test.h b/runtime/gc/space/space_test.h
index cbb3d73..1fe3fb2 100644
--- a/runtime/gc/space/space_test.h
+++ b/runtime/gc/space/space_test.h
@@ -200,7 +200,7 @@
}
footprint = space->GetFootprint();
EXPECT_GE(space->Size(), footprint); // invariant
- if (object.Get() != nullptr) { // allocation succeeded
+ if (object != nullptr) { // allocation succeeded
lots_of_objects[i] = object.Get();
size_t allocation_size = space->AllocationSize(object.Get(), nullptr);
EXPECT_EQ(bytes_allocated, allocation_size);
@@ -296,7 +296,7 @@
large_object.Assign(AllocWithGrowth(space, self, three_quarters_space, &bytes_allocated,
nullptr, &bytes_tl_bulk_allocated));
}
- EXPECT_TRUE(large_object.Get() != nullptr);
+ EXPECT_TRUE(large_object != nullptr);
// Sanity check footprint
footprint = space->GetFootprint();
diff --git a/runtime/handle.h b/runtime/handle.h
index e4b6d29..ccff575 100644
--- a/runtime/handle.h
+++ b/runtime/handle.h
@@ -81,6 +81,14 @@
return reference_;
}
+ ALWAYS_INLINE bool operator!=(std::nullptr_t) const REQUIRES_SHARED(Locks::mutator_lock_) {
+ return !IsNull();
+ }
+
+ ALWAYS_INLINE bool operator==(std::nullptr_t) const REQUIRES_SHARED(Locks::mutator_lock_) {
+ return IsNull();
+ }
+
protected:
template<typename S>
explicit Handle(StackReference<S>* reference)
diff --git a/runtime/image.cc b/runtime/image.cc
index 87f4295..54b099e 100644
--- a/runtime/image.cc
+++ b/runtime/image.cc
@@ -25,7 +25,7 @@
namespace art {
const uint8_t ImageHeader::kImageMagic[] = { 'a', 'r', 't', '\n' };
-const uint8_t ImageHeader::kImageVersion[] = { '0', '3', '7', '\0' }; // hash-based DexCache types
+const uint8_t ImageHeader::kImageVersion[] = { '0', '3', '6', '\0' }; // Erroneous resolved class.
ImageHeader::ImageHeader(uint32_t image_begin,
uint32_t image_size,
diff --git a/runtime/imtable_test.cc b/runtime/imtable_test.cc
index 8cbe291..17149df 100644
--- a/runtime/imtable_test.cc
+++ b/runtime/imtable_test.cc
@@ -53,7 +53,7 @@
ObjPtr<mirror::ClassLoader>::DownCast(self->DecodeJObject(jclass_loader_a)));
Handle<mirror::Class> h_class_a(
hs.NewHandle(class_linker->FindClass(self, class_name.c_str(), h_class_loader)));
- if (h_class_a.Get() == nullptr) {
+ if (h_class_a == nullptr) {
LOG(ERROR) << self->GetException()->Dump();
CHECK(false) << "h_class_a == nullptr";
}
@@ -63,7 +63,7 @@
ObjPtr<mirror::ClassLoader>::DownCast(self->DecodeJObject(jclass_loader_b)));
Handle<mirror::Class> h_class_b(
hs.NewHandle(class_linker->FindClass(self, class_name.c_str(), h_class_loader)));
- if (h_class_b.Get() == nullptr) {
+ if (h_class_b == nullptr) {
LOG(ERROR) << self->GetException()->Dump();
CHECK(false) << "h_class_b == nullptr";
}
diff --git a/runtime/indirect_reference_table_test.cc b/runtime/indirect_reference_table_test.cc
index bf4cab2..6aefe23 100644
--- a/runtime/indirect_reference_table_test.cc
+++ b/runtime/indirect_reference_table_test.cc
@@ -64,13 +64,13 @@
StackHandleScope<4> hs(soa.Self());
ASSERT_TRUE(c != nullptr);
Handle<mirror::Object> obj0 = hs.NewHandle(c->AllocObject(soa.Self()));
- ASSERT_TRUE(obj0.Get() != nullptr);
+ ASSERT_TRUE(obj0 != nullptr);
Handle<mirror::Object> obj1 = hs.NewHandle(c->AllocObject(soa.Self()));
- ASSERT_TRUE(obj1.Get() != nullptr);
+ ASSERT_TRUE(obj1 != nullptr);
Handle<mirror::Object> obj2 = hs.NewHandle(c->AllocObject(soa.Self()));
- ASSERT_TRUE(obj2.Get() != nullptr);
+ ASSERT_TRUE(obj2 != nullptr);
Handle<mirror::Object> obj3 = hs.NewHandle(c->AllocObject(soa.Self()));
- ASSERT_TRUE(obj3.Get() != nullptr);
+ ASSERT_TRUE(obj3 != nullptr);
const IRTSegmentState cookie = kIRTFirstSegment;
@@ -282,15 +282,15 @@
StackHandleScope<5> hs(soa.Self());
ASSERT_TRUE(c != nullptr);
Handle<mirror::Object> obj0 = hs.NewHandle(c->AllocObject(soa.Self()));
- ASSERT_TRUE(obj0.Get() != nullptr);
+ ASSERT_TRUE(obj0 != nullptr);
Handle<mirror::Object> obj1 = hs.NewHandle(c->AllocObject(soa.Self()));
- ASSERT_TRUE(obj1.Get() != nullptr);
+ ASSERT_TRUE(obj1 != nullptr);
Handle<mirror::Object> obj2 = hs.NewHandle(c->AllocObject(soa.Self()));
- ASSERT_TRUE(obj2.Get() != nullptr);
+ ASSERT_TRUE(obj2 != nullptr);
Handle<mirror::Object> obj3 = hs.NewHandle(c->AllocObject(soa.Self()));
- ASSERT_TRUE(obj3.Get() != nullptr);
+ ASSERT_TRUE(obj3 != nullptr);
Handle<mirror::Object> obj4 = hs.NewHandle(c->AllocObject(soa.Self()));
- ASSERT_TRUE(obj4.Get() != nullptr);
+ ASSERT_TRUE(obj4 != nullptr);
std::string error_msg;
@@ -491,7 +491,7 @@
StackHandleScope<1> hs(soa.Self());
ASSERT_TRUE(c != nullptr);
Handle<mirror::Object> obj0 = hs.NewHandle(c->AllocObject(soa.Self()));
- ASSERT_TRUE(obj0.Get() != nullptr);
+ ASSERT_TRUE(obj0 != nullptr);
std::string error_msg;
IndirectReferenceTable irt(kTableMax,
diff --git a/runtime/intern_table_test.cc b/runtime/intern_table_test.cc
index 3991d65..f0d0260 100644
--- a/runtime/intern_table_test.cc
+++ b/runtime/intern_table_test.cc
@@ -36,10 +36,10 @@
Handle<mirror::String> foo_3(
hs.NewHandle(mirror::String::AllocFromModifiedUtf8(soa.Self(), "foo")));
Handle<mirror::String> bar(hs.NewHandle(intern_table.InternStrong(3, "bar")));
- ASSERT_TRUE(foo_1.Get() != nullptr);
- ASSERT_TRUE(foo_2.Get() != nullptr);
- ASSERT_TRUE(foo_3.Get() != nullptr);
- ASSERT_TRUE(bar.Get() != nullptr);
+ ASSERT_TRUE(foo_1 != nullptr);
+ ASSERT_TRUE(foo_2 != nullptr);
+ ASSERT_TRUE(foo_3 != nullptr);
+ ASSERT_TRUE(bar != nullptr);
EXPECT_EQ(foo_1.Get(), foo_2.Get());
EXPECT_TRUE(foo_1->Equals("foo"));
EXPECT_TRUE(foo_2->Equals("foo"));
@@ -204,9 +204,9 @@
Handle<mirror::String> foo(hs.NewHandle(intern_table.InternStrong(3, "foo")));
Handle<mirror::String> bar(hs.NewHandle(intern_table.InternStrong(3, "bar")));
Handle<mirror::String> foobar(hs.NewHandle(intern_table.InternStrong(6, "foobar")));
- ASSERT_TRUE(foo.Get() != nullptr);
- ASSERT_TRUE(bar.Get() != nullptr);
- ASSERT_TRUE(foobar.Get() != nullptr);
+ ASSERT_TRUE(foo != nullptr);
+ ASSERT_TRUE(bar != nullptr);
+ ASSERT_TRUE(foobar != nullptr);
ASSERT_TRUE(foo->Equals("foo"));
ASSERT_TRUE(bar->Equals("bar"));
ASSERT_TRUE(foobar->Equals("foobar"));
diff --git a/runtime/interpreter/interpreter_common.cc b/runtime/interpreter/interpreter_common.cc
index 28bcb97..8978bfd 100644
--- a/runtime/interpreter/interpreter_common.cc
+++ b/runtime/interpreter/interpreter_common.cc
@@ -519,7 +519,7 @@
}
}
-template<bool is_range, bool do_access_check>
+template<bool is_range>
bool DoInvokePolymorphic(Thread* self,
ShadowFrame& shadow_frame,
const Instruction* inst,
@@ -539,10 +539,10 @@
// was symbolically invoked in bytecode (say MethodHandle.invoke or MethodHandle.invokeExact)
// and not the method that we'll dispatch to in the end.
StackHandleScope<5> hs(self);
- Handle<mirror::MethodHandleImpl> method_handle(hs.NewHandle(
- ObjPtr<mirror::MethodHandleImpl>::DownCast(
+ Handle<mirror::MethodHandle> method_handle(hs.NewHandle(
+ ObjPtr<mirror::MethodHandle>::DownCast(
MakeObjPtr(shadow_frame.GetVRegReference(vRegC)))));
- if (UNLIKELY(method_handle.Get() == nullptr)) {
+ if (UNLIKELY(method_handle == nullptr)) {
// Note that the invoke type is kVirtual here because a call to a signature
// polymorphic method is shaped like a virtual call at the bytecode level.
ThrowNullPointerExceptionForMethodAccess(invoke_method_idx, InvokeType::kVirtual);
@@ -564,7 +564,7 @@
hs.NewHandle<mirror::ClassLoader>(caller_class->GetClassLoader()))));
// This implies we couldn't resolve one or more types in this method handle.
- if (UNLIKELY(callsite_type.Get() == nullptr)) {
+ if (UNLIKELY(callsite_type == nullptr)) {
CHECK(self->IsExceptionPending());
return false;
}
@@ -584,31 +584,300 @@
// VRegC is the register holding the method handle. Arguments passed
// to the method handle's target do not include the method handle.
uint32_t first_arg = inst->VRegC_4rcc() + 1;
- return DoInvokePolymorphic<is_range, do_access_check>(self,
- invoke_method,
- shadow_frame,
- method_handle,
- callsite_type,
- args /* unused */,
- first_arg,
- result);
+ return DoInvokePolymorphic<is_range>(self,
+ invoke_method,
+ shadow_frame,
+ method_handle,
+ callsite_type,
+ args /* unused */,
+ first_arg,
+ result);
} else {
// Get the register arguments for the invoke.
inst->GetVarArgs(args, inst_data);
// Drop the first register which is the method handle performing the invoke.
memmove(args, args + 1, sizeof(args[0]) * (Instruction::kMaxVarArgRegs - 1));
args[Instruction::kMaxVarArgRegs - 1] = 0;
- return DoInvokePolymorphic<is_range, do_access_check>(self,
- invoke_method,
- shadow_frame,
- method_handle,
- callsite_type,
- args,
- args[0],
- result);
+ return DoInvokePolymorphic<is_range>(self,
+ invoke_method,
+ shadow_frame,
+ method_handle,
+ callsite_type,
+ args,
+ args[0],
+ result);
}
}
+static ObjPtr<mirror::CallSite> InvokeBootstrapMethod(Thread* self,
+ ShadowFrame& shadow_frame,
+ uint32_t call_site_idx)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ ArtMethod* referrer = shadow_frame.GetMethod();
+ const DexFile* dex_file = referrer->GetDexFile();
+ const DexFile::CallSiteIdItem& csi = dex_file->GetCallSiteId(call_site_idx);
+
+ StackHandleScope<9> hs(self);
+ Handle<mirror::ClassLoader> class_loader(hs.NewHandle(referrer->GetClassLoader()));
+ Handle<mirror::DexCache> dex_cache(hs.NewHandle(referrer->GetDexCache()));
+
+ CallSiteArrayValueIterator it(*dex_file, csi);
+ uint32_t method_handle_idx = static_cast<uint32_t>(it.GetJavaValue().i);
+ ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
+ Handle<mirror::MethodHandle>
+ bootstrap(hs.NewHandle(class_linker->ResolveMethodHandle(method_handle_idx, referrer)));
+ if (bootstrap.IsNull()) {
+ DCHECK(self->IsExceptionPending());
+ return nullptr;
+ }
+ Handle<mirror::MethodType> bootstrap_method_type = hs.NewHandle(bootstrap->GetMethodType());
+ it.Next();
+
+ DCHECK_EQ(static_cast<size_t>(bootstrap->GetMethodType()->GetPTypes()->GetLength()), it.Size());
+ const size_t num_bootstrap_vregs = bootstrap->GetMethodType()->NumberOfVRegs();
+
+ // Set-up a shadow frame for invoking the bootstrap method handle.
+ ShadowFrameAllocaUniquePtr bootstrap_frame =
+ CREATE_SHADOW_FRAME(num_bootstrap_vregs, nullptr, referrer, shadow_frame.GetDexPC());
+ ScopedStackedShadowFramePusher pusher(
+ self, bootstrap_frame.get(), StackedShadowFrameType::kShadowFrameUnderConstruction);
+ size_t vreg = 0;
+
+ // The first parameter is a MethodHandles lookup instance.
+ {
+ Handle<mirror::Class> lookup_class(hs.NewHandle(bootstrap->GetTargetClass()));
+ ObjPtr<mirror::MethodHandlesLookup> lookup =
+ mirror::MethodHandlesLookup::Create(self, lookup_class);
+ if (lookup.IsNull()) {
+ DCHECK(self->IsExceptionPending());
+ return nullptr;
+ }
+ bootstrap_frame->SetVRegReference(vreg++, lookup.Ptr());
+ }
+
+ // The second parameter is the name to lookup.
+ {
+ dex::StringIndex name_idx(static_cast<uint32_t>(it.GetJavaValue().i));
+ ObjPtr<mirror::String> name = class_linker->ResolveString(*dex_file, name_idx, dex_cache);
+ if (name.IsNull()) {
+ DCHECK(self->IsExceptionPending());
+ return nullptr;
+ }
+ bootstrap_frame->SetVRegReference(vreg++, name.Ptr());
+ }
+ it.Next();
+
+ // The third parameter is the method type associated with the name.
+ uint32_t method_type_idx = static_cast<uint32_t>(it.GetJavaValue().i);
+ Handle<mirror::MethodType>
+ method_type(hs.NewHandle(class_linker->ResolveMethodType(*dex_file,
+ method_type_idx,
+ dex_cache,
+ class_loader)));
+ if (method_type.IsNull()) {
+ DCHECK(self->IsExceptionPending());
+ return nullptr;
+ }
+ bootstrap_frame->SetVRegReference(vreg++, method_type.Get());
+ it.Next();
+
+ // Append remaining arguments (if any).
+ while (it.HasNext()) {
+ const jvalue& jvalue = it.GetJavaValue();
+ switch (it.GetValueType()) {
+ case EncodedArrayValueIterator::ValueType::kBoolean:
+ case EncodedArrayValueIterator::ValueType::kByte:
+ case EncodedArrayValueIterator::ValueType::kChar:
+ case EncodedArrayValueIterator::ValueType::kShort:
+ case EncodedArrayValueIterator::ValueType::kInt:
+ bootstrap_frame->SetVReg(vreg, jvalue.i);
+ vreg += 1;
+ break;
+ case EncodedArrayValueIterator::ValueType::kLong:
+ bootstrap_frame->SetVRegLong(vreg, jvalue.j);
+ vreg += 2;
+ break;
+ case EncodedArrayValueIterator::ValueType::kFloat:
+ bootstrap_frame->SetVRegFloat(vreg, jvalue.f);
+ vreg += 1;
+ break;
+ case EncodedArrayValueIterator::ValueType::kDouble:
+ bootstrap_frame->SetVRegDouble(vreg, jvalue.d);
+ vreg += 2;
+ break;
+ case EncodedArrayValueIterator::ValueType::kMethodType: {
+ uint32_t idx = static_cast<uint32_t>(jvalue.i);
+ ObjPtr<mirror::MethodType> ref =
+ class_linker->ResolveMethodType(*dex_file, idx, dex_cache, class_loader);
+ if (ref.IsNull()) {
+ DCHECK(self->IsExceptionPending());
+ return nullptr;
+ }
+ bootstrap_frame->SetVRegReference(vreg, ref.Ptr());
+ vreg += 1;
+ break;
+ }
+ case EncodedArrayValueIterator::ValueType::kMethodHandle: {
+ uint32_t idx = static_cast<uint32_t>(jvalue.i);
+ ObjPtr<mirror::MethodHandle> ref =
+ class_linker->ResolveMethodHandle(idx, referrer);
+ if (ref.IsNull()) {
+ DCHECK(self->IsExceptionPending());
+ return nullptr;
+ }
+ bootstrap_frame->SetVRegReference(vreg, ref.Ptr());
+ vreg += 1;
+ break;
+ }
+ case EncodedArrayValueIterator::ValueType::kString: {
+ dex::StringIndex idx(static_cast<uint32_t>(jvalue.i));
+ ObjPtr<mirror::String> ref = class_linker->ResolveString(*dex_file, idx, dex_cache);
+ if (ref.IsNull()) {
+ DCHECK(self->IsExceptionPending());
+ return nullptr;
+ }
+ bootstrap_frame->SetVRegReference(vreg, ref.Ptr());
+ vreg += 1;
+ break;
+ }
+ case EncodedArrayValueIterator::ValueType::kType: {
+ dex::TypeIndex idx(static_cast<uint32_t>(jvalue.i));
+ ObjPtr<mirror::Class> ref =
+ class_linker->ResolveType(*dex_file, idx, dex_cache, class_loader);
+ if (ref.IsNull()) {
+ DCHECK(self->IsExceptionPending());
+ return nullptr;
+ }
+ bootstrap_frame->SetVRegReference(vreg, ref.Ptr());
+ vreg += 1;
+ break;
+ }
+ case EncodedArrayValueIterator::ValueType::kNull:
+ bootstrap_frame->SetVRegReference(vreg, nullptr);
+ vreg += 1;
+ break;
+ case EncodedArrayValueIterator::ValueType::kField:
+ case EncodedArrayValueIterator::ValueType::kMethod:
+ case EncodedArrayValueIterator::ValueType::kEnum:
+ case EncodedArrayValueIterator::ValueType::kArray:
+ case EncodedArrayValueIterator::ValueType::kAnnotation:
+ // Unreachable based on current EncodedArrayValueIterator::Next().
+ UNREACHABLE();
+ }
+
+ it.Next();
+ }
+
+ // Invoke the bootstrap method handle.
+ JValue result;
+
+ // This array of arguments is unused. DoInvokePolymorphic() operates on either a
+ // an argument array or a range, but always takes an array argument.
+ uint32_t args_unused[Instruction::kMaxVarArgRegs];
+ ArtMethod* invoke_exact =
+ jni::DecodeArtMethod(WellKnownClasses::java_lang_invoke_MethodHandle_invokeExact);
+ bool invoke_success = DoInvokePolymorphic<true /* is_range */>(self,
+ invoke_exact,
+ *bootstrap_frame,
+ bootstrap,
+ bootstrap_method_type,
+ args_unused,
+ 0,
+ &result);
+ if (!invoke_success) {
+ DCHECK(self->IsExceptionPending());
+ return nullptr;
+ }
+
+ Handle<mirror::Object> object(hs.NewHandle(result.GetL()));
+
+ // Check the result is not null.
+ if (UNLIKELY(object.IsNull())) {
+ ThrowNullPointerException("CallSite == null");
+ return nullptr;
+ }
+
+ // Check the result type is a subclass of CallSite.
+ if (UNLIKELY(!object->InstanceOf(mirror::CallSite::StaticClass()))) {
+ ThrowClassCastException(object->GetClass(), mirror::CallSite::StaticClass());
+ return nullptr;
+ }
+
+ Handle<mirror::CallSite> call_site =
+ hs.NewHandle(ObjPtr<mirror::CallSite>::DownCast(ObjPtr<mirror::Object>(result.GetL())));
+
+ // Check the call site target is not null as we're going to invoke it.
+ Handle<mirror::MethodHandle> target = hs.NewHandle(call_site->GetTarget());
+ if (UNLIKELY(target.IsNull())) {
+ ThrowNullPointerException("CallSite target == null");
+ return nullptr;
+ }
+
+ // Check the target method type matches the method type requested.
+ if (UNLIKELY(!target->GetMethodType()->IsExactMatch(method_type.Get()))) {
+ ThrowWrongMethodTypeException(target->GetMethodType(), method_type.Get());
+ return nullptr;
+ }
+
+ return call_site.Get();
+}
+
+template<bool is_range>
+bool DoInvokeCustom(Thread* self,
+ ShadowFrame& shadow_frame,
+ const Instruction* inst,
+ uint16_t inst_data,
+ JValue* result)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ // invoke-custom is not supported in transactions. In transactions
+ // there is a limited set of types supported. invoke-custom allows
+ // running arbitrary code and instantiating arbitrary types.
+ CHECK(!Runtime::Current()->IsActiveTransaction());
+ StackHandleScope<4> hs(self);
+ Handle<mirror::DexCache> dex_cache(hs.NewHandle(shadow_frame.GetMethod()->GetDexCache()));
+ const uint32_t call_site_idx = is_range ? inst->VRegB_3rc() : inst->VRegB_35c();
+ MutableHandle<mirror::CallSite>
+ call_site(hs.NewHandle(dex_cache->GetResolvedCallSite(call_site_idx)));
+ if (call_site.IsNull()) {
+ call_site.Assign(InvokeBootstrapMethod(self, shadow_frame, call_site_idx));
+ if (UNLIKELY(call_site.IsNull())) {
+ CHECK(self->IsExceptionPending());
+ ThrowWrappedBootstrapMethodError("Exception from call site #%u bootstrap method",
+ call_site_idx);
+ result->SetJ(0);
+ return false;
+ }
+ mirror::CallSite* winning_call_site =
+ dex_cache->SetResolvedCallSite(call_site_idx, call_site.Get());
+ call_site.Assign(winning_call_site);
+ }
+
+ // CallSite.java checks the re-assignment of the call site target
+ // when mutating call site targets. We only check the target is
+ // non-null and has the right type during bootstrap method execution.
+ Handle<mirror::MethodHandle> target = hs.NewHandle(call_site->GetTarget());
+ Handle<mirror::MethodType> target_method_type = hs.NewHandle(target->GetMethodType());
+ DCHECK_EQ(static_cast<size_t>(inst->VRegA()), target_method_type->NumberOfVRegs());
+
+ uint32_t args[Instruction::kMaxVarArgRegs];
+ if (is_range) {
+ args[0] = inst->VRegC_3rc();
+ } else {
+ inst->GetVarArgs(args, inst_data);
+ }
+
+ ArtMethod* invoke_exact =
+ jni::DecodeArtMethod(WellKnownClasses::java_lang_invoke_MethodHandle_invokeExact);
+ return DoInvokePolymorphic<is_range>(self,
+ invoke_exact,
+ shadow_frame,
+ target,
+ target_method_type,
+ args,
+ args[0],
+ result);
+}
+
template <bool is_range>
inline void CopyRegisters(ShadowFrame& caller_frame,
ShadowFrame* callee_frame,
@@ -975,17 +1244,24 @@
EXPLICIT_DO_CALL_TEMPLATE_DECL(true, true);
#undef EXPLICIT_DO_CALL_TEMPLATE_DECL
-// Explicit DoInvokePolymorphic template function declarations.
-#define EXPLICIT_DO_INVOKE_POLYMORPHIC_TEMPLATE_DECL(_is_range, _do_assignability_check) \
- template REQUIRES_SHARED(Locks::mutator_lock_) \
- bool DoInvokePolymorphic<_is_range, _do_assignability_check>( \
- Thread* self, ShadowFrame& shadow_frame, const Instruction* inst, \
+// Explicit DoInvokeCustom template function declarations.
+#define EXPLICIT_DO_INVOKE_CUSTOM_TEMPLATE_DECL(_is_range) \
+ template REQUIRES_SHARED(Locks::mutator_lock_) \
+ bool DoInvokeCustom<_is_range>( \
+ Thread* self, ShadowFrame& shadow_frame, const Instruction* inst, \
uint16_t inst_data, JValue* result)
+EXPLICIT_DO_INVOKE_CUSTOM_TEMPLATE_DECL(false);
+EXPLICIT_DO_INVOKE_CUSTOM_TEMPLATE_DECL(true);
+#undef EXPLICIT_DO_INVOKE_CUSTOM_TEMPLATE_DECL
-EXPLICIT_DO_INVOKE_POLYMORPHIC_TEMPLATE_DECL(false, false);
-EXPLICIT_DO_INVOKE_POLYMORPHIC_TEMPLATE_DECL(false, true);
-EXPLICIT_DO_INVOKE_POLYMORPHIC_TEMPLATE_DECL(true, false);
-EXPLICIT_DO_INVOKE_POLYMORPHIC_TEMPLATE_DECL(true, true);
+// Explicit DoInvokePolymorphic template function declarations.
+#define EXPLICIT_DO_INVOKE_POLYMORPHIC_TEMPLATE_DECL(_is_range) \
+ template REQUIRES_SHARED(Locks::mutator_lock_) \
+ bool DoInvokePolymorphic<_is_range>( \
+ Thread* self, ShadowFrame& shadow_frame, const Instruction* inst, \
+ uint16_t inst_data, JValue* result)
+EXPLICIT_DO_INVOKE_POLYMORPHIC_TEMPLATE_DECL(false);
+EXPLICIT_DO_INVOKE_POLYMORPHIC_TEMPLATE_DECL(true);
#undef EXPLICIT_DO_INVOKE_POLYMORPHIC_TEMPLATE_DECL
// Explicit DoFilledNewArray template function declarations.
diff --git a/runtime/interpreter/interpreter_common.h b/runtime/interpreter/interpreter_common.h
index 7ef3508..6b22af9 100644
--- a/runtime/interpreter/interpreter_common.h
+++ b/runtime/interpreter/interpreter_common.h
@@ -40,9 +40,11 @@
#include "entrypoints/entrypoint_utils-inl.h"
#include "handle_scope-inl.h"
#include "jit/jit.h"
+#include "mirror/call_site.h"
#include "mirror/class-inl.h"
#include "mirror/dex_cache.h"
#include "mirror/method.h"
+#include "mirror/method_handles_lookup.h"
#include "mirror/object-inl.h"
#include "mirror/object_array-inl.h"
#include "mirror/string-inl.h"
@@ -154,13 +156,21 @@
}
// Performs a signature polymorphic invoke (invoke-polymorphic/invoke-polymorphic-range).
-template<bool is_range, bool do_access_check>
+template<bool is_range>
bool DoInvokePolymorphic(Thread* self,
ShadowFrame& shadow_frame,
const Instruction* inst,
uint16_t inst_data,
JValue* result);
+// Performs a custom invoke (invoke-custom/invoke-custom-range).
+template<bool is_range>
+bool DoInvokeCustom(Thread* self,
+ ShadowFrame& shadow_frame,
+ const Instruction* inst,
+ uint16_t inst_data,
+ JValue* result);
+
// Handles invoke-virtual-quick and invoke-virtual-quick-range instructions.
// Returns true on success, otherwise throws an exception and returns false.
template<bool is_range>
diff --git a/runtime/interpreter/interpreter_switch_impl.cc b/runtime/interpreter/interpreter_switch_impl.cc
index a77a3fc..b191dd7 100644
--- a/runtime/interpreter/interpreter_switch_impl.cc
+++ b/runtime/interpreter/interpreter_switch_impl.cc
@@ -1524,7 +1524,7 @@
case Instruction::INVOKE_POLYMORPHIC: {
PREAMBLE();
DCHECK(Runtime::Current()->IsMethodHandlesEnabled());
- bool success = DoInvokePolymorphic<false, do_access_check>(
+ bool success = DoInvokePolymorphic<false /* is_range */>(
self, shadow_frame, inst, inst_data, &result_register);
POSSIBLY_HANDLE_PENDING_EXCEPTION(!success, Next_4xx);
break;
@@ -1532,11 +1532,27 @@
case Instruction::INVOKE_POLYMORPHIC_RANGE: {
PREAMBLE();
DCHECK(Runtime::Current()->IsMethodHandlesEnabled());
- bool success = DoInvokePolymorphic<true, do_access_check>(
+ bool success = DoInvokePolymorphic<true /* is_range */>(
self, shadow_frame, inst, inst_data, &result_register);
POSSIBLY_HANDLE_PENDING_EXCEPTION(!success, Next_4xx);
break;
}
+ case Instruction::INVOKE_CUSTOM: {
+ PREAMBLE();
+ DCHECK(Runtime::Current()->IsMethodHandlesEnabled());
+ bool success = DoInvokeCustom<false /* is_range */>(
+ self, shadow_frame, inst, inst_data, &result_register);
+ POSSIBLY_HANDLE_PENDING_EXCEPTION(!success, Next_3xx);
+ break;
+ }
+ case Instruction::INVOKE_CUSTOM_RANGE: {
+ PREAMBLE();
+ DCHECK(Runtime::Current()->IsMethodHandlesEnabled());
+ bool success = DoInvokeCustom<true /* is_range */>(
+ self, shadow_frame, inst, inst_data, &result_register);
+ POSSIBLY_HANDLE_PENDING_EXCEPTION(!success, Next_3xx);
+ break;
+ }
case Instruction::NEG_INT:
PREAMBLE();
shadow_frame.SetVReg(
@@ -2315,7 +2331,7 @@
break;
case Instruction::UNUSED_3E ... Instruction::UNUSED_43:
case Instruction::UNUSED_F3 ... Instruction::UNUSED_F9:
- case Instruction::UNUSED_FC ... Instruction::UNUSED_FF:
+ case Instruction::UNUSED_FE ... Instruction::UNUSED_FF:
case Instruction::UNUSED_79:
case Instruction::UNUSED_7A:
UnexpectedOpcode(inst, shadow_frame);
diff --git a/runtime/interpreter/unstarted_runtime.cc b/runtime/interpreter/unstarted_runtime.cc
index 545cc1a..ae2a978 100644
--- a/runtime/interpreter/unstarted_runtime.cc
+++ b/runtime/interpreter/unstarted_runtime.cc
@@ -124,7 +124,7 @@
const std::string& method_name, bool initialize_class,
bool abort_if_not_found)
REQUIRES_SHARED(Locks::mutator_lock_) {
- CHECK(className.Get() != nullptr);
+ CHECK(className != nullptr);
std::string descriptor(DotToDescriptor(className->ToModifiedUtf8().c_str()));
ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
@@ -239,7 +239,7 @@
Handle<mirror::Class> h_klass(hs.NewHandle(klass));
// Check that it's not null.
- if (h_klass.Get() == nullptr) {
+ if (h_klass == nullptr) {
AbortTransactionOrFail(self, "Class reference is null for newInstance");
return;
}
@@ -263,7 +263,7 @@
auto* cons = h_klass->FindDeclaredDirectMethod("<init>", "()V", cl->GetImagePointerSize());
if (cons != nullptr) {
Handle<mirror::Object> h_obj(hs.NewHandle(klass->AllocObject(self)));
- CHECK(h_obj.Get() != nullptr); // We don't expect OOM at compile-time.
+ CHECK(h_obj != nullptr); // We don't expect OOM at compile-time.
EnterInterpreterFromInvoke(self, cons, h_obj.Get(), nullptr, nullptr);
if (!self->IsExceptionPending()) {
result->SetL(h_obj.Get());
@@ -542,7 +542,7 @@
// Create byte array for content.
Handle<mirror::ByteArray> h_array(hs.NewHandle(mirror::ByteArray::Alloc(self, map_size)));
- if (h_array.Get() == nullptr) {
+ if (h_array == nullptr) {
AbortTransactionOrFail(self, "Could not find/create byte array class");
return;
}
@@ -556,7 +556,7 @@
runtime->GetClassLinker()->FindClass(self,
"Ljava/io/ByteArrayInputStream;",
ScopedNullHandle<mirror::ClassLoader>())));
- if (h_class.Get() == nullptr) {
+ if (h_class == nullptr) {
AbortTransactionOrFail(self, "Could not find ByteArrayInputStream class");
return;
}
@@ -566,7 +566,7 @@
}
Handle<mirror::Object> h_obj(hs.NewHandle(h_class->AllocObject(self)));
- if (h_obj.Get() == nullptr) {
+ if (h_obj == nullptr) {
AbortTransactionOrFail(self, "Could not allocate ByteArrayInputStream object");
return;
}
@@ -800,7 +800,7 @@
StackHandleScope<4> hs(self);
Handle<mirror::String> h_key(
hs.NewHandle(reinterpret_cast<mirror::String*>(shadow_frame->GetVRegReference(arg_offset))));
- if (h_key.Get() == nullptr) {
+ if (h_key == nullptr) {
AbortTransactionOrFail(self, "getProperty key was null");
return;
}
@@ -815,7 +815,7 @@
class_linker->FindClass(self,
"Ljava/lang/AndroidHardcodedSystemProperties;",
ScopedNullHandle<mirror::ClassLoader>())));
- if (h_props_class.Get() == nullptr) {
+ if (h_props_class == nullptr) {
AbortTransactionOrFail(self, "Could not find AndroidHardcodedSystemProperties");
return;
}
@@ -837,7 +837,7 @@
ObjPtr<mirror::Object> props = static_properties->GetObject(h_props_class.Get());
Handle<mirror::ObjectArray<mirror::ObjectArray<mirror::String>>> h_2string_array(hs.NewHandle(
props->AsObjectArray<mirror::ObjectArray<mirror::String>>()));
- if (h_2string_array.Get() == nullptr) {
+ if (h_2string_array == nullptr) {
AbortTransactionOrFail(self, "Field %s is null", kAndroidHardcodedSystemPropertiesFieldName);
return;
}
@@ -849,7 +849,7 @@
hs.NewHandle<mirror::ObjectArray<mirror::String>>(nullptr));
for (int32_t i = 0; i < prop_count; ++i) {
h_string_array.Assign(h_2string_array->Get(i));
- if (h_string_array.Get() == nullptr ||
+ if (h_string_array == nullptr ||
h_string_array->GetLength() != 2 ||
h_string_array->Get(0) == nullptr) {
AbortTransactionOrFail(self,
@@ -897,11 +897,13 @@
REQUIRES_SHARED(Locks::mutator_lock_) {
for (const std::string& allowed_caller : allowed_call_stack) {
if (shadow_frame->GetLink() == nullptr) {
+ LOG(ERROR) << "Link is unexpectedly null";
return false;
}
std::string found_caller = ArtMethod::PrettyMethod(shadow_frame->GetLink()->GetMethod());
if (allowed_caller != found_caller) {
+ LOG(ERROR) << "Non-match: " << allowed_caller << " vs " << found_caller;
return false;
}
@@ -924,7 +926,7 @@
StackHandleScope<2> hs(self);
Handle<mirror::Class> h_class(hs.NewHandle(klass));
Handle<mirror::Object> h_obj(hs.NewHandle(h_class->AllocObject(self)));
- if (h_obj.Get() != nullptr) {
+ if (h_obj != nullptr) {
ArtMethod* init_method = h_class->FindDirectMethod(
"<init>", "()V", class_linker->GetImagePointerSize());
if (init_method == nullptr) {
@@ -955,6 +957,59 @@
}
}
+void UnstartedRuntime::UnstartedThreadCurrentThread(
+ Thread* self, ShadowFrame* shadow_frame, JValue* result, size_t arg_offset ATTRIBUTE_UNUSED) {
+ if (CheckCallers(shadow_frame,
+ { "void java.lang.Thread.init(java.lang.ThreadGroup, java.lang.Runnable, "
+ "java.lang.String, long)",
+ "void java.lang.Thread.<init>()",
+ "void java.util.logging.LogManager$Cleaner.<init>("
+ "java.util.logging.LogManager)" })) {
+ // Whitelist LogManager$Cleaner, which is an unstarted Thread (for a shutdown hook). The
+ // Thread constructor only asks for the current thread to set up defaults and add the
+ // thread as unstarted to the ThreadGroup. A faked-up main thread peer is good enough for
+ // these purposes.
+ Runtime::Current()->InitThreadGroups(self);
+ jobject main_peer =
+ self->CreateCompileTimePeer(self->GetJniEnv(),
+ "main",
+ false,
+ Runtime::Current()->GetMainThreadGroup());
+ if (main_peer == nullptr) {
+ AbortTransactionOrFail(self, "Failed allocating peer");
+ return;
+ }
+
+ result->SetL(self->DecodeJObject(main_peer));
+ self->GetJniEnv()->DeleteLocalRef(main_peer);
+ } else {
+ AbortTransactionOrFail(self,
+ "Thread.currentThread() does not support %s",
+ GetImmediateCaller(shadow_frame).c_str());
+ }
+}
+
+void UnstartedRuntime::UnstartedThreadGetNativeState(
+ Thread* self, ShadowFrame* shadow_frame, JValue* result, size_t arg_offset ATTRIBUTE_UNUSED) {
+ if (CheckCallers(shadow_frame,
+ { "java.lang.Thread$State java.lang.Thread.getState()",
+ "java.lang.ThreadGroup java.lang.Thread.getThreadGroup()",
+ "void java.lang.Thread.init(java.lang.ThreadGroup, java.lang.Runnable, "
+ "java.lang.String, long)",
+ "void java.lang.Thread.<init>()",
+ "void java.util.logging.LogManager$Cleaner.<init>("
+ "java.util.logging.LogManager)" })) {
+ // Whitelist reading the state of the "main" thread when creating another (unstarted) thread
+ // for LogManager. Report the thread as "new" (it really only counts that it isn't terminated).
+ constexpr int32_t kJavaRunnable = 1;
+ result->SetI(kJavaRunnable);
+ } else {
+ AbortTransactionOrFail(self,
+ "Thread.getNativeState() does not support %s",
+ GetImmediateCaller(shadow_frame).c_str());
+ }
+}
+
void UnstartedRuntime::UnstartedMathCeil(
Thread* self ATTRIBUTE_UNUSED, ShadowFrame* shadow_frame, JValue* result, size_t arg_offset) {
result->SetD(ceil(shadow_frame->GetVRegDouble(arg_offset)));
diff --git a/runtime/interpreter/unstarted_runtime_list.h b/runtime/interpreter/unstarted_runtime_list.h
index 96b35e4..929b747 100644
--- a/runtime/interpreter/unstarted_runtime_list.h
+++ b/runtime/interpreter/unstarted_runtime_list.h
@@ -66,6 +66,8 @@
V(StringFactoryNewStringFromString, "java.lang.String java.lang.StringFactory.newStringFromString(java.lang.String)") \
V(StringFastSubstring, "java.lang.String java.lang.String.fastSubstring(int, int)") \
V(StringToCharArray, "char[] java.lang.String.toCharArray()") \
+ V(ThreadCurrentThread, "java.lang.Thread java.lang.Thread.currentThread()") \
+ V(ThreadGetNativeState, "int java.lang.Thread.nativeGetStatus(boolean)") \
V(UnsafeCompareAndSwapLong, "boolean sun.misc.Unsafe.compareAndSwapLong(java.lang.Object, long, long, long)") \
V(UnsafeCompareAndSwapObject, "boolean sun.misc.Unsafe.compareAndSwapObject(java.lang.Object, long, java.lang.Object, java.lang.Object)") \
V(UnsafeGetObjectVolatile, "java.lang.Object sun.misc.Unsafe.getObjectVolatile(java.lang.Object, long)") \
diff --git a/runtime/interpreter/unstarted_runtime_test.cc b/runtime/interpreter/unstarted_runtime_test.cc
index 31be587..98a17e4 100644
--- a/runtime/interpreter/unstarted_runtime_test.cc
+++ b/runtime/interpreter/unstarted_runtime_test.cc
@@ -960,7 +960,7 @@
class_linker->FindClass(self,
"Lsun/misc/FloatingDecimal;",
ScopedNullHandle<mirror::ClassLoader>()));
- ASSERT_TRUE(floating_decimal.Get() != nullptr);
+ ASSERT_TRUE(floating_decimal != nullptr);
ASSERT_TRUE(class_linker->EnsureInitialized(self, floating_decimal, true, true));
ArtMethod* caller_method = floating_decimal->FindDeclaredDirectMethod(
@@ -1014,7 +1014,7 @@
class_linker->FindClass(self,
"Ljava/lang/Double;",
ScopedNullHandle<mirror::ClassLoader>()));
- ASSERT_TRUE(double_class.Get() != nullptr);
+ ASSERT_TRUE(double_class != nullptr);
ASSERT_TRUE(class_linker->EnsureInitialized(self, double_class, true, true));
ArtMethod* method = double_class->FindDeclaredDirectMethod("toString",
@@ -1039,5 +1039,50 @@
ShadowFrame::DeleteDeoptimizedFrame(shadow_frame);
}
+TEST_F(UnstartedRuntimeTest, ThreadCurrentThread) {
+ Thread* self = Thread::Current();
+ ScopedObjectAccess soa(self);
+
+ JValue result;
+ ShadowFrame* shadow_frame = ShadowFrame::CreateDeoptimizedFrame(10, nullptr, nullptr, 0);
+
+ StackHandleScope<1> hs(self);
+ ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
+ Handle<mirror::Class> thread_class = hs.NewHandle(
+ class_linker->FindClass(self, "Ljava/lang/Thread;", ScopedNullHandle<mirror::ClassLoader>()));
+ ASSERT_TRUE(thread_class.Get() != nullptr);
+ ASSERT_TRUE(class_linker->EnsureInitialized(self, thread_class, true, true));
+
+ // Negative test. In general, currentThread should fail (as we should not leak a peer that will
+ // be recreated at runtime).
+ PrepareForAborts();
+
+ {
+ Transaction transaction;
+ Runtime::Current()->EnterTransactionMode(&transaction);
+ UnstartedThreadCurrentThread(self, shadow_frame, &result, 0);
+ Runtime::Current()->ExitTransactionMode();
+ ASSERT_TRUE(self->IsExceptionPending());
+ ASSERT_TRUE(transaction.IsAborted());
+ self->ClearException();
+ }
+
+ ShadowFrame::DeleteDeoptimizedFrame(shadow_frame);
+}
+
+TEST_F(UnstartedRuntimeTest, LogManager) {
+ Thread* self = Thread::Current();
+ ScopedObjectAccess soa(self);
+
+ StackHandleScope<1> hs(self);
+ ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
+ Handle<mirror::Class> log_manager_class = hs.NewHandle(
+ class_linker->FindClass(self,
+ "Ljava/util/logging/LogManager;",
+ ScopedNullHandle<mirror::ClassLoader>()));
+ ASSERT_TRUE(log_manager_class.Get() != nullptr);
+ ASSERT_TRUE(class_linker->EnsureInitialized(self, log_manager_class, true, true));
+}
+
} // namespace interpreter
} // namespace art
diff --git a/runtime/jdwp/object_registry.cc b/runtime/jdwp/object_registry.cc
index 4615574..bd7251b 100644
--- a/runtime/jdwp/object_registry.cc
+++ b/runtime/jdwp/object_registry.cc
@@ -57,7 +57,7 @@
// Template instantiations must be declared below.
template<class T>
JDWP::ObjectId ObjectRegistry::Add(Handle<T> obj_h) {
- if (obj_h.Get() == nullptr) {
+ if (obj_h == nullptr) {
return 0;
}
return InternalAdd(obj_h);
@@ -76,7 +76,7 @@
template<class T>
JDWP::ObjectId ObjectRegistry::InternalAdd(Handle<T> obj_h) {
- CHECK(obj_h.Get() != nullptr);
+ CHECK(obj_h != nullptr);
Thread* const self = Thread::Current();
self->AssertNoPendingException();
diff --git a/runtime/jit/jit_code_cache.cc b/runtime/jit/jit_code_cache.cc
index f5151b5..60ab275 100644
--- a/runtime/jit/jit_code_cache.cc
+++ b/runtime/jit/jit_code_cache.cc
@@ -556,12 +556,13 @@
// Flush data cache, as compiled code references literals in it.
FlushDataCache(reinterpret_cast<char*>(roots_data),
reinterpret_cast<char*>(roots_data + data_size));
- // Flush caches before we remove write permission because on some ARMv8 hardware,
- // flushing caches require write permissions.
+ // Flush caches before we remove write permission because some ARMv8 Qualcomm kernels may
+ // trigger a segfault if a page fault occurs when requesting a cache maintenance operation.
+ // This is a kernel bug that we need to work around until affected devices (e.g. Nexus 5X and
+ // 6P) stop being supported or their kernels are fixed.
//
- // For reference, here are kernel patches discussing about this issue:
- // https://android.googlesource.com/kernel/msm/%2B/0e7f7bcc3fc87489cda5aa6aff8ce40eed912279
- // https://patchwork.kernel.org/patch/9047921/
+ // For reference, this behavior is caused by this commit:
+ // https://android.googlesource.com/kernel/msm/+/3fbe6bc28a6b9939d0650f2f17eb5216c719950c
FlushInstructionCache(reinterpret_cast<char*>(code_ptr),
reinterpret_cast<char*>(code_ptr + code_size));
DCHECK(!Runtime::Current()->IsAotCompiler());
@@ -685,6 +686,10 @@
// shouldn't be used since it is no longer logically in the jit code cache.
// TODO We should add DCHECKS that validate that the JIT is paused when this method is entered.
void JitCodeCache::MoveObsoleteMethod(ArtMethod* old_method, ArtMethod* new_method) {
+ // Native methods have no profiling info and need no special handling from the JIT code cache.
+ if (old_method->IsNative()) {
+ return;
+ }
MutexLock mu(Thread::Current(), lock_);
// Update ProfilingInfo to the new one and remove it from the old_method.
if (old_method->GetProfilingInfo(kRuntimePointerSize) != nullptr) {
diff --git a/runtime/jit/profiling_info.cc b/runtime/jit/profiling_info.cc
index 405280d..7d80d2c 100644
--- a/runtime/jit/profiling_info.cc
+++ b/runtime/jit/profiling_info.cc
@@ -77,20 +77,18 @@
}
InlineCache* ProfilingInfo::GetInlineCache(uint32_t dex_pc) {
- InlineCache* cache = nullptr;
// TODO: binary search if array is too long.
for (size_t i = 0; i < number_of_inline_caches_; ++i) {
if (cache_[i].dex_pc_ == dex_pc) {
- cache = &cache_[i];
- break;
+ return &cache_[i];
}
}
- return cache;
+ LOG(FATAL) << "No inline cache found for " << ArtMethod::PrettyMethod(method_) << "@" << dex_pc;
+ UNREACHABLE();
}
void ProfilingInfo::AddInvokeInfo(uint32_t dex_pc, mirror::Class* cls) {
InlineCache* cache = GetInlineCache(dex_pc);
- CHECK(cache != nullptr) << ArtMethod::PrettyMethod(method_) << "@" << dex_pc;
for (size_t i = 0; i < InlineCache::kIndividualCacheSize; ++i) {
mirror::Class* existing = cache->classes_[i].Read();
if (existing == cls) {
diff --git a/runtime/jit/profiling_info.h b/runtime/jit/profiling_info.h
index 9fbf2e3..1c58a83 100644
--- a/runtime/jit/profiling_info.h
+++ b/runtime/jit/profiling_info.h
@@ -73,7 +73,9 @@
return method_;
}
- InlineCache* GetInlineCache(uint32_t dex_pc);
+ // Mutator lock only required for debugging output.
+ InlineCache* GetInlineCache(uint32_t dex_pc)
+ REQUIRES_SHARED(Locks::mutator_lock_);
bool IsMethodBeingCompiled(bool osr) const {
return osr
diff --git a/runtime/jni_internal.cc b/runtime/jni_internal.cc
index 3c641b0..547b5b8 100644
--- a/runtime/jni_internal.cc
+++ b/runtime/jni_internal.cc
@@ -196,7 +196,7 @@
StackHandleScope<2> hs(soa.Self());
Handle<mirror::Class> c(
hs.NewHandle(EnsureInitialized(soa.Self(), soa.Decode<mirror::Class>(jni_class))));
- if (c.Get() == nullptr) {
+ if (c == nullptr) {
return nullptr;
}
ArtField* field = nullptr;
diff --git a/runtime/jobject_comparator.cc b/runtime/jobject_comparator.cc
index 443f095..4c45e38 100644
--- a/runtime/jobject_comparator.cc
+++ b/runtime/jobject_comparator.cc
@@ -34,9 +34,9 @@
StackHandleScope<2> hs(soa.Self());
Handle<mirror::Object> obj1(hs.NewHandle(soa.Decode<mirror::Object>(jobj1)));
Handle<mirror::Object> obj2(hs.NewHandle(soa.Decode<mirror::Object>(jobj2)));
- if (obj1.Get() == nullptr) {
+ if (obj1 == nullptr) {
return true;
- } else if (obj2.Get() == nullptr) {
+ } else if (obj2 == nullptr) {
return false;
}
// Sort by class...
diff --git a/runtime/method_handles.cc b/runtime/method_handles.cc
index 99886e5..6ecfd8c 100644
--- a/runtime/method_handles.cc
+++ b/runtime/method_handles.cc
@@ -220,7 +220,7 @@
StackHandleScope<2> hs(Thread::Current());
Handle<mirror::Class> h_to(hs.NewHandle(to));
Handle<mirror::Object> h_obj(hs.NewHandle(src_value.GetL()));
- if (h_obj.Get() != nullptr && !to->IsAssignableFrom(h_obj->GetClass())) {
+ if (h_obj != nullptr && !to->IsAssignableFrom(h_obj->GetClass())) {
ThrowClassCastException(h_to.Get(), h_obj->GetClass());
return false;
}
@@ -555,7 +555,7 @@
Handle<mirror::MethodType> callee_type,
Thread* self,
ShadowFrame& shadow_frame,
- Handle<mirror::MethodHandleImpl> receiver,
+ Handle<mirror::MethodHandle> receiver,
const uint32_t (&args)[Instruction::kMaxVarArgRegs],
uint32_t first_arg,
JValue* result)
@@ -599,7 +599,7 @@
// Something went wrong while creating the emulated stack frame, we should
// throw the pending exception.
- if (sf.Get() == nullptr) {
+ if (sf == nullptr) {
DCHECK(self->IsExceptionPending());
return false;
}
@@ -645,7 +645,7 @@
template <bool is_range>
bool DoInvokePolymorphicUnchecked(Thread* self,
ShadowFrame& shadow_frame,
- Handle<mirror::MethodHandleImpl> method_handle,
+ Handle<mirror::MethodHandle> method_handle,
Handle<mirror::MethodType> callsite_type,
const uint32_t (&args)[Instruction::kMaxVarArgRegs],
uint32_t first_arg,
@@ -780,7 +780,6 @@
}
// Helper for setters in invoke-polymorphic.
-template <bool do_assignability_check>
inline bool DoFieldPutForInvokePolymorphic(Thread* self,
ShadowFrame& shadow_frame,
ObjPtr<mirror::Object>& obj,
@@ -788,30 +787,33 @@
Primitive::Type field_type,
const JValue& value)
REQUIRES_SHARED(Locks::mutator_lock_) {
- static const bool kTransaction = false;
+ DCHECK(!Runtime::Current()->IsActiveTransaction());
+ static const bool kTransaction = false; // Not in a transaction.
+ static const bool kAssignabilityCheck = false; // No access check.
switch (field_type) {
case Primitive::kPrimBoolean:
- return DoFieldPutCommon<Primitive::kPrimBoolean, do_assignability_check, kTransaction>(
- self, shadow_frame, obj, field, value);
+ return
+ DoFieldPutCommon<Primitive::kPrimBoolean, kAssignabilityCheck, kTransaction>(
+ self, shadow_frame, obj, field, value);
case Primitive::kPrimByte:
- return DoFieldPutCommon<Primitive::kPrimByte, do_assignability_check, kTransaction>(
+ return DoFieldPutCommon<Primitive::kPrimByte, kAssignabilityCheck, kTransaction>(
self, shadow_frame, obj, field, value);
case Primitive::kPrimChar:
- return DoFieldPutCommon<Primitive::kPrimChar, do_assignability_check, kTransaction>(
+ return DoFieldPutCommon<Primitive::kPrimChar, kAssignabilityCheck, kTransaction>(
self, shadow_frame, obj, field, value);
case Primitive::kPrimShort:
- return DoFieldPutCommon<Primitive::kPrimShort, do_assignability_check, kTransaction>(
+ return DoFieldPutCommon<Primitive::kPrimShort, kAssignabilityCheck, kTransaction>(
self, shadow_frame, obj, field, value);
case Primitive::kPrimInt:
case Primitive::kPrimFloat:
- return DoFieldPutCommon<Primitive::kPrimInt, do_assignability_check, kTransaction>(
+ return DoFieldPutCommon<Primitive::kPrimInt, kAssignabilityCheck, kTransaction>(
self, shadow_frame, obj, field, value);
case Primitive::kPrimLong:
case Primitive::kPrimDouble:
- return DoFieldPutCommon<Primitive::kPrimLong, do_assignability_check, kTransaction>(
+ return DoFieldPutCommon<Primitive::kPrimLong, kAssignabilityCheck, kTransaction>(
self, shadow_frame, obj, field, value);
case Primitive::kPrimNot:
- return DoFieldPutCommon<Primitive::kPrimNot, do_assignability_check, kTransaction>(
+ return DoFieldPutCommon<Primitive::kPrimNot, kAssignabilityCheck, kTransaction>(
self, shadow_frame, obj, field, value);
case Primitive::kPrimVoid:
LOG(FATAL) << "Unreachable: " << field_type;
@@ -855,10 +857,10 @@
return field_value;
}
-template <bool is_range, bool do_conversions, bool do_assignability_check>
+template <bool is_range, bool do_conversions>
bool DoInvokePolymorphicFieldAccess(Thread* self,
ShadowFrame& shadow_frame,
- Handle<mirror::MethodHandleImpl> method_handle,
+ Handle<mirror::MethodHandle> method_handle,
Handle<mirror::MethodType> callsite_type,
const uint32_t (&args)[Instruction::kMaxVarArgRegs],
uint32_t first_arg,
@@ -903,12 +905,7 @@
return false;
}
ObjPtr<mirror::Object> obj = shadow_frame.GetVRegReference(obj_reg);
- return DoFieldPutForInvokePolymorphic<do_assignability_check>(self,
- shadow_frame,
- obj,
- field,
- field_type,
- value);
+ return DoFieldPutForInvokePolymorphic(self, shadow_frame, obj, field, field_type, value);
}
case mirror::MethodHandle::kStaticPut: {
ObjPtr<mirror::Object> obj = GetAndInitializeDeclaringClass(self, field);
@@ -922,12 +919,7 @@
DCHECK(self->IsExceptionPending());
return false;
}
- return DoFieldPutForInvokePolymorphic<do_assignability_check>(self,
- shadow_frame,
- obj,
- field,
- field_type,
- value);
+ return DoFieldPutForInvokePolymorphic(self, shadow_frame, obj, field, field_type, value);
}
default:
LOG(FATAL) << "Unreachable: " << handle_kind;
@@ -935,10 +927,10 @@
}
}
-template <bool is_range, bool do_assignability_check>
+template <bool is_range>
static inline bool DoInvokePolymorphicNonExact(Thread* self,
ShadowFrame& shadow_frame,
- Handle<mirror::MethodHandleImpl> method_handle,
+ Handle<mirror::MethodHandle> method_handle,
Handle<mirror::MethodType> callsite_type,
const uint32_t (&args)[Instruction::kMaxVarArgRegs],
uint32_t first_arg,
@@ -959,7 +951,7 @@
if (IsFieldAccess(handle_kind)) {
if (UNLIKELY(callsite_type->IsExactMatch(handle_type.Ptr()))) {
const bool do_convert = false;
- return DoInvokePolymorphicFieldAccess<is_range, do_convert, do_assignability_check>(
+ return DoInvokePolymorphicFieldAccess<is_range, do_convert>(
self,
shadow_frame,
method_handle,
@@ -969,7 +961,7 @@
result);
} else {
const bool do_convert = true;
- return DoInvokePolymorphicFieldAccess<is_range, do_convert, do_assignability_check>(
+ return DoInvokePolymorphicFieldAccess<is_range, do_convert>(
self,
shadow_frame,
method_handle,
@@ -999,10 +991,10 @@
}
}
-template <bool is_range, bool do_assignability_check>
+template <bool is_range>
bool DoInvokePolymorphicExact(Thread* self,
ShadowFrame& shadow_frame,
- Handle<mirror::MethodHandleImpl> method_handle,
+ Handle<mirror::MethodHandle> method_handle,
Handle<mirror::MethodType> callsite_type,
const uint32_t (&args)[Instruction::kMaxVarArgRegs],
uint32_t first_arg,
@@ -1018,13 +1010,13 @@
ThrowWrongMethodTypeException(nominal_type.Ptr(), callsite_type.Get());
return false;
}
- return DoInvokePolymorphicNonExact<is_range, do_assignability_check>(self,
- shadow_frame,
- method_handle,
- callsite_type,
- args,
- first_arg,
- result);
+ return DoInvokePolymorphicNonExact<is_range>(self,
+ shadow_frame,
+ method_handle,
+ callsite_type,
+ args,
+ first_arg,
+ result);
}
ObjPtr<mirror::MethodType> handle_type(method_handle->GetMethodType());
@@ -1036,7 +1028,7 @@
const mirror::MethodHandle::Kind handle_kind = method_handle->GetHandleKind();
if (IsFieldAccess(handle_kind)) {
const bool do_convert = false;
- return DoInvokePolymorphicFieldAccess<is_range, do_convert, do_assignability_check>(
+ return DoInvokePolymorphicFieldAccess<is_range, do_convert>(
self,
shadow_frame,
method_handle,
@@ -1057,51 +1049,49 @@
} // namespace
-template <bool is_range, bool do_assignability_check>
+template <bool is_range>
bool DoInvokePolymorphic(Thread* self,
ArtMethod* invoke_method,
ShadowFrame& shadow_frame,
- Handle<mirror::MethodHandleImpl> method_handle,
+ Handle<mirror::MethodHandle> method_handle,
Handle<mirror::MethodType> callsite_type,
const uint32_t (&args)[Instruction::kMaxVarArgRegs],
uint32_t first_arg,
JValue* result)
REQUIRES_SHARED(Locks::mutator_lock_) {
if (IsMethodHandleInvokeExact(invoke_method)) {
- return DoInvokePolymorphicExact<is_range, do_assignability_check>(self,
- shadow_frame,
- method_handle,
- callsite_type,
- args,
- first_arg,
- result);
+ return DoInvokePolymorphicExact<is_range>(self,
+ shadow_frame,
+ method_handle,
+ callsite_type,
+ args,
+ first_arg,
+ result);
} else {
- return DoInvokePolymorphicNonExact<is_range, do_assignability_check>(self,
- shadow_frame,
- method_handle,
- callsite_type,
- args,
- first_arg,
- result);
+ return DoInvokePolymorphicNonExact<is_range>(self,
+ shadow_frame,
+ method_handle,
+ callsite_type,
+ args,
+ first_arg,
+ result);
}
}
-#define EXPLICIT_DO_INVOKE_POLYMORPHIC_TEMPLATE_DECL(_is_range, _do_assignability_check) \
-template REQUIRES_SHARED(Locks::mutator_lock_) \
-bool DoInvokePolymorphic<_is_range, _do_assignability_check>( \
- Thread* self, \
- ArtMethod* invoke_method, \
- ShadowFrame& shadow_frame, \
- Handle<mirror::MethodHandleImpl> method_handle, \
- Handle<mirror::MethodType> callsite_type, \
- const uint32_t (&args)[Instruction::kMaxVarArgRegs], \
- uint32_t first_arg, \
- JValue* result)
+#define EXPLICIT_DO_INVOKE_POLYMORPHIC_TEMPLATE_DECL(_is_range) \
+ template REQUIRES_SHARED(Locks::mutator_lock_) \
+ bool DoInvokePolymorphic<_is_range>( \
+ Thread* self, \
+ ArtMethod* invoke_method, \
+ ShadowFrame& shadow_frame, \
+ Handle<mirror::MethodHandle> method_handle, \
+ Handle<mirror::MethodType> callsite_type, \
+ const uint32_t (&args)[Instruction::kMaxVarArgRegs], \
+ uint32_t first_arg, \
+ JValue* result)
-EXPLICIT_DO_INVOKE_POLYMORPHIC_TEMPLATE_DECL(true, true);
-EXPLICIT_DO_INVOKE_POLYMORPHIC_TEMPLATE_DECL(true, false);
-EXPLICIT_DO_INVOKE_POLYMORPHIC_TEMPLATE_DECL(false, true);
-EXPLICIT_DO_INVOKE_POLYMORPHIC_TEMPLATE_DECL(false, false);
+EXPLICIT_DO_INVOKE_POLYMORPHIC_TEMPLATE_DECL(true);
+EXPLICIT_DO_INVOKE_POLYMORPHIC_TEMPLATE_DECL(false);
#undef EXPLICIT_DO_INVOKE_POLYMORPHIC_TEMPLATE_DECL
} // namespace art
diff --git a/runtime/method_handles.h b/runtime/method_handles.h
index 734d7c7..5bea0ab 100644
--- a/runtime/method_handles.h
+++ b/runtime/method_handles.h
@@ -27,7 +27,7 @@
namespace art {
namespace mirror {
- class MethodHandleImpl;
+ class MethodHandle;
class MethodType;
} // mirror
@@ -202,11 +202,11 @@
size_t arg_index_;
};
-template <bool is_range, bool do_assignability_check>
+template <bool is_range>
bool DoInvokePolymorphic(Thread* self,
ArtMethod* invoke_method,
ShadowFrame& shadow_frame,
- Handle<mirror::MethodHandleImpl> method_handle,
+ Handle<mirror::MethodHandle> method_handle,
Handle<mirror::MethodType> callsite_type,
const uint32_t (&args)[Instruction::kMaxVarArgRegs],
uint32_t first_arg,
diff --git a/runtime/mirror/array.cc b/runtime/mirror/array.cc
index cc548b9..f283ec3 100644
--- a/runtime/mirror/array.cc
+++ b/runtime/mirror/array.cc
@@ -52,7 +52,7 @@
Array::Alloc<true>(self, array_class.Get(), array_length,
array_class->GetComponentSizeShift(),
Runtime::Current()->GetHeap()->GetCurrentAllocator())));
- if (UNLIKELY(new_array.Get() == nullptr)) {
+ if (UNLIKELY(new_array == nullptr)) {
CHECK(self->IsExceptionPending());
return nullptr;
}
@@ -98,14 +98,14 @@
StackHandleScope<1> hs(self);
MutableHandle<mirror::Class> array_class(
hs.NewHandle(class_linker->FindArrayClass(self, &element_class_ptr)));
- if (UNLIKELY(array_class.Get() == nullptr)) {
+ if (UNLIKELY(array_class == nullptr)) {
CHECK(self->IsExceptionPending());
return nullptr;
}
for (int32_t i = 1; i < dimensions->GetLength(); ++i) {
ObjPtr<mirror::Class> array_class_ptr = array_class.Get();
array_class.Assign(class_linker->FindArrayClass(self, &array_class_ptr));
- if (UNLIKELY(array_class.Get() == nullptr)) {
+ if (UNLIKELY(array_class == nullptr)) {
CHECK(self->IsExceptionPending());
return nullptr;
}
diff --git a/runtime/mirror/call_site.cc b/runtime/mirror/call_site.cc
new file mode 100644
index 0000000..eb613df
--- /dev/null
+++ b/runtime/mirror/call_site.cc
@@ -0,0 +1,52 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "call_site.h"
+
+#include "class-inl.h"
+#include "gc_root-inl.h"
+
+namespace art {
+namespace mirror {
+
+GcRoot<mirror::Class> CallSite::static_class_;
+
+mirror::CallSite* CallSite::Create(Thread* const self, Handle<MethodHandle> target) {
+ StackHandleScope<1> hs(self);
+ Handle<mirror::CallSite> cs(
+ hs.NewHandle(ObjPtr<CallSite>::DownCast(StaticClass()->AllocObject(self))));
+ CHECK(!Runtime::Current()->IsActiveTransaction());
+ cs->SetFieldObject<false>(TargetOffset(), target.Get());
+ return cs.Get();
+}
+
+void CallSite::SetClass(Class* klass) {
+ CHECK(static_class_.IsNull()) << static_class_.Read() << " " << klass;
+ CHECK(klass != nullptr);
+ static_class_ = GcRoot<Class>(klass);
+}
+
+void CallSite::ResetClass() {
+ CHECK(!static_class_.IsNull());
+ static_class_ = GcRoot<Class>(nullptr);
+}
+
+void CallSite::VisitRoots(RootVisitor* visitor) {
+ static_class_.VisitRootIfNonNull(visitor, RootInfo(kRootStickyClass));
+}
+
+} // namespace mirror
+} // namespace art
diff --git a/runtime/mirror/call_site.h b/runtime/mirror/call_site.h
new file mode 100644
index 0000000..db244a5
--- /dev/null
+++ b/runtime/mirror/call_site.h
@@ -0,0 +1,64 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#ifndef ART_RUNTIME_MIRROR_CALL_SITE_H_
+#define ART_RUNTIME_MIRROR_CALL_SITE_H_
+
+#include "mirror/method_handle_impl.h"
+#include "utils.h"
+
+namespace art {
+
+struct CallSiteOffsets;
+
+namespace mirror {
+
+// C++ mirror of java.lang.invoke.CallSite
+class MANAGED CallSite : public Object {
+ public:
+ static mirror::CallSite* Create(Thread* const self,
+ Handle<MethodHandle> method_handle)
+ REQUIRES_SHARED(Locks::mutator_lock_) REQUIRES(!Roles::uninterruptible_);
+
+ static mirror::Class* StaticClass() REQUIRES_SHARED(Locks::mutator_lock_) {
+ return static_class_.Read();
+ }
+
+ MethodHandle* GetTarget() REQUIRES_SHARED(Locks::mutator_lock_) {
+ return GetFieldObject<MethodHandle>(TargetOffset());
+ }
+
+ static void SetClass(Class* klass) REQUIRES_SHARED(Locks::mutator_lock_);
+ static void ResetClass() REQUIRES_SHARED(Locks::mutator_lock_);
+ static void VisitRoots(RootVisitor* visitor) REQUIRES_SHARED(Locks::mutator_lock_);
+
+ private:
+ static inline MemberOffset TargetOffset() {
+ return MemberOffset(OFFSETOF_MEMBER(CallSite, target_));
+ }
+
+ HeapReference<mirror::MethodHandle> target_;
+
+ static GcRoot<mirror::Class> static_class_; // java.lang.invoke.CallSite.class
+
+ friend struct art::CallSiteOffsets; // for verifying offset information
+ DISALLOW_IMPLICIT_CONSTRUCTORS(CallSite);
+};
+
+} // namespace mirror
+} // namespace art
+
+#endif // ART_RUNTIME_MIRROR_CALL_SITE_H_
diff --git a/runtime/mirror/class.cc b/runtime/mirror/class.cc
index f7ff735..9a9a5d8 100644
--- a/runtime/mirror/class.cc
+++ b/runtime/mirror/class.cc
@@ -81,7 +81,7 @@
self->ClearException();
// Allocate the ClassExt
Handle<ClassExt> new_ext(hs.NewHandle(ClassExt::Alloc(self)));
- if (new_ext.Get() == nullptr) {
+ if (new_ext == nullptr) {
// OOM allocating the classExt.
// TODO Should we restore the suppressed exception?
self->AssertPendingOOMException();
@@ -103,7 +103,7 @@
DCHECK(!set || h_this->GetExtData() == new_ext.Get());
CHECK(!ret.IsNull());
// Restore the exception if there was one.
- if (throwable.Get() != nullptr) {
+ if (throwable != nullptr) {
self->SetException(throwable.Get());
}
return ret.Ptr();
@@ -269,10 +269,10 @@
os << "----- " << (IsInterface() ? "interface" : "class") << " "
<< "'" << GetDescriptor(&temp) << "' cl=" << GetClassLoader() << " -----\n",
os << " objectSize=" << SizeOf() << " "
- << "(" << (h_super.Get() != nullptr ? h_super->SizeOf() : -1) << " from super)\n",
+ << "(" << (h_super != nullptr ? h_super->SizeOf() : -1) << " from super)\n",
os << StringPrintf(" access=0x%04x.%04x\n",
GetAccessFlags() >> 16, GetAccessFlags() & kAccJavaFlagsMask);
- if (h_super.Get() != nullptr) {
+ if (h_super != nullptr) {
os << " super='" << h_super->PrettyClass() << "' (cl=" << h_super->GetClassLoader()
<< ")\n";
}
@@ -297,7 +297,7 @@
} else {
// After this point, this may have moved due to GetDirectInterface.
os << " vtable (" << h_this->NumVirtualMethods() << " entries, "
- << (h_super.Get() != nullptr ? h_super->NumVirtualMethods() : 0) << " in super):\n";
+ << (h_super != nullptr ? h_super->NumVirtualMethods() : 0) << " in super):\n";
for (size_t i = 0; i < NumVirtualMethods(); ++i) {
os << StringPrintf(" %2zd: %s\n", i, ArtMethod::PrettyMethod(
h_this->GetVirtualMethodDuringLinking(i, image_pointer_size)).c_str());
@@ -951,8 +951,7 @@
return interfaces->Get(idx);
} else {
dex::TypeIndex type_idx = klass->GetDirectInterfaceTypeIdx(idx);
- ObjPtr<Class> interface = ClassLinker::LookupResolvedType(
- type_idx, klass->GetDexCache(), klass->GetClassLoader());
+ ObjPtr<Class> interface = klass->GetDexCache()->GetResolvedType(type_idx);
return interface;
}
}
@@ -972,7 +971,7 @@
}
ObjPtr<Class> Class::GetCommonSuperClass(Handle<Class> klass) {
- DCHECK(klass.Get() != nullptr);
+ DCHECK(klass != nullptr);
DCHECK(!klass->IsInterface());
DCHECK(!IsInterface());
ObjPtr<Class> common_super_class = this;
@@ -1166,7 +1165,7 @@
constexpr uint32_t kSkipModifiers = kAccMiranda | kAccSynthetic;
StackHandleScope<3> hs(self);
auto h_method_name = hs.NewHandle(name);
- if (UNLIKELY(h_method_name.Get() == nullptr)) {
+ if (UNLIKELY(h_method_name == nullptr)) {
ThrowNullPointerException("name == null");
return nullptr;
}
diff --git a/runtime/mirror/class_ext.cc b/runtime/mirror/class_ext.cc
index efd949e..7270079 100644
--- a/runtime/mirror/class_ext.cc
+++ b/runtime/mirror/class_ext.cc
@@ -58,8 +58,8 @@
Handle<ObjectArray<DexCache>> old_dex_caches(hs.NewHandle(h_this->GetObsoleteDexCaches()));
ClassLinker* cl = Runtime::Current()->GetClassLinker();
size_t new_len;
- if (old_methods.Get() == nullptr) {
- CHECK(old_dex_caches.Get() == nullptr);
+ if (old_methods == nullptr) {
+ CHECK(old_dex_caches == nullptr);
new_len = increase;
} else {
CHECK_EQ(old_methods->GetLength(), old_dex_caches->GetLength());
diff --git a/runtime/mirror/dex_cache-inl.h b/runtime/mirror/dex_cache-inl.h
index bef3ad2..973c8ed 100644
--- a/runtime/mirror/dex_cache-inl.h
+++ b/runtime/mirror/dex_cache-inl.h
@@ -26,6 +26,7 @@
#include "base/logging.h"
#include "gc_root.h"
#include "mirror/class.h"
+#include "mirror/call_site.h"
#include "mirror/method_type.h"
#include "runtime.h"
#include "obj_ptr.h"
@@ -40,22 +41,14 @@
return Class::ComputeClassSize(true, vtable_entries, 0, 0, 0, 0, 0, pointer_size);
}
-inline uint32_t DexCache::StringSlotIndex(dex::StringIndex string_idx) {
+inline mirror::String* DexCache::GetResolvedString(dex::StringIndex string_idx) {
DCHECK_LT(string_idx.index_, GetDexFile()->NumStringIds());
- const uint32_t slot_idx = string_idx.index_ % kDexCacheStringCacheSize;
- DCHECK_LT(slot_idx, NumStrings());
- return slot_idx;
+ return StringDexCachePair::Lookup(GetStrings(), string_idx.index_, NumStrings()).Read();
}
-inline String* DexCache::GetResolvedString(dex::StringIndex string_idx) {
- return GetStrings()[StringSlotIndex(string_idx)].load(
- std::memory_order_relaxed).GetObjectForIndex(string_idx.index_);
-}
-
-inline void DexCache::SetResolvedString(dex::StringIndex string_idx, ObjPtr<String> resolved) {
- DCHECK(resolved != nullptr);
- GetStrings()[StringSlotIndex(string_idx)].store(
- StringDexCachePair(resolved, string_idx.index_), std::memory_order_relaxed);
+inline void DexCache::SetResolvedString(dex::StringIndex string_idx,
+ ObjPtr<mirror::String> resolved) {
+ StringDexCachePair::Assign(GetStrings(), string_idx.index_, resolved.Ptr(), NumStrings());
Runtime* const runtime = Runtime::Current();
if (UNLIKELY(runtime->IsActiveTransaction())) {
DCHECK(runtime->IsAotCompiler());
@@ -66,74 +59,83 @@
}
inline void DexCache::ClearString(dex::StringIndex string_idx) {
+ const uint32_t slot_idx = string_idx.index_ % NumStrings();
DCHECK(Runtime::Current()->IsAotCompiler());
- uint32_t slot_idx = StringSlotIndex(string_idx);
StringDexCacheType* slot = &GetStrings()[slot_idx];
// This is racy but should only be called from the transactional interpreter.
if (slot->load(std::memory_order_relaxed).index == string_idx.index_) {
- StringDexCachePair cleared(nullptr, StringDexCachePair::InvalidIndexForSlot(slot_idx));
+ StringDexCachePair cleared(
+ nullptr,
+ StringDexCachePair::InvalidIndexForSlot(slot_idx));
slot->store(cleared, std::memory_order_relaxed);
}
}
-inline uint32_t DexCache::TypeSlotIndex(dex::TypeIndex type_idx) {
- DCHECK_LT(type_idx.index_, GetDexFile()->NumTypeIds());
- const uint32_t slot_idx = type_idx.index_ % kDexCacheTypeCacheSize;
- DCHECK_LT(slot_idx, NumResolvedTypes());
- return slot_idx;
-}
-
inline Class* DexCache::GetResolvedType(dex::TypeIndex type_idx) {
// It is theorized that a load acquire is not required since obtaining the resolved class will
// always have an address dependency or a lock.
- return GetResolvedTypes()[TypeSlotIndex(type_idx)].load(
- std::memory_order_relaxed).GetObjectForIndex(type_idx.index_);
+ DCHECK_LT(type_idx.index_, NumResolvedTypes());
+ return GetResolvedTypes()[type_idx.index_].Read();
}
inline void DexCache::SetResolvedType(dex::TypeIndex type_idx, ObjPtr<Class> resolved) {
- DCHECK(resolved != nullptr);
+ DCHECK_LT(type_idx.index_, NumResolvedTypes()); // NOTE: Unchecked, i.e. not throwing AIOOB.
// TODO default transaction support.
// Use a release store for SetResolvedType. This is done to prevent other threads from seeing a
// class but not necessarily seeing the loaded members like the static fields array.
// See b/32075261.
- GetResolvedTypes()[TypeSlotIndex(type_idx)].store(
- TypeDexCachePair(resolved, type_idx.index_), std::memory_order_release);
+ reinterpret_cast<Atomic<GcRoot<mirror::Class>>&>(GetResolvedTypes()[type_idx.index_]).
+ StoreRelease(GcRoot<Class>(resolved));
// TODO: Fine-grained marking, so that we don't need to go through all arrays in full.
Runtime::Current()->GetHeap()->WriteBarrierEveryFieldOf(this);
}
-inline void DexCache::ClearResolvedType(dex::TypeIndex type_idx) {
- DCHECK(Runtime::Current()->IsAotCompiler());
- uint32_t slot_idx = TypeSlotIndex(type_idx);
- TypeDexCacheType* slot = &GetResolvedTypes()[slot_idx];
- // This is racy but should only be called from the single-threaded ImageWriter and tests.
- if (slot->load(std::memory_order_relaxed).index == type_idx.index_) {
- TypeDexCachePair cleared(nullptr, TypeDexCachePair::InvalidIndexForSlot(slot_idx));
- slot->store(cleared, std::memory_order_relaxed);
- }
-}
-
-inline uint32_t DexCache::MethodTypeSlotIndex(uint32_t proto_idx) {
- DCHECK(Runtime::Current()->IsMethodHandlesEnabled());
- DCHECK_LT(proto_idx, GetDexFile()->NumProtoIds());
- const uint32_t slot_idx = proto_idx % kDexCacheMethodTypeCacheSize;
- DCHECK_LT(slot_idx, NumResolvedMethodTypes());
- return slot_idx;
-}
-
inline MethodType* DexCache::GetResolvedMethodType(uint32_t proto_idx) {
- return GetResolvedMethodTypes()[MethodTypeSlotIndex(proto_idx)].load(
- std::memory_order_relaxed).GetObjectForIndex(proto_idx);
+ DCHECK(Runtime::Current()->IsMethodHandlesEnabled());
+ DCHECK_LT(proto_idx, GetDexFile()->NumProtoIds());
+ return MethodTypeDexCachePair::Lookup(
+ GetResolvedMethodTypes(), proto_idx, NumResolvedMethodTypes()).Read();
}
inline void DexCache::SetResolvedMethodType(uint32_t proto_idx, MethodType* resolved) {
- DCHECK(resolved != nullptr);
- GetResolvedMethodTypes()[MethodTypeSlotIndex(proto_idx)].store(
- MethodTypeDexCachePair(resolved, proto_idx), std::memory_order_relaxed);
+ DCHECK(Runtime::Current()->IsMethodHandlesEnabled());
+ DCHECK_LT(proto_idx, GetDexFile()->NumProtoIds());
+
+ MethodTypeDexCachePair::Assign(GetResolvedMethodTypes(), proto_idx, resolved,
+ NumResolvedMethodTypes());
// TODO: Fine-grained marking, so that we don't need to go through all arrays in full.
Runtime::Current()->GetHeap()->WriteBarrierEveryFieldOf(this);
}
+inline CallSite* DexCache::GetResolvedCallSite(uint32_t call_site_idx) {
+ DCHECK(Runtime::Current()->IsMethodHandlesEnabled());
+ DCHECK_LT(call_site_idx, GetDexFile()->NumCallSiteIds());
+ GcRoot<mirror::CallSite>& target = GetResolvedCallSites()[call_site_idx];
+ Atomic<GcRoot<mirror::CallSite>>& ref =
+ reinterpret_cast<Atomic<GcRoot<mirror::CallSite>>&>(target);
+ return ref.LoadSequentiallyConsistent().Read();
+}
+
+inline CallSite* DexCache::SetResolvedCallSite(uint32_t call_site_idx, CallSite* call_site) {
+ DCHECK(Runtime::Current()->IsMethodHandlesEnabled());
+ DCHECK_LT(call_site_idx, GetDexFile()->NumCallSiteIds());
+
+ GcRoot<mirror::CallSite> null_call_site(nullptr);
+ GcRoot<mirror::CallSite> candidate(call_site);
+ GcRoot<mirror::CallSite>& target = GetResolvedCallSites()[call_site_idx];
+
+ // The first assignment for a given call site wins.
+ Atomic<GcRoot<mirror::CallSite>>& ref =
+ reinterpret_cast<Atomic<GcRoot<mirror::CallSite>>&>(target);
+ if (ref.CompareExchangeStrongSequentiallyConsistent(null_call_site, candidate)) {
+ // TODO: Fine-grained marking, so that we don't need to go through all arrays in full.
+ Runtime::Current()->GetHeap()->WriteBarrierEveryFieldOf(this);
+ return call_site;
+ } else {
+ return target.Read();
+ }
+}
+
inline ArtField* DexCache::GetResolvedField(uint32_t field_idx, PointerSize ptr_size) {
DCHECK_EQ(Runtime::Current()->GetClassLinker()->GetImagePointerSize(), ptr_size);
DCHECK_LT(field_idx, NumResolvedFields()); // NOTE: Unchecked, i.e. not throwing AIOOB.
@@ -226,51 +228,67 @@
VisitInstanceFieldsReferences<kVerifyFlags, kReadBarrierOption>(klass, visitor);
// Visit arrays after.
if (kVisitNativeRoots) {
- VisitDexCachePairs<String, kReadBarrierOption, Visitor>(
+ VisitDexCachePairs<mirror::String, kReadBarrierOption, Visitor>(
GetStrings(), NumStrings(), visitor);
- VisitDexCachePairs<Class, kReadBarrierOption, Visitor>(
- GetResolvedTypes(), NumResolvedTypes(), visitor);
+ GcRoot<mirror::Class>* resolved_types = GetResolvedTypes();
+ for (size_t i = 0, num_types = NumResolvedTypes(); i != num_types; ++i) {
+ visitor.VisitRootIfNonNull(resolved_types[i].AddressWithoutBarrier());
+ }
- VisitDexCachePairs<MethodType, kReadBarrierOption, Visitor>(
+ VisitDexCachePairs<mirror::MethodType, kReadBarrierOption, Visitor>(
GetResolvedMethodTypes(), NumResolvedMethodTypes(), visitor);
+
+ GcRoot<mirror::CallSite>* resolved_call_sites = GetResolvedCallSites();
+ for (size_t i = 0, num_call_sites = NumResolvedCallSites(); i != num_call_sites; ++i) {
+ visitor.VisitRootIfNonNull(resolved_call_sites[i].AddressWithoutBarrier());
+ }
}
}
template <ReadBarrierOption kReadBarrierOption, typename Visitor>
-inline void DexCache::FixupStrings(StringDexCacheType* dest, const Visitor& visitor) {
- StringDexCacheType* src = GetStrings();
+inline void DexCache::FixupStrings(mirror::StringDexCacheType* dest, const Visitor& visitor) {
+ mirror::StringDexCacheType* src = GetStrings();
for (size_t i = 0, count = NumStrings(); i < count; ++i) {
StringDexCachePair source = src[i].load(std::memory_order_relaxed);
- String* ptr = source.object.Read<kReadBarrierOption>();
- String* new_source = visitor(ptr);
+ mirror::String* ptr = source.object.Read<kReadBarrierOption>();
+ mirror::String* new_source = visitor(ptr);
source.object = GcRoot<String>(new_source);
dest[i].store(source, std::memory_order_relaxed);
}
}
template <ReadBarrierOption kReadBarrierOption, typename Visitor>
-inline void DexCache::FixupResolvedTypes(TypeDexCacheType* dest, const Visitor& visitor) {
- TypeDexCacheType* src = GetResolvedTypes();
+inline void DexCache::FixupResolvedTypes(GcRoot<mirror::Class>* dest, const Visitor& visitor) {
+ GcRoot<mirror::Class>* src = GetResolvedTypes();
for (size_t i = 0, count = NumResolvedTypes(); i < count; ++i) {
- TypeDexCachePair source = src[i].load(std::memory_order_relaxed);
- Class* ptr = source.object.Read<kReadBarrierOption>();
- Class* new_source = visitor(ptr);
- source.object = GcRoot<Class>(new_source);
+ mirror::Class* source = src[i].Read<kReadBarrierOption>();
+ mirror::Class* new_source = visitor(source);
+ dest[i] = GcRoot<mirror::Class>(new_source);
+ }
+}
+
+template <ReadBarrierOption kReadBarrierOption, typename Visitor>
+inline void DexCache::FixupResolvedMethodTypes(mirror::MethodTypeDexCacheType* dest,
+ const Visitor& visitor) {
+ mirror::MethodTypeDexCacheType* src = GetResolvedMethodTypes();
+ for (size_t i = 0, count = NumResolvedMethodTypes(); i < count; ++i) {
+ MethodTypeDexCachePair source = src[i].load(std::memory_order_relaxed);
+ mirror::MethodType* ptr = source.object.Read<kReadBarrierOption>();
+ mirror::MethodType* new_source = visitor(ptr);
+ source.object = GcRoot<MethodType>(new_source);
dest[i].store(source, std::memory_order_relaxed);
}
}
template <ReadBarrierOption kReadBarrierOption, typename Visitor>
-inline void DexCache::FixupResolvedMethodTypes(MethodTypeDexCacheType* dest,
- const Visitor& visitor) {
- MethodTypeDexCacheType* src = GetResolvedMethodTypes();
- for (size_t i = 0, count = NumResolvedMethodTypes(); i < count; ++i) {
- MethodTypeDexCachePair source = src[i].load(std::memory_order_relaxed);
- MethodType* ptr = source.object.Read<kReadBarrierOption>();
- MethodType* new_source = visitor(ptr);
- source.object = GcRoot<MethodType>(new_source);
- dest[i].store(source, std::memory_order_relaxed);
+inline void DexCache::FixupResolvedCallSites(GcRoot<mirror::CallSite>* dest,
+ const Visitor& visitor) {
+ GcRoot<mirror::CallSite>* src = GetResolvedCallSites();
+ for (size_t i = 0, count = NumResolvedCallSites(); i < count; ++i) {
+ mirror::CallSite* source = src[i].Read<kReadBarrierOption>();
+ mirror::CallSite* new_source = visitor(source);
+ dest[i] = GcRoot<mirror::CallSite>(new_source);
}
}
diff --git a/runtime/mirror/dex_cache.cc b/runtime/mirror/dex_cache.cc
index 3103a92..0f6acab 100644
--- a/runtime/mirror/dex_cache.cc
+++ b/runtime/mirror/dex_cache.cc
@@ -58,8 +58,8 @@
mirror::StringDexCacheType* strings = (dex_file->NumStringIds() == 0u) ? nullptr :
reinterpret_cast<mirror::StringDexCacheType*>(raw_arrays + layout.StringsOffset());
- mirror::TypeDexCacheType* types = (dex_file->NumTypeIds() == 0u) ? nullptr :
- reinterpret_cast<mirror::TypeDexCacheType*>(raw_arrays + layout.TypesOffset());
+ GcRoot<mirror::Class>* types = (dex_file->NumTypeIds() == 0u) ? nullptr :
+ reinterpret_cast<GcRoot<mirror::Class>*>(raw_arrays + layout.TypesOffset());
ArtMethod** methods = (dex_file->NumMethodIds() == 0u) ? nullptr :
reinterpret_cast<ArtMethod**>(raw_arrays + layout.MethodsOffset());
ArtField** fields = (dex_file->NumFieldIds() == 0u) ? nullptr :
@@ -69,10 +69,6 @@
if (dex_file->NumStringIds() < num_strings) {
num_strings = dex_file->NumStringIds();
}
- size_t num_types = mirror::DexCache::kDexCacheTypeCacheSize;
- if (dex_file->NumTypeIds() < num_types) {
- num_types = dex_file->NumTypeIds();
- }
// Note that we allocate the method type dex caches regardless of this flag,
// and we make sure here that they're not used by the runtime. This is in the
@@ -94,6 +90,10 @@
raw_arrays + layout.MethodTypesOffset());
}
+ GcRoot<mirror::CallSite>* call_sites = (dex_file->NumCallSiteIds() == 0)
+ ? nullptr
+ : reinterpret_cast<GcRoot<mirror::CallSite>*>(raw_arrays + layout.CallSitesOffset());
+
DCHECK_ALIGNED(raw_arrays, alignof(mirror::StringDexCacheType)) <<
"Expected raw_arrays to align to StringDexCacheType.";
DCHECK_ALIGNED(layout.StringsOffset(), alignof(mirror::StringDexCacheType)) <<
@@ -108,9 +108,8 @@
CHECK_EQ(strings[i].load(std::memory_order_relaxed).index, 0u);
CHECK(strings[i].load(std::memory_order_relaxed).object.IsNull());
}
- for (size_t i = 0; i < num_types; ++i) {
- CHECK_EQ(types[i].load(std::memory_order_relaxed).index, 0u);
- CHECK(types[i].load(std::memory_order_relaxed).object.IsNull());
+ for (size_t i = 0; i < dex_file->NumTypeIds(); ++i) {
+ CHECK(types[i].IsNull());
}
for (size_t i = 0; i < dex_file->NumMethodIds(); ++i) {
CHECK(mirror::DexCache::GetElementPtrSize(methods, i, image_pointer_size) == nullptr);
@@ -122,13 +121,13 @@
CHECK_EQ(method_types[i].load(std::memory_order_relaxed).index, 0u);
CHECK(method_types[i].load(std::memory_order_relaxed).object.IsNull());
}
+ for (size_t i = 0; i < dex_file->NumCallSiteIds(); ++i) {
+ CHECK(call_sites[i].IsNull());
+ }
}
if (strings != nullptr) {
mirror::StringDexCachePair::Initialize(strings);
}
- if (types != nullptr) {
- mirror::TypeDexCachePair::Initialize(types);
- }
if (method_types != nullptr) {
mirror::MethodTypeDexCachePair::Initialize(method_types);
}
@@ -137,13 +136,15 @@
strings,
num_strings,
types,
- num_types,
+ dex_file->NumTypeIds(),
methods,
dex_file->NumMethodIds(),
fields,
dex_file->NumFieldIds(),
method_types,
num_method_types,
+ call_sites,
+ dex_file->NumCallSiteIds(),
image_pointer_size);
}
@@ -151,7 +152,7 @@
ObjPtr<String> location,
StringDexCacheType* strings,
uint32_t num_strings,
- TypeDexCacheType* resolved_types,
+ GcRoot<Class>* resolved_types,
uint32_t num_resolved_types,
ArtMethod** resolved_methods,
uint32_t num_resolved_methods,
@@ -159,6 +160,8 @@
uint32_t num_resolved_fields,
MethodTypeDexCacheType* resolved_method_types,
uint32_t num_resolved_method_types,
+ GcRoot<CallSite>* resolved_call_sites,
+ uint32_t num_resolved_call_sites,
PointerSize pointer_size) {
CHECK(dex_file != nullptr);
CHECK(location != nullptr);
@@ -167,6 +170,7 @@
CHECK_EQ(num_resolved_methods != 0u, resolved_methods != nullptr);
CHECK_EQ(num_resolved_fields != 0u, resolved_fields != nullptr);
CHECK_EQ(num_resolved_method_types != 0u, resolved_method_types != nullptr);
+ CHECK_EQ(num_resolved_call_sites != 0u, resolved_call_sites != nullptr);
SetDexFile(dex_file);
SetLocation(location);
@@ -175,11 +179,13 @@
SetResolvedMethods(resolved_methods);
SetResolvedFields(resolved_fields);
SetResolvedMethodTypes(resolved_method_types);
+ SetResolvedCallSites(resolved_call_sites);
SetField32<false>(NumStringsOffset(), num_strings);
SetField32<false>(NumResolvedTypesOffset(), num_resolved_types);
SetField32<false>(NumResolvedMethodsOffset(), num_resolved_methods);
SetField32<false>(NumResolvedFieldsOffset(), num_resolved_fields);
SetField32<false>(NumResolvedMethodTypesOffset(), num_resolved_method_types);
+ SetField32<false>(NumResolvedCallSitesOffset(), num_resolved_call_sites);
Runtime* const runtime = Runtime::Current();
if (runtime->HasResolutionMethod()) {
diff --git a/runtime/mirror/dex_cache.h b/runtime/mirror/dex_cache.h
index e68b0c7..10bb5aa 100644
--- a/runtime/mirror/dex_cache.h
+++ b/runtime/mirror/dex_cache.h
@@ -18,14 +18,14 @@
#define ART_RUNTIME_MIRROR_DEX_CACHE_H_
#include "array.h"
-#include "base/bit_utils.h"
+#include "art_field.h"
+#include "class.h"
#include "dex_file_types.h"
#include "object.h"
#include "object_array.h"
namespace art {
-class ArtField;
class ArtMethod;
struct DexCacheOffsets;
class DexFile;
@@ -36,7 +36,7 @@
namespace mirror {
-class Class;
+class CallSite;
class MethodType;
class String;
@@ -61,7 +61,7 @@
// it's always non-null if the id branch succeeds (except for the 0th id).
// Set the initial state for the 0th entry to be {0,1} which is guaranteed to fail
// the lookup id == stored id branch.
- DexCachePair(ObjPtr<T> object, uint32_t index)
+ DexCachePair(T* object, uint32_t index)
: object(object),
index(index) {}
DexCachePair() = default;
@@ -75,28 +75,39 @@
dex_cache[0].store(first_elem, std::memory_order_relaxed);
}
+ static GcRoot<T> Lookup(std::atomic<DexCachePair<T>>* dex_cache,
+ uint32_t idx,
+ uint32_t cache_size) {
+ DCHECK_NE(cache_size, 0u);
+ DexCachePair<T> element = dex_cache[idx % cache_size].load(std::memory_order_relaxed);
+ if (idx != element.index) {
+ return GcRoot<T>(nullptr);
+ }
+
+ DCHECK(!element.object.IsNull());
+ return element.object;
+ }
+
+ static void Assign(std::atomic<DexCachePair<T>>* dex_cache,
+ uint32_t idx,
+ T* object,
+ uint32_t cache_size) {
+ DCHECK_LT(idx % cache_size, cache_size);
+ dex_cache[idx % cache_size].store(
+ DexCachePair<T>(object, idx), std::memory_order_relaxed);
+ }
+
static uint32_t InvalidIndexForSlot(uint32_t slot) {
// Since the cache size is a power of two, 0 will always map to slot 0.
// Use 1 for slot 0 and 0 for all other slots.
return (slot == 0) ? 1u : 0u;
}
-
- T* GetObjectForIndex(uint32_t idx) REQUIRES_SHARED(Locks::mutator_lock_) {
- if (idx != index) {
- return nullptr;
- }
- DCHECK(!object.IsNull());
- return object.Read();
- }
};
-using TypeDexCachePair = DexCachePair<Class>;
-using TypeDexCacheType = std::atomic<TypeDexCachePair>;
-
-using StringDexCachePair = DexCachePair<String>;
+using StringDexCachePair = DexCachePair<mirror::String>;
using StringDexCacheType = std::atomic<StringDexCachePair>;
-using MethodTypeDexCachePair = DexCachePair<MethodType>;
+using MethodTypeDexCachePair = DexCachePair<mirror::MethodType>;
using MethodTypeDexCacheType = std::atomic<MethodTypeDexCachePair>;
// C++ mirror of java.lang.DexCache.
@@ -105,11 +116,6 @@
// Size of java.lang.DexCache.class.
static uint32_t ClassSize(PointerSize pointer_size);
- // Size of type dex cache. Needs to be a power of 2 for entrypoint assumptions to hold.
- static constexpr size_t kDexCacheTypeCacheSize = 1024;
- static_assert(IsPowerOfTwo(kDexCacheTypeCacheSize),
- "Type dex cache size is not a power of 2.");
-
// Size of string dex cache. Needs to be a power of 2 for entrypoint assumptions to hold.
static constexpr size_t kDexCacheStringCacheSize = 1024;
static_assert(IsPowerOfTwo(kDexCacheStringCacheSize),
@@ -121,10 +127,6 @@
static_assert(IsPowerOfTwo(kDexCacheMethodTypeCacheSize),
"MethodType dex cache size is not a power of 2.");
- static constexpr size_t StaticTypeSize() {
- return kDexCacheTypeCacheSize;
- }
-
static constexpr size_t StaticStringSize() {
return kDexCacheStringCacheSize;
}
@@ -155,13 +157,17 @@
REQUIRES_SHARED(Locks::mutator_lock_);
template <ReadBarrierOption kReadBarrierOption = kWithReadBarrier, typename Visitor>
- void FixupResolvedTypes(TypeDexCacheType* dest, const Visitor& visitor)
+ void FixupResolvedTypes(GcRoot<mirror::Class>* dest, const Visitor& visitor)
REQUIRES_SHARED(Locks::mutator_lock_);
template <ReadBarrierOption kReadBarrierOption = kWithReadBarrier, typename Visitor>
void FixupResolvedMethodTypes(MethodTypeDexCacheType* dest, const Visitor& visitor)
REQUIRES_SHARED(Locks::mutator_lock_);
+ template <ReadBarrierOption kReadBarrierOption = kWithReadBarrier, typename Visitor>
+ void FixupResolvedCallSites(GcRoot<mirror::CallSite>* dest, const Visitor& visitor)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
String* GetLocation() REQUIRES_SHARED(Locks::mutator_lock_) {
return GetFieldObject<String>(OFFSET_OF_OBJECT_MEMBER(DexCache, location_));
}
@@ -190,6 +196,10 @@
return OFFSET_OF_OBJECT_MEMBER(DexCache, resolved_method_types_);
}
+ static MemberOffset ResolvedCallSitesOffset() {
+ return OFFSET_OF_OBJECT_MEMBER(DexCache, resolved_call_sites_);
+ }
+
static MemberOffset NumStringsOffset() {
return OFFSET_OF_OBJECT_MEMBER(DexCache, num_strings_);
}
@@ -210,7 +220,11 @@
return OFFSET_OF_OBJECT_MEMBER(DexCache, num_resolved_method_types_);
}
- String* GetResolvedString(dex::StringIndex string_idx) ALWAYS_INLINE
+ static MemberOffset NumResolvedCallSitesOffset() {
+ return OFFSET_OF_OBJECT_MEMBER(DexCache, num_resolved_call_sites_);
+ }
+
+ mirror::String* GetResolvedString(dex::StringIndex string_idx) ALWAYS_INLINE
REQUIRES_SHARED(Locks::mutator_lock_);
void SetResolvedString(dex::StringIndex string_idx, ObjPtr<mirror::String> resolved) ALWAYS_INLINE
@@ -225,8 +239,6 @@
void SetResolvedType(dex::TypeIndex type_idx, ObjPtr<Class> resolved)
REQUIRES_SHARED(Locks::mutator_lock_);
- void ClearResolvedType(dex::TypeIndex type_idx) REQUIRES_SHARED(Locks::mutator_lock_);
-
ALWAYS_INLINE ArtMethod* GetResolvedMethod(uint32_t method_idx, PointerSize ptr_size)
REQUIRES_SHARED(Locks::mutator_lock_);
@@ -245,7 +257,18 @@
MethodType* GetResolvedMethodType(uint32_t proto_idx) REQUIRES_SHARED(Locks::mutator_lock_);
- void SetResolvedMethodType(uint32_t proto_idx, MethodType* resolved) REQUIRES_SHARED(Locks::mutator_lock_);
+ void SetResolvedMethodType(uint32_t proto_idx, MethodType* resolved)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
+ CallSite* GetResolvedCallSite(uint32_t call_site_idx) REQUIRES_SHARED(Locks::mutator_lock_);
+
+ // Attempts to bind |call_site_idx| to the call site |resolved|. The
+ // caller must use the return value in place of |resolved|. This is
+ // because multiple threads can invoke the bootstrap method each
+ // producing a call site, but the method handle invocation on the
+ // call site must be on a common agreed value.
+ CallSite* SetResolvedCallSite(uint32_t call_site_idx, CallSite* resolved) WARN_UNUSED
+ REQUIRES_SHARED(Locks::mutator_lock_);
StringDexCacheType* GetStrings() ALWAYS_INLINE REQUIRES_SHARED(Locks::mutator_lock_) {
return GetFieldPtr64<StringDexCacheType*>(StringsOffset());
@@ -255,11 +278,11 @@
SetFieldPtr<false>(StringsOffset(), strings);
}
- TypeDexCacheType* GetResolvedTypes() ALWAYS_INLINE REQUIRES_SHARED(Locks::mutator_lock_) {
- return GetFieldPtr<TypeDexCacheType*>(ResolvedTypesOffset());
+ GcRoot<Class>* GetResolvedTypes() ALWAYS_INLINE REQUIRES_SHARED(Locks::mutator_lock_) {
+ return GetFieldPtr<GcRoot<Class>*>(ResolvedTypesOffset());
}
- void SetResolvedTypes(TypeDexCacheType* resolved_types)
+ void SetResolvedTypes(GcRoot<Class>* resolved_types)
ALWAYS_INLINE
REQUIRES_SHARED(Locks::mutator_lock_) {
SetFieldPtr<false>(ResolvedTypesOffset(), resolved_types);
@@ -296,6 +319,18 @@
SetFieldPtr<false>(ResolvedMethodTypesOffset(), resolved_method_types);
}
+ GcRoot<CallSite>* GetResolvedCallSites()
+ ALWAYS_INLINE
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ return GetFieldPtr<GcRoot<CallSite>*>(ResolvedCallSitesOffset());
+ }
+
+ void SetResolvedCallSites(GcRoot<CallSite>* resolved_call_sites)
+ ALWAYS_INLINE
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ SetFieldPtr<false>(ResolvedCallSitesOffset(), resolved_call_sites);
+ }
+
size_t NumStrings() REQUIRES_SHARED(Locks::mutator_lock_) {
return GetField32(NumStringsOffset());
}
@@ -316,6 +351,10 @@
return GetField32(NumResolvedMethodTypesOffset());
}
+ size_t NumResolvedCallSites() REQUIRES_SHARED(Locks::mutator_lock_) {
+ return GetField32(NumResolvedCallSitesOffset());
+ }
+
const DexFile* GetDexFile() ALWAYS_INLINE REQUIRES_SHARED(Locks::mutator_lock_) {
return GetFieldPtr<const DexFile*>(OFFSET_OF_OBJECT_MEMBER(DexCache, dex_file_));
}
@@ -324,7 +363,7 @@
SetFieldPtr<false>(OFFSET_OF_OBJECT_MEMBER(DexCache, dex_file_), dex_file);
}
- void SetLocation(ObjPtr<String> location) REQUIRES_SHARED(Locks::mutator_lock_);
+ void SetLocation(ObjPtr<mirror::String> location) REQUIRES_SHARED(Locks::mutator_lock_);
// NOTE: Get/SetElementPtrSize() are intended for working with ArtMethod** and ArtField**
// provided by GetResolvedMethods/Fields() and ArtMethod::GetDexCacheResolvedMethods(),
@@ -341,40 +380,41 @@
ObjPtr<String> location,
StringDexCacheType* strings,
uint32_t num_strings,
- TypeDexCacheType* resolved_types,
+ GcRoot<Class>* resolved_types,
uint32_t num_resolved_types,
ArtMethod** resolved_methods,
uint32_t num_resolved_methods,
ArtField** resolved_fields,
uint32_t num_resolved_fields,
- MethodTypeDexCacheType* resolved_methodtypes,
- uint32_t num_resolved_methodtypes,
+ MethodTypeDexCacheType* resolved_method_types,
+ uint32_t num_resolved_method_types,
+ GcRoot<CallSite>* resolved_call_sites,
+ uint32_t num_resolved_call_sites,
PointerSize pointer_size)
REQUIRES_SHARED(Locks::mutator_lock_);
- uint32_t StringSlotIndex(dex::StringIndex string_idx) REQUIRES_SHARED(Locks::mutator_lock_);
- uint32_t TypeSlotIndex(dex::TypeIndex type_idx) REQUIRES_SHARED(Locks::mutator_lock_);
- uint32_t MethodTypeSlotIndex(uint32_t proto_idx) REQUIRES_SHARED(Locks::mutator_lock_);
-
// Visit instance fields of the dex cache as well as its associated arrays.
template <bool kVisitNativeRoots,
VerifyObjectFlags kVerifyFlags = kDefaultVerifyFlags,
ReadBarrierOption kReadBarrierOption = kWithReadBarrier,
typename Visitor>
- void VisitReferences(ObjPtr<Class> klass, const Visitor& visitor)
+ void VisitReferences(ObjPtr<mirror::Class> klass, const Visitor& visitor)
REQUIRES_SHARED(Locks::mutator_lock_) REQUIRES(Locks::heap_bitmap_lock_);
HeapReference<Object> dex_;
HeapReference<String> location_;
uint64_t dex_file_; // const DexFile*
+ uint64_t resolved_call_sites_; // GcRoot<CallSite>* array with num_resolved_call_sites_
+ // elements.
uint64_t resolved_fields_; // ArtField*, array with num_resolved_fields_ elements.
uint64_t resolved_method_types_; // std::atomic<MethodTypeDexCachePair>* array with
// num_resolved_method_types_ elements.
uint64_t resolved_methods_; // ArtMethod*, array with num_resolved_methods_ elements.
- uint64_t resolved_types_; // TypeDexCacheType*, array with num_resolved_types_ elements.
+ uint64_t resolved_types_; // GcRoot<Class>*, array with num_resolved_types_ elements.
uint64_t strings_; // std::atomic<StringDexCachePair>*, array with num_strings_
// elements.
+ uint32_t num_resolved_call_sites_; // Number of elements in the call_sites_ array.
uint32_t num_resolved_fields_; // Number of elements in the resolved_fields_ array.
uint32_t num_resolved_method_types_; // Number of elements in the resolved_method_types_ array.
uint32_t num_resolved_methods_; // Number of elements in the resolved_methods_ array.
diff --git a/runtime/mirror/dex_cache_test.cc b/runtime/mirror/dex_cache_test.cc
index 5693f67..5a2ab71 100644
--- a/runtime/mirror/dex_cache_test.cc
+++ b/runtime/mirror/dex_cache_test.cc
@@ -47,12 +47,11 @@
soa.Self(),
*java_lang_dex_file_,
Runtime::Current()->GetLinearAlloc())));
- ASSERT_TRUE(dex_cache.Get() != nullptr);
+ ASSERT_TRUE(dex_cache != nullptr);
EXPECT_TRUE(dex_cache->StaticStringSize() == dex_cache->NumStrings()
|| java_lang_dex_file_->NumStringIds() == dex_cache->NumStrings());
- EXPECT_TRUE(dex_cache->StaticTypeSize() == dex_cache->NumResolvedTypes()
- || java_lang_dex_file_->NumTypeIds() == dex_cache->NumResolvedTypes());
+ EXPECT_EQ(java_lang_dex_file_->NumTypeIds(), dex_cache->NumResolvedTypes());
EXPECT_EQ(java_lang_dex_file_->NumMethodIds(), dex_cache->NumResolvedMethods());
EXPECT_EQ(java_lang_dex_file_->NumFieldIds(), dex_cache->NumResolvedFields());
EXPECT_TRUE(dex_cache->StaticMethodTypeSize() == dex_cache->NumResolvedMethodTypes()
@@ -96,10 +95,10 @@
soa.Decode<mirror::ClassLoader>(jclass_loader)));
Handle<mirror::Class> klass1 =
hs.NewHandle(class_linker_->FindClass(soa.Self(), "Lpackage1/Package1;", class_loader));
- ASSERT_TRUE(klass1.Get() != nullptr);
+ ASSERT_TRUE(klass1 != nullptr);
Handle<mirror::Class> klass2 =
hs.NewHandle(class_linker_->FindClass(soa.Self(), "Lpackage2/Package2;", class_loader));
- ASSERT_TRUE(klass2.Get() != nullptr);
+ ASSERT_TRUE(klass2 != nullptr);
EXPECT_EQ(klass1->GetDexCache(), klass2->GetDexCache());
EXPECT_NE(klass1->NumStaticFields(), 0u);
diff --git a/runtime/mirror/emulated_stack_frame.cc b/runtime/mirror/emulated_stack_frame.cc
index 978cc32..be0eac0 100644
--- a/runtime/mirror/emulated_stack_frame.cc
+++ b/runtime/mirror/emulated_stack_frame.cc
@@ -173,13 +173,13 @@
Handle<mirror::ObjectArray<mirror::Object>> references(hs.NewHandle(
mirror::ObjectArray<mirror::Object>::Alloc(self, array_class, refs_size)));
- if (references.Get() == nullptr) {
+ if (references == nullptr) {
DCHECK(self->IsExceptionPending());
return nullptr;
}
Handle<ByteArray> stack_frame(hs.NewHandle(ByteArray::Alloc(self, frame_size)));
- if (stack_frame.Get() == nullptr) {
+ if (stack_frame == nullptr) {
DCHECK(self->IsExceptionPending());
return nullptr;
}
diff --git a/runtime/mirror/field-inl.h b/runtime/mirror/field-inl.h
index c03f20a..2496989 100644
--- a/runtime/mirror/field-inl.h
+++ b/runtime/mirror/field-inl.h
@@ -33,7 +33,7 @@
// Try to resolve type before allocating since this is a thread suspension point.
Handle<mirror::Class> type = hs.NewHandle(field->GetType<true>());
- if (type.Get() == nullptr) {
+ if (type == nullptr) {
if (force_resolve) {
if (kIsDebugBuild) {
self->AssertPendingException();
@@ -49,7 +49,7 @@
}
}
auto ret = hs.NewHandle(ObjPtr<Field>::DownCast(StaticClass()->AllocObject(self)));
- if (UNLIKELY(ret.Get() == nullptr)) {
+ if (UNLIKELY(ret == nullptr)) {
self->AssertPendingOOMException();
return nullptr;
}
diff --git a/runtime/mirror/method_handle_impl.cc b/runtime/mirror/method_handle_impl.cc
index 4f1c448..fa4d25a 100644
--- a/runtime/mirror/method_handle_impl.cc
+++ b/runtime/mirror/method_handle_impl.cc
@@ -28,6 +28,18 @@
return klass;
}
+void MethodHandle::Initialize(uintptr_t art_field_or_method,
+ Kind kind,
+ Handle<MethodType> method_type)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ CHECK(!Runtime::Current()->IsActiveTransaction());
+ SetFieldObject<false>(CachedSpreadInvokerOffset(), nullptr);
+ SetFieldObject<false>(NominalTypeOffset(), nullptr);
+ SetFieldObject<false>(MethodTypeOffset(), method_type.Get());
+ SetField32<false>(HandleKindOffset(), static_cast<uint32_t>(kind));
+ SetField64<false>(ArtFieldOrMethodOffset(), art_field_or_method);
+}
+
GcRoot<mirror::Class> MethodHandleImpl::static_class_;
void MethodHandleImpl::SetClass(Class* klass) {
@@ -45,5 +57,17 @@
static_class_.VisitRootIfNonNull(visitor, RootInfo(kRootStickyClass));
}
+mirror::MethodHandleImpl* MethodHandleImpl::Create(Thread* const self,
+ uintptr_t art_field_or_method,
+ MethodHandle::Kind kind,
+ Handle<MethodType> method_type)
+ REQUIRES_SHARED(Locks::mutator_lock_) REQUIRES(!Roles::uninterruptible_) {
+ StackHandleScope<1> hs(self);
+ Handle<mirror::MethodHandleImpl> mh(
+ hs.NewHandle(ObjPtr<MethodHandleImpl>::DownCast(StaticClass()->AllocObject(self))));
+ mh->Initialize(art_field_or_method, kind, method_type);
+ return mh.Get();
+}
+
} // namespace mirror
} // namespace art
diff --git a/runtime/mirror/method_handle_impl.h b/runtime/mirror/method_handle_impl.h
index 53d267b..9938af8 100644
--- a/runtime/mirror/method_handle_impl.h
+++ b/runtime/mirror/method_handle_impl.h
@@ -17,10 +17,11 @@
#ifndef ART_RUNTIME_MIRROR_METHOD_HANDLE_IMPL_H_
#define ART_RUNTIME_MIRROR_METHOD_HANDLE_IMPL_H_
+#include "art_field.h"
+#include "art_method.h"
#include "class.h"
#include "gc_root.h"
#include "object-inl.h"
-#include "method_handles.h"
#include "method_type.h"
namespace art {
@@ -82,10 +83,19 @@
GetField64(OFFSET_OF_OBJECT_MEMBER(MethodHandle, art_field_or_method_)));
}
+ ObjPtr<mirror::Class> GetTargetClass() REQUIRES_SHARED(Locks::mutator_lock_) {
+ Kind kind = GetHandleKind();
+ return (kind <= kLastValidKind) ?
+ GetTargetMethod()->GetDeclaringClass() : GetTargetField()->GetDeclaringClass();
+ }
+
static mirror::Class* StaticClass() REQUIRES_SHARED(Locks::mutator_lock_);
+ protected:
+ void Initialize(uintptr_t art_field_or_method, Kind kind, Handle<MethodType> method_type)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
private:
- // NOTE: cached_spread_invoker_ isn't used by the runtime.
HeapReference<mirror::MethodHandle> cached_spread_invoker_;
HeapReference<mirror::MethodType> nominal_type_;
HeapReference<mirror::MethodType> method_type_;
@@ -93,6 +103,9 @@
uint64_t art_field_or_method_;
private:
+ static MemberOffset CachedSpreadInvokerOffset() {
+ return MemberOffset(OFFSETOF_MEMBER(MethodHandle, cached_spread_invoker_));
+ }
static MemberOffset NominalTypeOffset() {
return MemberOffset(OFFSETOF_MEMBER(MethodHandle, nominal_type_));
}
@@ -113,6 +126,12 @@
// C++ mirror of java.lang.invoke.MethodHandleImpl
class MANAGED MethodHandleImpl : public MethodHandle {
public:
+ static mirror::MethodHandleImpl* Create(Thread* const self,
+ uintptr_t art_field_or_method,
+ MethodHandle::Kind kind,
+ Handle<MethodType> method_type)
+ REQUIRES_SHARED(Locks::mutator_lock_) REQUIRES(!Roles::uninterruptible_);
+
static mirror::Class* StaticClass() REQUIRES_SHARED(Locks::mutator_lock_) {
return static_class_.Read();
}
diff --git a/runtime/mirror/method_handles_lookup.cc b/runtime/mirror/method_handles_lookup.cc
new file mode 100644
index 0000000..c758e54
--- /dev/null
+++ b/runtime/mirror/method_handles_lookup.cc
@@ -0,0 +1,58 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "method_handles_lookup.h"
+
+#include "class.h"
+#include "gc_root-inl.h"
+#include "object-inl.h"
+#include "handle_scope.h"
+#include "modifiers.h"
+
+namespace art {
+namespace mirror {
+
+GcRoot<mirror::Class> MethodHandlesLookup::static_class_;
+
+void MethodHandlesLookup::SetClass(Class* klass) {
+ CHECK(static_class_.IsNull()) << static_class_.Read() << " " << klass;
+ CHECK(klass != nullptr);
+ static_class_ = GcRoot<Class>(klass);
+}
+
+void MethodHandlesLookup::ResetClass() {
+ CHECK(!static_class_.IsNull());
+ static_class_ = GcRoot<Class>(nullptr);
+}
+
+void MethodHandlesLookup::VisitRoots(RootVisitor* visitor) {
+ static_class_.VisitRootIfNonNull(visitor, RootInfo(kRootStickyClass));
+}
+
+MethodHandlesLookup* MethodHandlesLookup::Create(Thread* const self, Handle<Class> lookup_class)
+ REQUIRES_SHARED(Locks::mutator_lock_) REQUIRES(!Roles::uninterruptible_) {
+ static constexpr uint32_t kAllModes = kAccPublic | kAccPrivate | kAccProtected | kAccStatic;
+
+ StackHandleScope<1> hs(self);
+ Handle<MethodHandlesLookup> mhl(
+ hs.NewHandle(ObjPtr<MethodHandlesLookup>::DownCast(StaticClass()->AllocObject(self))));
+ mhl->SetFieldObject<false>(LookupClassOffset(), lookup_class.Get());
+ mhl->SetField32<false>(AllowedModesOffset(), kAllModes);
+ return mhl.Get();
+}
+
+} // namespace mirror
+} // namespace art
diff --git a/runtime/mirror/method_handles_lookup.h b/runtime/mirror/method_handles_lookup.h
new file mode 100644
index 0000000..63eb428
--- /dev/null
+++ b/runtime/mirror/method_handles_lookup.h
@@ -0,0 +1,70 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#ifndef ART_RUNTIME_MIRROR_METHOD_HANDLES_LOOKUP_H_
+#define ART_RUNTIME_MIRROR_METHOD_HANDLES_LOOKUP_H_
+
+#include "obj_ptr.h"
+#include "gc_root.h"
+#include "object.h"
+#include "handle.h"
+#include "utils.h"
+
+namespace art {
+
+struct MethodHandlesLookupOffsets;
+class RootVisitor;
+
+namespace mirror {
+
+// C++ mirror of java.lang.invoke.MethodHandles.Lookup
+class MANAGED MethodHandlesLookup : public Object {
+ public:
+ static mirror::MethodHandlesLookup* Create(Thread* const self,
+ Handle<Class> lookup_class)
+ REQUIRES_SHARED(Locks::mutator_lock_) REQUIRES(!Roles::uninterruptible_);
+
+ static mirror::Class* StaticClass() REQUIRES_SHARED(Locks::mutator_lock_) {
+ return static_class_.Read();
+ }
+
+ static void SetClass(Class* klass) REQUIRES_SHARED(Locks::mutator_lock_);
+ static void ResetClass() REQUIRES_SHARED(Locks::mutator_lock_);
+ static void VisitRoots(RootVisitor* visitor) REQUIRES_SHARED(Locks::mutator_lock_);
+
+ private:
+ static MemberOffset AllowedModesOffset() {
+ return MemberOffset(OFFSETOF_MEMBER(MethodHandlesLookup, allowed_modes_));
+ }
+
+ static MemberOffset LookupClassOffset() {
+ return MemberOffset(OFFSETOF_MEMBER(MethodHandlesLookup, lookup_class_));
+ }
+
+ HeapReference<mirror::Class> lookup_class_;
+
+ int32_t allowed_modes_;
+
+ static GcRoot<mirror::Class> static_class_; // java.lang.invoke.MethodHandles.Lookup.class
+
+ friend struct art::MethodHandlesLookupOffsets; // for verifying offset information
+ DISALLOW_IMPLICIT_CONSTRUCTORS(MethodHandlesLookup);
+};
+
+} // namespace mirror
+} // namespace art
+
+#endif // ART_RUNTIME_MIRROR_METHOD_HANDLES_LOOKUP_H_
diff --git a/runtime/mirror/method_type.cc b/runtime/mirror/method_type.cc
index 5d77a16..4b8dfac 100644
--- a/runtime/mirror/method_type.cc
+++ b/runtime/mirror/method_type.cc
@@ -44,6 +44,22 @@
return mt.Get();
}
+size_t MethodType::NumberOfVRegs() REQUIRES_SHARED(Locks::mutator_lock_) {
+ mirror::ObjectArray<Class>* const p_types = GetPTypes();
+ const int32_t p_types_length = p_types->GetLength();
+
+ // Initialize |num_vregs| with number of parameters and only increment it for
+ // types requiring a second vreg.
+ size_t num_vregs = static_cast<size_t>(p_types_length);
+ for (int32_t i = 0; i < p_types_length; ++i) {
+ mirror::Class* klass = p_types->GetWithoutChecks(i);
+ if (klass->IsPrimitiveLong() || klass->IsPrimitiveDouble()) {
+ ++num_vregs;
+ }
+ }
+ return num_vregs;
+}
+
bool MethodType::IsExactMatch(mirror::MethodType* target) REQUIRES_SHARED(Locks::mutator_lock_) {
mirror::ObjectArray<Class>* const p_types = GetPTypes();
const int32_t params_length = p_types->GetLength();
diff --git a/runtime/mirror/method_type.h b/runtime/mirror/method_type.h
index 9a98143..374bbe5 100644
--- a/runtime/mirror/method_type.h
+++ b/runtime/mirror/method_type.h
@@ -44,6 +44,10 @@
return GetFieldObject<ObjectArray<Class>>(OFFSET_OF_OBJECT_MEMBER(MethodType, p_types_));
}
+ // Number of virtual registers required to hold the parameters for
+ // this method type.
+ size_t NumberOfVRegs() REQUIRES_SHARED(Locks::mutator_lock_);
+
Class* GetRType() REQUIRES_SHARED(Locks::mutator_lock_) {
return GetFieldObject<Class>(OFFSET_OF_OBJECT_MEMBER(MethodType, r_type_));
}
diff --git a/runtime/mirror/method_type_test.cc b/runtime/mirror/method_type_test.cc
index 637bafd..41231ef 100644
--- a/runtime/mirror/method_type_test.cc
+++ b/runtime/mirror/method_type_test.cc
@@ -51,7 +51,7 @@
Handle<mirror::Class> return_clazz = hs.NewHandle(class_linker->FindClass(
soa.Self(), FullyQualifiedType(return_type).c_str(), boot_class_loader));
- CHECK(return_clazz.Get() != nullptr);
+ CHECK(return_clazz != nullptr);
ObjPtr<mirror::Class> class_type = mirror::Class::GetJavaLangClass();
mirror::Class* class_array_type = class_linker->FindArrayClass(self, &class_type);
diff --git a/runtime/mirror/object_test.cc b/runtime/mirror/object_test.cc
index 6a4ec9d..e761e4d 100644
--- a/runtime/mirror/object_test.cc
+++ b/runtime/mirror/object_test.cc
@@ -530,8 +530,8 @@
Handle<Object> x(hs.NewHandle(X->AllocObject(soa.Self())));
Handle<Object> y(hs.NewHandle(Y->AllocObject(soa.Self())));
- ASSERT_TRUE(x.Get() != nullptr);
- ASSERT_TRUE(y.Get() != nullptr);
+ ASSERT_TRUE(x != nullptr);
+ ASSERT_TRUE(y != nullptr);
EXPECT_TRUE(x->InstanceOf(X));
EXPECT_FALSE(x->InstanceOf(Y));
@@ -650,7 +650,7 @@
ScopedObjectAccess soa(Thread::Current());
StackHandleScope<1> hs(soa.Self());
Handle<String> s(hs.NewHandle(String::AllocFromModifiedUtf8(soa.Self(), "ABC")));
- ASSERT_TRUE(s.Get() != nullptr);
+ ASSERT_TRUE(s != nullptr);
Class* c = s->GetClass();
ASSERT_TRUE(c != nullptr);
@@ -684,9 +684,9 @@
ScopedObjectAccess soa(Thread::Current());
StackHandleScope<4> hs(soa.Self());
Handle<String> s(hs.NewHandle(String::AllocFromModifiedUtf8(soa.Self(), "ABC")));
- ASSERT_TRUE(s.Get() != nullptr);
+ ASSERT_TRUE(s != nullptr);
Handle<Class> c(hs.NewHandle(s->GetClass()));
- ASSERT_TRUE(c.Get() != nullptr);
+ ASSERT_TRUE(c != nullptr);
// Wrong type.
EXPECT_TRUE(c->FindDeclaredStaticField("CASE_INSENSITIVE_ORDER", "I") == nullptr);
diff --git a/runtime/mirror/string-inl.h b/runtime/mirror/string-inl.h
index 9b8445d..c2407d7 100644
--- a/runtime/mirror/string-inl.h
+++ b/runtime/mirror/string-inl.h
@@ -308,7 +308,7 @@
}
template<typename MemoryType>
-bool String::AllASCII(const MemoryType* const chars, const int length) {
+inline bool String::AllASCII(const MemoryType* chars, const int length) {
static_assert(std::is_unsigned<MemoryType>::value, "Expecting unsigned MemoryType");
for (int i = 0; i < length; ++i) {
// Valid ASCII characters are in range 1..0x7f. Zero is not considered ASCII
@@ -320,6 +320,13 @@
return true;
}
+inline bool String::DexFileStringAllASCII(const char* chars, const int length) {
+ // For strings from the dex file we just need to check that
+ // the terminating character is at the right position.
+ DCHECK_EQ(AllASCII(reinterpret_cast<const uint8_t*>(chars), length), chars[length] == 0);
+ return chars[length] == 0;
+}
+
} // namespace mirror
} // namespace art
diff --git a/runtime/mirror/string.h b/runtime/mirror/string.h
index 409c6c2..38f6dd4 100644
--- a/runtime/mirror/string.h
+++ b/runtime/mirror/string.h
@@ -184,7 +184,9 @@
bool IsValueNull() REQUIRES_SHARED(Locks::mutator_lock_);
template<typename MemoryType>
- static bool AllASCII(const MemoryType* const chars, const int length);
+ static bool AllASCII(const MemoryType* chars, const int length);
+
+ static bool DexFileStringAllASCII(const char* chars, const int length);
ALWAYS_INLINE static bool IsCompressed(int32_t count) {
return GetCompressionFlagFromCount(count) == StringCompressionFlag::kCompressed;
diff --git a/runtime/monitor_test.cc b/runtime/monitor_test.cc
index 4fbfe47..27ce149 100644
--- a/runtime/monitor_test.cc
+++ b/runtime/monitor_test.cc
@@ -77,7 +77,7 @@
while (length > 10) {
MutableHandle<mirror::Object> h((*hsp)->NewHandle<mirror::Object>(
mirror::ObjectArray<mirror::Object>::Alloc(self, ca.Get(), length / 4)));
- if (self->IsExceptionPending() || h.Get() == nullptr) {
+ if (self->IsExceptionPending() || h == nullptr) {
self->ClearException();
// Try a smaller length
@@ -95,7 +95,7 @@
// Allocate simple objects till it fails.
while (!self->IsExceptionPending()) {
MutableHandle<mirror::Object> h = (*hsp)->NewHandle<mirror::Object>(c->AllocObject(self));
- if (!self->IsExceptionPending() && h.Get() != nullptr) {
+ if (!self->IsExceptionPending() && h != nullptr) {
handles->push_back(h);
}
}
diff --git a/runtime/native/dalvik_system_VMRuntime.cc b/runtime/native/dalvik_system_VMRuntime.cc
index 24308d9..6bfccdc 100644
--- a/runtime/native/dalvik_system_VMRuntime.cc
+++ b/runtime/native/dalvik_system_VMRuntime.cc
@@ -350,7 +350,7 @@
Thread* const self = Thread::Current();
StackHandleScope<1> hs(self);
Handle<mirror::Class> klass(hs.NewHandle(dex_cache->GetResolvedType(field_id.class_idx_)));
- if (klass.Get() == nullptr) {
+ if (klass == nullptr) {
return;
}
if (is_static) {
@@ -512,7 +512,7 @@
CHECK(dex_file != nullptr);
StackHandleScope<1> hs(soa.Self());
Handle<mirror::DexCache> dex_cache(hs.NewHandle(linker->RegisterDexFile(*dex_file, nullptr)));
- CHECK(dex_cache.Get() != nullptr); // Boot class path dex caches are never unloaded.
+ CHECK(dex_cache != nullptr); // Boot class path dex caches are never unloaded.
if (kPreloadDexCachesStrings) {
for (size_t j = 0; j < dex_cache->NumStrings(); j++) {
PreloadDexCachesResolveString(dex_cache, dex::StringIndex(j), strings);
diff --git a/runtime/native/dalvik_system_VMStack.cc b/runtime/native/dalvik_system_VMStack.cc
index 268d71a..be6f7f2 100644
--- a/runtime/native/dalvik_system_VMStack.cc
+++ b/runtime/native/dalvik_system_VMStack.cc
@@ -41,7 +41,7 @@
Thread* heap_task_thread =
Runtime::Current()->GetHeap()->GetTaskProcessor()->GetRunningThread();
// heap_task_thread could be null if the daemons aren't yet started.
- if (heap_task_thread != nullptr && decoded_peer == heap_task_thread->GetPeer()) {
+ if (heap_task_thread != nullptr && decoded_peer == heap_task_thread->GetPeerFromOtherThread()) {
return nullptr;
}
// Suspend thread to build stack trace.
diff --git a/runtime/native/java_lang_Class.cc b/runtime/native/java_lang_Class.cc
index 5438a6d..256787b 100644
--- a/runtime/native/java_lang_Class.cc
+++ b/runtime/native/java_lang_Class.cc
@@ -81,7 +81,7 @@
ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
Handle<mirror::Class> c(
hs.NewHandle(class_linker->FindClass(soa.Self(), descriptor.c_str(), class_loader)));
- if (c.Get() == nullptr) {
+ if (c == nullptr) {
ScopedLocalRef<jthrowable> cause(env, env->ExceptionOccurred());
env->ExceptionClear();
jthrowable cnfe = reinterpret_cast<jthrowable>(
@@ -137,7 +137,7 @@
size_t array_idx = 0;
auto object_array = hs.NewHandle(mirror::ObjectArray<mirror::Field>::Alloc(
self, mirror::Field::ArrayClass(), array_size));
- if (object_array.Get() == nullptr) {
+ if (object_array == nullptr) {
return nullptr;
}
for (ArtField& field : ifields) {
@@ -267,7 +267,7 @@
Handle<mirror::String> h_name(hs.NewHandle(name));
// We search the current class, its direct interfaces then its superclass.
- while (h_clazz.Get() != nullptr) {
+ while (h_clazz != nullptr) {
mirror::Field* result = GetDeclaredField(self, h_clazz.Get(), h_name.Get());
if ((result != nullptr) && (result->GetAccessFlags() & kAccPublic)) {
return result;
@@ -319,14 +319,14 @@
ScopedFastNativeObjectAccess soa(env);
StackHandleScope<3> hs(soa.Self());
Handle<mirror::String> h_string = hs.NewHandle(soa.Decode<mirror::String>(name));
- if (h_string.Get() == nullptr) {
+ if (h_string == nullptr) {
ThrowNullPointerException("name == null");
return nullptr;
}
Handle<mirror::Class> h_klass = hs.NewHandle(DecodeClass(soa, javaThis));
Handle<mirror::Field> result =
hs.NewHandle(GetDeclaredField(soa.Self(), h_klass.Get(), h_string.Get()));
- if (result.Get() == nullptr) {
+ if (result == nullptr) {
std::string name_str = h_string->ToModifiedUtf8();
if (name_str == "value" && h_klass->IsStringClass()) {
// We log the error for this specific case, as the user might just swallow the exception.
@@ -377,7 +377,7 @@
}
auto h_constructors = hs.NewHandle(mirror::ObjectArray<mirror::Constructor>::Alloc(
soa.Self(), mirror::Constructor::ArrayClass(), constructor_count));
- if (UNLIKELY(h_constructors.Get() == nullptr)) {
+ if (UNLIKELY(h_constructors == nullptr)) {
soa.Self()->AssertPendingException();
return nullptr;
}
@@ -428,7 +428,7 @@
}
auto ret = hs.NewHandle(mirror::ObjectArray<mirror::Method>::Alloc(
soa.Self(), mirror::Method::ArrayClass(), num_methods));
- if (ret.Get() == nullptr) {
+ if (ret == nullptr) {
soa.Self()->AssertPendingOOMException();
return nullptr;
}
@@ -645,7 +645,7 @@
// Verify that we can access the class.
if (!klass->IsPublic()) {
caller.Assign(GetCallingClass(soa.Self(), 1));
- if (caller.Get() != nullptr && !caller->CanAccess(klass.Get())) {
+ if (caller != nullptr && !caller->CanAccess(klass.Get())) {
soa.Self()->ThrowNewExceptionF(
"Ljava/lang/IllegalAccessException;", "%s is not accessible from %s",
klass->PrettyClass().c_str(), caller->PrettyClass().c_str());
@@ -673,17 +673,17 @@
}
}
auto receiver = hs.NewHandle(klass->AllocObject(soa.Self()));
- if (UNLIKELY(receiver.Get() == nullptr)) {
+ if (UNLIKELY(receiver == nullptr)) {
soa.Self()->AssertPendingOOMException();
return nullptr;
}
// Verify that we can access the constructor.
auto* declaring_class = constructor->GetDeclaringClass();
if (!constructor->IsPublic()) {
- if (caller.Get() == nullptr) {
+ if (caller == nullptr) {
caller.Assign(GetCallingClass(soa.Self(), 1));
}
- if (UNLIKELY(caller.Get() != nullptr && !VerifyAccess(receiver.Get(),
+ if (UNLIKELY(caller != nullptr && !VerifyAccess(receiver.Get(),
declaring_class,
constructor->GetAccessFlags(),
caller.Get()))) {
diff --git a/runtime/native/java_lang_DexCache.cc b/runtime/native/java_lang_DexCache.cc
index ee6dda5..b1ed74a 100644
--- a/runtime/native/java_lang_DexCache.cc
+++ b/runtime/native/java_lang_DexCache.cc
@@ -53,7 +53,7 @@
static jobject DexCache_getResolvedType(JNIEnv* env, jobject javaDexCache, jint type_index) {
ScopedFastNativeObjectAccess soa(env);
ObjPtr<mirror::DexCache> dex_cache = soa.Decode<mirror::DexCache>(javaDexCache);
- CHECK_LT(static_cast<size_t>(type_index), dex_cache->GetDexFile()->NumTypeIds());
+ CHECK_LT(static_cast<size_t>(type_index), dex_cache->NumResolvedTypes());
return soa.AddLocalReference<jobject>(dex_cache->GetResolvedType(dex::TypeIndex(type_index)));
}
diff --git a/runtime/native/java_lang_invoke_MethodHandleImpl.cc b/runtime/native/java_lang_invoke_MethodHandleImpl.cc
index 72a37f8..9113841 100644
--- a/runtime/native/java_lang_invoke_MethodHandleImpl.cc
+++ b/runtime/native/java_lang_invoke_MethodHandleImpl.cc
@@ -57,7 +57,7 @@
}
}
- if (UNLIKELY(h_object.Get() == nullptr)) {
+ if (UNLIKELY(h_object == nullptr)) {
soa.Self()->AssertPendingOOMException();
return nullptr;
}
diff --git a/runtime/native/java_lang_reflect_Executable.cc b/runtime/native/java_lang_reflect_Executable.cc
index ee59c4a..2a39428 100644
--- a/runtime/native/java_lang_reflect_Executable.cc
+++ b/runtime/native/java_lang_reflect_Executable.cc
@@ -103,7 +103,7 @@
}
// Validate the MethodParameters system annotation data.
- if (UNLIKELY(names.Get() == nullptr || access_flags.Get() == nullptr)) {
+ if (UNLIKELY(names == nullptr || access_flags == nullptr)) {
ThrowIllegalArgumentException(
StringPrintf("Missing parameter metadata for names or access flags for %s",
art_method->PrettyMethod().c_str()).c_str());
@@ -132,7 +132,7 @@
mirror::ObjectArray<mirror::Object>::Alloc(self,
parameter_array_class.Get(),
names_count));
- if (UNLIKELY(parameter_array.Get() == nullptr)) {
+ if (UNLIKELY(parameter_array == nullptr)) {
self->AssertPendingException();
return nullptr;
}
@@ -154,7 +154,7 @@
// Allocate / initialize the Parameter to add to parameter_array.
parameter.Assign(parameter_class->AllocObject(self));
- if (UNLIKELY(parameter.Get() == nullptr)) {
+ if (UNLIKELY(parameter == nullptr)) {
self->AssertPendingOOMException();
return nullptr;
}
diff --git a/runtime/native/libcore_util_CharsetUtils.cc b/runtime/native/libcore_util_CharsetUtils.cc
index 2590452..e51b6d2 100644
--- a/runtime/native/libcore_util_CharsetUtils.cc
+++ b/runtime/native/libcore_util_CharsetUtils.cc
@@ -155,7 +155,7 @@
ScopedObjectAccess soa(env);
StackHandleScope<1> hs(soa.Self());
Handle<mirror::String> string(hs.NewHandle(soa.Decode<mirror::String>(java_string)));
- if (string.Get() == nullptr) {
+ if (string == nullptr) {
return nullptr;
}
@@ -192,7 +192,7 @@
ScopedObjectAccess soa(env);
StackHandleScope<1> hs(soa.Self());
Handle<mirror::String> string(hs.NewHandle(soa.Decode<mirror::String>(java_string)));
- if (string.Get() == nullptr) {
+ if (string == nullptr) {
return nullptr;
}
diff --git a/runtime/oat.h b/runtime/oat.h
index e454c64..0f6657b 100644
--- a/runtime/oat.h
+++ b/runtime/oat.h
@@ -32,7 +32,7 @@
class PACKED(4) OatHeader {
public:
static constexpr uint8_t kOatMagic[] = { 'o', 'a', 't', '\n' };
- static constexpr uint8_t kOatVersion[] = { '1', '1', '1', '\0' }; // hash-based DexCache types.
+ static constexpr uint8_t kOatVersion[] = { '1', '1', '2', '\0' }; // Manual bump (Revert^3 hash-based DexCache types; stack maps).
static constexpr const char* kImageLocationKey = "image-location";
static constexpr const char* kDex2OatCmdLineKey = "dex2oat-cmdline";
diff --git a/runtime/oat_file.cc b/runtime/oat_file.cc
index 31eb1cc..493da27 100644
--- a/runtime/oat_file.cc
+++ b/runtime/oat_file.cc
@@ -273,6 +273,36 @@
return true;
}
+static bool FindDexFileMapItem(const uint8_t* dex_begin,
+ const uint8_t* dex_end,
+ DexFile::MapItemType map_item_type,
+ const DexFile::MapItem** result_item) {
+ *result_item = nullptr;
+
+ const DexFile::Header* header =
+ BoundsCheckedCast<const DexFile::Header*>(dex_begin, dex_begin, dex_end);
+ if (nullptr == header) return false;
+
+ if (!DexFile::IsMagicValid(header->magic_)) return true; // Not a dex file, not an error.
+
+ const DexFile::MapList* map_list =
+ BoundsCheckedCast<const DexFile::MapList*>(dex_begin + header->map_off_, dex_begin, dex_end);
+ if (nullptr == map_list) return false;
+
+ const DexFile::MapItem* map_item = map_list->list_;
+ size_t count = map_list->size_;
+ while (count--) {
+ if (map_item->type_ == static_cast<uint16_t>(map_item_type)) {
+ *result_item = map_item;
+ break;
+ }
+ map_item = BoundsCheckedCast<const DexFile::MapItem*>(map_item + 1, dex_begin, dex_end);
+ if (nullptr == map_item) return false;
+ }
+
+ return true;
+}
+
bool OatFileBase::Setup(const char* abs_dex_location, std::string* error_msg) {
if (!GetOatHeader().IsValid()) {
std::string cause = GetOatHeader().GetValidationErrorMessage();
@@ -501,7 +531,19 @@
uint8_t* current_dex_cache_arrays = nullptr;
if (dex_cache_arrays != nullptr) {
- DexCacheArraysLayout layout(pointer_size, *header);
+ // All DexCache types except for CallSite have their instance counts in the
+ // DexFile header. For CallSites, we need to read the info from the MapList.
+ const DexFile::MapItem* call_sites_item = nullptr;
+ if (!FindDexFileMapItem(DexBegin(),
+ DexEnd(),
+ DexFile::MapItemType::kDexTypeCallSiteIdItem,
+ &call_sites_item)) {
+ *error_msg = StringPrintf("In oat file '%s' could not read data from truncated DexFile map",
+ GetLocation().c_str());
+ return false;
+ }
+ size_t num_call_sites = call_sites_item == nullptr ? 0 : call_sites_item->size_;
+ DexCacheArraysLayout layout(pointer_size, *header, num_call_sites);
if (layout.Size() != 0u) {
if (static_cast<size_t>(dex_cache_arrays_end - dex_cache_arrays) < layout.Size()) {
*error_msg = StringPrintf("In oat file '%s' found OatDexFile #%zu for '%s' with "
@@ -1468,77 +1510,6 @@
return out.str();
}
-bool OatFile::CheckStaticDexFileDependencies(const char* dex_dependencies, std::string* msg) {
- if (dex_dependencies == nullptr || dex_dependencies[0] == 0) {
- // No dependencies.
- return true;
- }
-
- // Assumption: this is not performance-critical. So it's OK to do this with a std::string and
- // Split() instead of manual parsing of the combined char*.
- std::vector<std::string> split;
- Split(dex_dependencies, kDexClassPathEncodingSeparator, &split);
- if (split.size() % 2 != 0) {
- // Expected pairs of location and checksum.
- *msg = StringPrintf("Odd number of elements in dependency list %s", dex_dependencies);
- return false;
- }
-
- for (auto it = split.begin(), end = split.end(); it != end; it += 2) {
- std::string& location = *it;
- std::string& checksum = *(it + 1);
- int64_t converted = strtoll(checksum.c_str(), nullptr, 10);
- if (converted == 0) {
- // Conversion error.
- *msg = StringPrintf("Conversion error for %s", checksum.c_str());
- return false;
- }
-
- uint32_t dex_checksum;
- std::string error_msg;
- if (DexFile::GetChecksum(DexFile::GetDexCanonicalLocation(location.c_str()).c_str(),
- &dex_checksum,
- &error_msg)) {
- if (converted != dex_checksum) {
- *msg = StringPrintf("Checksums don't match for %s: %" PRId64 " vs %u",
- location.c_str(), converted, dex_checksum);
- return false;
- }
- } else {
- // Problem retrieving checksum.
- // TODO: odex files?
- *msg = StringPrintf("Could not retrieve checksum for %s: %s", location.c_str(),
- error_msg.c_str());
- return false;
- }
- }
-
- return true;
-}
-
-bool OatFile::GetDexLocationsFromDependencies(const char* dex_dependencies,
- std::vector<std::string>* locations) {
- DCHECK(locations != nullptr);
- if (dex_dependencies == nullptr || dex_dependencies[0] == 0) {
- return true;
- }
-
- // Assumption: this is not performance-critical. So it's OK to do this with a std::string and
- // Split() instead of manual parsing of the combined char*.
- std::vector<std::string> split;
- Split(dex_dependencies, kDexClassPathEncodingSeparator, &split);
- if (split.size() % 2 != 0) {
- // Expected pairs of location and checksum.
- return false;
- }
-
- for (auto it = split.begin(), end = split.end(); it != end; it += 2) {
- locations->push_back(*it);
- }
-
- return true;
-}
-
OatFile::OatClass OatFile::FindOatClass(const DexFile& dex_file,
uint16_t class_def_idx,
bool* found) {
diff --git a/runtime/oat_file.h b/runtime/oat_file.h
index 111755e..d24283a 100644
--- a/runtime/oat_file.h
+++ b/runtime/oat_file.h
@@ -290,15 +290,6 @@
// Create a dependency list (dex locations and checksums) for the given dex files.
static std::string EncodeDexFileDependencies(const std::vector<const DexFile*>& dex_files);
- // Check the given dependency list against their dex files - thus the name "Static," this does
- // not check the class-loader environment, only whether there have been file updates.
- static bool CheckStaticDexFileDependencies(const char* dex_dependencies, std::string* msg);
-
- // Get the dex locations of a dependency list. Note: this is *not* cleaned for synthetic
- // locations of multidex files.
- static bool GetDexLocationsFromDependencies(const char* dex_dependencies,
- std::vector<std::string>* locations);
-
// Finds the associated oat class for a dex_file and descriptor. Returns an invalid OatClass on
// error and sets found to false.
static OatClass FindOatClass(const DexFile& dex_file, uint16_t class_def_idx, bool* found);
diff --git a/runtime/oat_file_assistant.cc b/runtime/oat_file_assistant.cc
index 77cdd28..5ae2fc5 100644
--- a/runtime/oat_file_assistant.cc
+++ b/runtime/oat_file_assistant.cc
@@ -38,6 +38,8 @@
namespace art {
+using android::base::StringPrintf;
+
std::ostream& operator << (std::ostream& stream, const OatFileAssistant::OatStatus status) {
switch (status) {
case OatFileAssistant::kOatCannotOpen:
@@ -264,7 +266,7 @@
const OatFile& oat_file, const char* dex_location) {
std::vector<std::unique_ptr<const DexFile>> dex_files;
- // Load the primary dex file.
+ // Load the main dex file.
std::string error_msg;
const OatFile::OatDexFile* oat_dex_file = oat_file.GetOatDexFile(
dex_location, nullptr, &error_msg);
@@ -280,12 +282,12 @@
}
dex_files.push_back(std::move(dex_file));
- // Load secondary multidex files
+ // Load the rest of the multidex entries
for (size_t i = 1; ; i++) {
- std::string secondary_dex_location = DexFile::GetMultiDexLocation(i, dex_location);
- oat_dex_file = oat_file.GetOatDexFile(secondary_dex_location.c_str(), nullptr);
+ std::string multidex_dex_location = DexFile::GetMultiDexLocation(i, dex_location);
+ oat_dex_file = oat_file.GetOatDexFile(multidex_dex_location.c_str(), nullptr);
if (oat_dex_file == nullptr) {
- // There are no more secondary dex files to load.
+ // There are no more multidex entries to load.
break;
}
@@ -300,10 +302,10 @@
}
bool OatFileAssistant::HasOriginalDexFiles() {
- // Ensure GetRequiredDexChecksum has been run so that
+ // Ensure GetRequiredDexChecksums has been run so that
// has_original_dex_files_ is initialized. We don't care about the result of
- // GetRequiredDexChecksum.
- GetRequiredDexChecksum();
+ // GetRequiredDexChecksums.
+ GetRequiredDexChecksums();
return has_original_dex_files_;
}
@@ -316,88 +318,66 @@
}
bool OatFileAssistant::DexChecksumUpToDate(const VdexFile& file, std::string* error_msg) {
- if (file.GetHeader().GetNumberOfDexFiles() <= 0) {
- VLOG(oat) << "Vdex does not contain any dex files";
+ const std::vector<uint32_t>* required_dex_checksums = GetRequiredDexChecksums();
+ if (required_dex_checksums == nullptr) {
+ LOG(WARNING) << "Required dex checksums not found. Assuming dex checksums are up to date.";
+ return true;
+ }
+
+ uint32_t number_of_dex_files = file.GetHeader().GetNumberOfDexFiles();
+ if (required_dex_checksums->size() != number_of_dex_files) {
+ *error_msg = StringPrintf("expected %zu dex files but found %u",
+ required_dex_checksums->size(),
+ number_of_dex_files);
return false;
}
- // TODO: Use GetRequiredDexChecksum to get secondary checksums as well, not
- // just the primary. Because otherwise we may fail to see a secondary
- // checksum failure in the case when the original (multidex) files are
- // stripped but we have a newer odex file.
- const uint32_t* dex_checksum_pointer = GetRequiredDexChecksum();
- if (dex_checksum_pointer != nullptr) {
- uint32_t actual_checksum = file.GetLocationChecksum(0);
- if (*dex_checksum_pointer != actual_checksum) {
- VLOG(oat) << "Dex checksum does not match for primary dex: " << dex_location_
- << ". Expected: " << *dex_checksum_pointer
- << ", Actual: " << actual_checksum;
+ for (uint32_t i = 0; i < number_of_dex_files; i++) {
+ uint32_t expected_checksum = (*required_dex_checksums)[i];
+ uint32_t actual_checksum = file.GetLocationChecksum(i);
+ if (expected_checksum != actual_checksum) {
+ std::string dex = DexFile::GetMultiDexLocation(i, dex_location_.c_str());
+ *error_msg = StringPrintf("Dex checksum does not match for dex: %s."
+ "Expected: %u, actual: %u",
+ dex.c_str(),
+ expected_checksum,
+ actual_checksum);
return false;
}
}
- // Verify the dex checksums for any secondary multidex files
- for (uint32_t i = 1; i < file.GetHeader().GetNumberOfDexFiles(); i++) {
- std::string secondary_dex_location = DexFile::GetMultiDexLocation(i, dex_location_.c_str());
- uint32_t expected_secondary_checksum = 0;
- if (DexFile::GetChecksum(secondary_dex_location.c_str(),
- &expected_secondary_checksum,
- error_msg)) {
- uint32_t actual_secondary_checksum = file.GetLocationChecksum(i);
- if (expected_secondary_checksum != actual_secondary_checksum) {
- VLOG(oat) << "Dex checksum does not match for secondary dex: "
- << secondary_dex_location
- << ". Expected: " << expected_secondary_checksum
- << ", Actual: " << actual_secondary_checksum;
- return false;
- }
- } else {
- // If we can't get the checksum for the secondary location, we assume
- // the dex checksum is up to date for this and all other secondary dex
- // files.
- break;
- }
- }
return true;
}
bool OatFileAssistant::DexChecksumUpToDate(const OatFile& file, std::string* error_msg) {
- // Note: GetOatDexFile will return null if the dex checksum doesn't match
- // what we provide, which verifies the primary dex checksum for us.
- const uint32_t* dex_checksum_pointer = GetRequiredDexChecksum();
- const OatFile::OatDexFile* oat_dex_file = file.GetOatDexFile(
- dex_location_.c_str(), dex_checksum_pointer, error_msg);
- if (oat_dex_file == nullptr) {
+ const std::vector<uint32_t>* required_dex_checksums = GetRequiredDexChecksums();
+ if (required_dex_checksums == nullptr) {
+ LOG(WARNING) << "Required dex checksums not found. Assuming dex checksums are up to date.";
+ return true;
+ }
+
+ uint32_t number_of_dex_files = file.GetOatHeader().GetDexFileCount();
+ if (required_dex_checksums->size() != number_of_dex_files) {
+ *error_msg = StringPrintf("expected %zu dex files but found %u",
+ required_dex_checksums->size(),
+ number_of_dex_files);
return false;
}
- // Verify the dex checksums for any secondary multidex files
- for (size_t i = 1; ; i++) {
- std::string secondary_dex_location = DexFile::GetMultiDexLocation(i, dex_location_.c_str());
- const OatFile::OatDexFile* secondary_oat_dex_file
- = file.GetOatDexFile(secondary_dex_location.c_str(), nullptr);
- if (secondary_oat_dex_file == nullptr) {
- // There are no more secondary dex files to check.
- break;
+ for (uint32_t i = 0; i < number_of_dex_files; i++) {
+ std::string dex = DexFile::GetMultiDexLocation(i, dex_location_.c_str());
+ uint32_t expected_checksum = (*required_dex_checksums)[i];
+ const OatFile::OatDexFile* oat_dex_file = file.GetOatDexFile(dex.c_str(), nullptr);
+ if (oat_dex_file == nullptr) {
+ *error_msg = StringPrintf("failed to find %s in %s", dex.c_str(), file.GetLocation().c_str());
+ return false;
}
-
- uint32_t expected_secondary_checksum = 0;
- if (DexFile::GetChecksum(secondary_dex_location.c_str(),
- &expected_secondary_checksum, error_msg)) {
- uint32_t actual_secondary_checksum
- = secondary_oat_dex_file->GetDexFileLocationChecksum();
- if (expected_secondary_checksum != actual_secondary_checksum) {
- VLOG(oat) << "Dex checksum does not match for secondary dex: "
- << secondary_dex_location
- << ". Expected: " << expected_secondary_checksum
- << ", Actual: " << actual_secondary_checksum;
- return false;
- }
- } else {
- // If we can't get the checksum for the secondary location, we assume
- // the dex checksum is up to date for this and all other secondary dex
- // files.
- break;
+ uint32_t actual_checksum = oat_dex_file->GetDexFileLocationChecksum();
+ if (expected_checksum != actual_checksum) {
+ VLOG(oat) << "Dex checksum does not match for dex: " << dex
+ << ". Expected: " << expected_checksum
+ << ", Actual: " << actual_checksum;
+ return false;
}
}
return true;
@@ -710,13 +690,16 @@
return image_spaces[0]->GetImageLocation();
}
-const uint32_t* OatFileAssistant::GetRequiredDexChecksum() {
- if (!required_dex_checksum_attempted_) {
- required_dex_checksum_attempted_ = true;
- required_dex_checksum_found_ = false;
+const std::vector<uint32_t>* OatFileAssistant::GetRequiredDexChecksums() {
+ if (!required_dex_checksums_attempted_) {
+ required_dex_checksums_attempted_ = true;
+ required_dex_checksums_found_ = false;
+ cached_required_dex_checksums_.clear();
std::string error_msg;
- if (DexFile::GetChecksum(dex_location_.c_str(), &cached_required_dex_checksum_, &error_msg)) {
- required_dex_checksum_found_ = true;
+ if (DexFile::GetMultiDexChecksums(dex_location_.c_str(),
+ &cached_required_dex_checksums_,
+ &error_msg)) {
+ required_dex_checksums_found_ = true;
has_original_dex_files_ = true;
} else {
// This can happen if the original dex file has been stripped from the
@@ -724,19 +707,23 @@
VLOG(oat) << "OatFileAssistant: " << error_msg;
has_original_dex_files_ = false;
- // Get the checksum from the odex if we can.
+ // Get the checksums from the odex if we can.
const OatFile* odex_file = odex_.GetFile();
if (odex_file != nullptr) {
- const OatFile::OatDexFile* odex_dex_file
- = odex_file->GetOatDexFile(dex_location_.c_str(), nullptr);
- if (odex_dex_file != nullptr) {
- cached_required_dex_checksum_ = odex_dex_file->GetDexFileLocationChecksum();
- required_dex_checksum_found_ = true;
+ required_dex_checksums_found_ = true;
+ for (size_t i = 0; i < odex_file->GetOatHeader().GetDexFileCount(); i++) {
+ std::string dex = DexFile::GetMultiDexLocation(i, dex_location_.c_str());
+ const OatFile::OatDexFile* odex_dex_file = odex_file->GetOatDexFile(dex.c_str(), nullptr);
+ if (odex_dex_file == nullptr) {
+ required_dex_checksums_found_ = false;
+ break;
+ }
+ cached_required_dex_checksums_.push_back(odex_dex_file->GetDexFileLocationChecksum());
}
}
}
}
- return required_dex_checksum_found_ ? &cached_required_dex_checksum_ : nullptr;
+ return required_dex_checksums_found_ ? &cached_required_dex_checksums_ : nullptr;
}
const OatFileAssistant::ImageInfo* OatFileAssistant::GetImageInfo() {
diff --git a/runtime/oat_file_assistant.h b/runtime/oat_file_assistant.h
index 6d47ad2..3ede29f 100644
--- a/runtime/oat_file_assistant.h
+++ b/runtime/oat_file_assistant.h
@@ -400,13 +400,13 @@
// the oat file assistant.
static std::string ImageLocation();
- // Gets the dex checksum required for an up-to-date oat file.
- // Returns dex_checksum if a required checksum was located. Returns
- // null if the required checksum was not found.
- // The caller shouldn't clean up or free the returned pointer.
- // This sets the has_original_dex_files_ field to true if a checksum was
- // found for the dex_location_ dex file.
- const uint32_t* GetRequiredDexChecksum();
+ // Gets the dex checksums required for an up-to-date oat file.
+ // Returns cached_required_dex_checksums if the required checksums were
+ // located. Returns null if the required checksums were not found. The
+ // caller shouldn't clean up or free the returned pointer. This sets the
+ // has_original_dex_files_ field to true if the checksums were found for the
+ // dex_location_ dex file.
+ const std::vector<uint32_t>* GetRequiredDexChecksums();
// Returns the loaded image info.
// Loads the image info if needed. Returns null if the image info failed
@@ -430,11 +430,11 @@
// Whether we will attempt to load oat files executable.
bool load_executable_ = false;
- // Cached value of the required dex checksum.
- // This should be accessed only by the GetRequiredDexChecksum() method.
- uint32_t cached_required_dex_checksum_;
- bool required_dex_checksum_attempted_ = false;
- bool required_dex_checksum_found_;
+ // Cached value of the required dex checksums.
+ // This should be accessed only by the GetRequiredDexChecksums() method.
+ std::vector<uint32_t> cached_required_dex_checksums_;
+ bool required_dex_checksums_attempted_ = false;
+ bool required_dex_checksums_found_;
bool has_original_dex_files_;
OatFileInfo odex_;
diff --git a/runtime/oat_file_assistant_test.cc b/runtime/oat_file_assistant_test.cc
index f777340..9b35489 100644
--- a/runtime/oat_file_assistant_test.cc
+++ b/runtime/oat_file_assistant_test.cc
@@ -237,16 +237,16 @@
EXPECT_EQ(2u, dex_files.size());
}
-// Case: We have a MultiDEX file where the secondary dex file is out of date.
+// Case: We have a MultiDEX file where the non-main multdex entry is out of date.
// Expect: The status is kDex2OatNeeded.
-TEST_F(OatFileAssistantTest, MultiDexSecondaryOutOfDate) {
- std::string dex_location = GetScratchDir() + "/MultiDexSecondaryOutOfDate.jar";
+TEST_F(OatFileAssistantTest, MultiDexNonMainOutOfDate) {
+ std::string dex_location = GetScratchDir() + "/MultiDexNonMainOutOfDate.jar";
// Compile code for GetMultiDexSrc1.
Copy(GetMultiDexSrc1(), dex_location);
GenerateOatForTest(dex_location.c_str(), CompilerFilter::kSpeed);
- // Now overwrite the dex file with GetMultiDexSrc2 so the secondary checksum
+ // Now overwrite the dex file with GetMultiDexSrc2 so the non-main checksum
// is out of date.
Copy(GetMultiDexSrc2(), dex_location);
@@ -256,6 +256,37 @@
EXPECT_TRUE(oat_file_assistant.HasOriginalDexFiles());
}
+// Case: We have a stripped MultiDEX file where the non-main multidex entry is
+// out of date with respect to the odex file.
+TEST_F(OatFileAssistantTest, StrippedMultiDexNonMainOutOfDate) {
+ std::string dex_location = GetScratchDir() + "/StrippedMultiDexNonMainOutOfDate.jar";
+ std::string odex_location = GetOdexDir() + "/StrippedMultiDexNonMainOutOfDate.odex";
+
+ // Compile the oat from GetMultiDexSrc1.
+ Copy(GetMultiDexSrc1(), dex_location);
+ GenerateOatForTest(dex_location.c_str(), CompilerFilter::kSpeed);
+
+ // Compile the odex from GetMultiDexSrc2, which has a different non-main
+ // dex checksum.
+ Copy(GetMultiDexSrc2(), dex_location);
+ GenerateOdexForTest(dex_location, odex_location, CompilerFilter::kInterpretOnly);
+
+ // Strip the dex file.
+ Copy(GetStrippedDexSrc1(), dex_location);
+
+ OatFileAssistant oat_file_assistant(dex_location.c_str(), kRuntimeISA, /*load_executable*/false);
+
+ // Because the dex file is stripped, the odex file is considered the source
+ // of truth for the dex checksums. The oat file should be considered
+ // unusable.
+ std::unique_ptr<OatFile> best_file = oat_file_assistant.GetBestOatFile();
+ ASSERT_TRUE(best_file.get() != nullptr);
+ EXPECT_EQ(best_file->GetLocation(), odex_location);
+ EXPECT_FALSE(oat_file_assistant.HasOriginalDexFiles());
+ EXPECT_EQ(OatFileAssistant::kOatUpToDate, oat_file_assistant.OdexFileStatus());
+ EXPECT_EQ(OatFileAssistant::kOatDexOutOfDate, oat_file_assistant.OatFileStatus());
+}
+
// Case: We have a MultiDEX file and up-to-date OAT file for it with relative
// encoded dex locations.
// Expect: The oat file status is kNoDexOptNeeded.
@@ -336,16 +367,16 @@
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeed));
}
-// Case: We have a MultiDEX (ODEX) VDEX file where the secondary dex file is
-// out of date and there is no corresponding ODEX file.
-TEST_F(OatFileAssistantTest, VdexMultiDexSecondaryOutOfDate) {
+// Case: We have a MultiDEX (ODEX) VDEX file where the non-main multidex entry
+// is out of date and there is no corresponding ODEX file.
+TEST_F(OatFileAssistantTest, VdexMultiDexNonMainOutOfDate) {
// This test case is only meaningful if vdex is enabled.
if (!kIsVdexEnabled) {
return;
}
- std::string dex_location = GetScratchDir() + "/VdexMultiDexSecondaryOutOfDate.jar";
- std::string oat_location = GetOdexDir() + "/VdexMultiDexSecondaryOutOfDate.oat";
+ std::string dex_location = GetScratchDir() + "/VdexMultiDexNonMainOutOfDate.jar";
+ std::string oat_location = GetOdexDir() + "/VdexMultiDexNonMainOutOfDate.oat";
Copy(GetMultiDexSrc1(), dex_location);
GenerateOdexForTest(dex_location, oat_location, CompilerFilter::kSpeed);
@@ -1028,7 +1059,7 @@
ClassLinker* linker = Runtime::Current()->GetClassLinker();
Handle<mirror::Class> dexfile(
hs.NewHandle(linker->FindSystemClass(soa.Self(), "Ldalvik/system/DexFile;")));
- ASSERT_FALSE(dexfile.Get() == nullptr);
+ ASSERT_FALSE(dexfile == nullptr);
linker->EnsureInitialized(soa.Self(), dexfile, true, true);
for (std::pair<OatFileAssistant::DexOptNeeded, const char*> field : mapping) {
diff --git a/runtime/oat_file_manager.cc b/runtime/oat_file_manager.cc
index a46b470..7079614 100644
--- a/runtime/oat_file_manager.cc
+++ b/runtime/oat_file_manager.cc
@@ -342,7 +342,7 @@
ScopedObjectAccessAlreadyRunnable& soa,
Handle<mirror::ObjectArray<mirror::Object>> dex_elements,
std::priority_queue<DexFileAndClassPair>* queue) REQUIRES_SHARED(Locks::mutator_lock_) {
- if (dex_elements.Get() == nullptr) {
+ if (dex_elements == nullptr) {
// Nothing to do.
return;
}
@@ -463,14 +463,14 @@
hs.NewHandle(soa.Decode<mirror::ClassLoader>(class_loader));
Handle<mirror::ObjectArray<mirror::Object>> h_dex_elements =
hs.NewHandle(soa.Decode<mirror::ObjectArray<mirror::Object>>(dex_elements));
- if (h_class_loader.Get() != nullptr &&
+ if (h_class_loader != nullptr &&
GetDexFilesFromClassLoader(soa, h_class_loader.Get(), &queue)) {
class_loader_ok = true;
// In this case, also take into account the dex_elements array, if given. We don't need to
// read it otherwise, as we'll compare against all open oat files anyways.
GetDexFilesFromDexElementsArray(soa, h_dex_elements, &queue);
- } else if (h_class_loader.Get() != nullptr) {
+ } else if (h_class_loader != nullptr) {
VLOG(class_linker) << "Something unsupported with "
<< mirror::Class::PrettyClass(h_class_loader->GetClass());
}
@@ -658,7 +658,7 @@
Handle<mirror::ClassLoader> h_loader(
hs.NewHandle(soa.Decode<mirror::ClassLoader>(class_loader)));
// Can not load app image without class loader.
- if (h_loader.Get() != nullptr) {
+ if (h_loader != nullptr) {
std::string temp_error_msg;
// Add image space has a race condition since other threads could be reading from the
// spaces array.
diff --git a/runtime/oat_file_test.cc b/runtime/oat_file_test.cc
index b416b9d..d5fe1f3 100644
--- a/runtime/oat_file_test.cc
+++ b/runtime/oat_file_test.cc
@@ -62,54 +62,4 @@
"/data/app/foo/base.apk", "o/base.apk"));
}
-static std::vector<const DexFile*> ToConstDexFiles(
- const std::vector<std::unique_ptr<const DexFile>>& in) {
- std::vector<const DexFile*> ret;
- for (auto& d : in) {
- ret.push_back(d.get());
- }
- return ret;
-}
-
-TEST_F(OatFileTest, DexFileDependencies) {
- std::string error_msg;
-
- // No dependencies.
- EXPECT_TRUE(OatFile::CheckStaticDexFileDependencies(nullptr, &error_msg)) << error_msg;
- EXPECT_TRUE(OatFile::CheckStaticDexFileDependencies("", &error_msg)) << error_msg;
-
- // Ill-formed dependencies.
- EXPECT_FALSE(OatFile::CheckStaticDexFileDependencies("abc", &error_msg));
- EXPECT_FALSE(OatFile::CheckStaticDexFileDependencies("abc*123*def", &error_msg));
- EXPECT_FALSE(OatFile::CheckStaticDexFileDependencies("abc*def*", &error_msg));
-
- // Unsatisfiable dependency.
- EXPECT_FALSE(OatFile::CheckStaticDexFileDependencies("abc*123*", &error_msg));
-
- // Load some dex files to be able to do a real test.
- ScopedObjectAccess soa(Thread::Current());
-
- std::vector<std::unique_ptr<const DexFile>> dex_files1 = OpenTestDexFiles("Main");
- std::vector<const DexFile*> dex_files_const1 = ToConstDexFiles(dex_files1);
- std::string encoding1 = OatFile::EncodeDexFileDependencies(dex_files_const1);
- EXPECT_TRUE(OatFile::CheckStaticDexFileDependencies(encoding1.c_str(), &error_msg))
- << error_msg << " " << encoding1;
- std::vector<std::string> split1;
- EXPECT_TRUE(OatFile::GetDexLocationsFromDependencies(encoding1.c_str(), &split1));
- ASSERT_EQ(split1.size(), 1U);
- EXPECT_EQ(split1[0], dex_files_const1[0]->GetLocation());
-
- std::vector<std::unique_ptr<const DexFile>> dex_files2 = OpenTestDexFiles("MultiDex");
- EXPECT_GT(dex_files2.size(), 1U);
- std::vector<const DexFile*> dex_files_const2 = ToConstDexFiles(dex_files2);
- std::string encoding2 = OatFile::EncodeDexFileDependencies(dex_files_const2);
- EXPECT_TRUE(OatFile::CheckStaticDexFileDependencies(encoding2.c_str(), &error_msg))
- << error_msg << " " << encoding2;
- std::vector<std::string> split2;
- EXPECT_TRUE(OatFile::GetDexLocationsFromDependencies(encoding2.c_str(), &split2));
- ASSERT_EQ(split2.size(), 2U);
- EXPECT_EQ(split2[0], dex_files_const2[0]->GetLocation());
- EXPECT_EQ(split2[1], dex_files_const2[1]->GetLocation());
-}
-
} // namespace art
diff --git a/runtime/object_lock.cc b/runtime/object_lock.cc
index 39ab52f..f6db544 100644
--- a/runtime/object_lock.cc
+++ b/runtime/object_lock.cc
@@ -24,7 +24,7 @@
template <typename T>
ObjectLock<T>::ObjectLock(Thread* self, Handle<T> object) : self_(self), obj_(object) {
- CHECK(object.Get() != nullptr);
+ CHECK(object != nullptr);
obj_->MonitorEnter(self_);
}
@@ -50,7 +50,7 @@
template <typename T>
ObjectTryLock<T>::ObjectTryLock(Thread* self, Handle<T> object) : self_(self), obj_(object) {
- CHECK(object.Get() != nullptr);
+ CHECK(object != nullptr);
acquired_ = obj_->MonitorTryEnter(self_) != nullptr;
}
diff --git a/runtime/openjdkjvmti/ti_class.cc b/runtime/openjdkjvmti/ti_class.cc
index fc4b6fe..7ca233f 100644
--- a/runtime/openjdkjvmti/ti_class.cc
+++ b/runtime/openjdkjvmti/ti_class.cc
@@ -52,6 +52,7 @@
#include "mirror/class_ext.h"
#include "mirror/object_reference.h"
#include "mirror/object-inl.h"
+#include "mirror/reference.h"
#include "runtime.h"
#include "runtime_callbacks.h"
#include "ScopedLocalRef.h"
@@ -463,8 +464,17 @@
}
}
+ void operator()(art::ObjPtr<art::mirror::Class> klass ATTRIBUTE_UNUSED,
+ art::ObjPtr<art::mirror::Reference> reference) const
+ REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ art::mirror::Object* val = reference->GetReferent();
+ if (val == input_) {
+ reference->SetReferent<false>(output_);
+ }
+ }
+
void VisitRoot(art::mirror::CompressedReference<art::mirror::Object>* root ATTRIBUTE_UNUSED)
- const {
+ const {
LOG(FATAL) << "Unreachable";
}
@@ -478,7 +488,7 @@
HeapFixupVisitor* hfv = reinterpret_cast<HeapFixupVisitor*>(arg);
// Visit references, not native roots.
- obj->VisitReferences<false>(*hfv, art::VoidFunctor());
+ obj->VisitReferences<false>(*hfv, *hfv);
}
private:
diff --git a/runtime/openjdkjvmti/ti_class_loader.cc b/runtime/openjdkjvmti/ti_class_loader.cc
index afec0bf..d05f579 100644
--- a/runtime/openjdkjvmti/ti_class_loader.cc
+++ b/runtime/openjdkjvmti/ti_class_loader.cc
@@ -119,11 +119,11 @@
art::Handle<art::mirror::LongArray> cookie,
const art::DexFile* dex_file) {
art::StackHandleScope<1> hs(self);
- CHECK(cookie.Get() != nullptr);
+ CHECK(cookie != nullptr);
CHECK_GE(cookie->GetLength(), 1);
art::Handle<art::mirror::LongArray> new_cookie(
hs.NewHandle(art::mirror::LongArray::Alloc(self, cookie->GetLength() + 1)));
- if (new_cookie.Get() == nullptr) {
+ if (new_cookie == nullptr) {
self->AssertPendingOOMException();
return nullptr;
}
@@ -183,13 +183,13 @@
// Start navigating the fields of the loader (now known to be a BaseDexClassLoader derivative)
art::Handle<art::mirror::Object> path_list(
hs.NewHandle(path_list_field->GetObject(loader.Get())));
- CHECK(path_list.Get() != nullptr);
+ CHECK(path_list != nullptr);
CHECK(!self->IsExceptionPending());
art::Handle<art::mirror::ObjectArray<art::mirror::Object>> dex_elements_list(hs.NewHandle(
dex_path_list_element_field->GetObject(path_list.Get())->
AsObjectArray<art::mirror::Object>()));
CHECK(!self->IsExceptionPending());
- CHECK(dex_elements_list.Get() != nullptr);
+ CHECK(dex_elements_list != nullptr);
size_t num_elements = dex_elements_list->GetLength();
// Iterate over the DexPathList$Element to find the right one
for (size_t i = 0; i < num_elements; i++) {
diff --git a/runtime/openjdkjvmti/ti_redefine.cc b/runtime/openjdkjvmti/ti_redefine.cc
index 843fd8c..8436045 100644
--- a/runtime/openjdkjvmti/ti_redefine.cc
+++ b/runtime/openjdkjvmti/ti_redefine.cc
@@ -68,6 +68,66 @@
using android::base::StringPrintf;
+// A helper that fills in a classes obsolete_methods_ and obsolete_dex_caches_ classExt fields as
+// they are created. This ensures that we can always call any method of an obsolete ArtMethod object
+// almost as soon as they are created since the GetObsoleteDexCache method will succeed.
+class ObsoleteMap {
+ public:
+ art::ArtMethod* FindObsoleteVersion(art::ArtMethod* original)
+ REQUIRES(art::Locks::mutator_lock_, art::Roles::uninterruptible_) {
+ auto method_pair = id_map_.find(original);
+ if (method_pair != id_map_.end()) {
+ art::ArtMethod* res = obsolete_methods_->GetElementPtrSize<art::ArtMethod*>(
+ method_pair->second, art::kRuntimePointerSize);
+ DCHECK(res != nullptr);
+ DCHECK_EQ(original, res->GetNonObsoleteMethod());
+ return res;
+ } else {
+ return nullptr;
+ }
+ }
+
+ void RecordObsolete(art::ArtMethod* original, art::ArtMethod* obsolete)
+ REQUIRES(art::Locks::mutator_lock_, art::Roles::uninterruptible_) {
+ DCHECK(original != nullptr);
+ DCHECK(obsolete != nullptr);
+ int32_t slot = next_free_slot_++;
+ DCHECK_LT(slot, obsolete_methods_->GetLength());
+ DCHECK(nullptr ==
+ obsolete_methods_->GetElementPtrSize<art::ArtMethod*>(slot, art::kRuntimePointerSize));
+ DCHECK(nullptr == obsolete_dex_caches_->Get(slot));
+ obsolete_methods_->SetElementPtrSize(slot, obsolete, art::kRuntimePointerSize);
+ obsolete_dex_caches_->Set(slot, original_dex_cache_);
+ id_map_.insert({original, slot});
+ }
+
+ ObsoleteMap(art::ObjPtr<art::mirror::PointerArray> obsolete_methods,
+ art::ObjPtr<art::mirror::ObjectArray<art::mirror::DexCache>> obsolete_dex_caches,
+ art::ObjPtr<art::mirror::DexCache> original_dex_cache)
+ : next_free_slot_(0),
+ obsolete_methods_(obsolete_methods),
+ obsolete_dex_caches_(obsolete_dex_caches),
+ original_dex_cache_(original_dex_cache) {
+ // Figure out where the first unused slot in the obsolete_methods_ array is.
+ while (obsolete_methods_->GetElementPtrSize<art::ArtMethod*>(
+ next_free_slot_, art::kRuntimePointerSize) != nullptr) {
+ DCHECK(obsolete_dex_caches_->Get(next_free_slot_) != nullptr);
+ next_free_slot_++;
+ }
+ // Sanity check that the same slot in obsolete_dex_caches_ is free.
+ DCHECK(obsolete_dex_caches_->Get(next_free_slot_) == nullptr);
+ }
+
+ private:
+ int32_t next_free_slot_;
+ std::unordered_map<art::ArtMethod*, int32_t> id_map_;
+ // Pointers to the fields in mirror::ClassExt. These can be held as ObjPtr since this is only used
+ // when we have an exclusive mutator_lock_ (i.e. all threads are suspended).
+ art::ObjPtr<art::mirror::PointerArray> obsolete_methods_;
+ art::ObjPtr<art::mirror::ObjectArray<art::mirror::DexCache>> obsolete_dex_caches_;
+ art::ObjPtr<art::mirror::DexCache> original_dex_cache_;
+};
+
// This visitor walks thread stacks and allocates and sets up the obsolete methods. It also does
// some basic sanity checks that the obsolete method is sane.
class ObsoleteMethodStackVisitor : public art::StackVisitor {
@@ -76,7 +136,7 @@
art::Thread* thread,
art::LinearAlloc* allocator,
const std::unordered_set<art::ArtMethod*>& obsoleted_methods,
- /*out*/std::unordered_map<art::ArtMethod*, art::ArtMethod*>* obsolete_maps)
+ ObsoleteMap* obsolete_maps)
: StackVisitor(thread,
/*context*/nullptr,
StackVisitor::StackWalkKind::kIncludeInlinedFrames),
@@ -94,7 +154,7 @@
art::Thread* thread,
art::LinearAlloc* allocator,
const std::unordered_set<art::ArtMethod*>& obsoleted_methods,
- /*out*/std::unordered_map<art::ArtMethod*, art::ArtMethod*>* obsolete_maps)
+ ObsoleteMap* obsolete_maps)
REQUIRES(art::Locks::mutator_lock_) {
ObsoleteMethodStackVisitor visitor(thread,
allocator,
@@ -104,6 +164,7 @@
}
bool VisitFrame() OVERRIDE REQUIRES(art::Locks::mutator_lock_) {
+ art::ScopedAssertNoThreadSuspension snts("Fixing up the stack for obsolete methods.");
art::ArtMethod* old_method = GetMethod();
if (obsoleted_methods_.find(old_method) != obsoleted_methods_.end()) {
// We cannot ensure that the right dex file is used in inlined frames so we don't support
@@ -113,9 +174,8 @@
// TODO We should really support redefining intrinsics.
// We don't support intrinsics so check for them here.
DCHECK(!old_method->IsIntrinsic());
- art::ArtMethod* new_obsolete_method = nullptr;
- auto obsolete_method_pair = obsolete_maps_->find(old_method);
- if (obsolete_method_pair == obsolete_maps_->end()) {
+ art::ArtMethod* new_obsolete_method = obsolete_maps_->FindObsoleteVersion(old_method);
+ if (new_obsolete_method == nullptr) {
// Create a new Obsolete Method and put it in the list.
art::Runtime* runtime = art::Runtime::Current();
art::ClassLinker* cl = runtime->GetClassLinker();
@@ -129,7 +189,7 @@
DCHECK_EQ(new_obsolete_method->GetDeclaringClass(), old_method->GetDeclaringClass());
new_obsolete_method->SetIsObsolete();
new_obsolete_method->SetDontCompile();
- obsolete_maps_->insert({old_method, new_obsolete_method});
+ obsolete_maps_->RecordObsolete(old_method, new_obsolete_method);
// Update JIT Data structures to point to the new method.
art::jit::Jit* jit = art::Runtime::Current()->GetJit();
if (jit != nullptr) {
@@ -137,8 +197,6 @@
// structures to keep track of the new obsolete method.
jit->GetCodeCache()->MoveObsoleteMethod(old_method, new_obsolete_method);
}
- } else {
- new_obsolete_method = obsolete_method_pair->second;
}
DCHECK(new_obsolete_method != nullptr);
SetMethod(new_obsolete_method);
@@ -152,9 +210,9 @@
// The set of all methods which could be obsoleted.
const std::unordered_set<art::ArtMethod*>& obsoleted_methods_;
// A map from the original to the newly allocated obsolete method for frames on this thread. The
- // values in this map must be added to the obsolete_methods_ (and obsolete_dex_caches_) fields of
- // the redefined classes ClassExt by the caller.
- std::unordered_map<art::ArtMethod*, art::ArtMethod*>* obsolete_maps_;
+ // values in this map are added to the obsolete_methods_ (and obsolete_dex_caches_) fields of
+ // the redefined classes ClassExt as it is filled.
+ ObsoleteMap* obsolete_maps_;
};
jvmtiError Redefiner::IsModifiableClass(jvmtiEnv* env ATTRIBUTE_UNUSED,
@@ -431,11 +489,12 @@
}
struct CallbackCtx {
+ ObsoleteMap* obsolete_map;
art::LinearAlloc* allocator;
- std::unordered_map<art::ArtMethod*, art::ArtMethod*> obsolete_map;
std::unordered_set<art::ArtMethod*> obsolete_methods;
- explicit CallbackCtx(art::LinearAlloc* alloc) : allocator(alloc) {}
+ explicit CallbackCtx(ObsoleteMap* map, art::LinearAlloc* alloc)
+ : obsolete_map(map), allocator(alloc) {}
};
void DoAllocateObsoleteMethodsCallback(art::Thread* t, void* vdata) NO_THREAD_SAFETY_ANALYSIS {
@@ -443,7 +502,7 @@
ObsoleteMethodStackVisitor::UpdateObsoleteFrames(t,
data->allocator,
data->obsolete_methods,
- &data->obsolete_map);
+ data->obsolete_map);
}
// This creates any ArtMethod* structures needed for obsolete methods and ensures that the stack is
@@ -454,9 +513,18 @@
art::mirror::ClassExt* ext = art_klass->GetExtData();
CHECK(ext->GetObsoleteMethods() != nullptr);
art::ClassLinker* linker = driver_->runtime_->GetClassLinker();
- CallbackCtx ctx(linker->GetAllocatorForClassLoader(art_klass->GetClassLoader()));
+ // This holds pointers to the obsolete methods map fields which are updated as needed.
+ ObsoleteMap map(ext->GetObsoleteMethods(), ext->GetObsoleteDexCaches(), art_klass->GetDexCache());
+ CallbackCtx ctx(&map, linker->GetAllocatorForClassLoader(art_klass->GetClassLoader()));
// Add all the declared methods to the map
for (auto& m : art_klass->GetDeclaredMethods(art::kRuntimePointerSize)) {
+ // It is possible to simply filter out some methods where they cannot really become obsolete,
+ // such as native methods and keep their original (possibly optimized) implementations. We don't
+ // do this, however, since we would need to mark these functions (still in the classes
+ // declared_methods array) as obsolete so we will find the correct dex file to get meta-data
+ // from (for example about stack-frame size). Furthermore we would be unable to get some useful
+ // error checking from the interpreter which ensure we don't try to start executing obsolete
+ // methods.
ctx.obsolete_methods.insert(&m);
// TODO Allow this or check in IsModifiableClass.
DCHECK(!m.IsIntrinsic());
@@ -466,36 +534,6 @@
art::ThreadList* list = art::Runtime::Current()->GetThreadList();
list->ForEach(DoAllocateObsoleteMethodsCallback, static_cast<void*>(&ctx));
}
- FillObsoleteMethodMap(art_klass, ctx.obsolete_map);
-}
-
-// Fills the obsolete method map in the art_klass's extData. This is so obsolete methods are able to
-// figure out their DexCaches.
-void Redefiner::ClassRedefinition::FillObsoleteMethodMap(
- art::mirror::Class* art_klass,
- const std::unordered_map<art::ArtMethod*, art::ArtMethod*>& obsoletes) {
- int32_t index = 0;
- art::mirror::ClassExt* ext_data = art_klass->GetExtData();
- art::mirror::PointerArray* obsolete_methods = ext_data->GetObsoleteMethods();
- art::mirror::ObjectArray<art::mirror::DexCache>* obsolete_dex_caches =
- ext_data->GetObsoleteDexCaches();
- int32_t num_method_slots = obsolete_methods->GetLength();
- // Find the first empty index.
- for (; index < num_method_slots; index++) {
- if (obsolete_methods->GetElementPtrSize<art::ArtMethod*>(
- index, art::kRuntimePointerSize) == nullptr) {
- break;
- }
- }
- // Make sure we have enough space.
- CHECK_GT(num_method_slots, static_cast<int32_t>(obsoletes.size() + index));
- CHECK(obsolete_dex_caches->Get(index) == nullptr);
- // Fill in the map.
- for (auto& obs : obsoletes) {
- obsolete_methods->SetElementPtrSize(index, obs.second, art::kRuntimePointerSize);
- obsolete_dex_caches->Set(index, art_klass->GetDexCache());
- index++;
- }
}
// Try and get the declared method. First try to get a virtual method then a direct method if that's
@@ -709,8 +747,6 @@
}
}
}
- LOG(WARNING) << "No verification is done on annotations of redefined classes.";
-
return true;
}
@@ -939,7 +975,7 @@
art::Handle<art::mirror::Object> dex_file_obj(hs.NewHandle(
ClassLoaderHelper::FindSourceDexFileObject(driver_->self_, loader)));
holder->SetJavaDexFile(klass_index, dex_file_obj.Get());
- if (dex_file_obj.Get() == nullptr) {
+ if (dex_file_obj == nullptr) {
// TODO Better error msg.
RecordFailure(ERR(INTERNAL), "Unable to find dex file!");
return false;
@@ -1212,13 +1248,13 @@
art::StackHandleScope<2> hs(driver_->self_);
art::Handle<art::mirror::Class> klass(hs.NewHandle(
driver_->self_->DecodeJObject(klass_)->AsClass()));
- if (klass.Get() == nullptr) {
+ if (klass == nullptr) {
RecordFailure(ERR(INVALID_CLASS), "Unable to decode class argument!");
return false;
}
// Allocate the classExt
art::Handle<art::mirror::ClassExt> ext(hs.NewHandle(klass->EnsureExtDataPresent(driver_->self_)));
- if (ext.Get() == nullptr) {
+ if (ext == nullptr) {
// No memory. Clear exception (it's not useful) and return error.
// TODO This doesn't need to be fatal. We could just not support obsolete methods after hitting
// this case.
diff --git a/runtime/openjdkjvmti/ti_redefine.h b/runtime/openjdkjvmti/ti_redefine.h
index c441377..65ee291 100644
--- a/runtime/openjdkjvmti/ti_redefine.h
+++ b/runtime/openjdkjvmti/ti_redefine.h
@@ -155,12 +155,6 @@
void FindAndAllocateObsoleteMethods(art::mirror::Class* art_klass)
REQUIRES(art::Locks::mutator_lock_);
- void FillObsoleteMethodMap(
- art::mirror::Class* art_klass,
- const std::unordered_map<art::ArtMethod*, art::ArtMethod*>& obsoletes)
- REQUIRES(art::Locks::mutator_lock_);
-
-
// Checks that the dex file contains only the single expected class and that the top-level class
// data has not been modified in an incompatible manner.
bool CheckClass() REQUIRES_SHARED(art::Locks::mutator_lock_);
diff --git a/runtime/openjdkjvmti/ti_stack.cc b/runtime/openjdkjvmti/ti_stack.cc
index b5a6c6e..067c7c1 100644
--- a/runtime/openjdkjvmti/ti_stack.cc
+++ b/runtime/openjdkjvmti/ti_stack.cc
@@ -328,7 +328,7 @@
// For the time being, set the thread to null. We don't have good ScopedLocalRef
// infrastructure.
- DCHECK(self->GetPeer() != nullptr);
+ DCHECK(self->GetPeerFromOtherThread() != nullptr);
stack_info.thread = nullptr;
stack_info.state = JVMTI_THREAD_STATE_SUSPENDED;
@@ -495,7 +495,7 @@
// For the time being, set the thread to null. We don't have good ScopedLocalRef
// infrastructure.
- DCHECK(self->GetPeer() != nullptr);
+ DCHECK(self->GetPeerFromOtherThread() != nullptr);
stack_info.thread = nullptr;
stack_info.state = JVMTI_THREAD_STATE_SUSPENDED;
diff --git a/runtime/openjdkjvmti/ti_threadgroup.cc b/runtime/openjdkjvmti/ti_threadgroup.cc
index e63ce65..1423874 100644
--- a/runtime/openjdkjvmti/ti_threadgroup.cc
+++ b/runtime/openjdkjvmti/ti_threadgroup.cc
@@ -155,7 +155,7 @@
static bool IsInDesiredThreadGroup(art::Handle<art::mirror::Object> desired_thread_group,
art::ObjPtr<art::mirror::Object> peer)
REQUIRES_SHARED(art::Locks::mutator_lock_) {
- CHECK(desired_thread_group.Get() != nullptr);
+ CHECK(desired_thread_group != nullptr);
art::ArtField* thread_group_field =
art::jni::DecodeArtField(art::WellKnownClasses::java_lang_Thread_group);
@@ -167,7 +167,7 @@
static void GetThreads(art::Handle<art::mirror::Object> thread_group,
std::vector<art::ObjPtr<art::mirror::Object>>* thread_peers)
REQUIRES_SHARED(art::Locks::mutator_lock_) REQUIRES(!art::Locks::thread_list_lock_) {
- CHECK(thread_group.Get() != nullptr);
+ CHECK(thread_group != nullptr);
art::MutexLock mu(art::Thread::Current(), *art::Locks::thread_list_lock_);
for (art::Thread* t : art::Runtime::Current()->GetThreadList()->GetList()) {
@@ -187,7 +187,7 @@
static void GetChildThreadGroups(art::Handle<art::mirror::Object> thread_group,
std::vector<art::ObjPtr<art::mirror::Object>>* thread_groups)
REQUIRES_SHARED(art::Locks::mutator_lock_) {
- CHECK(thread_group.Get() != nullptr);
+ CHECK(thread_group != nullptr);
// Get the ThreadGroup[] "groups" out of this thread group...
art::ArtField* groups_field =
diff --git a/runtime/proxy_test.cc b/runtime/proxy_test.cc
index 1292a81..5748475 100644
--- a/runtime/proxy_test.cc
+++ b/runtime/proxy_test.cc
@@ -114,8 +114,8 @@
class_linker_->FindClass(soa.Self(), "LInterfaces$I;", class_loader)));
Handle<mirror::Class> J(hs.NewHandle(
class_linker_->FindClass(soa.Self(), "LInterfaces$J;", class_loader)));
- ASSERT_TRUE(I.Get() != nullptr);
- ASSERT_TRUE(J.Get() != nullptr);
+ ASSERT_TRUE(I != nullptr);
+ ASSERT_TRUE(J != nullptr);
std::vector<mirror::Class*> interfaces;
interfaces.push_back(I.Get());
@@ -123,7 +123,7 @@
Handle<mirror::Class> proxy_class(hs.NewHandle(
GenerateProxyClass(soa, jclass_loader, "$Proxy1234", interfaces)));
interfaces.clear(); // Don't least possibly stale objects in the array as good practice.
- ASSERT_TRUE(proxy_class.Get() != nullptr);
+ ASSERT_TRUE(proxy_class != nullptr);
ASSERT_TRUE(proxy_class->IsProxyClass());
ASSERT_TRUE(proxy_class->IsInitialized());
@@ -148,8 +148,8 @@
class_linker_->FindClass(soa.Self(), "LInterfaces$I;", class_loader)));
Handle<mirror::Class> J(hs.NewHandle(
class_linker_->FindClass(soa.Self(), "LInterfaces$J;", class_loader)));
- ASSERT_TRUE(I.Get() != nullptr);
- ASSERT_TRUE(J.Get() != nullptr);
+ ASSERT_TRUE(I != nullptr);
+ ASSERT_TRUE(J != nullptr);
Handle<mirror::Class> proxyClass;
{
@@ -159,7 +159,7 @@
proxyClass = hs.NewHandle(GenerateProxyClass(soa, jclass_loader, "$Proxy1234", interfaces));
}
- ASSERT_TRUE(proxyClass.Get() != nullptr);
+ ASSERT_TRUE(proxyClass != nullptr);
ASSERT_TRUE(proxyClass->IsProxyClass());
ASSERT_TRUE(proxyClass->IsInitialized());
@@ -171,10 +171,10 @@
Handle<mirror::Class> interfacesFieldClass(
hs.NewHandle(class_linker_->FindSystemClass(soa.Self(), "[Ljava/lang/Class;")));
- ASSERT_TRUE(interfacesFieldClass.Get() != nullptr);
+ ASSERT_TRUE(interfacesFieldClass != nullptr);
Handle<mirror::Class> throwsFieldClass(
hs.NewHandle(class_linker_->FindSystemClass(soa.Self(), "[[Ljava/lang/Class;")));
- ASSERT_TRUE(throwsFieldClass.Get() != nullptr);
+ ASSERT_TRUE(throwsFieldClass != nullptr);
// Test "Class[] interfaces" field.
ArtField* field = &static_fields->At(0);
@@ -208,10 +208,10 @@
proxyClass1 = hs.NewHandle(GenerateProxyClass(soa, jclass_loader, "$Proxy1", interfaces));
}
- ASSERT_TRUE(proxyClass0.Get() != nullptr);
+ ASSERT_TRUE(proxyClass0 != nullptr);
ASSERT_TRUE(proxyClass0->IsProxyClass());
ASSERT_TRUE(proxyClass0->IsInitialized());
- ASSERT_TRUE(proxyClass1.Get() != nullptr);
+ ASSERT_TRUE(proxyClass1 != nullptr);
ASSERT_TRUE(proxyClass1->IsProxyClass());
ASSERT_TRUE(proxyClass1->IsInitialized());
diff --git a/runtime/reference_table_test.cc b/runtime/reference_table_test.cc
index 9523e92..4ccfb6d 100644
--- a/runtime/reference_table_test.cc
+++ b/runtime/reference_table_test.cc
@@ -48,12 +48,12 @@
class_linker->FindClass(self,
"Ljava/lang/ref/WeakReference;",
ScopedNullHandle<mirror::ClassLoader>())));
- CHECK(h_ref_class.Get() != nullptr);
+ CHECK(h_ref_class != nullptr);
CHECK(class_linker->EnsureInitialized(self, h_ref_class, true, true));
Handle<mirror::Object> h_ref_instance(scope.NewHandle<mirror::Object>(
h_ref_class->AllocObject(self)));
- CHECK(h_ref_instance.Get() != nullptr);
+ CHECK(h_ref_instance != nullptr);
ArtMethod* constructor = h_ref_class->FindDeclaredDirectMethod(
"<init>", "(Ljava/lang/Object;)V", class_linker->GetImagePointerSize());
diff --git a/runtime/reflection.cc b/runtime/reflection.cc
index a2b4cb3..3c64d40 100644
--- a/runtime/reflection.cc
+++ b/runtime/reflection.cc
@@ -231,8 +231,8 @@
hs.NewHandle<mirror::ObjectArray<mirror::Object>>(raw_args));
for (size_t i = 1, args_offset = 0; i < shorty_len_; ++i, ++args_offset) {
arg.Assign(args->Get(args_offset));
- if (((shorty_[i] == 'L') && (arg.Get() != nullptr)) ||
- ((arg.Get() == nullptr && shorty_[i] != 'L'))) {
+ if (((shorty_[i] == 'L') && (arg != nullptr)) ||
+ ((arg == nullptr && shorty_[i] != 'L'))) {
// TODO: The method's parameter's type must have been previously resolved, yet
// we've seen cases where it's not b/34440020.
ObjPtr<mirror::Class> dst_class(
@@ -242,7 +242,7 @@
CHECK(self->IsExceptionPending());
return false;
}
- if (UNLIKELY(arg.Get() == nullptr || !arg->InstanceOf(dst_class))) {
+ if (UNLIKELY(arg == nullptr || !arg->InstanceOf(dst_class))) {
ThrowIllegalArgumentException(
StringPrintf("method %s argument %zd has type %s, got %s",
m->PrettyMethod(false).c_str(),
@@ -254,13 +254,13 @@
}
#define DO_FIRST_ARG(match_descriptor, get_fn, append) { \
- if (LIKELY(arg.Get() != nullptr && \
+ if (LIKELY(arg != nullptr && \
arg->GetClass()->DescriptorEquals(match_descriptor))) { \
ArtField* primitive_field = arg->GetClass()->GetInstanceField(0); \
append(primitive_field-> get_fn(arg.Get()));
#define DO_ARG(match_descriptor, get_fn, append) \
- } else if (LIKELY(arg.Get() != nullptr && \
+ } else if (LIKELY(arg != nullptr && \
arg->GetClass<>()->DescriptorEquals(match_descriptor))) { \
ArtField* primitive_field = arg->GetClass()->GetInstanceField(0); \
append(primitive_field-> get_fn(arg.Get()));
diff --git a/runtime/runtime.cc b/runtime/runtime.cc
index 9609bee..f8f3d76 100644
--- a/runtime/runtime.cc
+++ b/runtime/runtime.cc
@@ -95,6 +95,7 @@
#include "mirror/field.h"
#include "mirror/method.h"
#include "mirror/method_handle_impl.h"
+#include "mirror/method_handles_lookup.h"
#include "mirror/method_type.h"
#include "mirror/stack_trace_element.h"
#include "mirror/throwable.h"
@@ -1715,6 +1716,7 @@
mirror::Field::VisitRoots(visitor);
mirror::MethodType::VisitRoots(visitor);
mirror::MethodHandleImpl::VisitRoots(visitor);
+ mirror::MethodHandlesLookup::VisitRoots(visitor);
mirror::EmulatedStackFrame::VisitRoots(visitor);
mirror::ClassExt::VisitRoots(visitor);
// Visit all the primitive array types classes.
diff --git a/runtime/runtime.h b/runtime/runtime.h
index 30b1756..4a0169d 100644
--- a/runtime/runtime.h
+++ b/runtime/runtime.h
@@ -662,6 +662,8 @@
RuntimeCallbacks* GetRuntimeCallbacks();
+ void InitThreadGroups(Thread* self);
+
private:
static void InitPlatformSignalHandlers();
@@ -672,7 +674,6 @@
bool Init(RuntimeArgumentMap&& runtime_options)
SHARED_TRYLOCK_FUNCTION(true, Locks::mutator_lock_);
void InitNativeMethods() REQUIRES(!Locks::mutator_lock_);
- void InitThreadGroups(Thread* self);
void RegisterRuntimeNativeMethods(JNIEnv* env);
void StartDaemonThreads();
diff --git a/runtime/runtime_callbacks_test.cc b/runtime/runtime_callbacks_test.cc
index f1e78b4..abe99e0 100644
--- a/runtime/runtime_callbacks_test.cc
+++ b/runtime/runtime_callbacks_test.cc
@@ -294,7 +294,7 @@
const char* descriptor_y = "LY;";
Handle<mirror::Class> h_Y(
hs.NewHandle(class_linker_->FindClass(soa.Self(), descriptor_y, class_loader)));
- ASSERT_TRUE(h_Y.Get() != nullptr);
+ ASSERT_TRUE(h_Y != nullptr);
bool expect1 = Expect({ "PreDefine:LY; <art-gtest-XandY.jar>",
"PreDefine:LX; <art-gtest-XandY.jar>",
diff --git a/runtime/stack.cc b/runtime/stack.cc
index d7ba1d7..51a24e4 100644
--- a/runtime/stack.cc
+++ b/runtime/stack.cc
@@ -874,9 +874,13 @@
CHECK_EQ(GetMethod(), callee) << "Expected: " << ArtMethod::PrettyMethod(callee)
<< " Found: " << ArtMethod::PrettyMethod(GetMethod());
} else {
- CHECK_EQ(instrumentation_frame.method_, GetMethod())
- << "Expected: " << ArtMethod::PrettyMethod(instrumentation_frame.method_)
- << " Found: " << ArtMethod::PrettyMethod(GetMethod());
+ // Instrumentation generally doesn't distinguish between a method's obsolete and
+ // non-obsolete version.
+ CHECK_EQ(instrumentation_frame.method_->GetNonObsoleteMethod(),
+ GetMethod()->GetNonObsoleteMethod())
+ << "Expected: "
+ << ArtMethod::PrettyMethod(instrumentation_frame.method_->GetNonObsoleteMethod())
+ << " Found: " << ArtMethod::PrettyMethod(GetMethod()->GetNonObsoleteMethod());
}
if (num_frames_ != 0) {
// Check agreement of frame Ids only if num_frames_ is computed to avoid infinite
@@ -903,7 +907,7 @@
<< " native=" << method->IsNative()
<< std::noboolalpha
<< " entrypoints=" << method->GetEntryPointFromQuickCompiledCode()
- << "," << method->GetEntryPointFromJni()
+ << "," << (method->IsNative() ? method->GetEntryPointFromJni() : nullptr)
<< " next=" << *cur_quick_frame_;
}
diff --git a/runtime/stack_map.h b/runtime/stack_map.h
index 61d6a58..f7a6402 100644
--- a/runtime/stack_map.h
+++ b/runtime/stack_map.h
@@ -747,6 +747,7 @@
return total_bit_size_;
}
+ // Encode the encoding into the vector.
template<typename Vector>
void Encode(Vector* dest) const {
static_assert(alignof(StackMapEncoding) == 1, "Should not require alignment");
@@ -754,6 +755,7 @@
dest->insert(dest->end(), ptr, ptr + sizeof(*this));
}
+ // Decode the encoding from a pointer, updates the pointer.
void Decode(const uint8_t** ptr) {
*this = *reinterpret_cast<const StackMapEncoding*>(*ptr);
*ptr += sizeof(*this);
@@ -924,6 +926,7 @@
void Dump(VariableIndentationOutputStream* vios) const;
+ // Encode the encoding into the vector.
template<typename Vector>
void Encode(Vector* dest) const {
static_assert(alignof(InlineInfoEncoding) == 1, "Should not require alignment");
@@ -931,6 +934,7 @@
dest->insert(dest->end(), ptr, ptr + sizeof(*this));
}
+ // Decode the encoding from a pointer, updates the pointer.
void Decode(const uint8_t** ptr) {
*this = *reinterpret_cast<const InlineInfoEncoding*>(*ptr);
*ptr += sizeof(*this);
@@ -1171,6 +1175,7 @@
ComputeTableOffsets();
}
+ // Compress is not const since it calculates cache_header_size. This is used by PrepareForFillIn.
template<typename Vector>
void Compress(Vector* dest) {
dex_register_map.Encode(dest);
@@ -1210,9 +1215,9 @@
private:
// Computed fields (not serialized).
- // Header size in bytes.
+ // Header size in bytes, cached to avoid needing to re-decoding the encoding in HeaderSize.
uint32_t cache_header_size = kInvalidSize;
- // Non header size in bytes.
+ // Non header size in bytes, cached to avoid needing to re-decoding the encoding in NonHeaderSize.
uint32_t cache_non_header_size = kInvalidSize;
};
@@ -1221,7 +1226,13 @@
* The information is of the form:
*
* [CodeInfoEncoding, DexRegisterMap+, DexLocationCatalog+, StackMap+, RegisterMask+, StackMask+,
- * DexRegisterMap+, InlineInfo*]
+ * InlineInfo*]
+ *
+ * where CodeInfoEncoding is of the form:
+ *
+ * [ByteSizedTable(dex_register_map), ByteSizedTable(location_catalog),
+ * BitEncodingTable<StackMapEncoding>, BitEncodingTable<BitRegionEncoding>,
+ * BitEncodingTable<BitRegionEncoding>, BitEncodingTable<InlineInfoEncoding>]
*/
class CodeInfo {
public:
@@ -1331,7 +1342,9 @@
}
InlineInfo GetInlineInfo(size_t index, const CodeInfoEncoding& encoding) const {
- // Since we do not know the depth, we just return the whole remaining map.
+ // Since we do not know the depth, we just return the whole remaining map. The caller may
+ // access the inline info for arbitrary depths. To return the precise inline info we would need
+ // to count the depth before returning.
// TODO: Clean this up.
const size_t bit_offset = encoding.inline_info.bit_offset +
index * encoding.inline_info.encoding.BitSize();
diff --git a/runtime/thread.cc b/runtime/thread.cc
index 7b65404..3abb9fc 100644
--- a/runtime/thread.cc
+++ b/runtime/thread.cc
@@ -874,35 +874,100 @@
ScopedObjectAccess soa(self);
StackHandleScope<1> hs(self);
MutableHandle<mirror::String> peer_thread_name(hs.NewHandle(GetThreadName()));
- if (peer_thread_name.Get() == nullptr) {
+ if (peer_thread_name == nullptr) {
// The Thread constructor should have set the Thread.name to a
// non-null value. However, because we can run without code
// available (in the compiler, in tests), we manually assign the
// fields the constructor should have set.
if (runtime->IsActiveTransaction()) {
- InitPeer<true>(soa, thread_is_daemon, thread_group, thread_name.get(), thread_priority);
+ InitPeer<true>(soa,
+ tlsPtr_.opeer,
+ thread_is_daemon,
+ thread_group,
+ thread_name.get(),
+ thread_priority);
} else {
- InitPeer<false>(soa, thread_is_daemon, thread_group, thread_name.get(), thread_priority);
+ InitPeer<false>(soa,
+ tlsPtr_.opeer,
+ thread_is_daemon,
+ thread_group,
+ thread_name.get(),
+ thread_priority);
}
peer_thread_name.Assign(GetThreadName());
}
// 'thread_name' may have been null, so don't trust 'peer_thread_name' to be non-null.
- if (peer_thread_name.Get() != nullptr) {
+ if (peer_thread_name != nullptr) {
SetThreadName(peer_thread_name->ToModifiedUtf8().c_str());
}
}
+jobject Thread::CreateCompileTimePeer(JNIEnv* env,
+ const char* name,
+ bool as_daemon,
+ jobject thread_group) {
+ Runtime* runtime = Runtime::Current();
+ CHECK(!runtime->IsStarted());
+
+ if (thread_group == nullptr) {
+ thread_group = runtime->GetMainThreadGroup();
+ }
+ ScopedLocalRef<jobject> thread_name(env, env->NewStringUTF(name));
+ // Add missing null check in case of OOM b/18297817
+ if (name != nullptr && thread_name.get() == nullptr) {
+ CHECK(Thread::Current()->IsExceptionPending());
+ return nullptr;
+ }
+ jint thread_priority = GetNativePriority();
+ jboolean thread_is_daemon = as_daemon;
+
+ ScopedLocalRef<jobject> peer(env, env->AllocObject(WellKnownClasses::java_lang_Thread));
+ if (peer.get() == nullptr) {
+ CHECK(Thread::Current()->IsExceptionPending());
+ return nullptr;
+ }
+
+ // We cannot call Thread.init, as it will recursively ask for currentThread.
+
+ // The Thread constructor should have set the Thread.name to a
+ // non-null value. However, because we can run without code
+ // available (in the compiler, in tests), we manually assign the
+ // fields the constructor should have set.
+ ScopedObjectAccessUnchecked soa(Thread::Current());
+ if (runtime->IsActiveTransaction()) {
+ InitPeer<true>(soa,
+ soa.Decode<mirror::Object>(peer.get()),
+ thread_is_daemon,
+ thread_group,
+ thread_name.get(),
+ thread_priority);
+ } else {
+ InitPeer<false>(soa,
+ soa.Decode<mirror::Object>(peer.get()),
+ thread_is_daemon,
+ thread_group,
+ thread_name.get(),
+ thread_priority);
+ }
+
+ return peer.release();
+}
+
template<bool kTransactionActive>
-void Thread::InitPeer(ScopedObjectAccess& soa, jboolean thread_is_daemon, jobject thread_group,
- jobject thread_name, jint thread_priority) {
+void Thread::InitPeer(ScopedObjectAccessAlreadyRunnable& soa,
+ ObjPtr<mirror::Object> peer,
+ jboolean thread_is_daemon,
+ jobject thread_group,
+ jobject thread_name,
+ jint thread_priority) {
jni::DecodeArtField(WellKnownClasses::java_lang_Thread_daemon)->
- SetBoolean<kTransactionActive>(tlsPtr_.opeer, thread_is_daemon);
+ SetBoolean<kTransactionActive>(peer, thread_is_daemon);
jni::DecodeArtField(WellKnownClasses::java_lang_Thread_group)->
- SetObject<kTransactionActive>(tlsPtr_.opeer, soa.Decode<mirror::Object>(thread_group));
+ SetObject<kTransactionActive>(peer, soa.Decode<mirror::Object>(thread_group));
jni::DecodeArtField(WellKnownClasses::java_lang_Thread_name)->
- SetObject<kTransactionActive>(tlsPtr_.opeer, soa.Decode<mirror::Object>(thread_name));
+ SetObject<kTransactionActive>(peer, soa.Decode<mirror::Object>(thread_name));
jni::DecodeArtField(WellKnownClasses::java_lang_Thread_priority)->
- SetInt<kTransactionActive>(tlsPtr_.opeer, thread_priority);
+ SetInt<kTransactionActive>(peer, thread_priority);
}
void Thread::SetThreadName(const char* name) {
@@ -2284,7 +2349,7 @@
Handle<mirror::ObjectArray<mirror::Object>> trace(
hs.NewHandle(
mirror::ObjectArray<mirror::Object>::Alloc(hs.Self(), array_class, depth + 1)));
- if (trace.Get() == nullptr) {
+ if (trace == nullptr) {
// Acquire uninterruptible_ in all paths.
self_->StartAssertNoThreadSuspension("Building internal stack trace");
self_->AssertPendingOOMException();
@@ -2479,14 +2544,14 @@
std::string class_name(PrettyDescriptor(descriptor));
class_name_object.Assign(
mirror::String::AllocFromModifiedUtf8(soa.Self(), class_name.c_str()));
- if (class_name_object.Get() == nullptr) {
+ if (class_name_object == nullptr) {
soa.Self()->AssertPendingOOMException();
return nullptr;
}
const char* source_file = method->GetDeclaringClassSourceFile();
if (source_file != nullptr) {
source_name_object.Assign(mirror::String::AllocFromModifiedUtf8(soa.Self(), source_file));
- if (source_name_object.Get() == nullptr) {
+ if (source_name_object == nullptr) {
soa.Self()->AssertPendingOOMException();
return nullptr;
}
@@ -2496,7 +2561,7 @@
CHECK(method_name != nullptr);
Handle<mirror::String> method_name_object(
hs.NewHandle(mirror::String::AllocFromModifiedUtf8(soa.Self(), method_name)));
- if (method_name_object.Get() == nullptr) {
+ if (method_name_object == nullptr) {
return nullptr;
}
ObjPtr<mirror::StackTraceElement> obj =mirror::StackTraceElement::Alloc(soa.Self(),
@@ -2554,7 +2619,7 @@
auto* cl = runtime->GetClassLinker();
Handle<mirror::Class> exception_class(
hs.NewHandle(cl->FindClass(this, exception_class_descriptor, class_loader)));
- if (UNLIKELY(exception_class.Get() == nullptr)) {
+ if (UNLIKELY(exception_class == nullptr)) {
CHECK(IsExceptionPending());
LOG(ERROR) << "No exception class " << PrettyDescriptor(exception_class_descriptor);
return;
@@ -2570,7 +2635,7 @@
hs.NewHandle(ObjPtr<mirror::Throwable>::DownCast(exception_class->AllocObject(this))));
// If we couldn't allocate the exception, throw the pre-allocated out of memory exception.
- if (exception.Get() == nullptr) {
+ if (exception == nullptr) {
SetException(Runtime::Current()->GetPreAllocatedOutOfMemoryError());
return;
}
@@ -3485,7 +3550,8 @@
}
mirror::Object* Thread::GetPeerFromOtherThread() const {
- mirror::Object* peer = GetPeer();
+ DCHECK(tlsPtr_.jpeer == nullptr);
+ mirror::Object* peer = tlsPtr_.opeer;
if (kUseReadBarrier && Current()->GetIsGcMarking()) {
// We may call Thread::Dump() in the middle of the CC thread flip and this thread's stack
// may have not been flipped yet and peer may be a from-space (stale) ref. So explicitly
diff --git a/runtime/thread.h b/runtime/thread.h
index a46e799..d5fd9e9 100644
--- a/runtime/thread.h
+++ b/runtime/thread.h
@@ -359,6 +359,7 @@
uint64_t GetCpuMicroTime() const;
mirror::Object* GetPeer() const REQUIRES_SHARED(Locks::mutator_lock_) {
+ DCHECK(Thread::Current() == this) << "Use GetPeerFromOtherThread instead";
CHECK(tlsPtr_.jpeer == nullptr);
return tlsPtr_.opeer;
}
@@ -1173,6 +1174,12 @@
return false;
}
+ static jobject CreateCompileTimePeer(JNIEnv* env,
+ const char* name,
+ bool as_daemon,
+ jobject thread_group)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
private:
explicit Thread(bool daemon);
~Thread() REQUIRES(!Locks::mutator_lock_, !Locks::thread_suspend_count_lock_);
@@ -1188,8 +1195,12 @@
void CreatePeer(const char* name, bool as_daemon, jobject thread_group);
template<bool kTransactionActive>
- void InitPeer(ScopedObjectAccess& soa, jboolean thread_is_daemon, jobject thread_group,
- jobject thread_name, jint thread_priority)
+ static void InitPeer(ScopedObjectAccessAlreadyRunnable& soa,
+ ObjPtr<mirror::Object> peer,
+ jboolean thread_is_daemon,
+ jobject thread_group,
+ jobject thread_name,
+ jint thread_priority)
REQUIRES_SHARED(Locks::mutator_lock_);
// Avoid use, callers should use SetState. Used only by SignalCatcher::HandleSigQuit, ~Thread and
diff --git a/runtime/transaction_test.cc b/runtime/transaction_test.cc
index a43c967..97c1228 100644
--- a/runtime/transaction_test.cc
+++ b/runtime/transaction_test.cc
@@ -35,7 +35,7 @@
StackHandleScope<2> hs(soa.Self());
Handle<mirror::ClassLoader> class_loader(
hs.NewHandle(soa.Decode<mirror::ClassLoader>(jclass_loader)));
- ASSERT_TRUE(class_loader.Get() != nullptr);
+ ASSERT_TRUE(class_loader != nullptr);
// Load and initialize java.lang.ExceptionInInitializerError and the exception class used
// to abort transaction so they can be thrown during class initialization if the transaction
@@ -43,26 +43,26 @@
MutableHandle<mirror::Class> h_klass(
hs.NewHandle(class_linker_->FindSystemClass(soa.Self(),
"Ljava/lang/ExceptionInInitializerError;")));
- ASSERT_TRUE(h_klass.Get() != nullptr);
+ ASSERT_TRUE(h_klass != nullptr);
class_linker_->EnsureInitialized(soa.Self(), h_klass, true, true);
ASSERT_TRUE(h_klass->IsInitialized());
h_klass.Assign(class_linker_->FindSystemClass(soa.Self(),
Transaction::kAbortExceptionSignature));
- ASSERT_TRUE(h_klass.Get() != nullptr);
+ ASSERT_TRUE(h_klass != nullptr);
class_linker_->EnsureInitialized(soa.Self(), h_klass, true, true);
ASSERT_TRUE(h_klass->IsInitialized());
// Load and verify utility class.
h_klass.Assign(class_linker_->FindClass(soa.Self(), "LTransaction$AbortHelperClass;",
class_loader));
- ASSERT_TRUE(h_klass.Get() != nullptr);
+ ASSERT_TRUE(h_klass != nullptr);
class_linker_->VerifyClass(soa.Self(), h_klass);
ASSERT_TRUE(h_klass->IsVerified());
// Load and verify tested class.
h_klass.Assign(class_linker_->FindClass(soa.Self(), tested_class_signature, class_loader));
- ASSERT_TRUE(h_klass.Get() != nullptr);
+ ASSERT_TRUE(h_klass != nullptr);
class_linker_->VerifyClass(soa.Self(), h_klass);
ASSERT_TRUE(h_klass->IsVerified());
@@ -95,12 +95,12 @@
StackHandleScope<2> hs(soa.Self());
Handle<mirror::Class> h_klass(
hs.NewHandle(class_linker_->FindSystemClass(soa.Self(), "Ljava/lang/Object;")));
- ASSERT_TRUE(h_klass.Get() != nullptr);
+ ASSERT_TRUE(h_klass != nullptr);
Transaction transaction;
Runtime::Current()->EnterTransactionMode(&transaction);
Handle<mirror::Object> h_obj(hs.NewHandle(h_klass->AllocObject(soa.Self())));
- ASSERT_TRUE(h_obj.Get() != nullptr);
+ ASSERT_TRUE(h_obj != nullptr);
ASSERT_EQ(h_obj->GetClass(), h_klass.Get());
Runtime::Current()->ExitTransactionMode();
@@ -115,9 +115,9 @@
StackHandleScope<2> hs(soa.Self());
Handle<mirror::Class> h_klass(
hs.NewHandle(class_linker_->FindSystemClass(soa.Self(), "Ljava/lang/Object;")));
- ASSERT_TRUE(h_klass.Get() != nullptr);
+ ASSERT_TRUE(h_klass != nullptr);
Handle<mirror::Object> h_obj(hs.NewHandle(h_klass->AllocObject(soa.Self())));
- ASSERT_TRUE(h_obj.Get() != nullptr);
+ ASSERT_TRUE(h_obj != nullptr);
ASSERT_EQ(h_obj->GetClass(), h_klass.Get());
// Lock object's monitor outside the transaction.
@@ -144,7 +144,7 @@
StackHandleScope<2> hs(soa.Self());
Handle<mirror::Class> h_klass(
hs.NewHandle(class_linker_->FindSystemClass(soa.Self(), "[Ljava/lang/Object;")));
- ASSERT_TRUE(h_klass.Get() != nullptr);
+ ASSERT_TRUE(h_klass != nullptr);
constexpr int32_t kArraySize = 2;
@@ -157,7 +157,7 @@
mirror::Array::Alloc<true>(soa.Self(), h_klass.Get(), kArraySize,
h_klass->GetComponentSizeShift(),
Runtime::Current()->GetHeap()->GetCurrentAllocator())));
- ASSERT_TRUE(h_obj.Get() != nullptr);
+ ASSERT_TRUE(h_obj != nullptr);
ASSERT_EQ(h_obj->GetClass(), h_klass.Get());
Runtime::Current()->ExitTransactionMode();
@@ -172,11 +172,11 @@
StackHandleScope<4> hs(soa.Self());
Handle<mirror::ClassLoader> class_loader(
hs.NewHandle(soa.Decode<mirror::ClassLoader>(LoadDex("Transaction"))));
- ASSERT_TRUE(class_loader.Get() != nullptr);
+ ASSERT_TRUE(class_loader != nullptr);
Handle<mirror::Class> h_klass(
hs.NewHandle(class_linker_->FindClass(soa.Self(), "LStaticFieldsTest;", class_loader)));
- ASSERT_TRUE(h_klass.Get() != nullptr);
+ ASSERT_TRUE(h_klass != nullptr);
bool success = class_linker_->EnsureInitialized(soa.Self(), h_klass, true, true);
ASSERT_TRUE(success);
ASSERT_TRUE(h_klass->IsInitialized());
@@ -232,9 +232,9 @@
// Create a java.lang.Object instance to set objectField.
Handle<mirror::Class> object_klass(
hs.NewHandle(class_linker_->FindSystemClass(soa.Self(), "Ljava/lang/Object;")));
- ASSERT_TRUE(object_klass.Get() != nullptr);
+ ASSERT_TRUE(object_klass != nullptr);
Handle<mirror::Object> h_obj(hs.NewHandle(h_klass->AllocObject(soa.Self())));
- ASSERT_TRUE(h_obj.Get() != nullptr);
+ ASSERT_TRUE(h_obj != nullptr);
ASSERT_EQ(h_obj->GetClass(), h_klass.Get());
// Modify fields inside transaction then rollback changes.
@@ -270,11 +270,11 @@
StackHandleScope<5> hs(soa.Self());
Handle<mirror::ClassLoader> class_loader(
hs.NewHandle(soa.Decode<mirror::ClassLoader>(LoadDex("Transaction"))));
- ASSERT_TRUE(class_loader.Get() != nullptr);
+ ASSERT_TRUE(class_loader != nullptr);
Handle<mirror::Class> h_klass(
hs.NewHandle(class_linker_->FindClass(soa.Self(), "LInstanceFieldsTest;", class_loader)));
- ASSERT_TRUE(h_klass.Get() != nullptr);
+ ASSERT_TRUE(h_klass != nullptr);
bool success = class_linker_->EnsureInitialized(soa.Self(), h_klass, true, true);
ASSERT_TRUE(success);
ASSERT_TRUE(h_klass->IsInitialized());
@@ -282,7 +282,7 @@
// Allocate an InstanceFieldTest object.
Handle<mirror::Object> h_instance(hs.NewHandle(h_klass->AllocObject(soa.Self())));
- ASSERT_TRUE(h_instance.Get() != nullptr);
+ ASSERT_TRUE(h_instance != nullptr);
// Lookup fields.
ArtField* booleanField = h_klass->FindDeclaredInstanceField("booleanField", "Z");
@@ -334,9 +334,9 @@
// Create a java.lang.Object instance to set objectField.
Handle<mirror::Class> object_klass(
hs.NewHandle(class_linker_->FindSystemClass(soa.Self(), "Ljava/lang/Object;")));
- ASSERT_TRUE(object_klass.Get() != nullptr);
+ ASSERT_TRUE(object_klass != nullptr);
Handle<mirror::Object> h_obj(hs.NewHandle(h_klass->AllocObject(soa.Self())));
- ASSERT_TRUE(h_obj.Get() != nullptr);
+ ASSERT_TRUE(h_obj != nullptr);
ASSERT_EQ(h_obj->GetClass(), h_klass.Get());
// Modify fields inside transaction then rollback changes.
@@ -372,11 +372,11 @@
StackHandleScope<4> hs(soa.Self());
Handle<mirror::ClassLoader> class_loader(
hs.NewHandle(soa.Decode<mirror::ClassLoader>(LoadDex("Transaction"))));
- ASSERT_TRUE(class_loader.Get() != nullptr);
+ ASSERT_TRUE(class_loader != nullptr);
Handle<mirror::Class> h_klass(
hs.NewHandle(class_linker_->FindClass(soa.Self(), "LStaticArrayFieldsTest;", class_loader)));
- ASSERT_TRUE(h_klass.Get() != nullptr);
+ ASSERT_TRUE(h_klass != nullptr);
bool success = class_linker_->EnsureInitialized(soa.Self(), h_klass, true, true);
ASSERT_TRUE(success);
ASSERT_TRUE(h_klass->IsInitialized());
@@ -451,9 +451,9 @@
// Create a java.lang.Object instance to set objectField.
Handle<mirror::Class> object_klass(
hs.NewHandle(class_linker_->FindSystemClass(soa.Self(), "Ljava/lang/Object;")));
- ASSERT_TRUE(object_klass.Get() != nullptr);
+ ASSERT_TRUE(object_klass != nullptr);
Handle<mirror::Object> h_obj(hs.NewHandle(h_klass->AllocObject(soa.Self())));
- ASSERT_TRUE(h_obj.Get() != nullptr);
+ ASSERT_TRUE(h_obj != nullptr);
ASSERT_EQ(h_obj->GetClass(), h_klass.Get());
// Modify fields inside transaction then rollback changes.
@@ -489,15 +489,15 @@
StackHandleScope<3> hs(soa.Self());
Handle<mirror::ClassLoader> class_loader(
hs.NewHandle(soa.Decode<mirror::ClassLoader>(LoadDex("Transaction"))));
- ASSERT_TRUE(class_loader.Get() != nullptr);
+ ASSERT_TRUE(class_loader != nullptr);
Handle<mirror::Class> h_klass(
hs.NewHandle(class_linker_->FindClass(soa.Self(), "LTransaction$ResolveString;",
class_loader)));
- ASSERT_TRUE(h_klass.Get() != nullptr);
+ ASSERT_TRUE(h_klass != nullptr);
Handle<mirror::DexCache> h_dex_cache(hs.NewHandle(h_klass->GetDexCache()));
- ASSERT_TRUE(h_dex_cache.Get() != nullptr);
+ ASSERT_TRUE(h_dex_cache != nullptr);
const DexFile* const dex_file = h_dex_cache->GetDexFile();
ASSERT_TRUE(dex_file != nullptr);
@@ -538,12 +538,12 @@
StackHandleScope<2> hs(soa.Self());
Handle<mirror::ClassLoader> class_loader(
hs.NewHandle(soa.Decode<mirror::ClassLoader>(LoadDex("Transaction"))));
- ASSERT_TRUE(class_loader.Get() != nullptr);
+ ASSERT_TRUE(class_loader != nullptr);
Handle<mirror::Class> h_klass(
hs.NewHandle(class_linker_->FindClass(soa.Self(), "LTransaction$EmptyStatic;",
class_loader)));
- ASSERT_TRUE(h_klass.Get() != nullptr);
+ ASSERT_TRUE(h_klass != nullptr);
class_linker_->VerifyClass(soa.Self(), h_klass);
ASSERT_TRUE(h_klass->IsVerified());
@@ -562,12 +562,12 @@
StackHandleScope<2> hs(soa.Self());
Handle<mirror::ClassLoader> class_loader(
hs.NewHandle(soa.Decode<mirror::ClassLoader>(LoadDex("Transaction"))));
- ASSERT_TRUE(class_loader.Get() != nullptr);
+ ASSERT_TRUE(class_loader != nullptr);
Handle<mirror::Class> h_klass(
hs.NewHandle(class_linker_->FindClass(soa.Self(), "LTransaction$StaticFieldClass;",
class_loader)));
- ASSERT_TRUE(h_klass.Get() != nullptr);
+ ASSERT_TRUE(h_klass != nullptr);
class_linker_->VerifyClass(soa.Self(), h_klass);
ASSERT_TRUE(h_klass->IsVerified());
diff --git a/runtime/utils.h b/runtime/utils.h
index 67438b5..96e5bfa 100644
--- a/runtime/utils.h
+++ b/runtime/utils.h
@@ -301,6 +301,30 @@
}
}
+// Returns a type cast pointer if object pointed to is within the provided bounds.
+// Otherwise returns nullptr.
+template <typename T>
+inline static T BoundsCheckedCast(const void* pointer,
+ const void* lower,
+ const void* upper) {
+ const uint8_t* bound_begin = static_cast<const uint8_t*>(lower);
+ const uint8_t* bound_end = static_cast<const uint8_t*>(upper);
+ DCHECK(bound_begin <= bound_end);
+
+ T result = reinterpret_cast<T>(pointer);
+ const uint8_t* begin = static_cast<const uint8_t*>(pointer);
+ const uint8_t* end = begin + sizeof(*result);
+ if (begin < bound_begin || end > bound_end || begin > end) {
+ return nullptr;
+ }
+ return result;
+}
+
+template <typename T, size_t size>
+constexpr size_t ArrayCount(const T (&)[size]) {
+ return size;
+}
+
} // namespace art
#endif // ART_RUNTIME_UTILS_H_
diff --git a/runtime/utils/dex_cache_arrays_layout-inl.h b/runtime/utils/dex_cache_arrays_layout-inl.h
index 2812c21..9865821 100644
--- a/runtime/utils/dex_cache_arrays_layout-inl.h
+++ b/runtime/utils/dex_cache_arrays_layout-inl.h
@@ -29,7 +29,8 @@
namespace art {
inline DexCacheArraysLayout::DexCacheArraysLayout(PointerSize pointer_size,
- const DexFile::Header& header)
+ const DexFile::Header& header,
+ uint32_t num_call_sites)
: pointer_size_(pointer_size),
/* types_offset_ is always 0u, so it's constexpr */
methods_offset_(
@@ -40,19 +41,19 @@
RoundUp(strings_offset_ + StringsSize(header.string_ids_size_), FieldsAlignment())),
method_types_offset_(
RoundUp(fields_offset_ + FieldsSize(header.field_ids_size_), MethodTypesAlignment())),
- size_(
- RoundUp(method_types_offset_ + MethodTypesSize(header.proto_ids_size_), Alignment())) {
+ call_sites_offset_(
+ RoundUp(method_types_offset_ + MethodTypesSize(header.proto_ids_size_),
+ MethodTypesAlignment())),
+ size_(RoundUp(call_sites_offset_ + CallSitesSize(num_call_sites), Alignment())) {
}
inline DexCacheArraysLayout::DexCacheArraysLayout(PointerSize pointer_size, const DexFile* dex_file)
- : DexCacheArraysLayout(pointer_size, dex_file->GetHeader()) {
+ : DexCacheArraysLayout(pointer_size, dex_file->GetHeader(), dex_file->NumCallSiteIds()) {
}
-constexpr size_t DexCacheArraysLayout::Alignment() {
- // mirror::Type/String/MethodTypeDexCacheType alignment is 8,
- // i.e. higher than or equal to the pointer alignment.
- static_assert(alignof(mirror::TypeDexCacheType) == 8,
- "Expecting alignof(ClassDexCacheType) == 8");
+inline constexpr size_t DexCacheArraysLayout::Alignment() {
+ // GcRoot<> alignment is 4, i.e. lower than or equal to the pointer alignment.
+ static_assert(alignof(GcRoot<mirror::Class>) == 4, "Expecting alignof(GcRoot<>) == 4");
static_assert(alignof(mirror::StringDexCacheType) == 8,
"Expecting alignof(StringDexCacheType) == 8");
static_assert(alignof(mirror::MethodTypeDexCacheType) == 8,
@@ -62,22 +63,17 @@
}
template <typename T>
-constexpr PointerSize GcRootAsPointerSize() {
+static constexpr PointerSize GcRootAsPointerSize() {
static_assert(sizeof(GcRoot<T>) == 4U, "Unexpected GcRoot size");
return PointerSize::k32;
}
inline size_t DexCacheArraysLayout::TypeOffset(dex::TypeIndex type_idx) const {
- return types_offset_ + ElementOffset(PointerSize::k64,
- type_idx.index_ % mirror::DexCache::kDexCacheTypeCacheSize);
+ return types_offset_ + ElementOffset(GcRootAsPointerSize<mirror::Class>(), type_idx.index_);
}
inline size_t DexCacheArraysLayout::TypesSize(size_t num_elements) const {
- size_t cache_size = mirror::DexCache::kDexCacheTypeCacheSize;
- if (num_elements < cache_size) {
- cache_size = num_elements;
- }
- return ArraySize(PointerSize::k64, cache_size);
+ return ArraySize(GcRootAsPointerSize<mirror::Class>(), num_elements);
}
inline size_t DexCacheArraysLayout::TypesAlignment() const {
@@ -138,10 +134,18 @@
inline size_t DexCacheArraysLayout::MethodTypesAlignment() const {
static_assert(alignof(mirror::MethodTypeDexCacheType) == 8,
- "alignof(MethodTypeDexCacheType) != 8");
+ "Expecting alignof(MethodTypeDexCacheType) == 8");
return alignof(mirror::MethodTypeDexCacheType);
}
+inline size_t DexCacheArraysLayout::CallSitesSize(size_t num_elements) const {
+ return ArraySize(GcRootAsPointerSize<mirror::CallSite>(), num_elements);
+}
+
+inline size_t DexCacheArraysLayout::CallSitesAlignment() const {
+ return alignof(GcRoot<mirror::CallSite>);
+}
+
inline size_t DexCacheArraysLayout::ElementOffset(PointerSize element_size, uint32_t idx) {
return static_cast<size_t>(element_size) * idx;
}
diff --git a/runtime/utils/dex_cache_arrays_layout.h b/runtime/utils/dex_cache_arrays_layout.h
index 7d4b23a..ed677ed 100644
--- a/runtime/utils/dex_cache_arrays_layout.h
+++ b/runtime/utils/dex_cache_arrays_layout.h
@@ -37,11 +37,14 @@
strings_offset_(0u),
fields_offset_(0u),
method_types_offset_(0u),
+ call_sites_offset_(0u),
size_(0u) {
}
// Construct a layout for a particular dex file header.
- DexCacheArraysLayout(PointerSize pointer_size, const DexFile::Header& header);
+ DexCacheArraysLayout(PointerSize pointer_size,
+ const DexFile::Header& header,
+ uint32_t num_call_sites);
// Construct a layout for a particular dex file.
DexCacheArraysLayout(PointerSize pointer_size, const DexFile* dex_file);
@@ -104,6 +107,14 @@
size_t MethodTypesAlignment() const;
+ size_t CallSitesOffset() const {
+ return call_sites_offset_;
+ }
+
+ size_t CallSitesSize(size_t num_elements) const;
+
+ size_t CallSitesAlignment() const;
+
private:
static constexpr size_t types_offset_ = 0u;
const PointerSize pointer_size_; // Must be first for construction initialization order.
@@ -111,6 +122,7 @@
const size_t strings_offset_;
const size_t fields_offset_;
const size_t method_types_offset_;
+ const size_t call_sites_offset_;
const size_t size_;
static size_t Alignment(PointerSize pointer_size);
diff --git a/runtime/utils_test.cc b/runtime/utils_test.cc
index 02f1e1b..634bd47 100644
--- a/runtime/utils_test.cc
+++ b/runtime/utils_test.cc
@@ -408,4 +408,23 @@
IsValidDescriptor(reinterpret_cast<char*>(&unpaired_surrogate_with_multibyte_sequence[0])));
}
+TEST_F(UtilsTest, ArrayCount) {
+ int i[64];
+ EXPECT_EQ(ArrayCount(i), 64u);
+ char c[7];
+ EXPECT_EQ(ArrayCount(c), 7u);
+}
+
+TEST_F(UtilsTest, BoundsCheckedCast) {
+ char buffer[64];
+ const char* buffer_end = buffer + ArrayCount(buffer);
+ EXPECT_EQ(BoundsCheckedCast<const uint64_t*>(nullptr, buffer, buffer_end), nullptr);
+ EXPECT_EQ(BoundsCheckedCast<const uint64_t*>(buffer, buffer, buffer_end),
+ reinterpret_cast<const uint64_t*>(buffer));
+ EXPECT_EQ(BoundsCheckedCast<const uint64_t*>(buffer + 56, buffer, buffer_end),
+ reinterpret_cast<const uint64_t*>(buffer + 56));
+ EXPECT_EQ(BoundsCheckedCast<const uint64_t*>(buffer - 1, buffer, buffer_end), nullptr);
+ EXPECT_EQ(BoundsCheckedCast<const uint64_t*>(buffer + 57, buffer, buffer_end), nullptr);
+}
+
} // namespace art
diff --git a/runtime/verifier/method_verifier.cc b/runtime/verifier/method_verifier.cc
index 9598870..16739fa 100644
--- a/runtime/verifier/method_verifier.cc
+++ b/runtime/verifier/method_verifier.cc
@@ -2399,8 +2399,7 @@
const RegType& res_type = ResolveClassAndCheckAccess(type_idx);
if (res_type.IsConflict()) {
// If this is a primitive type, fail HARD.
- ObjPtr<mirror::Class> klass =
- ClassLinker::LookupResolvedType(type_idx, dex_cache_.Get(), class_loader_.Get());
+ mirror::Class* klass = dex_cache_->GetResolvedType(type_idx);
if (klass != nullptr && klass->IsPrimitive()) {
Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "using primitive type "
<< dex_file_->StringByTypeIdx(type_idx) << " in instanceof in "
@@ -3115,6 +3114,44 @@
just_set_result = true;
break;
}
+ case Instruction::INVOKE_CUSTOM:
+ case Instruction::INVOKE_CUSTOM_RANGE: {
+ // Verify registers based on method_type in the call site.
+ bool is_range = (inst->Opcode() == Instruction::INVOKE_CUSTOM_RANGE);
+
+ // Step 1. Check the call site that produces the method handle for invocation
+ const uint32_t call_site_idx = is_range ? inst->VRegB_3rc() : inst->VRegB_35c();
+ if (!CheckCallSite(call_site_idx)) {
+ DCHECK(HasFailures());
+ break;
+ }
+
+ // Step 2. Check the register arguments correspond to the expected arguments for the
+ // method handle produced by step 1. The dex file verifier has checked ranges for
+ // the first three arguments and CheckCallSite has checked the method handle type.
+ CallSiteArrayValueIterator it(*dex_file_, dex_file_->GetCallSiteId(call_site_idx));
+ it.Next(); // Skip to name.
+ it.Next(); // Skip to method type of the method handle
+ const uint32_t proto_idx = static_cast<uint32_t>(it.GetJavaValue().i);
+ const DexFile::ProtoId& proto_id = dex_file_->GetProtoId(proto_idx);
+ DexFileParameterIterator param_it(*dex_file_, proto_id);
+ // Treat method as static as it has yet to be determined.
+ VerifyInvocationArgsFromIterator(¶m_it, inst, METHOD_STATIC, is_range, nullptr);
+ const char* return_descriptor = dex_file_->GetReturnTypeDescriptor(proto_id);
+
+ // Step 3. Propagate return type information
+ const RegType& return_type =
+ reg_types_.FromDescriptor(GetClassLoader(), return_descriptor, false);
+ if (!return_type.IsLowHalf()) {
+ work_line_->SetResultRegisterType(this, return_type);
+ } else {
+ work_line_->SetResultRegisterTypeWide(return_type, return_type.HighHalf(®_types_));
+ }
+ just_set_result = true;
+ // TODO: Add compiler support for invoke-custom (b/35337872).
+ Fail(VERIFY_ERROR_FORCE_INTERPRETER);
+ break;
+ }
case Instruction::NEG_INT:
case Instruction::NOT_INT:
work_line_->CheckUnaryOp(this, inst, reg_types_.Integer(), reg_types_.Integer());
@@ -3424,7 +3461,7 @@
/* These should never appear during verification. */
case Instruction::UNUSED_3E ... Instruction::UNUSED_43:
case Instruction::UNUSED_F3 ... Instruction::UNUSED_F9:
- case Instruction::UNUSED_FC ... Instruction::UNUSED_FF:
+ case Instruction::UNUSED_FE ... Instruction::UNUSED_FF:
case Instruction::UNUSED_79:
case Instruction::UNUSED_7A:
Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "Unexpected opcode " << inst->DumpString(dex_file_);
@@ -3685,16 +3722,9 @@
}
const RegType& MethodVerifier::ResolveClassAndCheckAccess(dex::TypeIndex class_idx) {
- mirror::Class* klass = can_load_classes_
- ? Runtime::Current()->GetClassLinker()->ResolveType(
- *dex_file_, class_idx, dex_cache_, class_loader_)
- : ClassLinker::LookupResolvedType(class_idx, dex_cache_.Get(), class_loader_.Get()).Ptr();
- if (can_load_classes_ && klass == nullptr) {
- DCHECK(self_->IsExceptionPending());
- self_->ClearException();
- }
+ mirror::Class* klass = dex_cache_->GetResolvedType(class_idx);
const RegType* result = nullptr;
- if (klass != nullptr && !klass->IsErroneous()) {
+ if (klass != nullptr) {
bool precise = klass->CannotBeAssignedFromOtherTypes();
if (precise && !IsInstantiableOrPrimitive(klass)) {
const char* descriptor = dex_file_->StringByTypeIdx(class_idx);
@@ -3717,6 +3747,10 @@
<< "' in " << GetDeclaringClass();
return *result;
}
+ if (klass == nullptr && !result->IsUnresolvedTypes()) {
+ klass = result->GetClass();
+ dex_cache_->SetResolvedType(class_idx, klass);
+ }
// Record result of class resolution attempt.
VerifierDeps::MaybeRecordClassResolution(*dex_file_, class_idx, klass);
@@ -4098,6 +4132,116 @@
VerifyInvocationArgsFromIterator(&it, inst, method_type, is_range, nullptr);
}
+bool MethodVerifier::CheckCallSite(uint32_t call_site_idx) {
+ CallSiteArrayValueIterator it(*dex_file_, dex_file_->GetCallSiteId(call_site_idx));
+ // Check essential arguments are provided. The dex file verifier has verified indicies of the
+ // main values (method handle, name, method_type).
+ if (it.Size() < 3) {
+ Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "Call site #" << call_site_idx
+ << " has too few arguments: "
+ << it.Size() << "< 3";
+ return false;
+ }
+
+ // Get and check the first argument: the method handle.
+ uint32_t method_handle_idx = static_cast<uint32_t>(it.GetJavaValue().i);
+ it.Next();
+ const DexFile::MethodHandleItem& mh = dex_file_->GetMethodHandle(method_handle_idx);
+ if (mh.method_handle_type_ != static_cast<uint16_t>(DexFile::MethodHandleType::kInvokeStatic)) {
+ Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "Call site #" << call_site_idx
+ << " argument 0 method handle type is not InvokeStatic";
+ return false;
+ }
+
+ // Skip the second argument, the name to resolve, as checked by the
+ // dex file verifier.
+ it.Next();
+
+ // Skip the third argument, the method type expected, as checked by
+ // the dex file verifier.
+ it.Next();
+
+ // Check the bootstrap method handle and remaining arguments.
+ const DexFile::MethodId& method_id = dex_file_->GetMethodId(mh.field_or_method_idx_);
+ uint32_t length;
+ const char* shorty = dex_file_->GetMethodShorty(method_id, &length);
+
+ if (it.Size() < length - 1) {
+ Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "Call site #" << call_site_idx
+ << " too few arguments for bootstrap method: "
+ << it.Size() << " < " << (length - 1);
+ return false;
+ }
+
+ // Check the return type and first 3 arguments are references
+ // (CallSite, Lookup, String, MethodType). If they are not of the
+ // expected types (or subtypes), it will trigger a
+ // WrongMethodTypeException during execution.
+ if (shorty[0] != 'L') {
+ Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "Call site #" << call_site_idx
+ << " bootstrap return type is not a reference";
+ return false;
+ }
+
+ for (uint32_t i = 1; i < 4; ++i) {
+ if (shorty[i] != 'L') {
+ Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "Call site #" << call_site_idx
+ << " bootstrap method argument " << (i - 1)
+ << " is not a reference";
+ return false;
+ }
+ }
+
+ // Check the optional arguments.
+ for (uint32_t i = 4; i < length; ++i, it.Next()) {
+ bool match = false;
+ switch (it.GetValueType()) {
+ case EncodedArrayValueIterator::ValueType::kBoolean:
+ case EncodedArrayValueIterator::ValueType::kByte:
+ case EncodedArrayValueIterator::ValueType::kShort:
+ case EncodedArrayValueIterator::ValueType::kChar:
+ case EncodedArrayValueIterator::ValueType::kInt:
+ // These all fit within one register and encoders do not seem
+ // too exacting on the encoding type they use (ie using
+ // integer for all of these).
+ match = (strchr("ZBCSI", shorty[i]) != nullptr);
+ break;
+ case EncodedArrayValueIterator::ValueType::kLong:
+ match = ('J' == shorty[i]);
+ break;
+ case EncodedArrayValueIterator::ValueType::kFloat:
+ match = ('F' == shorty[i]);
+ break;
+ case EncodedArrayValueIterator::ValueType::kDouble:
+ match = ('D' == shorty[i]);
+ break;
+ case EncodedArrayValueIterator::ValueType::kMethodType:
+ case EncodedArrayValueIterator::ValueType::kMethodHandle:
+ case EncodedArrayValueIterator::ValueType::kString:
+ case EncodedArrayValueIterator::ValueType::kType:
+ case EncodedArrayValueIterator::ValueType::kNull:
+ match = ('L' == shorty[i]);
+ break;
+ case EncodedArrayValueIterator::ValueType::kField:
+ case EncodedArrayValueIterator::ValueType::kMethod:
+ case EncodedArrayValueIterator::ValueType::kEnum:
+ case EncodedArrayValueIterator::ValueType::kArray:
+ case EncodedArrayValueIterator::ValueType::kAnnotation:
+ // Unreachable based on current EncodedArrayValueIterator::Next().
+ UNREACHABLE();
+ }
+
+ if (!match) {
+ Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "Call site #" << call_site_idx
+ << " bootstrap method argument " << (i - 1)
+ << " expected " << shorty[i]
+ << " got value type: " << it.GetValueType();
+ return false;
+ }
+ }
+ return true;
+}
+
class MethodParamListDescriptorIterator {
public:
explicit MethodParamListDescriptorIterator(ArtMethod* res_method) :
diff --git a/runtime/verifier/method_verifier.h b/runtime/verifier/method_verifier.h
index fa5a698..7b67967 100644
--- a/runtime/verifier/method_verifier.h
+++ b/runtime/verifier/method_verifier.h
@@ -697,6 +697,11 @@
REQUIRES_SHARED(Locks::mutator_lock_);
/*
+ * Verify the arguments present for a call site. Returns "true" if all is well, "false" otherwise.
+ */
+ bool CheckCallSite(uint32_t call_site_idx);
+
+ /*
* Verify that the target instruction is not "move-exception". It's important that the only way
* to execute a move-exception is as the first instruction of an exception handler.
* Returns "true" if all is well, "false" if the target instruction is move-exception.
diff --git a/runtime/verifier/verifier_deps.cc b/runtime/verifier/verifier_deps.cc
index 1131607..000cf7c 100644
--- a/runtime/verifier/verifier_deps.cc
+++ b/runtime/verifier/verifier_deps.cc
@@ -890,12 +890,12 @@
source.Assign(
FindClassAndClearException(class_linker, self, source_desc.c_str(), class_loader));
- if (destination.Get() == nullptr) {
+ if (destination == nullptr) {
LOG(INFO) << "VerifiersDeps: Could not resolve class " << destination_desc;
return false;
}
- if (source.Get() == nullptr) {
+ if (source == nullptr) {
LOG(INFO) << "VerifierDeps: Could not resolve class " << source_desc;
return false;
}
@@ -925,7 +925,7 @@
cls.Assign(FindClassAndClearException(class_linker, self, descriptor, class_loader));
if (entry.IsResolved()) {
- if (cls.Get() == nullptr) {
+ if (cls == nullptr) {
LOG(INFO) << "VerifierDeps: Could not resolve class " << descriptor;
return false;
} else if (entry.GetAccessFlags() != GetAccessFlags(cls.Get())) {
@@ -939,7 +939,7 @@
<< std::dec;
return false;
}
- } else if (cls.Get() != nullptr) {
+ } else if (cls != nullptr) {
LOG(INFO) << "VerifierDeps: Unexpected successful resolution of class " << descriptor;
return false;
}
diff --git a/runtime/zip_archive.cc b/runtime/zip_archive.cc
index cd79bb6..416873f 100644
--- a/runtime/zip_archive.cc
+++ b/runtime/zip_archive.cc
@@ -23,10 +23,16 @@
#include <unistd.h>
#include <vector>
+#include "android-base/stringprintf.h"
#include "base/unix_file/fd_file.h"
namespace art {
+// Log file contents and mmap info when mapping entries directly.
+static constexpr const bool kDebugZipMapDirectly = false;
+
+using android::base::StringPrintf;
+
uint32_t ZipEntry::GetUncompressedLength() {
return zip_entry_->uncompressed_length;
}
@@ -35,6 +41,15 @@
return zip_entry_->crc32;
}
+bool ZipEntry::IsUncompressed() {
+ return zip_entry_->method == kCompressStored;
+}
+
+bool ZipEntry::IsAlignedTo(size_t alignment) {
+ DCHECK(IsPowerOfTwo(alignment)) << alignment;
+ return IsAlignedParam(zip_entry_->offset, static_cast<int>(alignment));
+}
+
ZipEntry::~ZipEntry() {
delete zip_entry_;
}
@@ -73,6 +88,102 @@
return map.release();
}
+MemMap* ZipEntry::MapDirectlyFromFile(const char* zip_filename, std::string* error_msg) {
+ const int zip_fd = GetFileDescriptor(handle_);
+ const char* entry_filename = entry_name_.c_str();
+
+ // Should not happen since we don't have a memory ZipArchive constructor.
+ // However the underlying ZipArchive isn't required to have an FD,
+ // so check to be sure.
+ CHECK_GE(zip_fd, 0) <<
+ StringPrintf("Cannot map '%s' (in zip '%s') directly because the zip archive "
+ "is not file backed.",
+ entry_filename,
+ zip_filename);
+
+ if (!IsUncompressed()) {
+ *error_msg = StringPrintf("Cannot map '%s' (in zip '%s') directly because it is compressed.",
+ entry_filename,
+ zip_filename);
+ return nullptr;
+ } else if (zip_entry_->uncompressed_length != zip_entry_->compressed_length) {
+ *error_msg = StringPrintf("Cannot map '%s' (in zip '%s') directly because "
+ "entry has bad size (%u != %u).",
+ entry_filename,
+ zip_filename,
+ zip_entry_->uncompressed_length,
+ zip_entry_->compressed_length);
+ return nullptr;
+ }
+
+ std::string name(entry_filename);
+ name += " mapped directly in memory from ";
+ name += zip_filename;
+
+ const off_t offset = zip_entry_->offset;
+
+ if (kDebugZipMapDirectly) {
+ LOG(INFO) << "zip_archive: " << "make mmap of " << name << " @ offset = " << offset;
+ }
+
+ std::unique_ptr<MemMap> map(
+ MemMap::MapFileAtAddress(nullptr, // Expected pointer address
+ GetUncompressedLength(), // Byte count
+ PROT_READ | PROT_WRITE,
+ MAP_PRIVATE,
+ zip_fd,
+ offset,
+ false, // Don't restrict allocation to lower4GB
+ false, // Doesn't overlap existing map (reuse=false)
+ name.c_str(),
+ /*out*/error_msg));
+
+ if (map == nullptr) {
+ DCHECK(!error_msg->empty());
+ }
+
+ if (kDebugZipMapDirectly) {
+ // Dump contents of file, same format as using this shell command:
+ // $> od -j <offset> -t x1 <zip_filename>
+ static constexpr const int kMaxDumpChars = 15;
+ lseek(zip_fd, 0, SEEK_SET);
+
+ int count = offset + kMaxDumpChars;
+
+ std::string tmp;
+ char buf;
+
+ // Dump file contents.
+ int i = 0;
+ while (read(zip_fd, &buf, 1) > 0 && i < count) {
+ tmp += StringPrintf("%3d ", (unsigned int)buf);
+ ++i;
+ }
+
+ LOG(INFO) << "map_fd raw bytes starting at 0";
+ LOG(INFO) << "" << tmp;
+ LOG(INFO) << "---------------------------";
+
+ // Dump map contents.
+ if (map != nullptr) {
+ tmp = "";
+
+ count = kMaxDumpChars;
+
+ uint8_t* begin = map->Begin();
+ for (i = 0; i < count; ++i) {
+ tmp += StringPrintf("%3d ", (unsigned int)begin[i]);
+ }
+
+ LOG(INFO) << "map address " << StringPrintf("%p", begin);
+ LOG(INFO) << "map first " << kMaxDumpChars << " chars:";
+ LOG(INFO) << tmp;
+ }
+ }
+
+ return map.release();
+}
+
static void SetCloseOnExec(int fd) {
// This dance is more portable than Linux's O_CLOEXEC open(2) flag.
int flags = fcntl(fd, F_GETFD);
@@ -129,7 +240,7 @@
return nullptr;
}
- return new ZipEntry(handle_, zip_entry.release());
+ return new ZipEntry(handle_, zip_entry.release(), name);
}
ZipArchive::~ZipArchive() {
diff --git a/runtime/zip_archive.h b/runtime/zip_archive.h
index 42bf55c..1858444 100644
--- a/runtime/zip_archive.h
+++ b/runtime/zip_archive.h
@@ -37,19 +37,35 @@
class ZipEntry {
public:
bool ExtractToFile(File& file, std::string* error_msg);
+ // Extract this entry to anonymous memory (R/W).
+ // Returns null on failure and sets error_msg.
MemMap* ExtractToMemMap(const char* zip_filename, const char* entry_filename,
std::string* error_msg);
+ // Create a file-backed private (clean, R/W) memory mapping to this entry.
+ // 'zip_filename' is used for diagnostics only,
+ // the original file that the ZipArchive was open with is used
+ // for the mapping.
+ //
+ // Will only succeed if the entry is stored uncompressed.
+ // Returns null on failure and sets error_msg.
+ MemMap* MapDirectlyFromFile(const char* zip_filename, /*out*/std::string* error_msg);
virtual ~ZipEntry();
uint32_t GetUncompressedLength();
uint32_t GetCrc32();
+ bool IsUncompressed();
+ bool IsAlignedTo(size_t alignment);
+
private:
ZipEntry(ZipArchiveHandle handle,
- ::ZipEntry* zip_entry) : handle_(handle), zip_entry_(zip_entry) {}
+ ::ZipEntry* zip_entry,
+ const std::string& entry_name)
+ : handle_(handle), zip_entry_(zip_entry), entry_name_(entry_name) {}
ZipArchiveHandle handle_;
::ZipEntry* const zip_entry_;
+ std::string const entry_name_;
friend class ZipArchive;
DISALLOW_COPY_AND_ASSIGN(ZipEntry);
diff --git a/test/021-string2/src/Main.java b/test/021-string2/src/Main.java
index df0a3dd..5a43a4f 100644
--- a/test/021-string2/src/Main.java
+++ b/test/021-string2/src/Main.java
@@ -117,6 +117,9 @@
" " + $noinline$equals(s0_3, s0_1) +
" " + $noinline$equals(s0_3, s0_2) +
" " + $noinline$equals(s0_3, s0_3));
+
+ testEqualsConstString();
+ testConstStringEquals();
}
public static void testCompareToAndEquals() {
@@ -539,6 +542,266 @@
}
}
+ public static void testEqualsConstString() {
+ Assert.assertTrue($noinline$equalsConstString0(""));
+ Assert.assertFalse($noinline$equalsConstString0("1"));
+
+ Assert.assertTrue($noinline$equalsConstString7("0123456"));
+ Assert.assertFalse($noinline$equalsConstString7("012345"));
+ Assert.assertFalse($noinline$equalsConstString7("01234567"));
+ Assert.assertFalse($noinline$equalsConstString7("012345x"));
+ Assert.assertFalse($noinline$equalsConstString7("012345\u0440"));
+
+ Assert.assertTrue($noinline$equalsConstString14("01234567890123"));
+ Assert.assertFalse($noinline$equalsConstString14("0123456789012"));
+ Assert.assertFalse($noinline$equalsConstString14("012345678901234"));
+ Assert.assertFalse($noinline$equalsConstString14("0123456789012x"));
+ Assert.assertFalse($noinline$equalsConstString14("0123456789012\u0440"));
+
+ Assert.assertTrue($noinline$equalsConstString24("012345678901234567890123"));
+ Assert.assertFalse($noinline$equalsConstString24("01234567890123456789012"));
+ Assert.assertFalse($noinline$equalsConstString24("0123456789012345678901234"));
+ Assert.assertFalse($noinline$equalsConstString24("01234567890123456789012x"));
+ Assert.assertFalse($noinline$equalsConstString24("01234567890123456789012\u0440"));
+
+ Assert.assertTrue($noinline$equalsConstString29("01234567890123456789012345678"));
+ Assert.assertFalse($noinline$equalsConstString29("0123456789012345678901234567"));
+ Assert.assertFalse($noinline$equalsConstString29("012345678901234567890123456789"));
+ Assert.assertFalse($noinline$equalsConstString29("0123456789012345678901234567x"));
+ Assert.assertFalse($noinline$equalsConstString29("0123456789012345678901234567\u0440"));
+
+ Assert.assertTrue($noinline$equalsConstString35("01234567890123456789012345678901234"));
+ Assert.assertFalse($noinline$equalsConstString35("0123456789012345678901234567890123"));
+ Assert.assertFalse($noinline$equalsConstString35("012345678901234567890123456789012345"));
+ Assert.assertFalse($noinline$equalsConstString35("0123456789012345678901234567890123x"));
+ Assert.assertFalse(
+ $noinline$equalsConstString35("0123456789012345678901234567890123\u0440"));
+
+ Assert.assertTrue($noinline$equalsConstNonAsciiString7("\u0440123456"));
+ Assert.assertFalse($noinline$equalsConstNonAsciiString7("\u044012345"));
+ Assert.assertFalse($noinline$equalsConstNonAsciiString7("\u04401234567"));
+ Assert.assertFalse($noinline$equalsConstNonAsciiString7("\u044012345x"));
+ Assert.assertFalse($noinline$equalsConstNonAsciiString7("0123456"));
+
+ Assert.assertTrue($noinline$equalsConstNonAsciiString14("\u04401234567890123"));
+ Assert.assertFalse($noinline$equalsConstNonAsciiString14("\u0440123456789012"));
+ Assert.assertFalse($noinline$equalsConstNonAsciiString14("\u044012345678901234"));
+ Assert.assertFalse($noinline$equalsConstNonAsciiString14("\u0440123456789012x"));
+ Assert.assertFalse($noinline$equalsConstNonAsciiString14("01234567890123"));
+
+ Assert.assertTrue($noinline$equalsConstNonAsciiString24("\u044012345678901234567890123"));
+ Assert.assertFalse($noinline$equalsConstNonAsciiString24("\u04401234567890123456789012"));
+ Assert.assertFalse($noinline$equalsConstNonAsciiString24("\u0440123456789012345678901234"));
+ Assert.assertFalse($noinline$equalsConstNonAsciiString24("\u04401234567890123456789012x"));
+ Assert.assertFalse($noinline$equalsConstNonAsciiString24("\012345678901234567890123"));
+
+ Assert.assertTrue(
+ $noinline$equalsConstNonAsciiString29("\u04401234567890123456789012345678"));
+ Assert.assertFalse(
+ $noinline$equalsConstNonAsciiString29("\u0440123456789012345678901234567"));
+ Assert.assertFalse(
+ $noinline$equalsConstNonAsciiString29("\u044012345678901234567890123456789"));
+ Assert.assertFalse(
+ $noinline$equalsConstNonAsciiString29("\u0440123456789012345678901234567x"));
+ Assert.assertFalse($noinline$equalsConstNonAsciiString29("01234567890123456789012345678"));
+
+ Assert.assertTrue(
+ $noinline$equalsConstNonAsciiString35("\u04401234567890123456789012345678901234"));
+ Assert.assertFalse(
+ $noinline$equalsConstNonAsciiString35("\u0440123456789012345678901234567890123"));
+ Assert.assertFalse(
+ $noinline$equalsConstNonAsciiString35("\u044012345678901234567890123456789012345"));
+ Assert.assertFalse(
+ $noinline$equalsConstNonAsciiString35("\u0440123456789012345678901234567890123x"));
+ Assert.assertFalse(
+ $noinline$equalsConstNonAsciiString35("01234567890123456789012345678901234"));
+ }
+
+ public static void testConstStringEquals() {
+ Assert.assertTrue($noinline$constString0Equals(""));
+ Assert.assertFalse($noinline$constString0Equals("1"));
+
+ Assert.assertTrue($noinline$constString7Equals("0123456"));
+ Assert.assertFalse($noinline$constString7Equals("012345"));
+ Assert.assertFalse($noinline$constString7Equals("01234567"));
+ Assert.assertFalse($noinline$constString7Equals("012345x"));
+ Assert.assertFalse($noinline$constString7Equals("012345\u0440"));
+
+ Assert.assertTrue($noinline$constString14Equals("01234567890123"));
+ Assert.assertFalse($noinline$constString14Equals("0123456789012"));
+ Assert.assertFalse($noinline$constString14Equals("012345678901234"));
+ Assert.assertFalse($noinline$constString14Equals("0123456789012x"));
+ Assert.assertFalse($noinline$constString14Equals("0123456789012\u0440"));
+
+ Assert.assertTrue($noinline$constString24Equals("012345678901234567890123"));
+ Assert.assertFalse($noinline$constString24Equals("01234567890123456789012"));
+ Assert.assertFalse($noinline$constString24Equals("0123456789012345678901234"));
+ Assert.assertFalse($noinline$constString24Equals("01234567890123456789012x"));
+ Assert.assertFalse($noinline$constString24Equals("01234567890123456789012\u0440"));
+
+ Assert.assertTrue($noinline$constString29Equals("01234567890123456789012345678"));
+ Assert.assertFalse($noinline$constString29Equals("0123456789012345678901234567"));
+ Assert.assertFalse($noinline$constString29Equals("012345678901234567890123456789"));
+ Assert.assertFalse($noinline$constString29Equals("0123456789012345678901234567x"));
+ Assert.assertFalse($noinline$constString29Equals("0123456789012345678901234567\u0440"));
+
+ Assert.assertTrue($noinline$constString35Equals("01234567890123456789012345678901234"));
+ Assert.assertFalse($noinline$constString35Equals("0123456789012345678901234567890123"));
+ Assert.assertFalse($noinline$constString35Equals("012345678901234567890123456789012345"));
+ Assert.assertFalse($noinline$constString35Equals("0123456789012345678901234567890123x"));
+ Assert.assertFalse(
+ $noinline$constString35Equals("0123456789012345678901234567890123\u0040"));
+
+ Assert.assertTrue($noinline$constNonAsciiString7Equals("\u0440123456"));
+ Assert.assertFalse($noinline$constNonAsciiString7Equals("\u044012345"));
+ Assert.assertFalse($noinline$constNonAsciiString7Equals("\u04401234567"));
+ Assert.assertFalse($noinline$constNonAsciiString7Equals("\u044012345x"));
+ Assert.assertFalse($noinline$constNonAsciiString7Equals("0123456"));
+
+ Assert.assertTrue($noinline$constNonAsciiString14Equals("\u04401234567890123"));
+ Assert.assertFalse($noinline$constNonAsciiString14Equals("\u0440123456789012"));
+ Assert.assertFalse($noinline$constNonAsciiString14Equals("\u044012345678901234"));
+ Assert.assertFalse($noinline$constNonAsciiString14Equals("\u0440123456789012x"));
+ Assert.assertFalse($noinline$constNonAsciiString14Equals("01234567890123"));
+
+ Assert.assertTrue($noinline$constNonAsciiString24Equals("\u044012345678901234567890123"));
+ Assert.assertFalse($noinline$constNonAsciiString24Equals("\u04401234567890123456789012"));
+ Assert.assertFalse($noinline$constNonAsciiString24Equals("\u0440123456789012345678901234"));
+ Assert.assertFalse($noinline$constNonAsciiString24Equals("\u04401234567890123456789012x"));
+ Assert.assertFalse($noinline$constNonAsciiString24Equals("\012345678901234567890123"));
+
+ Assert.assertTrue(
+ $noinline$constNonAsciiString29Equals("\u04401234567890123456789012345678"));
+ Assert.assertFalse(
+ $noinline$constNonAsciiString29Equals("\u0440123456789012345678901234567"));
+ Assert.assertFalse(
+ $noinline$constNonAsciiString29Equals("\u044012345678901234567890123456789"));
+ Assert.assertFalse(
+ $noinline$constNonAsciiString29Equals("\u0440123456789012345678901234567x"));
+ Assert.assertFalse($noinline$constNonAsciiString29Equals("01234567890123456789012345678"));
+
+ Assert.assertTrue(
+ $noinline$constNonAsciiString35Equals("\u04401234567890123456789012345678901234"));
+ Assert.assertFalse(
+ $noinline$constNonAsciiString35Equals("\u0440123456789012345678901234567890123"));
+ Assert.assertFalse(
+ $noinline$constNonAsciiString35Equals("\u044012345678901234567890123456789012345"));
+ Assert.assertFalse(
+ $noinline$constNonAsciiString35Equals("\u0440123456789012345678901234567890123x"));
+ Assert.assertFalse(
+ $noinline$constNonAsciiString35Equals("01234567890123456789012345678901234"));
+ }
+
+ public static boolean $noinline$equalsConstString0(String s) {
+ if (doThrow) { throw new Error(); }
+ return s.equals("");
+ }
+
+ public static boolean $noinline$equalsConstString7(String s) {
+ if (doThrow) { throw new Error(); }
+ return s.equals("0123456");
+ }
+
+ public static boolean $noinline$equalsConstString14(String s) {
+ if (doThrow) { throw new Error(); }
+ return s.equals("01234567890123");
+ }
+
+ public static boolean $noinline$equalsConstString24(String s) {
+ if (doThrow) { throw new Error(); }
+ return s.equals("012345678901234567890123");
+ }
+
+ public static boolean $noinline$equalsConstString29(String s) {
+ if (doThrow) { throw new Error(); }
+ return s.equals("01234567890123456789012345678");
+ }
+
+ public static boolean $noinline$equalsConstString35(String s) {
+ if (doThrow) { throw new Error(); }
+ return s.equals("01234567890123456789012345678901234");
+ }
+
+ public static boolean $noinline$equalsConstNonAsciiString7(String s) {
+ if (doThrow) { throw new Error(); }
+ return s.equals("\u0440123456");
+ }
+
+ public static boolean $noinline$equalsConstNonAsciiString14(String s) {
+ if (doThrow) { throw new Error(); }
+ return s.equals("\u04401234567890123");
+ }
+
+ public static boolean $noinline$equalsConstNonAsciiString24(String s) {
+ if (doThrow) { throw new Error(); }
+ return s.equals("\u044012345678901234567890123");
+ }
+
+ public static boolean $noinline$equalsConstNonAsciiString29(String s) {
+ if (doThrow) { throw new Error(); }
+ return s.equals("\u04401234567890123456789012345678");
+ }
+
+ public static boolean $noinline$equalsConstNonAsciiString35(String s) {
+ if (doThrow) { throw new Error(); }
+ return s.equals("\u04401234567890123456789012345678901234");
+ }
+
+ public static boolean $noinline$constString0Equals(String s) {
+ if (doThrow) { throw new Error(); }
+ return s.equals("");
+ }
+
+ public static boolean $noinline$constString7Equals(String s) {
+ if (doThrow) { throw new Error(); }
+ return "0123456".equals(s);
+ }
+
+ public static boolean $noinline$constString14Equals(String s) {
+ if (doThrow) { throw new Error(); }
+ return "01234567890123".equals(s);
+ }
+
+ public static boolean $noinline$constString24Equals(String s) {
+ if (doThrow) { throw new Error(); }
+ return "012345678901234567890123".equals(s);
+ }
+
+ public static boolean $noinline$constString29Equals(String s) {
+ if (doThrow) { throw new Error(); }
+ return "01234567890123456789012345678".equals(s);
+ }
+
+ public static boolean $noinline$constString35Equals(String s) {
+ if (doThrow) { throw new Error(); }
+ return "01234567890123456789012345678901234".equals(s);
+ }
+
+ public static boolean $noinline$constNonAsciiString7Equals(String s) {
+ if (doThrow) { throw new Error(); }
+ return "\u0440123456".equals(s);
+ }
+
+ public static boolean $noinline$constNonAsciiString14Equals(String s) {
+ if (doThrow) { throw new Error(); }
+ return "\u04401234567890123".equals(s);
+ }
+
+ public static boolean $noinline$constNonAsciiString24Equals(String s) {
+ if (doThrow) { throw new Error(); }
+ return "\u044012345678901234567890123".equals(s);
+ }
+
+ public static boolean $noinline$constNonAsciiString29Equals(String s) {
+ if (doThrow) { throw new Error(); }
+ return "\u04401234567890123456789012345678".equals(s);
+ }
+
+ public static boolean $noinline$constNonAsciiString35Equals(String s) {
+ if (doThrow) { throw new Error(); }
+ return "\u04401234567890123456789012345678901234".equals(s);
+ }
+
public static int $noinline$compareTo(String lhs, String rhs) {
if (doThrow) { throw new Error(); }
return lhs.compareTo(rhs);
diff --git a/test/044-proxy/build b/test/044-proxy/build
new file mode 100755
index 0000000..ab956e2
--- /dev/null
+++ b/test/044-proxy/build
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2017 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-build "$@" --experimental java-8
diff --git a/test/044-proxy/expected.txt b/test/044-proxy/expected.txt
index 2a5f0b9..63a4620 100644
--- a/test/044-proxy/expected.txt
+++ b/test/044-proxy/expected.txt
@@ -87,7 +87,7 @@
Proxy methods: [public final boolean $PROXY_CLASS_NAME1$.equals(java.lang.Object), public final java.lang.Object $PROXY_CLASS_NAME1$.foo(), public final java.lang.String $PROXY_CLASS_NAME1$.foo(), public final int $PROXY_CLASS_NAME1$.hashCode(), public final java.lang.String $PROXY_CLASS_NAME1$.toString()]
Invocation of public abstract java.lang.String NarrowingTest$I2.foo()
Invoking foo using I2 type: hello
-Invocation of public abstract java.lang.Object NarrowingTest$I1.foo()
+Invocation of public default java.lang.Object NarrowingTest$I2.foo()
Invoking foo using I1 type: 1
Invocation of public abstract java.lang.String NarrowingTest$I2.foo()
Got expected exception
diff --git a/test/071-dexfile-map-clean/build b/test/071-dexfile-map-clean/build
new file mode 100755
index 0000000..a171fc3
--- /dev/null
+++ b/test/071-dexfile-map-clean/build
@@ -0,0 +1,21 @@
+#!/bin/bash
+#
+# Copyright 2017 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+# Any JAR files used by this test shall have their classes.dex be stored, NOT compressed.
+# This is needed for our test correctness which validates classes.dex are mapped file-backed.
+#
+# In addition, align to at least 4 bytes since that's the dex alignment requirement.
+./default-build "$@" --zip-compression-method store --zip-align 4
diff --git a/test/071-dexfile-map-clean/expected.txt b/test/071-dexfile-map-clean/expected.txt
new file mode 100644
index 0000000..af7fb28
--- /dev/null
+++ b/test/071-dexfile-map-clean/expected.txt
@@ -0,0 +1,3 @@
+Another
+Secondary dexfile mmap is clean
+Another Instance
diff --git a/test/071-dexfile-map-clean/info.txt b/test/071-dexfile-map-clean/info.txt
new file mode 100644
index 0000000..7e45808
--- /dev/null
+++ b/test/071-dexfile-map-clean/info.txt
@@ -0,0 +1,11 @@
+Exercise Dalvik-specific DEX file feature. Will not work on RI.
+
+If these conditions are met:
+* When we are loading in a secondary dex file
+* and when dex2oat is not used
+* and the dex file is stored uncompressed in a ZIP file
+
+Then check:
+* The dex file is memory-mapped file-backed as clean memory
+(i.e. there is no extraction step)
+
diff --git a/test/071-dexfile-map-clean/run b/test/071-dexfile-map-clean/run
new file mode 100755
index 0000000..9c100ec
--- /dev/null
+++ b/test/071-dexfile-map-clean/run
@@ -0,0 +1,31 @@
+#!/bin/bash
+#
+# Copyright 2017 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+# Run without dex2oat so that we don't create oat/vdex files
+# when trying to load the secondary dex file.
+
+# In this way, the secondary dex file will be forced to be
+# loaded directly.
+#
+# In addition, make sure we call 'sync'
+# before executing dalvikvm because otherwise
+# it's highly likely the pushed JAR files haven't
+# been committed to permanent storage yet,
+# and when we mmap them the kernel will think
+# the memory is dirty (despite being file-backed).
+# (Note: this was reproducible 100% of the time on
+# a target angler device).
+./default-run "$@" --no-dex2oat --sync
diff --git a/test/071-dexfile-map-clean/src-ex/Another.java b/test/071-dexfile-map-clean/src-ex/Another.java
new file mode 100644
index 0000000..58464a6
--- /dev/null
+++ b/test/071-dexfile-map-clean/src-ex/Another.java
@@ -0,0 +1,21 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class Another {
+ public Another() {
+ System.out.println("Another Instance");
+ }
+}
diff --git a/test/071-dexfile-map-clean/src/Main.java b/test/071-dexfile-map-clean/src/Main.java
new file mode 100644
index 0000000..8a196dd
--- /dev/null
+++ b/test/071-dexfile-map-clean/src/Main.java
@@ -0,0 +1,147 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.lang.reflect.Method;
+import java.util.Enumeration;
+
+import java.nio.file.Files;
+import java.nio.file.Paths;
+
+/**
+ * DexFile tests (Dalvik-specific).
+ */
+public class Main {
+ private static final String CLASS_PATH =
+ System.getenv("DEX_LOCATION") + "/071-dexfile-map-clean-ex.jar";
+
+ /**
+ * Prep the environment then run the test.
+ */
+ public static void main(String[] args) throws Exception {
+ // Load the dex file, this is a pre-requisite to mmap-ing it in.
+ Class<?> AnotherClass = testDexFile();
+ // Check that the memory maps are clean.
+ testDexMemoryMaps();
+
+ // Prevent garbage collector from collecting our DexFile
+ // (and unmapping too early) by using it after we finish
+ // our verification.
+ AnotherClass.newInstance();
+ }
+
+ private static boolean checkSmapsEntry(String[] smapsLines, int offset) {
+ String nameDescription = smapsLines[offset];
+ String[] split = nameDescription.split(" ");
+
+ String permissions = split[1];
+ // Mapped as read-only + anonymous.
+ if (!permissions.startsWith("r--p")) {
+ return false;
+ }
+
+ boolean validated = false;
+
+ // We have the right entry, now make sure it's valid.
+ for (int i = offset; i < smapsLines.length; ++i) {
+ String line = smapsLines[i];
+
+ if (line.startsWith("Shared_Dirty") || line.startsWith("Private_Dirty")) {
+ String lineTrimmed = line.trim();
+ String[] lineSplit = lineTrimmed.split(" +");
+
+ String sizeUsuallyInKb = lineSplit[lineSplit.length - 2];
+
+ sizeUsuallyInKb = sizeUsuallyInKb.trim();
+
+ if (!sizeUsuallyInKb.equals("0")) {
+ System.out.println(
+ "ERROR: Memory mapping for " + CLASS_PATH + " is unexpectedly dirty");
+ System.out.println(line);
+ } else {
+ validated = true;
+ }
+ }
+
+ // VmFlags marks the "end" of an smaps entry.
+ if (line.startsWith("VmFlags")) {
+ break;
+ }
+ }
+
+ if (validated) {
+ System.out.println("Secondary dexfile mmap is clean");
+ } else {
+ System.out.println("ERROR: Memory mapping is missing Shared_Dirty/Private_Dirty entries");
+ }
+
+ return true;
+ }
+
+ // This test takes relies on dex2oat being skipped.
+ // (enforced in 'run' file by using '--no-dex2oat'
+ //
+ // This could happen in a non-test situation
+ // if a secondary dex file is loaded (but not yet maintenance-mode compiled)
+ // with JIT.
+ //
+ // Or it could also happen if a secondary dex file is loaded and forced
+ // into running into the interpreter (e.g. duplicate classes).
+ //
+ // Rather than relying on those weird fallbacks,
+ // we force the runtime not to dex2oat the dex file to ensure
+ // this test is repeatable and less brittle.
+ private static void testDexMemoryMaps() throws Exception {
+ // Ensure that the secondary dex file is mapped clean (directly from JAR file).
+ String smaps = new String(Files.readAllBytes(Paths.get("/proc/self/smaps")));
+
+ String[] smapsLines = smaps.split("\n");
+ boolean found = true;
+ for (int i = 0; i < smapsLines.length; ++i) {
+ if (smapsLines[i].contains(CLASS_PATH)) {
+ if (checkSmapsEntry(smapsLines, i)) {
+ return;
+ } // else we found the wrong one, keep going.
+ }
+ }
+
+ // Error case:
+ System.out.println("Could not find " + CLASS_PATH + " RO-anonymous smaps entry");
+ System.out.println(smaps);
+ }
+
+ private static Class<?> testDexFile() throws Exception {
+ ClassLoader classLoader = Main.class.getClassLoader();
+ Class<?> DexFile = classLoader.loadClass("dalvik.system.DexFile");
+ Method DexFile_loadDex = DexFile.getMethod("loadDex",
+ String.class,
+ String.class,
+ Integer.TYPE);
+ Method DexFile_entries = DexFile.getMethod("entries");
+ Object dexFile = DexFile_loadDex.invoke(null, CLASS_PATH, null, 0);
+ Enumeration<String> e = (Enumeration<String>) DexFile_entries.invoke(dexFile);
+ while (e.hasMoreElements()) {
+ String className = e.nextElement();
+ System.out.println(className);
+ }
+
+ Method DexFile_loadClass = DexFile.getMethod("loadClass",
+ String.class,
+ ClassLoader.class);
+ Class<?> AnotherClass = (Class<?>)DexFile_loadClass.invoke(dexFile,
+ "Another", Main.class.getClassLoader());
+ return AnotherClass;
+ }
+}
diff --git a/test/121-modifiers/build b/test/121-modifiers/build
deleted file mode 100644
index 771dd51..0000000
--- a/test/121-modifiers/build
+++ /dev/null
@@ -1,40 +0,0 @@
-#!/bin/bash
-#
-# Copyright (C) 2014 The Android Open Source Project
-#
-# Licensed under the Apache License, Version 2.0 (the "License");
-# you may not use this file except in compliance with the License.
-# You may obtain a copy of the License at
-#
-# http://www.apache.org/licenses/LICENSE-2.0
-#
-# Unless required by applicable law or agreed to in writing, software
-# distributed under the License is distributed on an "AS IS" BASIS,
-# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
-# See the License for the specific language governing permissions and
-# limitations under the License.
-
-# Stop if something fails.
-set -e
-
-# The classes are pre-compiled and modified with ASM.
-#
-# To reproduce, compile the source files. Asm.java needs the ASM libraries (core and tree). Then
-# run Asm.java, which produces Inf.out and NonInf.out. Rename these to class files and put them
-# into the classes directory (this assumes the ASM libraries are names asm.jar and asm-tree.jar):
-#
-# javac Inf.java NonInf.java Main.java
-# javac -cp asm.jar:asm-tree.jar:. Asm.java
-# java -cp asm.jar:asm-tree.jar:. Asm
-# mv Inf.out classes/Inf.class
-# mv NonInf.out classes/NonInf.class
-# mv Main.class A.class A\$B.class A\$C.class classes/
-
-if [ ${USE_JACK} = "true" ]; then
- jar cf classes.jill.jar -C classes .
- # Workaround b/19561685: disable sanity checks to produce a DEX file with invalid modifiers.
- ${JACK} --sanity-checks off --import classes.jill.jar --output-dex .
-else
- ${DX} --debug --dex --dump-to=classes.lst --output=classes.dex classes
-fi
-zip $TEST_NAME.jar classes.dex
diff --git a/test/121-modifiers/info.txt b/test/121-modifiers/info.txt
index 943cbf8..129aee8 100644
--- a/test/121-modifiers/info.txt
+++ b/test/121-modifiers/info.txt
@@ -1 +1,18 @@
This is a test checking the modifier (access flags) handling of ART.
+
+The classes are pre-compiled and modified with ASM.
+
+To reproduce, compile the source files. Asm.java needs the ASM libraries (core and tree). Then
+run Asm.java, which produces Inf.out and NonInf.out. Rename these to class files and put them
+into the classes directory (this assumes the ASM libraries are names asm.jar and asm-tree.jar).
+Finally, compile with jack/jill or dx, and run baksmali.
+
+javac Inf.java NonInf.java Main.java
+javac -cp asm.jar:asm-tree.jar:. Asm.java
+java -cp asm.jar:asm-tree.jar:. Asm
+mv Inf.out classes/Inf.class
+mv NonInf.out classes/NonInf.class
+mv Main.class A.class A\$B.class A\$C.class classes/
+dx --debug --dex --output=classes.dex classes
+baksmali classes.dex
+mv out/*.smali smali/
diff --git a/test/121-modifiers/smali/A$B.smali b/test/121-modifiers/smali/A$B.smali
new file mode 100644
index 0000000..d6addc2
--- /dev/null
+++ b/test/121-modifiers/smali/A$B.smali
@@ -0,0 +1,42 @@
+#
+# Copyright (C) 2014 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+#
+
+.class LA$B;
+.super Ljava/lang/Object;
+.source "Main.java"
+
+
+# annotations
+.annotation system Ldalvik/annotation/EnclosingClass;
+ value = LA;
+.end annotation
+
+.annotation system Ldalvik/annotation/InnerClass;
+ accessFlags = 0xa
+ name = "B"
+.end annotation
+
+
+# direct methods
+.method private constructor <init>()V
+ .registers 1
+
+ .prologue
+ .line 19
+ invoke-direct {p0}, Ljava/lang/Object;-><init>()V
+
+ return-void
+.end method
diff --git a/test/121-modifiers/smali/A$C.smali b/test/121-modifiers/smali/A$C.smali
new file mode 100644
index 0000000..eba4756
--- /dev/null
+++ b/test/121-modifiers/smali/A$C.smali
@@ -0,0 +1,30 @@
+#
+# Copyright (C) 2014 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+#
+
+.class public interface abstract LA$C;
+.super Ljava/lang/Object;
+.source "Main.java"
+
+
+# annotations
+.annotation system Ldalvik/annotation/EnclosingClass;
+ value = LA;
+.end annotation
+
+.annotation system Ldalvik/annotation/InnerClass;
+ accessFlags = 0x60c
+ name = "C"
+.end annotation
diff --git a/test/121-modifiers/smali/A.smali b/test/121-modifiers/smali/A.smali
new file mode 100644
index 0000000..b1078bc
--- /dev/null
+++ b/test/121-modifiers/smali/A.smali
@@ -0,0 +1,41 @@
+#
+# Copyright (C) 2014 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+#
+
+.class LA;
+.super Ljava/lang/Object;
+.source "Main.java"
+
+
+# annotations
+.annotation system Ldalvik/annotation/MemberClasses;
+ value = {
+ LA$B;,
+ LA$C;
+ }
+.end annotation
+
+
+# direct methods
+.method constructor <init>()V
+ .registers 1
+
+ .prologue
+ .line 18
+ invoke-direct {p0}, Ljava/lang/Object;-><init>()V
+
+ .line 21
+ return-void
+.end method
diff --git a/test/121-modifiers/smali/Inf.smali b/test/121-modifiers/smali/Inf.smali
new file mode 100644
index 0000000..6a3a7ab
--- /dev/null
+++ b/test/121-modifiers/smali/Inf.smali
@@ -0,0 +1,23 @@
+#
+# Copyright (C) 2014 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+#
+
+.class public interface abstract LInf;
+.super Ljava/lang/Object;
+.source "Inf.java"
+
+
+# static fields
+.field public static final I:I
diff --git a/test/121-modifiers/smali/NonInf.smali b/test/121-modifiers/smali/NonInf.smali
new file mode 100644
index 0000000..34bf031
--- /dev/null
+++ b/test/121-modifiers/smali/NonInf.smali
@@ -0,0 +1,177 @@
+#
+# Copyright (C) 2014 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+#
+
+.class public abstract LNonInf;
+.super Ljava/lang/Object;
+.source "NonInf.java"
+
+
+# static fields
+.field static staticField:I
+
+
+# instance fields
+.field final finalField:I
+
+.field private privateField:I
+
+.field protected protectedField:I
+
+.field public publicField:I
+
+.field transient transientField:I
+
+.field volatile volatileField:I
+
+
+# direct methods
+.method public constructor <init>()V
+ .registers 2
+
+ .prologue
+ .line 11
+ invoke-direct {p0}, Ljava/lang/Object;-><init>()V
+
+ .line 12
+ const/4 v0, 0x0
+
+ iput v0, p0, LNonInf;->publicField:I
+
+ .line 13
+ const/4 v0, 0x1
+
+ iput v0, p0, LNonInf;->privateField:I
+
+ .line 14
+ const/4 v0, 0x2
+
+ iput v0, p0, LNonInf;->protectedField:I
+
+ .line 15
+ const/4 v0, 0x3
+
+ sput v0, LNonInf;->staticField:I
+
+ .line 16
+ const/4 v0, 0x4
+
+ iput v0, p0, LNonInf;->transientField:I
+
+ .line 17
+ const/4 v0, 0x5
+
+ iput v0, p0, LNonInf;->volatileField:I
+
+ .line 18
+ const/4 v0, 0x6
+
+ iput v0, p0, LNonInf;->finalField:I
+
+ .line 19
+ return-void
+.end method
+
+.method private privateMethod()I
+ .registers 2
+
+ .prologue
+ .line 24
+ const/4 v0, 0x0
+
+ return v0
+.end method
+
+.method public static staticMethod()I
+ .registers 1
+
+ .prologue
+ .line 42
+ const/4 v0, 0x0
+
+ return v0
+.end method
+
+
+# virtual methods
+.method public abstract abstractMethod()I
+.end method
+
+.method public final finalMethod()I
+ .registers 2
+
+ .prologue
+ .line 54
+ const/4 v0, 0x0
+
+ return v0
+.end method
+
+.method public native nativeMethod()V
+.end method
+
+.method protected protectedMethod()I
+ .registers 2
+
+ .prologue
+ .line 28
+ const/4 v0, 0x0
+
+ return v0
+.end method
+
+.method public publicMethod()I
+ .registers 2
+
+ .prologue
+ .line 32
+ const/4 v0, 0x0
+
+ return v0
+.end method
+
+.method public strictfp strictfpMethod()D
+ .registers 3
+
+ .prologue
+ .line 46
+ const-wide/16 v0, 0x0
+
+ return-wide v0
+.end method
+
+.method public declared-synchronized synchronizedMethod()I
+ .registers 2
+
+ .prologue
+ monitor-enter p0
+
+ .line 38
+ const/4 v0, 0x0
+
+ monitor-exit p0
+
+ return v0
+.end method
+
+.method public varargs varargsMethod([Ljava/lang/Object;)I
+ .registers 3
+
+ .prologue
+ .line 50
+ const/4 v0, 0x0
+
+ return v0
+.end method
diff --git a/test/121-modifiers/src-java/A.java b/test/121-modifiers/src-java/A.java
new file mode 100644
index 0000000..d97f6b3
--- /dev/null
+++ b/test/121-modifiers/src-java/A.java
@@ -0,0 +1,23 @@
+/*
+ * Copyright (C) 2014 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+// These classes are to check the additional flags for inner classes.
+class A {
+ private static class B {
+ }
+ protected static interface C {
+ }
+}
diff --git a/test/121-modifiers/src/Asm.java b/test/121-modifiers/src-java/Asm.java
similarity index 100%
rename from test/121-modifiers/src/Asm.java
rename to test/121-modifiers/src-java/Asm.java
diff --git a/test/121-modifiers/src/Inf.java b/test/121-modifiers/src-java/Inf.java
similarity index 100%
rename from test/121-modifiers/src/Inf.java
rename to test/121-modifiers/src-java/Inf.java
diff --git a/test/121-modifiers/src/NonInf.java b/test/121-modifiers/src-java/NonInf.java
similarity index 100%
rename from test/121-modifiers/src/NonInf.java
rename to test/121-modifiers/src-java/NonInf.java
diff --git a/test/121-modifiers/src/Main.java b/test/121-modifiers/src2/Main.java
similarity index 97%
rename from test/121-modifiers/src/Main.java
rename to test/121-modifiers/src2/Main.java
index e21b789..62e65a8 100644
--- a/test/121-modifiers/src/Main.java
+++ b/test/121-modifiers/src2/Main.java
@@ -14,14 +14,6 @@
* limitations under the License.
*/
-// These classes are to check the additional flags for inner classes.
-class A {
- private static class B {
- }
- protected static interface C {
- }
-}
-
public class Main {
public final static int INTERFACE_DEFINED_BITS =
0x0001 | // public, may be set.
diff --git a/test/155-java-set-resolved-type/src/Main.java b/test/155-java-set-resolved-type/src/Main.java
index 56b8c3e..f92363e 100644
--- a/test/155-java-set-resolved-type/src/Main.java
+++ b/test/155-java-set-resolved-type/src/Main.java
@@ -55,7 +55,11 @@
Class<?> timpl = Class.forName("TestImplementation", false, mainLoader);
// Clear the dex cache resolved types to force a proper lookup the next time
// we need to find TestInterface.
- clearResolvedTypes(timpl);
+ // TODO: Enable clearing the dex cache when we switch to the hash-based type array
+ // and do a proper lookup. Currently, ClassLinker fully relies on the DexCache.
+ if (false) {
+ clearResolvedTypes(timpl);
+ }
// Force intialization of TestClass2. This expects the interface type to be
// resolved and found through simple lookup.
diff --git a/test/476-checker-ctor-memory-barrier/src/Main.java b/test/476-checker-ctor-memory-barrier/src/Main.java
index c2a2a10..65486e9 100644
--- a/test/476-checker-ctor-memory-barrier/src/Main.java
+++ b/test/476-checker-ctor-memory-barrier/src/Main.java
@@ -27,15 +27,10 @@
public ClassWithFinals obj;
public static boolean doThrow = false;
- /// CHECK-START: void ClassWithFinals.<init>(boolean) register (after)
- /// CHECK: MemoryBarrier kind:StoreStore
- /// CHECK-NEXT: ReturnVoid
public ClassWithFinals(boolean cond) {
- x = 0;
- if (doThrow) {
- // avoid inlining
- throw new RuntimeException();
- }
+ x = 1;
+ throw new RuntimeException();
+ // should not inline this constructor
}
/// CHECK-START: void ClassWithFinals.<init>() register (after)
@@ -146,6 +141,7 @@
/// CHECK-NOT: MemoryBarrier kind:StoreStore
public static ClassWithFinals noInlineNoConstructorBarrier() {
return new ClassWithFinals(false);
+ // should not inline the constructor
}
/// CHECK-START: void Main.inlineNew() register (after)
diff --git a/test/478-checker-clinit-check-pruning/src/Main.java b/test/478-checker-clinit-check-pruning/src/Main.java
index c2982b4..63e2b95 100644
--- a/test/478-checker-clinit-check-pruning/src/Main.java
+++ b/test/478-checker-clinit-check-pruning/src/Main.java
@@ -400,8 +400,10 @@
/// CHECK-NOT: ClinitCheck
static void inlinedInvokeStaticViaNonStatic(Iterable<?> it) {
- inlinedInvokeStaticViaNonStaticHelper(null);
- inlinedInvokeStaticViaNonStaticHelper(it);
+ if (it != null) {
+ inlinedInvokeStaticViaNonStaticHelper(null);
+ inlinedInvokeStaticViaNonStaticHelper(it);
+ }
}
static void inlinedInvokeStaticViaNonStaticHelper(Iterable<?> it) {
@@ -417,8 +419,8 @@
static void inlinedForNull(Iterable<?> it) {
if (it != null) {
it.iterator();
- // We're not inlining throw at the moment.
- if (doThrow) { throw new Error(""); }
+ // We're not inlining methods that always throw.
+ throw new Error("");
}
}
}
@@ -441,7 +443,9 @@
/// CHECK-NOT: ClinitCheck
static void inlinedInvokeStaticViaStatic(Iterable<?> it) {
- ClassWithClinit11.callInlinedForNull(it);
+ if (it != null) {
+ ClassWithClinit11.callInlinedForNull(it);
+ }
}
static class ClassWithClinit11 {
@@ -457,8 +461,8 @@
static void inlinedForNull(Iterable<?> it) {
it.iterator();
if (it != null) {
- // We're not inlining throw at the moment.
- if (doThrow) { throw new Error(""); }
+ // We're not inlining methods that always throw.
+ throw new Error("");
}
}
}
@@ -476,8 +480,10 @@
/// CHECK-NOT: ClinitCheck
static void inlinedInvokeStaticViaStaticTwice(Iterable<?> it) {
- ClassWithClinit12.callInlinedForNull(null);
- ClassWithClinit12.callInlinedForNull(it);
+ if (it != null) {
+ ClassWithClinit12.callInlinedForNull(null);
+ ClassWithClinit12.callInlinedForNull(it);
+ }
}
static class ClassWithClinit12 {
@@ -492,8 +498,8 @@
static void inlinedForNull(Iterable<?> it) {
if (it != null) {
- // We're not inlining throw at the moment.
- if (doThrow) { throw new Error(""); }
+ // We're not inlining methods that always throw.
+ throw new Error("");
}
}
}
@@ -537,9 +543,21 @@
constClassAndInvokeStatic(it);
sgetAndInvokeStatic(it);
constClassSgetAndInvokeStatic(it);
- inlinedInvokeStaticViaNonStatic(it);
- inlinedInvokeStaticViaStatic(it);
- inlinedInvokeStaticViaStaticTwice(it);
+ try {
+ inlinedInvokeStaticViaNonStatic(it);
+ } catch (Error e) {
+ // Expected
+ }
+ try {
+ inlinedInvokeStaticViaStatic(it);
+ } catch (Error e) {
+ // Expected
+ }
+ try{
+ inlinedInvokeStaticViaStaticTwice(it);
+ } catch (Error e) {
+ // Expected
+ }
$noinline$testInliningAndNewInstance(it);
}
}
diff --git a/test/536-checker-intrinsic-optimization/src/Main.java b/test/536-checker-intrinsic-optimization/src/Main.java
index ed7524c..52f3f84 100644
--- a/test/536-checker-intrinsic-optimization/src/Main.java
+++ b/test/536-checker-intrinsic-optimization/src/Main.java
@@ -329,7 +329,7 @@
/// CHECK-NOT: cbz
// Terminate the scope for the CHECK-NOT search at the reference or length comparison,
// whichever comes first.
- /// CHECK: cmp {{w.*,}} {{w.*}}
+ /// CHECK: cmp {{w.*,}} {{w.*|#.*}}
public static boolean stringArgumentNotNull(Object obj) {
obj.getClass();
return "foo".equals(obj);
@@ -380,10 +380,10 @@
// so repeat the check twice.
/// CHECK-NOT: ldr {{w\d+}}, [{{x\d+}}]
/// CHECK-NOT: ldr {{w\d+}}, [{{x\d+}}, #0]
- /// CHECK: cmp {{w\d+}}, {{w\d+}}
+ /// CHECK: cmp {{w\d+}}, {{w\d+|#.*}}
/// CHECK-NOT: ldr {{w\d+}}, [{{x\d+}}]
/// CHECK-NOT: ldr {{w\d+}}, [{{x\d+}}, #0]
- /// CHECK: cmp {{w\d+}}, {{w\d+}}
+ /// CHECK: cmp {{w\d+}}, {{w\d+|#.*}}
public static boolean stringArgumentIsString() {
return "foo".equals(myString);
}
diff --git a/test/609-checker-inline-interface/src/Main.java b/test/609-checker-inline-interface/src/Main.java
index 413f2dd..249b778 100644
--- a/test/609-checker-inline-interface/src/Main.java
+++ b/test/609-checker-inline-interface/src/Main.java
@@ -21,12 +21,21 @@
}
public void doCall() {
- if (doThrow) throw new Error("");
+ // We do not inline methods that always throw.
+ throw new Error("");
}
public static void main(String[] args) {
- testInlineInterfaceCall();
- testInterfaceToVirtualCall();
+ try {
+ testInlineInterfaceCall();
+ } catch (Error e) {
+ // Expected
+ }
+ try {
+ testInterfaceToVirtualCall();
+ } catch (Error e) {
+ // Expected.
+ }
}
/// CHECK-START: void Main.testInlineInterfaceCall() inliner (before)
@@ -62,7 +71,6 @@
static Interface itf = new Main();
static Main m = new Main();
- static boolean doThrow = false;
}
interface Interface {
diff --git a/test/616-cha-native/expected.txt b/test/616-cha-native/expected.txt
new file mode 100644
index 0000000..6a5618e
--- /dev/null
+++ b/test/616-cha-native/expected.txt
@@ -0,0 +1 @@
+JNI_OnLoad called
diff --git a/test/616-cha-native/info.txt b/test/616-cha-native/info.txt
new file mode 100644
index 0000000..a17bcab
--- /dev/null
+++ b/test/616-cha-native/info.txt
@@ -0,0 +1,2 @@
+Test for Class Hierarchy Analysis (CHA) single-implementation status updating
+behavior on an overridden native method.
diff --git a/test/616-cha-native/src/Main.java b/test/616-cha-native/src/Main.java
new file mode 100644
index 0000000..53a463c
--- /dev/null
+++ b/test/616-cha-native/src/Main.java
@@ -0,0 +1,33 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+abstract class A {
+ public abstract void foo();
+}
+
+class B extends A {
+ public native void foo();
+}
+
+class C extends B {
+ public void foo() {}
+}
+
+public class Main {
+ public static void main(String[] args) {
+ System.loadLibrary(args[0]);
+ }
+}
diff --git a/test/616-cha/src/Main.java b/test/616-cha/src/Main.java
index b617944..beea90a 100644
--- a/test/616-cha/src/Main.java
+++ b/test/616-cha/src/Main.java
@@ -196,8 +196,6 @@
// should return true for those cases.
assertSingleImplementation(java.lang.String.class, "charAt", true);
assertSingleImplementation(java.lang.Thread.class, "join", true);
- // We don't set single-implementation modifier bit for native methods.
- assertSingleImplementation(java.lang.Thread.class, "isInterrupted", false);
if (isInterpreted()) {
sIsOptimizing = false;
diff --git a/test/626-const-class-linking/clear_dex_cache_types.cc b/test/626-const-class-linking/clear_dex_cache_types.cc
index ff5ae6b..b35dff4 100644
--- a/test/626-const-class-linking/clear_dex_cache_types.cc
+++ b/test/626-const-class-linking/clear_dex_cache_types.cc
@@ -27,8 +27,7 @@
ScopedObjectAccess soa(Thread::Current());
mirror::DexCache* dex_cache = soa.Decode<mirror::Class>(cls)->GetDexCache();
for (size_t i = 0, num_types = dex_cache->NumResolvedTypes(); i != num_types; ++i) {
- mirror::TypeDexCachePair cleared(nullptr, mirror::TypeDexCachePair::InvalidIndexForSlot(i));
- dex_cache->GetResolvedTypes()[i].store(cleared, std::memory_order_relaxed);
+ dex_cache->SetResolvedType(dex::TypeIndex(i), ObjPtr<mirror::Class>(nullptr));
}
}
@@ -50,7 +49,7 @@
StackHandleScope<1> hs(soa.Self());
Handle<mirror::ObjectArray<mirror::Object>> classes =
hs.NewHandle(soa.Decode<mirror::ObjectArray<mirror::Object>>(array));
- CHECK(classes.Get() != nullptr);
+ CHECK(classes != nullptr);
for (size_t i = 0, length = classes->GetLength(); i != length; ++i) {
CHECK(classes->Get(i) != nullptr) << i;
CHECK(classes->Get(i)->IsClass())
diff --git a/test/637-checker-throw-inline/expected.txt b/test/637-checker-throw-inline/expected.txt
new file mode 100644
index 0000000..e69de29
--- /dev/null
+++ b/test/637-checker-throw-inline/expected.txt
diff --git a/test/637-checker-throw-inline/info.txt b/test/637-checker-throw-inline/info.txt
new file mode 100644
index 0000000..4fcf6a9
--- /dev/null
+++ b/test/637-checker-throw-inline/info.txt
@@ -0,0 +1 @@
+Test that the compiler can inline methods that throw.
diff --git a/test/637-checker-throw-inline/src/Main.java b/test/637-checker-throw-inline/src/Main.java
new file mode 100644
index 0000000..d4fbdf5
--- /dev/null
+++ b/test/637-checker-throw-inline/src/Main.java
@@ -0,0 +1,64 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class Main {
+
+ public static void $inline$doCall() {
+ if (doThrow) throw new Error("");
+ }
+
+ public static void tryInline() {
+ if (doThrow) throw new Error("");
+ }
+
+ /// CHECK-START: void Main.test() inliner (before)
+ /// CHECK: InvokeStaticOrDirect method_name:Main.$inline$doCall loop:none
+
+ /// CHECK-START: void Main.test() inliner (after)
+ /// CHECK-NOT: InvokeStaticOrDirect method_name:Main.$inline$doCall
+ public static void test() {
+ $inline$doCall();
+ }
+
+ /// CHECK-START: void Main.testInLoop() inliner (before)
+ /// CHECK: InvokeStaticOrDirect method_name:Main.$inline$doCall loop:{{B\d+}}
+
+ /// CHECK-START: void Main.testInLoop() inliner (after)
+ /// CHECK-NOT: InvokeStaticOrDirect method_name:Main.$inline$doCall
+ public static void testInLoop() {
+ for (int i = 0; i < 10; ++i) {
+ $inline$doCall();
+ }
+ }
+
+ /// CHECK-START: void Main.testInInfiniteLoop() inliner (before)
+ /// CHECK: InvokeStaticOrDirect method_name:Main.tryInline loop:{{B\d+}}
+
+ /// CHECK-START: void Main.testInInfiniteLoop() inliner (after)
+ /// CHECK: InvokeStaticOrDirect method_name:Main.tryInline loop:{{B\d+}}
+ public static void testInInfiniteLoop() {
+ while (true) {
+ tryInline();
+ }
+ }
+
+ public static void main(String[] args) {
+ test();
+ testInLoop();
+ }
+
+ static boolean doThrow = false;
+}
diff --git a/test/911-get-stack-trace/expected.txt b/test/911-get-stack-trace/expected.txt
index 2687f85..feabb20 100644
--- a/test/911-get-stack-trace/expected.txt
+++ b/test/911-get-stack-trace/expected.txt
@@ -211,6 +211,36 @@
### Other threads (suspended) ###
################################
---------
+AllTraces Thread 0
+
+---------
+AllTraces Thread 1
+
+---------
+AllTraces Thread 2
+
+---------
+AllTraces Thread 3
+
+---------
+AllTraces Thread 4
+
+---------
+AllTraces Thread 5
+
+---------
+AllTraces Thread 6
+
+---------
+AllTraces Thread 7
+
+---------
+AllTraces Thread 8
+
+---------
+AllTraces Thread 9
+
+---------
FinalizerDaemon
<not printed>
---------
@@ -226,39 +256,89 @@
Signal Catcher
---------
-Thread-10
-
----------
-Thread-11
-
----------
-Thread-12
-
----------
-Thread-13
-
----------
-Thread-4
-
----------
-Thread-5
-
----------
-Thread-6
-
----------
-Thread-7
-
----------
-Thread-8
-
----------
-Thread-9
-
----------
main
---------
+AllTraces Thread 0
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+
+---------
+AllTraces Thread 1
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+
+---------
+AllTraces Thread 2
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+
+---------
+AllTraces Thread 3
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+
+---------
+AllTraces Thread 4
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+
+---------
+AllTraces Thread 5
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+
+---------
+AllTraces Thread 6
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+
+---------
+AllTraces Thread 7
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+
+---------
+AllTraces Thread 8
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+
+---------
+AllTraces Thread 9
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+
+---------
FinalizerDaemon
<not printed>
---------
@@ -274,93 +354,223 @@
Signal Catcher
---------
-Thread-10
- wait ()V -1 -2
- printOrWait (IILControlData;)V 24 45
- baz (IIILControlData;)Ljava/lang/Object; 2 30
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
-
----------
-Thread-11
- wait ()V -1 -2
- printOrWait (IILControlData;)V 24 45
- baz (IIILControlData;)Ljava/lang/Object; 2 30
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
-
----------
-Thread-12
- wait ()V -1 -2
- printOrWait (IILControlData;)V 24 45
- baz (IIILControlData;)Ljava/lang/Object; 2 30
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
-
----------
-Thread-13
- wait ()V -1 -2
- printOrWait (IILControlData;)V 24 45
- baz (IIILControlData;)Ljava/lang/Object; 2 30
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
-
----------
-Thread-4
- wait ()V -1 -2
- printOrWait (IILControlData;)V 24 45
- baz (IIILControlData;)Ljava/lang/Object; 2 30
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
-
----------
-Thread-5
- wait ()V -1 -2
- printOrWait (IILControlData;)V 24 45
- baz (IIILControlData;)Ljava/lang/Object; 2 30
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
-
----------
-Thread-6
- wait ()V -1 -2
- printOrWait (IILControlData;)V 24 45
- baz (IIILControlData;)Ljava/lang/Object; 2 30
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
-
----------
-Thread-7
- wait ()V -1 -2
- printOrWait (IILControlData;)V 24 45
- baz (IIILControlData;)Ljava/lang/Object; 2 30
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
-
----------
-Thread-8
- wait ()V -1 -2
- printOrWait (IILControlData;)V 24 45
- baz (IIILControlData;)Ljava/lang/Object; 2 30
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
-
----------
-Thread-9
- wait ()V -1 -2
- printOrWait (IILControlData;)V 24 45
- baz (IIILControlData;)Ljava/lang/Object; 2 30
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
-
----------
main
getAllStackTraces (I)[[Ljava/lang/Object; -1 -2
printAll (I)V 0 73
- doTest ()V 102 57
+ doTest ()V 128 57
main ([Ljava/lang/String;)V 27 33
---------
+AllTraces Thread 0
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 45
+
+---------
+AllTraces Thread 1
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 45
+
+---------
+AllTraces Thread 2
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 45
+
+---------
+AllTraces Thread 3
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 45
+
+---------
+AllTraces Thread 4
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 45
+
+---------
+AllTraces Thread 5
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 45
+
+---------
+AllTraces Thread 6
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 45
+
+---------
+AllTraces Thread 7
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 45
+
+---------
+AllTraces Thread 8
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 45
+
+---------
+AllTraces Thread 9
+ wait ()V -1 -2
+ printOrWait (IILControlData;)V 24 45
+ baz (IIILControlData;)Ljava/lang/Object; 2 30
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ baz (IIILControlData;)Ljava/lang/Object; 9 32
+ bar (IIILControlData;)J 0 24
+ foo (IIILControlData;)I 0 19
+ run ()V 4 45
+
+---------
FinalizerDaemon
<not printed>
---------
@@ -376,220 +586,10 @@
Signal Catcher
---------
-Thread-10
- wait ()V -1 -2
- printOrWait (IILControlData;)V 24 45
- baz (IIILControlData;)Ljava/lang/Object; 2 30
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- run ()V 4 45
-
----------
-Thread-11
- wait ()V -1 -2
- printOrWait (IILControlData;)V 24 45
- baz (IIILControlData;)Ljava/lang/Object; 2 30
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- run ()V 4 45
-
----------
-Thread-12
- wait ()V -1 -2
- printOrWait (IILControlData;)V 24 45
- baz (IIILControlData;)Ljava/lang/Object; 2 30
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- run ()V 4 45
-
----------
-Thread-13
- wait ()V -1 -2
- printOrWait (IILControlData;)V 24 45
- baz (IIILControlData;)Ljava/lang/Object; 2 30
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- run ()V 4 45
-
----------
-Thread-4
- wait ()V -1 -2
- printOrWait (IILControlData;)V 24 45
- baz (IIILControlData;)Ljava/lang/Object; 2 30
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- run ()V 4 45
-
----------
-Thread-5
- wait ()V -1 -2
- printOrWait (IILControlData;)V 24 45
- baz (IIILControlData;)Ljava/lang/Object; 2 30
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- run ()V 4 45
-
----------
-Thread-6
- wait ()V -1 -2
- printOrWait (IILControlData;)V 24 45
- baz (IIILControlData;)Ljava/lang/Object; 2 30
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- run ()V 4 45
-
----------
-Thread-7
- wait ()V -1 -2
- printOrWait (IILControlData;)V 24 45
- baz (IIILControlData;)Ljava/lang/Object; 2 30
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- run ()V 4 45
-
----------
-Thread-8
- wait ()V -1 -2
- printOrWait (IILControlData;)V 24 45
- baz (IIILControlData;)Ljava/lang/Object; 2 30
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- run ()V 4 45
-
----------
-Thread-9
- wait ()V -1 -2
- printOrWait (IILControlData;)V 24 45
- baz (IIILControlData;)Ljava/lang/Object; 2 30
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- baz (IIILControlData;)Ljava/lang/Object; 9 32
- bar (IIILControlData;)J 0 24
- foo (IIILControlData;)I 0 19
- run ()V 4 45
-
----------
main
getAllStackTraces (I)[[Ljava/lang/Object; -1 -2
printAll (I)V 0 73
- doTest ()V 107 59
+ doTest ()V 133 59
main ([Ljava/lang/String;)V 27 33
@@ -597,25 +597,25 @@
### Other select threads (suspended) ###
########################################
---------
-Thread-14
+ThreadListTraces Thread 0
---------
-Thread-16
+ThreadListTraces Thread 2
---------
-Thread-18
+ThreadListTraces Thread 4
---------
-Thread-20
+ThreadListTraces Thread 6
---------
-Thread-22
+ThreadListTraces Thread 8
---------
main
---------
-Thread-14
+ThreadListTraces Thread 0
wait ()V -1 -2
printOrWait (IILControlData;)V 24 45
baz (IIILControlData;)Ljava/lang/Object; 2 30
@@ -623,7 +623,7 @@
foo (IIILControlData;)I 0 19
---------
-Thread-16
+ThreadListTraces Thread 2
wait ()V -1 -2
printOrWait (IILControlData;)V 24 45
baz (IIILControlData;)Ljava/lang/Object; 2 30
@@ -631,7 +631,7 @@
foo (IIILControlData;)I 0 19
---------
-Thread-18
+ThreadListTraces Thread 4
wait ()V -1 -2
printOrWait (IILControlData;)V 24 45
baz (IIILControlData;)Ljava/lang/Object; 2 30
@@ -639,7 +639,7 @@
foo (IIILControlData;)I 0 19
---------
-Thread-20
+ThreadListTraces Thread 6
wait ()V -1 -2
printOrWait (IILControlData;)V 24 45
baz (IIILControlData;)Ljava/lang/Object; 2 30
@@ -647,7 +647,7 @@
foo (IIILControlData;)I 0 19
---------
-Thread-22
+ThreadListTraces Thread 8
wait ()V -1 -2
printOrWait (IILControlData;)V 24 45
baz (IIILControlData;)Ljava/lang/Object; 2 30
@@ -658,11 +658,11 @@
main
getThreadListStackTraces ([Ljava/lang/Thread;I)[[Ljava/lang/Object; -1 -2
printList ([Ljava/lang/Thread;I)V 0 66
- doTest ()V 96 52
+ doTest ()V 116 52
main ([Ljava/lang/String;)V 35 37
---------
-Thread-14
+ThreadListTraces Thread 0
wait ()V -1 -2
printOrWait (IILControlData;)V 24 45
baz (IIILControlData;)Ljava/lang/Object; 2 30
@@ -683,7 +683,7 @@
run ()V 4 35
---------
-Thread-16
+ThreadListTraces Thread 2
wait ()V -1 -2
printOrWait (IILControlData;)V 24 45
baz (IIILControlData;)Ljava/lang/Object; 2 30
@@ -704,7 +704,7 @@
run ()V 4 35
---------
-Thread-18
+ThreadListTraces Thread 4
wait ()V -1 -2
printOrWait (IILControlData;)V 24 45
baz (IIILControlData;)Ljava/lang/Object; 2 30
@@ -725,7 +725,7 @@
run ()V 4 35
---------
-Thread-20
+ThreadListTraces Thread 6
wait ()V -1 -2
printOrWait (IILControlData;)V 24 45
baz (IIILControlData;)Ljava/lang/Object; 2 30
@@ -746,7 +746,7 @@
run ()V 4 35
---------
-Thread-22
+ThreadListTraces Thread 8
wait ()V -1 -2
printOrWait (IILControlData;)V 24 45
baz (IIILControlData;)Ljava/lang/Object; 2 30
@@ -770,7 +770,7 @@
main
getThreadListStackTraces ([Ljava/lang/Thread;I)[[Ljava/lang/Object; -1 -2
printList ([Ljava/lang/Thread;I)V 0 66
- doTest ()V 101 54
+ doTest ()V 121 54
main ([Ljava/lang/String;)V 35 37
diff --git a/test/911-get-stack-trace/src/AllTraces.java b/test/911-get-stack-trace/src/AllTraces.java
index adf6f38..1d9aa96 100644
--- a/test/911-get-stack-trace/src/AllTraces.java
+++ b/test/911-get-stack-trace/src/AllTraces.java
@@ -26,8 +26,8 @@
System.out.println("################################");
// Also create an unstarted and a dead thread.
- RETAIN.add(new Thread());
- Thread deadThread = new Thread();
+ RETAIN.add(new Thread("UNSTARTED"));
+ Thread deadThread = new Thread("DEAD");
RETAIN.add(deadThread);
deadThread.start();
deadThread.join();
@@ -40,7 +40,7 @@
Thread threads[] = new Thread[N];
for (int i = 0; i < N; i++) {
- Thread t = new Thread() {
+ Thread t = new Thread("AllTraces Thread " + i) {
public void run() {
Recurse.foo(4, 0, 0, data);
}
diff --git a/test/911-get-stack-trace/src/Frames.java b/test/911-get-stack-trace/src/Frames.java
index a1a11c3..54d4165 100644
--- a/test/911-get-stack-trace/src/Frames.java
+++ b/test/911-get-stack-trace/src/Frames.java
@@ -59,7 +59,7 @@
System.out.println("################################");
final ControlData data = new ControlData();
data.waitFor = new Object();
- Thread t = new Thread() {
+ Thread t = new Thread("Frames doTestOtherThreadWait") {
public void run() {
Recurse.foo(4, 0, 0, data);
}
@@ -97,7 +97,7 @@
System.out.println("### Other thread (live) ###");
System.out.println("###########################");
final ControlData data = new ControlData();
- Thread t = new Thread() {
+ Thread t = new Thread("Frames doTestOtherThreadBusyLoop") {
public void run() {
Recurse.foo(4, 0, 0, data);
}
diff --git a/test/911-get-stack-trace/src/OtherThread.java b/test/911-get-stack-trace/src/OtherThread.java
index 0748433..0a78523 100644
--- a/test/911-get-stack-trace/src/OtherThread.java
+++ b/test/911-get-stack-trace/src/OtherThread.java
@@ -21,7 +21,7 @@
System.out.println("################################");
final ControlData data = new ControlData();
data.waitFor = new Object();
- Thread t = new Thread() {
+ Thread t = new Thread("OtherThread doTestOtherThreadWait") {
public void run() {
Recurse.foo(4, 0, 0, data);
}
@@ -54,7 +54,7 @@
System.out.println("### Other thread (live) ###");
System.out.println("###########################");
final ControlData data = new ControlData();
- Thread t = new Thread() {
+ Thread t = new Thread("OtherThread doTestOtherThreadBusyLoop") {
public void run() {
Recurse.foo(4, 0, 0, data);
}
diff --git a/test/911-get-stack-trace/src/ThreadListTraces.java b/test/911-get-stack-trace/src/ThreadListTraces.java
index f66557f..14868e9 100644
--- a/test/911-get-stack-trace/src/ThreadListTraces.java
+++ b/test/911-get-stack-trace/src/ThreadListTraces.java
@@ -30,7 +30,7 @@
Thread list[] = new Thread[N/2 + 1];
for (int i = 0; i < N; i++) {
- Thread t = new Thread() {
+ Thread t = new Thread("ThreadListTraces Thread " + i) {
public void run() {
Recurse.foo(4, 0, 0, data);
}
diff --git a/test/912-classes/classes.cc b/test/912-classes/classes.cc
index c92e49f..3ccfe86 100644
--- a/test/912-classes/classes.cc
+++ b/test/912-classes/classes.cc
@@ -433,9 +433,13 @@
class ClassLoadPrepareEquality {
public:
static constexpr const char* kClassName = "LMain$ClassE;";
- static constexpr const char* kStorageClassName = "Main$ClassF";
static constexpr const char* kStorageFieldName = "STATIC";
static constexpr const char* kStorageFieldSig = "Ljava/lang/Object;";
+ static constexpr const char* kStorageWeakFieldName = "WEAK";
+ static constexpr const char* kStorageWeakFieldSig = "Ljava/lang/ref/Reference;";
+ static constexpr const char* kWeakClassName = "java/lang/ref/WeakReference";
+ static constexpr const char* kWeakInitSig = "(Ljava/lang/Object;)V";
+ static constexpr const char* kWeakGetSig = "()Ljava/lang/Object;";
static void JNICALL ClassLoadCallback(jvmtiEnv* jenv,
JNIEnv* jni_env,
@@ -472,6 +476,8 @@
static void SetOrCompare(JNIEnv* jni_env, jobject value, bool set) {
CHECK(storage_class_ != nullptr);
+
+ // Simple direct storage.
jfieldID field = jni_env->GetStaticFieldID(storage_class_, kStorageFieldName, kStorageFieldSig);
CHECK(field != nullptr);
@@ -482,6 +488,36 @@
ScopedLocalRef<jobject> stored(jni_env, jni_env->GetStaticObjectField(storage_class_, field));
CHECK(jni_env->IsSameObject(value, stored.get()));
}
+
+ // Storage as a reference.
+ ScopedLocalRef<jclass> weak_ref_class(jni_env, jni_env->FindClass(kWeakClassName));
+ CHECK(weak_ref_class.get() != nullptr);
+ jfieldID weak_field = jni_env->GetStaticFieldID(storage_class_,
+ kStorageWeakFieldName,
+ kStorageWeakFieldSig);
+ CHECK(weak_field != nullptr);
+ if (set) {
+ // Create a WeakReference.
+ jmethodID weak_init = jni_env->GetMethodID(weak_ref_class.get(), "<init>", kWeakInitSig);
+ CHECK(weak_init != nullptr);
+ ScopedLocalRef<jobject> weak_obj(jni_env, jni_env->NewObject(weak_ref_class.get(),
+ weak_init,
+ value));
+ CHECK(weak_obj.get() != nullptr);
+ jni_env->SetStaticObjectField(storage_class_, weak_field, weak_obj.get());
+ CHECK(!jni_env->ExceptionCheck());
+ } else {
+ // Check the reference value.
+ jmethodID get_referent = jni_env->GetMethodID(weak_ref_class.get(), "get", kWeakGetSig);
+ CHECK(get_referent != nullptr);
+ ScopedLocalRef<jobject> weak_obj(jni_env, jni_env->GetStaticObjectField(storage_class_,
+ weak_field));
+ CHECK(weak_obj.get() != nullptr);
+ ScopedLocalRef<jobject> weak_referent(jni_env, jni_env->CallObjectMethod(weak_obj.get(),
+ get_referent));
+ CHECK(weak_referent.get() != nullptr);
+ CHECK(jni_env->IsSameObject(value, weak_referent.get()));
+ }
}
static void CheckFound() {
diff --git a/test/912-classes/src/Main.java b/test/912-classes/src/Main.java
index 52a5194..005074f 100644
--- a/test/912-classes/src/Main.java
+++ b/test/912-classes/src/Main.java
@@ -14,6 +14,7 @@
* limitations under the License.
*/
+import java.lang.ref.Reference;
import java.lang.reflect.Constructor;
import java.lang.reflect.Proxy;
import java.util.Arrays;
@@ -433,6 +434,7 @@
public static class ClassF {
public static Object STATIC = null;
+ public static Reference<Object> WEAK = null;
}
private static final String DEX1 = System.getenv("DEX_LOCATION") + "/912-classes.jar";
diff --git a/test/945-obsolete-native/build b/test/945-obsolete-native/build
new file mode 100755
index 0000000..898e2e5
--- /dev/null
+++ b/test/945-obsolete-native/build
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-build "$@" --experimental agents
diff --git a/test/945-obsolete-native/expected.txt b/test/945-obsolete-native/expected.txt
new file mode 100644
index 0000000..83efda1
--- /dev/null
+++ b/test/945-obsolete-native/expected.txt
@@ -0,0 +1,9 @@
+hello
+Not doing anything here
+goodbye
+hello
+transforming calling function
+goodbye
+Hello - Transformed
+Not doing anything here
+Goodbye - Transformed
diff --git a/test/945-obsolete-native/info.txt b/test/945-obsolete-native/info.txt
new file mode 100644
index 0000000..c8b892c
--- /dev/null
+++ b/test/945-obsolete-native/info.txt
@@ -0,0 +1 @@
+Tests basic obsolete method support
diff --git a/test/945-obsolete-native/obsolete_native.cc b/test/945-obsolete-native/obsolete_native.cc
new file mode 100644
index 0000000..061e7af
--- /dev/null
+++ b/test/945-obsolete-native/obsolete_native.cc
@@ -0,0 +1,51 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include <inttypes.h>
+#include <memory>
+#include <stdio.h>
+
+#include "android-base/stringprintf.h"
+
+#include "android-base/stringprintf.h"
+#include "base/logging.h"
+#include "base/macros.h"
+#include "jni.h"
+#include "openjdkjvmti/jvmti.h"
+#include "ScopedLocalRef.h"
+#include "ti-agent/common_helper.h"
+#include "ti-agent/common_load.h"
+
+namespace art {
+namespace Test945ObsoleteNative {
+
+extern "C" JNIEXPORT void JNICALL Java_Main_bindTest945ObsoleteNative(
+ JNIEnv* env, jclass klass ATTRIBUTE_UNUSED) {
+ BindFunctions(jvmti_env, env, "Transform");
+}
+
+extern "C" JNIEXPORT void JNICALL Java_Transform_doExecute(JNIEnv* env,
+ jclass klass ATTRIBUTE_UNUSED,
+ jobject runnable) {
+ jclass runnable_klass = env->FindClass("java/lang/Runnable");
+ DCHECK(runnable_klass != nullptr);
+ jmethodID run_method = env->GetMethodID(runnable_klass, "run", "()V");
+ env->CallVoidMethod(runnable, run_method);
+}
+
+
+} // namespace Test945ObsoleteNative
+} // namespace art
diff --git a/test/945-obsolete-native/run b/test/945-obsolete-native/run
new file mode 100755
index 0000000..c6e62ae
--- /dev/null
+++ b/test/945-obsolete-native/run
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-run "$@" --jvmti
diff --git a/test/945-obsolete-native/src/Main.java b/test/945-obsolete-native/src/Main.java
new file mode 100644
index 0000000..5e2154e
--- /dev/null
+++ b/test/945-obsolete-native/src/Main.java
@@ -0,0 +1,77 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+
+public class Main {
+ // class Transform {
+ // public void sayHi(Runnable r) {
+ // System.out.println("Hello - Transformed");
+ // doExecute(r);
+ // System.out.println("Goodbye - Transformed");
+ // }
+ //
+ // private static native void doExecute(Runnable r);
+ // }
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAIgoACAASCQATABQIABUKABYAFwoABwAYCAAZBwAaBwAbAQAGPGluaXQ+AQADKClW" +
+ "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
+ "KVYBAAlkb0V4ZWN1dGUBAApTb3VyY2VGaWxlAQAOVHJhbnNmb3JtLmphdmEMAAkACgcAHAwAHQAe" +
+ "AQATSGVsbG8gLSBUcmFuc2Zvcm1lZAcAHwwAIAAhDAAPAA4BABVHb29kYnllIC0gVHJhbnNmb3Jt" +
+ "ZWQBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291" +
+ "dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2phdmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxu" +
+ "AQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABwAIAAAAAAADAAAACQAKAAEACwAAAB0AAQABAAAA" +
+ "BSq3AAGxAAAAAQAMAAAABgABAAAAEQABAA0ADgABAAsAAAA5AAIAAgAAABWyAAISA7YABCu4AAWy" +
+ "AAISBrYABLEAAAABAAwAAAASAAQAAAATAAgAFAAMABUAFAAWAQoADwAOAAAAAQAQAAAAAgAR");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQB1fZcJR/opPuXacK8mIla5shH0LSg72qJYAwAAcAAAAHhWNBIAAAAAAAAAALgCAAAR" +
+ "AAAAcAAAAAcAAAC0AAAAAwAAANAAAAABAAAA9AAAAAUAAAD8AAAAAQAAACQBAAAUAgAARAEAAKIB" +
+ "AACqAQAAwQEAANYBAADjAQAA+gEAAA4CAAAkAgAAOAIAAEwCAABcAgAAXwIAAGMCAABuAgAAggIA" +
+ "AIcCAACQAgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACgAAAAoAAAAGAAAAAAAAAAsAAAAGAAAA" +
+ "lAEAAAsAAAAGAAAAnAEAAAUAAQAOAAAAAAAAAAAAAAAAAAEADAAAAAAAAQAQAAAAAQACAA8AAAAC" +
+ "AAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAJAAAAAAAAAKUCAAAAAAAAAQABAAEAAACXAgAABAAAAHAQ" +
+ "BAAAAA4ABAACAAIAAACcAgAAFAAAAGIAAAAbAQIAAABuIAMAEABxEAEAAwBiAAAAGwEBAAAAbiAD" +
+ "ABAADgABAAAAAwAAAAEAAAAEAAY8aW5pdD4AFUdvb2RieWUgLSBUcmFuc2Zvcm1lZAATSGVsbG8g" +
+ "LSBUcmFuc2Zvcm1lZAALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwASTGphdmEv" +
+ "bGFuZy9PYmplY3Q7ABRMamF2YS9sYW5nL1J1bm5hYmxlOwASTGphdmEvbGFuZy9TdHJpbmc7ABJM" +
+ "amF2YS9sYW5nL1N5c3RlbTsADlRyYW5zZm9ybS5qYXZhAAFWAAJWTAAJZG9FeGVjdXRlABJlbWl0" +
+ "dGVyOiBqYWNrLTQuMjUAA291dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAQAHDoc8hwAAAAIBAICA" +
+ "BMQCAYoCAAIB3AIADQAAAAAAAAABAAAAAAAAAAEAAAARAAAAcAAAAAIAAAAHAAAAtAAAAAMAAAAD" +
+ "AAAA0AAAAAQAAAABAAAA9AAAAAUAAAAFAAAA/AAAAAYAAAABAAAAJAEAAAEgAAACAAAARAEAAAEQ" +
+ "AAACAAAAlAEAAAIgAAARAAAAogEAAAMgAAACAAAAlwIAAAAgAAABAAAApQIAAAAQAAABAAAAuAIA" +
+ "AA==");
+
+ public static void main(String[] args) {
+ bindTest945ObsoleteNative();
+ doTest(new Transform());
+ }
+
+ public static void doTest(Transform t) {
+ t.sayHi(() -> { System.out.println("Not doing anything here"); });
+ t.sayHi(() -> {
+ System.out.println("transforming calling function");
+ doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+ });
+ t.sayHi(() -> { System.out.println("Not doing anything here"); });
+ }
+
+ // Transforms the class
+ private static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+
+ private static native void bindTest945ObsoleteNative();
+}
diff --git a/test/945-obsolete-native/src/Transform.java b/test/945-obsolete-native/src/Transform.java
new file mode 100644
index 0000000..2b7cc1b
--- /dev/null
+++ b/test/945-obsolete-native/src/Transform.java
@@ -0,0 +1,25 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Transform {
+ public void sayHi(Runnable r) {
+ System.out.println("hello");
+ doExecute(r);
+ System.out.println("goodbye");
+ }
+
+ private static native void doExecute(Runnable r);
+}
diff --git a/test/946-obsolete-throw/build b/test/946-obsolete-throw/build
new file mode 100755
index 0000000..ebbc368
--- /dev/null
+++ b/test/946-obsolete-throw/build
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2017 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-build "$@" --experimental agents
diff --git a/test/946-obsolete-throw/expected.txt b/test/946-obsolete-throw/expected.txt
new file mode 100644
index 0000000..91dd7df
--- /dev/null
+++ b/test/946-obsolete-throw/expected.txt
@@ -0,0 +1,14 @@
+hello
+Not doing anything here
+goodbye
+hello
+transforming calling function
+Received error : java.lang.Error: Throwing exception into an obsolete method!
+java.lang.Error: Throwing exception into an obsolete method!
+ at Main$DoRedefinitionClass.run(Main.java:64)
+ at Transform.sayHi(Transform.java:27)
+ at Main.doTest(Main.java:71)
+ at Main.main(Main.java:56)
+Hello - Transformed
+Not doing anything here
+Goodbye - Transformed
diff --git a/test/946-obsolete-throw/info.txt b/test/946-obsolete-throw/info.txt
new file mode 100644
index 0000000..7b7a63d
--- /dev/null
+++ b/test/946-obsolete-throw/info.txt
@@ -0,0 +1,3 @@
+Tests basic obsolete method support
+
+Tests that we correctly handle exceptions thrown through obsolete methods.
diff --git a/test/946-obsolete-throw/run b/test/946-obsolete-throw/run
new file mode 100755
index 0000000..e92b873
--- /dev/null
+++ b/test/946-obsolete-throw/run
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2017 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-run "$@" --jvmti
diff --git a/test/946-obsolete-throw/src/Main.java b/test/946-obsolete-throw/src/Main.java
new file mode 100644
index 0000000..3ff97ae
--- /dev/null
+++ b/test/946-obsolete-throw/src/Main.java
@@ -0,0 +1,83 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+
+public class Main {
+ // class Transform {
+ // public void sayHi(Runnable r) {
+ // System.out.println("Hello - Transformed");
+ // r.run();
+ // System.out.println("Goodbye - Transformed");
+ // }
+ // }
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAJAoACAARCQASABMIABQKABUAFgsAFwAYCAAZBwAaBwAbAQAGPGluaXQ+AQADKClW" +
+ "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
+ "KVYBAApTb3VyY2VGaWxlAQAOVHJhbnNmb3JtLmphdmEMAAkACgcAHAwAHQAeAQATSGVsbG8gLSBU" +
+ "cmFuc2Zvcm1lZAcAHwwAIAAhBwAiDAAjAAoBABVHb29kYnllIC0gVHJhbnNmb3JtZWQBAAlUcmFu" +
+ "c2Zvcm0BABBqYXZhL2xhbmcvT2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZh" +
+ "L2lvL1ByaW50U3RyZWFtOwEAE2phdmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZh" +
+ "L2xhbmcvU3RyaW5nOylWAQASamF2YS9sYW5nL1J1bm5hYmxlAQADcnVuACAABwAIAAAAAAACAAAA" +
+ "CQAKAAEACwAAAB0AAQABAAAABSq3AAGxAAAAAQAMAAAABgABAAAAAQABAA0ADgABAAsAAAA7AAIA" +
+ "AgAAABeyAAISA7YABCu5AAUBALIAAhIGtgAEsQAAAAEADAAAABIABAAAAAMACAAEAA4ABQAWAAYA" +
+ "AQAPAAAAAgAQ");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQAYeAMMXgYWxoeSHAS9EWKCCtVRSAGpqZVQAwAAcAAAAHhWNBIAAAAAAAAAALACAAAR" +
+ "AAAAcAAAAAcAAAC0AAAAAwAAANAAAAABAAAA9AAAAAUAAAD8AAAAAQAAACQBAAAMAgAARAEAAKIB" +
+ "AACqAQAAwQEAANYBAADjAQAA+gEAAA4CAAAkAgAAOAIAAEwCAABcAgAAXwIAAGMCAAB3AgAAfAIA" +
+ "AIUCAACKAgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACgAAAAoAAAAGAAAAAAAAAAsAAAAGAAAA" +
+ "lAEAAAsAAAAGAAAAnAEAAAUAAQANAAAAAAAAAAAAAAAAAAEAEAAAAAEAAgAOAAAAAgAAAAAAAAAD" +
+ "AAAADwAAAAAAAAAAAAAAAgAAAAAAAAAJAAAAAAAAAJ8CAAAAAAAAAQABAAEAAACRAgAABAAAAHAQ" +
+ "AwAAAA4ABAACAAIAAACWAgAAFAAAAGIAAAAbAQIAAABuIAIAEAByEAQAAwBiAAAAGwEBAAAAbiAC" +
+ "ABAADgABAAAAAwAAAAEAAAAEAAY8aW5pdD4AFUdvb2RieWUgLSBUcmFuc2Zvcm1lZAATSGVsbG8g" +
+ "LSBUcmFuc2Zvcm1lZAALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwASTGphdmEv" +
+ "bGFuZy9PYmplY3Q7ABRMamF2YS9sYW5nL1J1bm5hYmxlOwASTGphdmEvbGFuZy9TdHJpbmc7ABJM" +
+ "amF2YS9sYW5nL1N5c3RlbTsADlRyYW5zZm9ybS5qYXZhAAFWAAJWTAASZW1pdHRlcjogamFjay00" +
+ "LjEzAANvdXQAB3ByaW50bG4AA3J1bgAFc2F5SGkAAQAHDgADAQAHDoc8hwAAAAEBAICABMQCAQHc" +
+ "AgAAAA0AAAAAAAAAAQAAAAAAAAABAAAAEQAAAHAAAAACAAAABwAAALQAAAADAAAAAwAAANAAAAAE" +
+ "AAAAAQAAAPQAAAAFAAAABQAAAPwAAAAGAAAAAQAAACQBAAABIAAAAgAAAEQBAAABEAAAAgAAAJQB" +
+ "AAACIAAAEQAAAKIBAAADIAAAAgAAAJECAAAAIAAAAQAAAJ8CAAAAEAAAAQAAALACAAA=");
+
+ public static void main(String[] args) {
+ doTest(new Transform());
+ }
+
+ static class DoRedefinitionClass implements Runnable {
+ @Override
+ public void run() {
+ System.out.println("transforming calling function");
+ doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+ throw new Error("Throwing exception into an obsolete method!");
+ }
+ }
+
+ public static void doTest(Transform t) {
+ t.sayHi(() -> { System.out.println("Not doing anything here"); });
+ try {
+ t.sayHi(new DoRedefinitionClass());
+ } catch (Throwable e) {
+ System.out.println("Received error : " + e);
+ e.printStackTrace();
+ }
+ t.sayHi(() -> { System.out.println("Not doing anything here"); });
+ }
+
+ // Transforms the class
+ private static native void doCommonClassRedefinition(Class<?> target,
+ byte[] classfile,
+ byte[] dexfile);
+}
diff --git a/test/946-obsolete-throw/src/Transform.java b/test/946-obsolete-throw/src/Transform.java
new file mode 100644
index 0000000..4f43086
--- /dev/null
+++ b/test/946-obsolete-throw/src/Transform.java
@@ -0,0 +1,30 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Transform {
+ public void sayHi(Runnable r) {
+ // Use lower 'h' to make sure the string will have a different string id
+ // than the transformation (the transformation code is the same except
+ // the actual printed String, which was making the test inacurately passing
+ // in JIT mode when loading the string from the dex cache, as the string ids
+ // of the two different strings were the same).
+ // We know the string ids will be different because lexicographically:
+ // "Hello" < "LTransform;" < "hello".
+ System.out.println("hello");
+ r.run();
+ System.out.println("goodbye");
+ }
+}
diff --git a/test/947-reflect-method/build b/test/947-reflect-method/build
new file mode 100755
index 0000000..ebbc368
--- /dev/null
+++ b/test/947-reflect-method/build
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2017 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-build "$@" --experimental agents
diff --git a/test/947-reflect-method/expected.txt b/test/947-reflect-method/expected.txt
new file mode 100644
index 0000000..4774b81
--- /dev/null
+++ b/test/947-reflect-method/expected.txt
@@ -0,0 +1,2 @@
+hello
+Goodbye
diff --git a/test/947-reflect-method/info.txt b/test/947-reflect-method/info.txt
new file mode 100644
index 0000000..f3d03c1
--- /dev/null
+++ b/test/947-reflect-method/info.txt
@@ -0,0 +1,4 @@
+Tests basic functions in the jvmti plugin.
+
+Tests that we are able to use java/lang/reflect/Method objects to invoke methods
+that have been redefined.
diff --git a/test/947-reflect-method/run b/test/947-reflect-method/run
new file mode 100755
index 0000000..e92b873
--- /dev/null
+++ b/test/947-reflect-method/run
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2017 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-run "$@" --jvmti
diff --git a/test/947-reflect-method/src/Main.java b/test/947-reflect-method/src/Main.java
new file mode 100644
index 0000000..a229dd4
--- /dev/null
+++ b/test/947-reflect-method/src/Main.java
@@ -0,0 +1,72 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+import java.lang.reflect.Method;
+
+public class Main {
+
+ /**
+ * base64 encoded class/dex file for
+ * class Transform {
+ * public void sayHi() {
+ * System.out.println("Goodbye");
+ * }
+ * }
+ */
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+ "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
+ "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
+ "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
+ "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" +
+ "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
+ "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0=");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+ "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+ "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
+ "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+ "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
+ "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
+ "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
+ "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
+ "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
+ "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
+ "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+ "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+ "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
+
+ public static void main(String[] args) {
+ doTest(new Transform());
+ }
+
+ public static void doTest(Transform t) {
+ try {
+ Method say_hi_method = t.getClass().getDeclaredMethod("sayHi");
+ say_hi_method.invoke(t);
+ doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+ say_hi_method.invoke(t);
+ } catch (Exception e) {
+ e.printStackTrace();
+ }
+ }
+
+ // Transforms the class
+ private static native void doCommonClassRedefinition(Class<?> target,
+ byte[] class_file,
+ byte[] dex_file);
+}
diff --git a/test/947-reflect-method/src/Transform.java b/test/947-reflect-method/src/Transform.java
new file mode 100644
index 0000000..b8fe34a
--- /dev/null
+++ b/test/947-reflect-method/src/Transform.java
@@ -0,0 +1,28 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Transform {
+ public void sayHi() {
+ // Use lower 'h' to make sure the string will have a different string id
+ // than the transformation (the transformation code is the same except
+ // the actual printed String, which was making the test inacurately passing
+ // in JIT mode when loading the string from the dex cache, as the string ids
+ // of the two different strings were the same).
+ // We know the string ids will be different because lexicographically:
+ // "Goodbye" < "LTransform;" < "hello".
+ System.out.println("hello");
+ }
+}
diff --git a/test/948-change-annotations/build b/test/948-change-annotations/build
new file mode 100755
index 0000000..898e2e5
--- /dev/null
+++ b/test/948-change-annotations/build
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-build "$@" --experimental agents
diff --git a/test/948-change-annotations/expected.txt b/test/948-change-annotations/expected.txt
new file mode 100644
index 0000000..680b18e
--- /dev/null
+++ b/test/948-change-annotations/expected.txt
@@ -0,0 +1,21 @@
+Running test class RemoveAnnotationsTest
+Type annotations: [@TestClassAnnotation1(value=hello)]
+method public void Transform.sayHi() -> [@TestMethodAnnotation1(value=hi hi)]
+hello
+Goodbye
+Type annotations: []
+method public void Transform.sayHi() -> []
+Running test class AddAnnotationsTest
+Type annotations: [@TestClassAnnotation1(value=hello)]
+method public void Transform.sayHi() -> [@TestMethodAnnotation1(value=hi hi)]
+hello
+Goodbye
+Type annotations: [@TestClassAnnotation2(value=hello2), @TestClassAnnotation1(value=hello)]
+method public void Transform.sayHi() -> [@TestMethodAnnotation1(value=hi hi), @TestMethodAnnotation2(value=hi hi2)]
+Running test class ChangeAnnotationValues
+Type annotations: [@TestClassAnnotation1(value=hello)]
+method public void Transform.sayHi() -> [@TestMethodAnnotation1(value=hi hi)]
+hello
+Goodbye
+Type annotations: [@TestClassAnnotation1(value=Goodbye)]
+method public void Transform.sayHi() -> [@TestMethodAnnotation1(value=Bye Bye)]
diff --git a/test/948-change-annotations/info.txt b/test/948-change-annotations/info.txt
new file mode 100644
index 0000000..875a5f6
--- /dev/null
+++ b/test/948-change-annotations/info.txt
@@ -0,0 +1 @@
+Tests basic functions in the jvmti plugin.
diff --git a/test/948-change-annotations/run b/test/948-change-annotations/run
new file mode 100755
index 0000000..c6e62ae
--- /dev/null
+++ b/test/948-change-annotations/run
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-run "$@" --jvmti
diff --git a/test/948-change-annotations/src/AddAnnotationsTest.java b/test/948-change-annotations/src/AddAnnotationsTest.java
new file mode 100644
index 0000000..6876e87
--- /dev/null
+++ b/test/948-change-annotations/src/AddAnnotationsTest.java
@@ -0,0 +1,70 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+public class AddAnnotationsTest implements TestCase {
+ /**
+ * base64 encoded class/dex file for
+ * @TestClassAnnotation1("hello")
+ * @TestClassAnnotation2("hello2")
+ * class Transform {
+ * @TestMethodAnnotation1("hi hi")
+ * @TestMethodAnnotation2("hi hi2")
+ * public void sayHi() {
+ * System.out.println("Goodbye");
+ * }
+ * }
+ */
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAKQoABgAbCQAcAB0IAB4KAB8AIAcAIQcAIgEABjxpbml0PgEAAygpVgEABENvZGUB" +
+ "AA9MaW5lTnVtYmVyVGFibGUBABJMb2NhbFZhcmlhYmxlVGFibGUBAAR0aGlzAQALTFRyYW5zZm9y" +
+ "bTsBAAVzYXlIaQEAGVJ1bnRpbWVWaXNpYmxlQW5ub3RhdGlvbnMBABdMVGVzdE1ldGhvZEFubm90" +
+ "YXRpb24xOwEABXZhbHVlAQAFaGkgaGkBABdMVGVzdE1ldGhvZEFubm90YXRpb24yOwEABmhpIGhp" +
+ "MgEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQEAFkxUZXN0Q2xhc3NBbm5vdGF0aW9uMTsB" +
+ "AAVoZWxsbwEAFkxUZXN0Q2xhc3NBbm5vdGF0aW9uMjsBAAZoZWxsbzIMAAcACAcAIwwAJAAlAQAH" +
+ "R29vZGJ5ZQcAJgwAJwAoAQAJVHJhbnNmb3JtAQAQamF2YS9sYW5nL09iamVjdAEAEGphdmEvbGFu" +
+ "Zy9TeXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsBABNqYXZhL2lvL1ByaW50U3Ry" +
+ "ZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgAgAAUABgAAAAAAAgAAAAcACAAB" +
+ "AAkAAAAvAAEAAQAAAAUqtwABsQAAAAIACgAAAAYAAQAAABMACwAAAAwAAQAAAAUADAANAAAAAQAO" +
+ "AAgAAgAJAAAANwACAAEAAAAJsgACEgO2AASxAAAAAgAKAAAACgACAAAAFwAIABgACwAAAAwAAQAA" +
+ "AAkADAANAAAADwAAABQAAgAQAAEAEXMAEgATAAEAEXMAFAACABUAAAACABYADwAAABQAAgAXAAEA" +
+ "EXMAGAAZAAEAEXMAGg==");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQA7mPKPjUKe43s+OLHHgFVRVCAPn/rRz9z0AwAAcAAAAHhWNBIAAAAAAAAAADADAAAX" +
+ "AAAAcAAAAAoAAADMAAAAAgAAAPQAAAABAAAADAEAAAQAAAAUAQAAAQAAADQBAACgAgAAVAEAAMYB" +
+ "AADOAQAA1wEAAO8BAAAHAgAAIAIAADkCAABGAgAAXQIAAHECAACFAgAAmQIAAKkCAACsAgAAsAIA" +
+ "AMQCAADLAgAA0wIAANoCAADiAgAA5wIAAPACAAD3AgAAAgAAAAMAAAAEAAAABQAAAAYAAAAHAAAA" +
+ "CAAAAAkAAAAKAAAADAAAAAwAAAAJAAAAAAAAAA0AAAAJAAAAwAEAAAgABQATAAAABAAAAAAAAAAE" +
+ "AAAAFQAAAAUAAQAUAAAABgAAAAAAAAAEAAAAAAAAAAYAAAAAAAAACwAAAKgBAAAhAwAAAAAAAAIA" +
+ "AAAJAwAADwMAAAIAAAAVAwAAGwMAAAEAAQABAAAA/gIAAAQAAABwEAMAAAAOAAMAAQACAAAAAwMA" +
+ "AAkAAABiAAAAGwEBAAAAbiACABAADgAAAFQBAAAAAAAAAQAAAAAAAAABAAAAYAEAAAEAAAAHAAY8" +
+ "aW5pdD4AB0dvb2RieWUAFkxUZXN0Q2xhc3NBbm5vdGF0aW9uMTsAFkxUZXN0Q2xhc3NBbm5vdGF0" +
+ "aW9uMjsAF0xUZXN0TWV0aG9kQW5ub3RhdGlvbjE7ABdMVGVzdE1ldGhvZEFubm90YXRpb24yOwAL" +
+ "TFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJM" +
+ "amF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xhbmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYA" +
+ "AlZMABJlbWl0dGVyOiBqYWNrLTQuMjUABWhlbGxvAAZoZWxsbzIABWhpIGhpAAZoaSBoaTIAA291" +
+ "dAAHcHJpbnRsbgAFc2F5SGkABXZhbHVlABMABw4AFwAHDocAAQABFhcPAQEBFhcQAQIBFhcRAQMB" +
+ "FhcSAAABAQCAgATsAgEBhAMAEAAAAAAAAAABAAAAAAAAAAEAAAAXAAAAcAAAAAIAAAAKAAAAzAAA" +
+ "AAMAAAACAAAA9AAAAAQAAAABAAAADAEAAAUAAAAEAAAAFAEAAAYAAAABAAAANAEAAAMQAAACAAAA" +
+ "VAEAAAEgAAACAAAAbAEAAAYgAAABAAAAqAEAAAEQAAABAAAAwAEAAAIgAAAXAAAAxgEAAAMgAAAC" +
+ "AAAA/gIAAAQgAAAEAAAACQMAAAAgAAABAAAAIQMAAAAQAAABAAAAMAMAAA==");
+
+ public void runTest(Transform t) {
+ t.sayHi();
+ Main.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+ t.sayHi();
+ }
+}
diff --git a/test/948-change-annotations/src/ChangeAnnotationValues.java b/test/948-change-annotations/src/ChangeAnnotationValues.java
new file mode 100644
index 0000000..89a766c
--- /dev/null
+++ b/test/948-change-annotations/src/ChangeAnnotationValues.java
@@ -0,0 +1,64 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+public class ChangeAnnotationValues implements TestCase {
+ /**
+ * base64 encoded class/dex file for
+ * @TestClassAnnotation1("Goodbye")
+ * class Transform {
+ * @TestMethodAnnotation1("Bye Bye")
+ * public void sayHi() {
+ * System.out.println("Goodbye");
+ * }
+ * }
+ */
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAJAoABgAXCQAYABkIABYKABoAGwcAHAcAHQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+ "AA9MaW5lTnVtYmVyVGFibGUBABJMb2NhbFZhcmlhYmxlVGFibGUBAAR0aGlzAQALTFRyYW5zZm9y" +
+ "bTsBAAVzYXlIaQEAGVJ1bnRpbWVWaXNpYmxlQW5ub3RhdGlvbnMBABdMVGVzdE1ldGhvZEFubm90" +
+ "YXRpb24xOwEABXZhbHVlAQAHQnllIEJ5ZQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQEA" +
+ "FkxUZXN0Q2xhc3NBbm5vdGF0aW9uMTsBAAdHb29kYnllDAAHAAgHAB4MAB8AIAcAIQwAIgAjAQAJ" +
+ "VHJhbnNmb3JtAQAQamF2YS9sYW5nL09iamVjdAEAEGphdmEvbGFuZy9TeXN0ZW0BAANvdXQBABVM" +
+ "amF2YS9pby9QcmludFN0cmVhbTsBABNqYXZhL2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShM" +
+ "amF2YS9sYW5nL1N0cmluZzspVgAgAAUABgAAAAAAAgAAAAcACAABAAkAAAAvAAEAAQAAAAUqtwAB" +
+ "sQAAAAIACgAAAAYAAQAAAAIACwAAAAwAAQAAAAUADAANAAAAAQAOAAgAAgAJAAAANwACAAEAAAAJ" +
+ "sgACEgO2AASxAAAAAgAKAAAACgACAAAABQAIAAYACwAAAAwAAQAAAAkADAANAAAADwAAAAsAAQAQ" +
+ "AAEAEXMAEgACABMAAAACABQADwAAAAsAAQAVAAEAEXMAFg==");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQAXfYs9FUE830lxfnB+X66S7iZiP5A7uDSAAwAAcAAAAHhWNBIAAAAAAAAAALwCAAAS" +
+ "AAAAcAAAAAgAAAC4AAAAAgAAANgAAAABAAAA8AAAAAQAAAD4AAAAAQAAABgBAABIAgAAOAEAAKIB" +
+ "AACqAQAAswEAALwBAADUAQAA7QEAAPoBAAARAgAAJQIAADkCAABNAgAAXQIAAGACAABkAgAAeAIA" +
+ "AH0CAACGAgAAjQIAAAMAAAAEAAAABQAAAAYAAAAHAAAACAAAAAkAAAALAAAACwAAAAcAAAAAAAAA" +
+ "DAAAAAcAAACcAQAABgADAA4AAAACAAAAAAAAAAIAAAAQAAAAAwABAA8AAAAEAAAAAAAAAAIAAAAA" +
+ "AAAABAAAAAAAAAAKAAAAhAEAAKsCAAAAAAAAAQAAAJ8CAAABAAAApQIAAAEAAQABAAAAlAIAAAQA" +
+ "AABwEAMAAAAOAAMAAQACAAAAmQIAAAkAAABiAAAAGwECAAAAbiACABAADgAAADgBAAAAAAAAAQAA" +
+ "AAAAAAABAAAAQAEAAAEAAAAFAAY8aW5pdD4AB0J5ZSBCeWUAB0dvb2RieWUAFkxUZXN0Q2xhc3NB" +
+ "bm5vdGF0aW9uMTsAF0xUZXN0TWV0aG9kQW5ub3RhdGlvbjE7AAtMVHJhbnNmb3JtOwAVTGphdmEv" +
+ "aW8vUHJpbnRTdHJlYW07ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwAS" +
+ "TGphdmEvbGFuZy9TeXN0ZW07AA5UcmFuc2Zvcm0uamF2YQABVgACVkwAEmVtaXR0ZXI6IGphY2st" +
+ "NC4yNQADb3V0AAdwcmludGxuAAVzYXlIaQAFdmFsdWUAAgAHDgAFAAcOhwABAAERFwIBAQERFwEA" +
+ "AAEBAICABMgCAQHgAgAAABAAAAAAAAAAAQAAAAAAAAABAAAAEgAAAHAAAAACAAAACAAAALgAAAAD" +
+ "AAAAAgAAANgAAAAEAAAAAQAAAPAAAAAFAAAABAAAAPgAAAAGAAAAAQAAABgBAAADEAAAAgAAADgB" +
+ "AAABIAAAAgAAAEgBAAAGIAAAAQAAAIQBAAABEAAAAQAAAJwBAAACIAAAEgAAAKIBAAADIAAAAgAA" +
+ "AJQCAAAEIAAAAgAAAJ8CAAAAIAAAAQAAAKsCAAAAEAAAAQAAALwCAAA=");
+
+ public void runTest(Transform t) {
+ t.sayHi();
+ Main.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+ t.sayHi();
+ }
+}
diff --git a/test/948-change-annotations/src/Main.java b/test/948-change-annotations/src/Main.java
new file mode 100644
index 0000000..fe321e2
--- /dev/null
+++ b/test/948-change-annotations/src/Main.java
@@ -0,0 +1,82 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Arrays;
+import java.util.Base64;
+import java.lang.reflect.*;
+import java.lang.annotation.*;
+public class Main {
+
+ /**
+ * base64 encoded class/dex file for for initial Transform.java
+ */
+ private static final byte[] INITIAL_CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAJAoABgAXCQAYABkIABYKABoAGwcAHAcAHQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+ "AA9MaW5lTnVtYmVyVGFibGUBABJMb2NhbFZhcmlhYmxlVGFibGUBAAR0aGlzAQALTFRyYW5zZm9y" +
+ "bTsBAAVzYXlIaQEAGVJ1bnRpbWVWaXNpYmxlQW5ub3RhdGlvbnMBABdMVGVzdE1ldGhvZEFubm90" +
+ "YXRpb24xOwEABXZhbHVlAQAFaGkgaGkBAApTb3VyY2VGaWxlAQAOVHJhbnNmb3JtLmphdmEBABZM" +
+ "VGVzdENsYXNzQW5ub3RhdGlvbjE7AQAFaGVsbG8MAAcACAcAHgwAHwAgBwAhDAAiACMBAAlUcmFu" +
+ "c2Zvcm0BABBqYXZhL2xhbmcvT2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZh" +
+ "L2lvL1ByaW50U3RyZWFtOwEAE2phdmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZh" +
+ "L2xhbmcvU3RyaW5nOylWACAABQAGAAAAAAACAAAABwAIAAEACQAAAC8AAQABAAAABSq3AAGxAAAA" +
+ "AgAKAAAABgABAAAAEgALAAAADAABAAAABQAMAA0AAAABAA4ACAACAAkAAAA3AAIAAQAAAAmyAAIS" +
+ "A7YABLEAAAACAAoAAAAKAAIAAAAVAAgAFgALAAAADAABAAAACQAMAA0AAAAPAAAACwABABAAAQAR" +
+ "cwASAAIAEwAAAAIAFAAPAAAACwABABUAAQARcwAW");
+ private static final byte[] INITIAL_DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQCufKz9atC18kWgSsEfRq699UEcX4cHonN8AwAAcAAAAHhWNBIAAAAAAAAAALgCAAAS" +
+ "AAAAcAAAAAgAAAC4AAAAAgAAANgAAAABAAAA8AAAAAQAAAD4AAAAAQAAABgBAABEAgAAOAEAAKIB" +
+ "AACqAQAAwgEAANsBAADoAQAA/wEAABMCAAAnAgAAOwIAAEsCAABOAgAAUgIAAGYCAABtAgAAdAIA" +
+ "AHkCAACCAgAAiQIAAAEAAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAJAAAACQAAAAcAAAAAAAAA" +
+ "CgAAAAcAAACcAQAABgADAA4AAAACAAAAAAAAAAIAAAAQAAAAAwABAA8AAAAEAAAAAAAAAAIAAAAA" +
+ "AAAABAAAAAAAAAAIAAAAhAEAAKcCAAAAAAAAAQAAAJsCAAABAAAAoQIAAAEAAQABAAAAkAIAAAQA" +
+ "AABwEAMAAAAOAAMAAQACAAAAlQIAAAkAAABiAAAAGwEMAAAAbiACABAADgAAADgBAAAAAAAAAQAA" +
+ "AAAAAAABAAAAQAEAAAEAAAAFAAY8aW5pdD4AFkxUZXN0Q2xhc3NBbm5vdGF0aW9uMTsAF0xUZXN0" +
+ "TWV0aG9kQW5ub3RhdGlvbjE7AAtMVHJhbnNmb3JtOwAVTGphdmEvaW8vUHJpbnRTdHJlYW07ABJM" +
+ "amF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwASTGphdmEvbGFuZy9TeXN0ZW07" +
+ "AA5UcmFuc2Zvcm0uamF2YQABVgACVkwAEmVtaXR0ZXI6IGphY2stNC4yNQAFaGVsbG8ABWhpIGhp" +
+ "AANvdXQAB3ByaW50bG4ABXNheUhpAAV2YWx1ZQASAAcOABUABw6HAAEAAREXDAEBAREXDQAAAQEA" +
+ "gIAEyAIBAeACAAAAEAAAAAAAAAABAAAAAAAAAAEAAAASAAAAcAAAAAIAAAAIAAAAuAAAAAMAAAAC" +
+ "AAAA2AAAAAQAAAABAAAA8AAAAAUAAAAEAAAA+AAAAAYAAAABAAAAGAEAAAMQAAACAAAAOAEAAAEg" +
+ "AAACAAAASAEAAAYgAAABAAAAhAEAAAEQAAABAAAAnAEAAAIgAAASAAAAogEAAAMgAAACAAAAkAIA" +
+ "AAQgAAACAAAAmwIAAAAgAAABAAAApwIAAAAQAAABAAAAuAIAAA==");
+
+ public static void main(String[] args) {
+ doTest(new RemoveAnnotationsTest());
+ doTest(new AddAnnotationsTest());
+ doTest(new ChangeAnnotationValues());
+ }
+
+ public static void doTest(TestCase t) {
+ // Get back to normal first.
+ doCommonClassRedefinition(Transform.class, INITIAL_CLASS_BYTES, INITIAL_DEX_BYTES);
+ System.out.println("Running test " + t.getClass());
+ printAnnotations(Transform.class);
+ t.runTest(new Transform());
+ printAnnotations(Transform.class);
+ }
+
+ private static void printAnnotations(Class<?> transform) {
+ System.out.println("Type annotations: " + Arrays.toString(transform.getAnnotations()));
+ for (Method m : transform.getDeclaredMethods()) {
+ System.out.println("method " + m + " -> " + Arrays.toString(m.getDeclaredAnnotations()));
+ }
+ }
+
+ // Transforms the class
+ public static native void doCommonClassRedefinition(Class<?> target,
+ byte[] class_file,
+ byte[] dex_file);
+}
diff --git a/test/948-change-annotations/src/RemoveAnnotationsTest.java b/test/948-change-annotations/src/RemoveAnnotationsTest.java
new file mode 100644
index 0000000..3b1725a
--- /dev/null
+++ b/test/948-change-annotations/src/RemoveAnnotationsTest.java
@@ -0,0 +1,55 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+public class RemoveAnnotationsTest implements TestCase {
+ /**
+ * base64 encoded class/dex file for
+ * class Transform {
+ * public void sayHi() {
+ * System.out.println("Goodbye");
+ * }
+ * }
+ */
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+ "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
+ "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
+ "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
+ "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" +
+ "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
+ "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0=");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+ "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+ "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
+ "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+ "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
+ "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
+ "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
+ "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
+ "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
+ "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
+ "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+ "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+ "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
+
+ public void runTest(Transform t) {
+ t.sayHi();
+ Main.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+ t.sayHi();
+ }
+}
diff --git a/test/948-change-annotations/src/TestCase.java b/test/948-change-annotations/src/TestCase.java
new file mode 100644
index 0000000..9edc01e
--- /dev/null
+++ b/test/948-change-annotations/src/TestCase.java
@@ -0,0 +1,19 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public interface TestCase {
+ public void runTest(Transform t);
+}
diff --git a/test/948-change-annotations/src/TestClassAnnotation1.java b/test/948-change-annotations/src/TestClassAnnotation1.java
new file mode 100644
index 0000000..adef98f
--- /dev/null
+++ b/test/948-change-annotations/src/TestClassAnnotation1.java
@@ -0,0 +1,22 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.lang.annotation.*;
+@Retention(RetentionPolicy.RUNTIME)
+@Target(ElementType.TYPE)
+public @ interface TestClassAnnotation1 {
+ public String value();
+}
diff --git a/test/948-change-annotations/src/TestClassAnnotation2.java b/test/948-change-annotations/src/TestClassAnnotation2.java
new file mode 100644
index 0000000..67e6260
--- /dev/null
+++ b/test/948-change-annotations/src/TestClassAnnotation2.java
@@ -0,0 +1,22 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.lang.annotation.*;
+@Retention(RetentionPolicy.RUNTIME)
+@Target(ElementType.TYPE)
+public @ interface TestClassAnnotation2 {
+ public String value();
+}
diff --git a/test/948-change-annotations/src/TestMethodAnnotation1.java b/test/948-change-annotations/src/TestMethodAnnotation1.java
new file mode 100644
index 0000000..d3920f3
--- /dev/null
+++ b/test/948-change-annotations/src/TestMethodAnnotation1.java
@@ -0,0 +1,22 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.lang.annotation.*;
+@Retention(RetentionPolicy.RUNTIME)
+@Target(ElementType.METHOD)
+public @ interface TestMethodAnnotation1 {
+ public String value();
+}
diff --git a/test/948-change-annotations/src/TestMethodAnnotation2.java b/test/948-change-annotations/src/TestMethodAnnotation2.java
new file mode 100644
index 0000000..2d5bb72
--- /dev/null
+++ b/test/948-change-annotations/src/TestMethodAnnotation2.java
@@ -0,0 +1,22 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.lang.annotation.*;
+@Retention(RetentionPolicy.RUNTIME)
+@Target(ElementType.METHOD)
+public @ interface TestMethodAnnotation2 {
+ public String value();
+}
diff --git a/test/948-change-annotations/src/Transform.java b/test/948-change-annotations/src/Transform.java
new file mode 100644
index 0000000..1c6a145
--- /dev/null
+++ b/test/948-change-annotations/src/Transform.java
@@ -0,0 +1,23 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+@TestClassAnnotation1("hello")
+class Transform {
+ @TestMethodAnnotation1("hi hi")
+ public void sayHi() {
+ System.out.println("hello");
+ }
+}
diff --git a/test/952-invoke-custom/build b/test/952-invoke-custom/build
new file mode 100644
index 0000000..a423ca6
--- /dev/null
+++ b/test/952-invoke-custom/build
@@ -0,0 +1,25 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+# make us exit on a failure
+set -e
+
+if [[ $@ != *"--jvm"* ]]; then
+ # Don't do anything with jvm.
+ export USE_JACK=true
+fi
+
+./default-build "$@" --experimental method-handles
diff --git a/test/952-invoke-custom/expected.txt b/test/952-invoke-custom/expected.txt
new file mode 100644
index 0000000..bb87296
--- /dev/null
+++ b/test/952-invoke-custom/expected.txt
@@ -0,0 +1,14 @@
+Caught exception from uninitialized call site
+Caught exception from uninitialized call site
+linkerMethod failure type 1
+Returning null instead of CallSite for add (int,int)int
+linkerMethod failure type 2
+Throwing InstantiationException in linkerMethod()
+linkerMethod failure type 3
+Throwing ArithmeticException in add()
+Failure Type + 0 (1013)
+Linking add (int,int)int
+100
+-9000
+9000
+Winners 1 Votes 16
diff --git a/test/952-invoke-custom/generator/TestInvokeCustomWithConcurrentThreads.java b/test/952-invoke-custom/generator/TestInvokeCustomWithConcurrentThreads.java
new file mode 100644
index 0000000..9c0645b
--- /dev/null
+++ b/test/952-invoke-custom/generator/TestInvokeCustomWithConcurrentThreads.java
@@ -0,0 +1,231 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import com.android.jack.annotations.CalledByInvokeCustom;
+import com.android.jack.annotations.Constant;
+import com.android.jack.annotations.LinkerMethodHandle;
+import com.android.jack.annotations.MethodHandleKind;
+
+import java.lang.invoke.CallSite;
+import java.lang.invoke.ConstantCallSite;
+import java.lang.invoke.MethodHandle;
+import java.lang.invoke.MethodHandles;
+import java.lang.invoke.MethodType;
+
+import java.lang.Thread;
+import java.lang.ThreadLocal;
+import java.util.concurrent.atomic.AtomicInteger;
+import java.util.concurrent.CyclicBarrier;
+
+public class TestInvokeCustomWithConcurrentThreads extends Thread {
+ private static final int NUMBER_OF_THREADS = 16;
+
+ private static final AtomicInteger nextIndex = new AtomicInteger(0);
+
+ private static final ThreadLocal<Integer> threadIndex =
+ new ThreadLocal<Integer>() {
+ @Override
+ protected Integer initialValue() {
+ return nextIndex.getAndIncrement();
+ }
+ };
+
+ // Array of call sites instantiated, one per thread
+ private static final CallSite[] instantiated = new CallSite[NUMBER_OF_THREADS];
+
+ // Array of counters for how many times each instantiated call site is called
+ private static final AtomicInteger[] called = new AtomicInteger[NUMBER_OF_THREADS];
+
+ // Array of call site indicies of which call site a thread invoked
+ private static final AtomicInteger[] targetted = new AtomicInteger[NUMBER_OF_THREADS];
+
+ // Synchronization barrier all threads will wait on in the bootstrap method.
+ private static final CyclicBarrier barrier = new CyclicBarrier(NUMBER_OF_THREADS);
+
+ private TestInvokeCustomWithConcurrentThreads() {}
+
+ private static int getThreadIndex() {
+ return threadIndex.get().intValue();
+ }
+
+ public static int notUsed(int x) {
+ return x;
+ }
+
+ @Override
+ public void run() {
+ int x = setCalled(-1 /* argument dropped */);
+ notUsed(x);
+ }
+
+ @CalledByInvokeCustom(
+ invokeMethodHandle = @LinkerMethodHandle(kind = MethodHandleKind.INVOKE_STATIC,
+ enclosingType = TestInvokeCustomWithConcurrentThreads.class,
+ name = "linkerMethod",
+ argumentTypes = {MethodHandles.Lookup.class, String.class, MethodType.class}),
+ name = "setCalled",
+ returnType = int.class,
+ argumentTypes = {int.class})
+ private static int setCalled(int index) {
+ called[index].getAndIncrement();
+ targetted[getThreadIndex()].set(index);
+ return 0;
+ }
+
+ @SuppressWarnings("unused")
+ private static CallSite linkerMethod(MethodHandles.Lookup caller,
+ String name,
+ MethodType methodType) throws Throwable {
+ int threadIndex = getThreadIndex();
+ MethodHandle mh =
+ caller.findStatic(TestInvokeCustomWithConcurrentThreads.class, name, methodType);
+ assertEquals(methodType, mh.type());
+ assertEquals(mh.type().parameterCount(), 1);
+ mh = MethodHandles.insertArguments(mh, 0, threadIndex);
+ mh = MethodHandles.dropArguments(mh, 0, int.class);
+ assertEquals(mh.type().parameterCount(), 1);
+ assertEquals(methodType, mh.type());
+
+ // Wait for all threads to be in this method.
+ // Multiple call sites should be created, but only one
+ // invoked.
+ barrier.await();
+
+ instantiated[getThreadIndex()] = new ConstantCallSite(mh);
+ return instantiated[getThreadIndex()];
+ }
+
+ public static void test() throws Throwable {
+ // Initialize counters for which call site gets invoked
+ for (int i = 0; i < NUMBER_OF_THREADS; ++i) {
+ called[i] = new AtomicInteger(0);
+ targetted[i] = new AtomicInteger(0);
+ }
+
+ // Run threads that each invoke-custom the call site
+ Thread [] threads = new Thread[NUMBER_OF_THREADS];
+ for (int i = 0; i < NUMBER_OF_THREADS; ++i) {
+ threads[i] = new TestInvokeCustomWithConcurrentThreads();
+ threads[i].start();
+ }
+
+ // Wait for all threads to complete
+ for (int i = 0; i < NUMBER_OF_THREADS; ++i) {
+ threads[i].join();
+ }
+
+ // Check one call site instance won
+ int winners = 0;
+ int votes = 0;
+ for (int i = 0; i < NUMBER_OF_THREADS; ++i) {
+ assertNotEquals(instantiated[i], null);
+ if (called[i].get() != 0) {
+ winners++;
+ votes += called[i].get();
+ }
+ }
+
+ System.out.println("Winners " + winners + " Votes " + votes);
+
+ // We assert this below but output details when there's an error as
+ // it's non-deterministic.
+ if (winners != 1) {
+ System.out.println("Threads did not the same call-sites:");
+ for (int i = 0; i < NUMBER_OF_THREADS; ++i) {
+ System.out.format(" Thread % 2d invoked call site instance #%02d\n",
+ i, targetted[i].get());
+ }
+ }
+
+ // We assert this below but output details when there's an error as
+ // it's non-deterministic.
+ if (votes != NUMBER_OF_THREADS) {
+ System.out.println("Call-sites invocations :");
+ for (int i = 0; i < NUMBER_OF_THREADS; ++i) {
+ System.out.format(" Call site instance #%02d was invoked % 2d times\n",
+ i, called[i].get());
+ }
+ }
+
+ assertEquals(winners, 1);
+ assertEquals(votes, NUMBER_OF_THREADS);
+ }
+
+ public static void assertTrue(boolean value) {
+ if (!value) {
+ throw new AssertionError("assertTrue value: " + value);
+ }
+ }
+
+ public static void assertEquals(byte b1, byte b2) {
+ if (b1 == b2) { return; }
+ throw new AssertionError("assertEquals b1: " + b1 + ", b2: " + b2);
+ }
+
+ public static void assertEquals(char c1, char c2) {
+ if (c1 == c2) { return; }
+ throw new AssertionError("assertEquals c1: " + c1 + ", c2: " + c2);
+ }
+
+ public static void assertEquals(short s1, short s2) {
+ if (s1 == s2) { return; }
+ throw new AssertionError("assertEquals s1: " + s1 + ", s2: " + s2);
+ }
+
+ public static void assertEquals(int i1, int i2) {
+ if (i1 == i2) { return; }
+ throw new AssertionError("assertEquals i1: " + i1 + ", i2: " + i2);
+ }
+
+ public static void assertEquals(long l1, long l2) {
+ if (l1 == l2) { return; }
+ throw new AssertionError("assertEquals l1: " + l1 + ", l2: " + l2);
+ }
+
+ public static void assertEquals(float f1, float f2) {
+ if (f1 == f2) { return; }
+ throw new AssertionError("assertEquals f1: " + f1 + ", f2: " + f2);
+ }
+
+ public static void assertEquals(double d1, double d2) {
+ if (d1 == d2) { return; }
+ throw new AssertionError("assertEquals d1: " + d1 + ", d2: " + d2);
+ }
+
+ public static void assertEquals(Object o, Object p) {
+ if (o == p) { return; }
+ if (o != null && p != null && o.equals(p)) { return; }
+ throw new AssertionError("assertEquals: o1: " + o + ", o2: " + p);
+ }
+
+ public static void assertNotEquals(Object o, Object p) {
+ if (o != p) { return; }
+ if (o != null && p != null && !o.equals(p)) { return; }
+ throw new AssertionError("assertNotEquals: o1: " + o + ", o2: " + p);
+ }
+
+ public static void assertEquals(String s1, String s2) {
+ if (s1 == s2) {
+ return;
+ }
+
+ if (s1 != null && s2 != null && s1.equals(s2)) {
+ return;
+ }
+
+ throw new AssertionError("assertEquals s1: " + s1 + ", s2: " + s2);
+ }
+}
diff --git a/test/952-invoke-custom/generator/TestLinkerMethodMinimalArguments.java b/test/952-invoke-custom/generator/TestLinkerMethodMinimalArguments.java
new file mode 100644
index 0000000..93d96a9
--- /dev/null
+++ b/test/952-invoke-custom/generator/TestLinkerMethodMinimalArguments.java
@@ -0,0 +1,137 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import com.android.jack.annotations.CalledByInvokeCustom;
+import com.android.jack.annotations.Constant;
+import com.android.jack.annotations.LinkerMethodHandle;
+import com.android.jack.annotations.MethodHandleKind;
+
+import java.lang.invoke.CallSite;
+import java.lang.invoke.ConstantCallSite;
+import java.lang.invoke.MethodHandle;
+import java.lang.invoke.MethodHandles;
+import java.lang.invoke.MethodType;
+
+public class TestLinkerMethodMinimalArguments {
+
+ private static int forceFailureType = 0;
+
+ private static int FAILURE_TYPE_NONE = 0;
+ private static int FAILURE_TYPE_LINKER_METHOD_RETURNS_NULL = 1;
+ private static int FAILURE_TYPE_LINKER_METHOD_THROWS = 2;
+ private static int FAILURE_TYPE_TARGET_METHOD_THROWS = 3;
+
+ @CalledByInvokeCustom(
+ invokeMethodHandle = @LinkerMethodHandle(
+ kind = MethodHandleKind.INVOKE_STATIC,
+ enclosingType = TestLinkerMethodMinimalArguments.class,
+ argumentTypes = {MethodHandles.Lookup.class, String.class, MethodType.class},
+ name = "linkerMethod"),
+ name = "add",
+ returnType = int.class,
+ argumentTypes = {int.class, int.class})
+ private static int add(int a, int b) {
+ if (forceFailureType == FAILURE_TYPE_TARGET_METHOD_THROWS) {
+ System.out.println("Throwing ArithmeticException in add()");
+ throw new ArithmeticException("add");
+ }
+ return a + b;
+ }
+
+ @SuppressWarnings("unused")
+ private static CallSite linkerMethod(MethodHandles.Lookup caller, String name,
+ MethodType methodType) throws Throwable {
+ System.out.println("linkerMethod failure type " + forceFailureType);
+ MethodHandle mh_add =
+ caller.findStatic(TestLinkerMethodMinimalArguments.class, name, methodType);
+ if (forceFailureType == FAILURE_TYPE_LINKER_METHOD_RETURNS_NULL) {
+ System.out.println("Returning null instead of CallSite for " + name + " " + methodType);
+ return null;
+ } else if (forceFailureType == FAILURE_TYPE_LINKER_METHOD_THROWS) {
+ System.out.println("Throwing InstantiationException in linkerMethod()");
+ throw new InstantiationException("linkerMethod");
+ } else {
+ return new ConstantCallSite(mh_add);
+ }
+ }
+
+ public static void test(int failureType, int x, int y) throws Throwable {
+ assertTrue(failureType >= FAILURE_TYPE_NONE);
+ assertTrue(failureType <= FAILURE_TYPE_TARGET_METHOD_THROWS);
+ forceFailureType = failureType;
+ assertEquals(x + y, add(x, y));
+ System.out.println("Failure Type + " + failureType + " (" + x + y+ ")");
+ }
+
+ public static void assertTrue(boolean value) {
+ if (!value) {
+ throw new AssertionError("assertTrue value: " + value);
+ }
+ }
+
+ public static void assertEquals(byte b1, byte b2) {
+ if (b1 == b2) { return; }
+ throw new AssertionError("assertEquals b1: " + b1 + ", b2: " + b2);
+ }
+
+ public static void assertEquals(char c1, char c2) {
+ if (c1 == c2) { return; }
+ throw new AssertionError("assertEquals c1: " + c1 + ", c2: " + c2);
+ }
+
+ public static void assertEquals(short s1, short s2) {
+ if (s1 == s2) { return; }
+ throw new AssertionError("assertEquals s1: " + s1 + ", s2: " + s2);
+ }
+
+ public static void assertEquals(int i1, int i2) {
+ if (i1 == i2) { return; }
+ throw new AssertionError("assertEquals i1: " + i1 + ", i2: " + i2);
+ }
+
+ public static void assertEquals(long l1, long l2) {
+ if (l1 == l2) { return; }
+ throw new AssertionError("assertEquals l1: " + l1 + ", l2: " + l2);
+ }
+
+ public static void assertEquals(float f1, float f2) {
+ if (f1 == f2) { return; }
+ throw new AssertionError("assertEquals f1: " + f1 + ", f2: " + f2);
+ }
+
+ public static void assertEquals(double d1, double d2) {
+ if (d1 == d2) { return; }
+ throw new AssertionError("assertEquals d1: " + d1 + ", d2: " + d2);
+ }
+
+ public static void assertEquals(Object o, Object p) {
+ if (o == p) { return; }
+ if (o != null && p != null && o.equals(p)) { return; }
+ throw new AssertionError("assertEquals: o1: " + o + ", o2: " + p);
+ }
+
+ public static void assertEquals(String s1, String s2) {
+ if (s1 == s2) {
+ return;
+ }
+
+ if (s1 != null && s2 != null && s1.equals(s2)) {
+ return;
+ }
+
+ throw new AssertionError("assertEquals s1: " + s1 + ", s2: " + s2);
+ }
+}
diff --git a/test/952-invoke-custom/generator/TestLinkerMethodMultipleArgumentTypes.java b/test/952-invoke-custom/generator/TestLinkerMethodMultipleArgumentTypes.java
new file mode 100644
index 0000000..4e4d97e
--- /dev/null
+++ b/test/952-invoke-custom/generator/TestLinkerMethodMultipleArgumentTypes.java
@@ -0,0 +1,140 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import com.android.jack.annotations.CalledByInvokeCustom;
+import com.android.jack.annotations.Constant;
+import com.android.jack.annotations.LinkerMethodHandle;
+import com.android.jack.annotations.MethodHandleKind;
+
+import java.lang.invoke.CallSite;
+import java.lang.invoke.ConstantCallSite;
+import java.lang.invoke.MethodHandle;
+import java.lang.invoke.MethodHandles;
+import java.lang.invoke.MethodType;
+
+public class TestLinkerMethodMultipleArgumentTypes {
+
+ private static int bootstrapRunCount = 0;
+
+ @CalledByInvokeCustom(
+ invokeMethodHandle = @LinkerMethodHandle(kind = MethodHandleKind.INVOKE_STATIC,
+ enclosingType = TestLinkerMethodMultipleArgumentTypes.class,
+ name = "linkerMethod",
+ argumentTypes = {MethodHandles.Lookup.class, String.class, MethodType.class,
+ boolean.class, byte.class, char.class, short.class, int.class,
+ float.class, double.class, String.class, Class.class, long.class}),
+ methodHandleExtraArgs = {@Constant(booleanValue = true), @Constant(byteValue = 1),
+ @Constant(charValue = 'a'), @Constant(shortValue = 1024),
+ @Constant(intValue = 1), @Constant(floatValue = 11.1f),
+ @Constant(doubleValue = 2.2), @Constant(stringValue = "Hello"),
+ @Constant(classValue = TestLinkerMethodMultipleArgumentTypes.class),
+ @Constant(longValue = 123456789L)},
+ name = "add",
+ returnType = int.class,
+ argumentTypes = {int.class, int.class})
+ private static int add(int a, int b) {
+ return a + b;
+ }
+
+ @SuppressWarnings("unused")
+ private static CallSite linkerMethod(MethodHandles.Lookup caller, String name,
+ MethodType methodType, boolean v1, byte v2, char v3,
+ short v4, int v5, float v6, double v7,
+ String v8, Class<?> v9, long v10) throws Throwable {
+ System.out.println("Linking " + name + " " + methodType);
+ assertTrue(v1);
+ assertEquals(1, v2);
+ assertEquals('a', v3);
+ assertEquals(1024, v4);
+ assertEquals(1, v5);
+ assertEquals(11.1f, v6);
+ assertEquals(2.2, v7);
+ assertEquals("Hello", v8);
+ assertEquals(TestLinkerMethodMultipleArgumentTypes.class, v9);
+ assertEquals(123456789L, v10);
+ MethodHandle mh_add =
+ caller.findStatic(TestLinkerMethodMultipleArgumentTypes.class, name, methodType);
+ return new ConstantCallSite(mh_add);
+ }
+
+ public int GetBootstrapRunCount() {
+ return bootstrapRunCount;
+ }
+
+ public static void test(int x, int y) throws Throwable {
+ assertEquals(x + y, add(x, y));
+ System.out.println(x + y);
+ }
+
+ public static void assertTrue(boolean value) {
+ if (!value) {
+ throw new AssertionError("assertTrue value: " + value);
+ }
+ }
+
+ public static void assertEquals(byte b1, byte b2) {
+ if (b1 == b2) { return; }
+ throw new AssertionError("assertEquals b1: " + b1 + ", b2: " + b2);
+ }
+
+ public static void assertEquals(char c1, char c2) {
+ if (c1 == c2) { return; }
+ throw new AssertionError("assertEquals c1: " + c1 + ", c2: " + c2);
+ }
+
+ public static void assertEquals(short s1, short s2) {
+ if (s1 == s2) { return; }
+ throw new AssertionError("assertEquals s1: " + s1 + ", s2: " + s2);
+ }
+
+ public static void assertEquals(int i1, int i2) {
+ if (i1 == i2) { return; }
+ throw new AssertionError("assertEquals i1: " + i1 + ", i2: " + i2);
+ }
+
+ public static void assertEquals(long l1, long l2) {
+ if (l1 == l2) { return; }
+ throw new AssertionError("assertEquals l1: " + l1 + ", l2: " + l2);
+ }
+
+ public static void assertEquals(float f1, float f2) {
+ if (f1 == f2) { return; }
+ throw new AssertionError("assertEquals f1: " + f1 + ", f2: " + f2);
+ }
+
+ public static void assertEquals(double d1, double d2) {
+ if (d1 == d2) { return; }
+ throw new AssertionError("assertEquals d1: " + d1 + ", d2: " + d2);
+ }
+
+ public static void assertEquals(Object o, Object p) {
+ if (o == p) { return; }
+ if (o != null && p != null && o.equals(p)) { return; }
+ throw new AssertionError("assertEquals: o1: " + o + ", o2: " + p);
+ }
+
+ public static void assertEquals(String s1, String s2) {
+ if (s1 == s2) {
+ return;
+ }
+
+ if (s1 != null && s2 != null && s1.equals(s2)) {
+ return;
+ }
+
+ throw new AssertionError("assertEquals s1: " + s1 + ", s2: " + s2);
+ }
+}
diff --git a/test/952-invoke-custom/generator/build-test.sh b/test/952-invoke-custom/generator/build-test.sh
new file mode 100755
index 0000000..d1d8221
--- /dev/null
+++ b/test/952-invoke-custom/generator/build-test.sh
@@ -0,0 +1,86 @@
+#!/bin/bash
+#
+# Copyright (C) 2017 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+# Set up prog to be the path of this script, including following symlinks,
+# and set up progdir to be the fully-qualified pathname of its directory.
+prog="$0"
+args="$@"
+while [ -h "${prog}" ]; do
+ newProg=`/bin/ls -ld "${prog}"`
+ newProg=`expr "${newProg}" : ".* -> \(.*\)$"`
+ if expr "x${newProg}" : 'x/' >/dev/null; then
+ prog="${newProg}"
+ else
+ progdir=`dirname "${prog}"`
+ prog="${progdir}/${newProg}"
+ fi
+done
+oldwd=`pwd`
+progdir=`dirname "${prog}"`
+cd "${progdir}"
+progdir=`pwd`
+prog="${progdir}"/`basename "${prog}"`
+test_dir="test-$$"
+if [ -z "$TMPDIR" ]; then
+ tmp_dir="/tmp/$USER/${test_dir}"
+else
+ tmp_dir="${TMPDIR}/${test_dir}"
+fi
+
+if [ "x$ANDROID_BUILD_TOP" = "x" ]; then
+ echo Build environment is not set-up.
+ exit -1
+fi
+
+# This only works internally for now (sorry folks!)
+jack_annotations_lib=/google/data/rw/teams/android-runtime/jack/jack-test-annotations-lib.jack
+if [ ! -f $jack_annotations_lib ]; then
+ echo Try 'prodaccess' to access android-runtime directory.
+ exit -1
+fi
+
+# Compile test into a base64 string that can be instantiated via
+# reflection on hosts without the jack-test-annotations-lib.jack file.
+mkdir $tmp_dir
+for input_file in $progdir/*.java; do
+ i=${input_file##*/Test}
+ i=${i%%.java}
+ src_file=$progdir/Test$i.java
+ jack_file=./src.jack
+ dex_file=./classes.dex
+ base_64_file=$tmp_dir/TestData$i.base64
+ output_file=$progdir/../src/TestData$i.java
+ # Compile source file to jack file.
+ jack -g -cp $ANDROID_BUILD_TOP/out/host/linux-x86/../common/obj/JAVA_LIBRARIES/core-libart-hostdex_intermediates/classes.jack:$ANDROID_BUILD_TOP/out/host/linux-x86/../common/obj/JAVA_LIBRARIES/core-oj-hostdex_intermediates/classes.jack:$jack_annotations_lib -D sched.runner=multi-threaded -D sched.runner.thread.kind=fixed -D sched.runner.thread.fixed.count=4 -D jack.java.source.version=1.7 -D jack.android.min-api-level=o-b2 --output-jack $jack_file $src_file
+ # Compile jack file to classes.dex.
+ jack -g -cp $ANDROID_BUILD_TOP/out/host/linux-x86/../common/obj/JAVA_LIBRARIES/core-libart-hostdex_intermediates/classes.jack:$ANDROID_BUILD_TOP/out/host/linux-x86/../common/obj/JAVA_LIBRARIES/core-oj-hostdex_intermediates/classes.jack -D sched.runner=multi-threaded -D sched.runner.thread.kind=fixed -D sched.runner.thread.fixed.count=4 -D jack.java.source.version=1.7 -D jack.android.min-api-level=o-b2 --import $jack_file --output-dex .
+ # Pack the classes.dex file into a base64 string.
+ base64 -w 72 $dex_file > $base_64_file
+ # Emit a managed source file containing the base64 string. The test can be
+ # run by loading this string as a dex file and invoking it via reflection.
+cat > $output_file <<HEADER
+/* Generated by ${prog##*/} from ${src_file##*/} */
+public class TestData$i {
+ public static final String BASE64_DEX_FILE =
+HEADER
+sed -e 's/^\(.*\)$/ "\1" +/' -e '$s/ +/;/' $base_64_file >> $output_file
+cat >> $output_file <<FOOTER
+}
+FOOTER
+ rm $dex_file $jack_file
+done
+
+rm -rf $tmp_dir
diff --git a/test/952-invoke-custom/info.txt b/test/952-invoke-custom/info.txt
new file mode 100644
index 0000000..2954e55
--- /dev/null
+++ b/test/952-invoke-custom/info.txt
@@ -0,0 +1,9 @@
+A test that is only available as a DEX binary.
+
+This tests execution of invoke-custom. There is no bytecode to emit
+invoke-custom directly. This test is generated using an internal only jack file.
+
+Internal developers MUST regenerate the test data files after editing
+the tests under generator/ using:
+
+$ generator/build-tests.sh
diff --git a/test/952-invoke-custom/src/Main.java b/test/952-invoke-custom/src/Main.java
new file mode 100644
index 0000000..2abc312
--- /dev/null
+++ b/test/952-invoke-custom/src/Main.java
@@ -0,0 +1,159 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import dalvik.system.InMemoryDexClassLoader;
+
+import java.lang.invoke.CallSite;
+import java.lang.invoke.MethodType;
+import java.lang.invoke.MutableCallSite;
+
+import java.lang.reflect.InvocationTargetException;
+import java.lang.reflect.Method;
+import java.nio.ByteBuffer;
+import java.util.Base64;
+
+// This test is a stop-gap until we have support for generating invoke-custom
+// in the Android tree.
+
+public class Main {
+
+ private static void TestUninitializedCallSite() throws Throwable {
+ CallSite callSite = new MutableCallSite(MethodType.methodType(int.class));
+ try {
+ callSite.getTarget().invoke();
+ fail();
+ } catch (IllegalStateException e) {
+ System.out.println("Caught exception from uninitialized call site");
+ }
+
+ callSite = new MutableCallSite(MethodType.methodType(String.class, int.class, char.class));
+ try {
+ callSite.getTarget().invoke(1535, 'd');
+ fail();
+ } catch (IllegalStateException e) {
+ System.out.println("Caught exception from uninitialized call site");
+ }
+ }
+
+ private static void TestLinkerMethodMultipleArgumentTypes() throws Throwable {
+ // This is a more comprehensive test of invoke-custom, the linker
+ // method takes additional arguments of types boolean, byte, char,
+ // short, int, float, double, String, Class, and long (in this order)
+ // The test asserts the values passed to the linker method match their
+ // expected values.
+ byte[] base64Data = TestDataLinkerMethodMultipleArgumentTypes.BASE64_DEX_FILE.getBytes();
+ Base64.Decoder decoder = Base64.getDecoder();
+ ByteBuffer dexBuffer = ByteBuffer.wrap(decoder.decode(base64Data));
+
+ InMemoryDexClassLoader classLoader =
+ new InMemoryDexClassLoader(dexBuffer,
+ ClassLoader.getSystemClassLoader());
+ Class<?> testClass =
+ classLoader.loadClass("TestLinkerMethodMultipleArgumentTypes");
+ Method testMethod = testClass.getDeclaredMethod("test", int.class, int.class);
+ // First invocation should link via the bootstrap method (outputs "Linking add" ...).
+ testMethod.invoke(null, 33, 67);
+ // Subsequent invocations use the cached value of the CallSite and do not require linking.
+ testMethod.invoke(null, -10000, +1000);
+ testMethod.invoke(null, -1000, +10000);
+ }
+
+ private static void TestLinkerMethodMinimalArguments() throws Throwable {
+ // This test checks various failures when running the linker
+ // method and during invocation of the method handle.
+ byte[] base64Data = TestDataLinkerMethodMinimalArguments.BASE64_DEX_FILE.getBytes();
+ Base64.Decoder decoder = Base64.getDecoder();
+ ByteBuffer dexBuffer = ByteBuffer.wrap(decoder.decode(base64Data));
+
+ InMemoryDexClassLoader classLoader =
+ new InMemoryDexClassLoader(dexBuffer,
+ ClassLoader.getSystemClassLoader());
+ Class<?> testClass =
+ classLoader.loadClass("TestLinkerMethodMinimalArguments");
+ Method testMethod = testClass.getDeclaredMethod("test", int.class, int.class, int.class);
+
+ try {
+ testMethod.invoke(null, 1 /* linker method return null */, 10, 10);
+ } catch (InvocationTargetException e) {
+ assertEquals(e.getCause().getClass().getName(), "java.lang.BootstrapMethodError");
+ assertEquals(
+ e.getCause().getCause().getClass().getName(), "java.lang.NullPointerException");
+ }
+
+ try {
+ testMethod.invoke(null, 2 /* linker method throw InstantiationException */, 10, 11);
+ } catch (InvocationTargetException e) {
+ assertEquals(e.getCause().getClass().getName(), "java.lang.BootstrapMethodError");
+ assertEquals(
+ e.getCause().getCause().getClass().getName(), "java.lang.InstantiationException");
+ }
+ try {
+ // Creating the CallSite works here, but fail invoking the method.
+ testMethod.invoke(null, 3 /* target throw NPE */, 10, 12);
+ } catch (InvocationTargetException e) {
+ assertEquals(e.getCause().getClass().getName(), "java.lang.ArithmeticException");
+ }
+
+ // This should succeed using already resolved CallSite.
+ testMethod.invoke(null, 0 /* no error */, 10, 13);
+ }
+
+ private static void TestInvokeCustomWithConcurrentThreads() throws Throwable {
+ // This is a concurrency test that attempts to run invoke-custom on the same
+ // call site.
+ byte[] base64Data = TestDataInvokeCustomWithConcurrentThreads.BASE64_DEX_FILE.getBytes();
+ Base64.Decoder decoder = Base64.getDecoder();
+ ByteBuffer dexBuffer = ByteBuffer.wrap(decoder.decode(base64Data));
+
+ InMemoryDexClassLoader classLoader =
+ new InMemoryDexClassLoader(dexBuffer,
+ ClassLoader.getSystemClassLoader());
+ Class<?> testClass =
+ classLoader.loadClass("TestInvokeCustomWithConcurrentThreads");
+ Method testMethod = testClass.getDeclaredMethod("test");
+ testMethod.invoke(null);
+ }
+
+ public static void assertEquals(Object o, Object p) {
+ if (o == p) { return; }
+ if (o != null && p != null && o.equals(p)) { return; }
+ throw new AssertionError("assertEquals: o1: " + o + ", o2: " + p);
+ }
+
+ public static void assertEquals(String s1, String s2) {
+ if (s1 == s2) {
+ return;
+ }
+
+ if (s1 != null && s2 != null && s1.equals(s2)) {
+ return;
+ }
+
+ throw new AssertionError("assertEquals s1: " + s1 + ", s2: " + s2);
+ }
+
+ private static void fail() {
+ System.out.println("fail");
+ Thread.dumpStack();
+ }
+
+ public static void main(String[] args) throws Throwable {
+ TestUninitializedCallSite();
+ TestLinkerMethodMinimalArguments();
+ TestLinkerMethodMultipleArgumentTypes();
+ TestInvokeCustomWithConcurrentThreads();
+ }
+}
\ No newline at end of file
diff --git a/test/952-invoke-custom/src/TestDataInvokeCustomWithConcurrentThreads.java b/test/952-invoke-custom/src/TestDataInvokeCustomWithConcurrentThreads.java
new file mode 100644
index 0000000..076acd7
--- /dev/null
+++ b/test/952-invoke-custom/src/TestDataInvokeCustomWithConcurrentThreads.java
@@ -0,0 +1,147 @@
+/* Generated by build-test.sh from TestInvokeCustomWithConcurrentThreads.java */
+public class TestDataInvokeCustomWithConcurrentThreads {
+ public static final String BASE64_DEX_FILE =
+ "ZGV4CjAzOABWCyocbwmvY62Y5O92LHrb3B/jTa9jHG0IHgAAcAAAAHhWNBIAAAAAAAAAACAd" +
+ "AACrAAAAcAAAACsAAAAcAwAAJQAAAMgDAAAKAAAAhAUAADkAAADUBQAAAgAAAKAHAAAgFgAA" +
+ "6AcAAMARAADzEQAAIxIAACwSAAA0EgAAPBIAAEQSAABMEgAAVBIAAFwSAABkEgAAbBIAAHMS" +
+ "AAB2EgAAgBIAAIgSAACMEgAAjxIAAJISAACsEgAArxIAALISAAC1EgAAuRIAAMgSAADLEgAA" +
+ "zhIAANISAADWEgAA2hIAAN4SAADiEgAA5hIAAOwSAADxEgAA9xIAACITAABLEwAATxMAAIQT" +
+ "AAC3EwAA6BMAAAwUAAAsFAAATxQAAG4UAACKFAAAoRQAAL0UAADQFAAA5RQAAPkUAAANFQAA" +
+ "KBUAADwVAABQFQAAaBUAAIEVAACYFQAAtRUAANoVAAD7FQAAJBYAAEYWAABlFgAAixYAALgW" +
+ "AADLFgAAzhYAANQWAAAAFwAAJhcAACkXAAAuFwAAMxcAADgXAAA9FwAAQRcAAEYXAABLFwAA" +
+ "TxcAAFQXAABZFwAAXRcAAGcXAABqFwAAbhcAAIIXAACXFwAArBcAAMoXAAD4FwAABRgAAA0Y" +
+ "AAAcGAAAKhgAAD0YAABQGAAAYxgAAHYYAACJGAAAnBgAAK8YAADDGAAA1BgAAOsYAAD3GAAA" +
+ "CxkAABIZAAAWGQAAGhkAACMZAAAnGQAAKxkAADMZAAA7GQAAPxkAAEMZAABSGQAAZhkAAHUZ" +
+ "AAB9GQAAgRkAAIUZAACRGQAAmRkAAJ4ZAACvGQAAvxkAAMIZAADGGQAAyhkAANEZAADfGQAA" +
+ "8BkAAP4ZAAAIGgAAHBoAACIaAAAoGgAALBoAADAaAAA+GgAAShoAAE4aAABUGgAAXxoAAGga" +
+ "AABrGgAAcBoAAHMaAACDGgAAjBoAAJgaAACdGgAAoRoAAKUaAACqGgAAtRoAALwaAADHGgAA" +
+ "zRoAANMaAADgGgAA6RoAAPMaAAD5GgAAABsAAAkbAAAQGwAAGRsAABAAAAARAAAAEwAAABQA" +
+ "AAAVAAAAGAAAACMAAAAkAAAAJgAAACcAAAAoAAAAKQAAACoAAAArAAAALAAAAC0AAAAuAAAA" +
+ "LwAAADAAAAAxAAAAMgAAADMAAAA0AAAANQAAADYAAAA4AAAAOQAAADoAAAA7AAAAPAAAAD0A" +
+ "AAA+AAAAPwAAAEAAAABBAAAAQwAAAEcAAABUAAAAVgAAAFcAAABYAAAAWQAAAFoAAAAVAAAA" +
+ "BAAAAAAAAAAWAAAABAAAAPgQAAAhAAAAEAAAAAARAAAZAAAAEwAAAAAAAAAdAAAAEwAAAPgQ" +
+ "AAAZAAAAFAAAAAAAAAAZAAAAFQAAAAAAAAAaAAAAFgAAAAgRAAAbAAAAFgAAABARAAAcAAAA" +
+ "FgAAABgRAAAdAAAAFgAAAPgQAAAeAAAAFgAAACARAAAfAAAAFgAAACgRAAAfAAAAFgAAADAR" +
+ "AAAlAAAAFgAAADgRAAAiAAAAGwAAAEARAAAiAAAAHQAAAEwRAAAgAAAAHQAAAFgRAAAgAAAA" +
+ "HQAAAGQRAAAZAAAAIAAAAAAAAAAZAAAAIgAAAAAAAABHAAAAJAAAAAAAAABIAAAAJAAAAHAR" +
+ "AABJAAAAJAAAAHgRAABKAAAAJAAAAIARAABLAAAAJAAAAIgRAABMAAAAJAAAAPgQAABNAAAA" +
+ "JAAAAJARAABOAAAAJAAAAJgRAABPAAAAJAAAACgRAABQAAAAJAAAAKARAABPAAAAJAAAADAR" +
+ "AABQAAAAJAAAAKgRAABPAAAAJAAAALARAABRAAAAJAAAALgRAABSAAAAJAAAADgRAABVAAAA" +
+ "JQAAACgRAAAHAAQAQgAAAAcAIQBuAAAABwAqAHEAAAAHACkAhgAAAAcAIgCRAAAABwAqAJ8A" +
+ "AAAHABkAogAAAAoACgAXAAAAEwASAEQAAAAXABAAlAAAAAYAFQAOAAAABgADAIQAAAAGAAUA" +
+ "hAAAAAcAFAALAAAABwAVAA0AAAAHABUADgAAAAcAFgBeAAAABwAXAF4AAAAHABgAXgAAAAcA" +
+ "GQBeAAAABwAbAF4AAAAHABwAXgAAAAcAHgBeAAAABwAgAF4AAAAHACIAXgAAAAcAHgBnAAAA" +
+ "BwAjAGkAAAAHAAAAfwAAAAcADwCNAAAABwABAJIAAAAHABUAmQAAAAcAAQCdAAAABwAVAKAA" +
+ "AAAQAAIAfAAAABAAHwCXAAAAEQAdAA4AAAATAAAAhwAAABMABACnAAAAFAAkAHgAAAAVACQA" +
+ "eAAAABYAFQAOAAAAFgAHAFwAAAAWAAgAXAAAABYACQBcAAAAFgAKAFwAAAAWAAsAXAAAABYA" +
+ "DABcAAAAFgANAFwAAAAWAA4AXAAAABYABgCkAAAAGAAVAA4AAAAYABUAiQAAABgAFQCeAAAA" +
+ "GQAVAA4AAAAZAAUAfQAAABwAIQAOAAAAHQATAKUAAAAeABAAewAAAB8AEQB1AAAAHwASAIUA" +
+ "AAAgAAAAlgAAACEAGgAOAAAAIQAAAGsAAAAiABoADgAAACIAAAB9AAAAIgAAAH4AAAAiABoA" +
+ "nAAAAJwcAAAGAAAAEAAAABkAAAAAAAAARQAAALgQAACjHAAAAAAAAAcAAAABAAAAGAAAAAAA" +
+ "AABFAAAAyBAAALYcAACZHAAABAAAABIAAAADAAAAPRwAAEQcAABNHAAAAQAAAFwcAAABAAAA" +
+ "TRwAAAEAAABlHAAAAQAAAG4cAAABAAEAAQAAABwbAAAEAAAAcBArAAAADgACAAEAAQAAACQb" +
+ "AAANAAAAcQADAAAADABuEDcAAAAKAHEQGwAAAAwAEQAAAAIAAQABAAAAKRsAAAUAAABuEAEA" +
+ "AQAMABEAAAABAAAAAAAAAAAAAAADAAAAYgAEABEAAAADAAAAAgAAAC4bAAAlAAAAEwIQACIA" +
+ "IgASAXAgNQAQAGkABAAiAAYAcBAAAAAAaQAGACMgKQBpAAMAIyAqAGkAAgAjICoAaQAFACIA" +
+ "IQBwIDMAIABpAAEADgAAAAEAAQABAAAAPBsAAAQAAABwECgAAAAOAAUAAgACAAAAQRsAACgA" +
+ "AAAzQwMADgAiABEAIgEWAHAQHgABABsCXwAAAG4gJQAhAAwBbiAiADEADAEbAgMAAABuICUA" +
+ "IQAMAW4gIgBBAAwBbhAnAAEADAFwIBkAEAAnAAUAAgACAAAAShsAACgAAAAzQwMADgAiABEA" +
+ "IgEWAHAQHgABABsCYAAAAG4gJQAhAAwBbiAfADEADAEbAgQAAABuICUAIQAMAW4gHwBBAAwB" +
+ "bhAnAAEADAFwIBkAEAAnAAgABAADAAAAUxsAACoAAAAvAAQGOQADAA4AIgARACIBFgBwEB4A" +
+ "AQAbAmEAAABuICUAIQAMAW4wIABBBQwBGwIFAAAAbiAlACEADAFuMCAAYQcMAW4QJwABAAwB" +
+ "cCAZABAAJwAFAAIAAgAAAFwbAAAqAAAALQADBDkAAwAOACIAEQAiARYAcBAeAAEAGwJiAAAA" +
+ "biAlACEADAFuICEAMQAMARsCBgAAAG4gJQAhAAwBbiAhAEEADAFuECcAAQAMAXAgGQAQACcA" +
+ "BQACAAIAAABlGwAAKAAAADNDAwAOACIAEQAiARYAcBAeAAEAGwJjAAAAbiAlACEADAFuICIA" +
+ "MQAMARsCBwAAAG4gJQAhAAwBbiAiAEEADAFuECcAAQAMAXAgGQAQACcACAAEAAMAAABwGwAA" +
+ "KgAAADEABAY5AAMADgAiABEAIgEWAHAQHgABABsCZAAAAG4gJQAhAAwBbjAjAEEFDAEbAggA" +
+ "AABuICUAIQAMAW4wIwBhBwwBbhAnAAEADAFwIBkAEAAnAAUAAgACAAAAexsAADMAAAAzQwMA" +
+ "DgA4AwsAOAQJAG4gHABDAAoAOAADAA4AIgARACIBFgBwEB4AAQAbAmYAAABuICUAIQAMAW4g" +
+ "JAAxAAwBGwIJAAAAbiAlACEADAFuICQAQQAMAW4QJwABAAwBcCAZABAAJwAAAAUAAgACAAAA" +
+ "hxsAADMAAAAzQwMADgA4AwsAOAQJAG4gHQBDAAoAOAADAA4AIgARACIBFgBwEB4AAQAbAmUA" +
+ "AABuICUAIQAMAW4gJQAxAAwBGwIKAAAAbiAlACEADAFuICUAQQAMAW4QJwABAAwBcCAZABAA" +
+ "JwAAAAUAAgACAAAAlRsAACgAAAAzQwMADgAiABEAIgEWAHAQHgABABsCZQAAAG4gJQAhAAwB" +
+ "biAiADEADAEbAgoAAABuICUAIQAMAW4gIgBBAAwBbhAnAAEADAFwIBkAEAAnAAUAAgACAAAA" +
+ "oBsAADUAAAAyQwMADgA4Aw0AOAQLAG4gHABDAAoA3wAAATgAAwAOACIAEQAiARYAcBAeAAEA" +
+ "GwJoAAAAbiAlACEADAFuICQAMQAMARsCCQAAAG4gJQAhAAwBbiAkAEEADAFuECcAAQAMAXAg" +
+ "GQAQACcAAAAEAAEAAgAAAKwbAAAdAAAAOQMcACIAEQAiARYAcBAeAAEAGwJqAAAAbiAlACEA" +
+ "DAFuICYAMQAMAW4QJwABAAwBcCAZABAAJwAOAAAAAQAAAAEAAAC4GwAADQAAAGIABgBuECwA" +
+ "AAAMAB8AEwBuEBoAAAAKAA8AAAAJAAMABAAAAL0bAABhAAAAEhUSBHEAEQAAAAoBHAIHAG5A" +
+ "LwAmhwwAbhAuAAAADAJxIAwAKABuEC4AAAAMAm4QMgACAAoCcSAKAFIAI1InAHEQGwABAAwD" +
+ "TQMCBHEwMQBAAgwAI1ImAGIDCABNAwIEcTAwAEACDABuEC4AAAAMAm4QMgACAAoCcSAKAFIA" +
+ "bhAuAAAADAJxIAwAKABiAgEAbhA0AAIAYgIDAHEAEQAAAAoDIgQcAHAgLQAEAE0EAgNiAgMA" +
+ "cQARAAAACgNGAgIDEQIAAAEAAQAAAAAA2xsAAAEAAAAPAAAAAwABAAIAAADiGwAAFAAAAGIA" +
+ "AgBGAAACbhA3AAAAYgAFAHEAEQAAAAoBRgAAAW4gOAAgABIADwAMAAAAAwAAAOsbAADoAAAA" +
+ "EisSGhIJEwgQABIANYAXAGIEAgAiBSIAcCA1AJUATQUEAGIEBQAiBSIAcCA1AJUATQUEANgA" +
+ "AAEo6iOBKAASADWAEQAiBAcAcBAFAAQATQQBAEYEAQBuECoABADYAAABKPASADWACgBGBAEA" +
+ "bhApAAQA2AAAASj3EgMSAhIANYAiAGIEAwBGBAQAEgVxIA8AVABiBAIARgQEAG4QNgAEAAoE" +
+ "OAQNANgDAwFiBAIARgQEAG4QNgAEAAoEsELYAAABKN9iBAkAIgUWAHAQHgAFABsGUwAAAG4g" +
+ "JQBlAAwFbiAiADUADAUbBgIAAABuICUAZQAMBW4gIgAlAAwFbhAnAAUADAVuIBgAVAAyoy4A" +
+ "YgQJABsFRgAAAG4gGABUABIANYAjAGIECQAbBQEAAAAjticAcRAbAAAADAdNBwYJYgcFAEYH" +
+ "BwBuEDYABwAKB3EQGwAHAAwHTQcGCm4wFwBUBtgAAAEo3jKCLgBiBAkAGwUSAAAAbiAYAFQA" +
+ "EgA1gCMAYgQJABsFAAAAACO2JwBxEBsAAAAMB00HBgliBwIARgcHAG4QNgAHAAoHcRAbAAcA" +
+ "DAdNBwYKbjAXAFQG2AAAASjecSAKAKMAcSAKAIIADgADAAEAAQAAADEcAAAJAAAAEvH8EAAA" +
+ "AQAKAHEQEwAAAA4AAADoBwAAAAAAAAAAAAAAAAAA+AcAAAEAAAADAAAAAAAAAAYAAAAACAAA" +
+ "EgAAAAgIAAAVAAAAEAgAABYAAAAICAAAAQAAAAQAAAACAAAAFQAnAAEAAAABAAAAAQAAAAIA" +
+ "AAABAAAAAwAAAAEAAAAFAAAAAQAAABQAAAABAAAAFQAAAAEAAAAlAAAAAwAAAB4AFQAgAAAA" +
+ "AwAAABIAFQAgAAAAAwAAAB0ABAAmAAAAAwAAAB0ABAAnAAAAAgAAAAAAAAACAAAAAQABAAIA" +
+ "AAACAAIAAgAAAAMAAwACAAAABAAEAAIAAAAFAAUAAgAAABQAFAACAAAAFQAVAAEAAAAdAAAA" +
+ "AgAAACMAIwAxIENhbGwgc2l0ZSBpbnN0YW5jZSAjJTAyZCB3YXMgaW52b2tlZCAlIDJkIHRp" +
+ "bWVzCgAuIFRocmVhZCAlIDJkIGludm9rZWQgY2FsbCBzaXRlIGluc3RhbmNlICMlMDJkCgAH" +
+ "IFZvdGVzIAAGLCBiMjogAAYsIGMyOiAABiwgZDI6IAAGLCBmMjogAAYsIGkyOiAABiwgbDI6" +
+ "IAAGLCBvMjogAAYsIHMyOiAABS1nZXQwAAE8AAg8Y2xpbml0PgAGPGluaXQ+AAI+OwABQgAB" +
+ "QwAYQ2FsbC1zaXRlcyBpbnZvY2F0aW9ucyA6AAFEAAFGAAFJAAJJSQANSU5WT0tFX1NUQVRJ" +
+ "QwABSgABTAACTEMAAkxEAAJMRgACTEkAAkxKAAJMTAAETExJTAADTExMAARMTExMAClMVGVz" +
+ "dEludm9rZUN1c3RvbVdpdGhDb25jdXJyZW50VGhyZWFkcyQxOwAnTFRlc3RJbnZva2VDdXN0" +
+ "b21XaXRoQ29uY3VycmVudFRocmVhZHM7AAJMWgAzTGNvbS9hbmRyb2lkL2phY2svYW5ub3Rh" +
+ "dGlvbnMvQ2FsbGVkQnlJbnZva2VDdXN0b207ADFMY29tL2FuZHJvaWQvamFjay9hbm5vdGF0" +
+ "aW9ucy9MaW5rZXJNZXRob2RIYW5kbGU7AC9MY29tL2FuZHJvaWQvamFjay9hbm5vdGF0aW9u" +
+ "cy9NZXRob2RIYW5kbGVLaW5kOwAiTGRhbHZpay9hbm5vdGF0aW9uL0VuY2xvc2luZ0NsYXNz" +
+ "OwAeTGRhbHZpay9hbm5vdGF0aW9uL0lubmVyQ2xhc3M7ACFMZGFsdmlrL2Fubm90YXRpb24v" +
+ "TWVtYmVyQ2xhc3NlczsAHUxkYWx2aWsvYW5ub3RhdGlvbi9TaWduYXR1cmU7ABpMZGFsdmlr" +
+ "L2Fubm90YXRpb24vVGhyb3dzOwAVTGphdmEvaW8vUHJpbnRTdHJlYW07ABpMamF2YS9sYW5n" +
+ "L0Fzc2VydGlvbkVycm9yOwARTGphdmEvbGFuZy9DbGFzczsAE0xqYXZhL2xhbmcvSW50ZWdl" +
+ "cjsAEkxqYXZhL2xhbmcvT2JqZWN0OwASTGphdmEvbGFuZy9TdHJpbmc7ABlMamF2YS9sYW5n" +
+ "L1N0cmluZ0J1aWxkZXI7ABJMamF2YS9sYW5nL1N5c3RlbTsAEkxqYXZhL2xhbmcvVGhyZWFk" +
+ "OwAWTGphdmEvbGFuZy9UaHJlYWRMb2NhbAAXTGphdmEvbGFuZy9UaHJlYWRMb2NhbDsAFUxq" +
+ "YXZhL2xhbmcvVGhyb3dhYmxlOwAbTGphdmEvbGFuZy9pbnZva2UvQ2FsbFNpdGU7ACNMamF2" +
+ "YS9sYW5nL2ludm9rZS9Db25zdGFudENhbGxTaXRlOwAfTGphdmEvbGFuZy9pbnZva2UvTWV0" +
+ "aG9kSGFuZGxlOwAnTGphdmEvbGFuZy9pbnZva2UvTWV0aG9kSGFuZGxlcyRMb29rdXA7ACBM" +
+ "amF2YS9sYW5nL2ludm9rZS9NZXRob2RIYW5kbGVzOwAdTGphdmEvbGFuZy9pbnZva2UvTWV0" +
+ "aG9kVHlwZTsAJExqYXZhL3V0aWwvY29uY3VycmVudC9DeWNsaWNCYXJyaWVyOwArTGphdmEv" +
+ "dXRpbC9jb25jdXJyZW50L2F0b21pYy9BdG9taWNJbnRlZ2VyOwARTlVNQkVSX09GX1RIUkVB" +
+ "RFMAAVMABFRZUEUAKlRlc3RJbnZva2VDdXN0b21XaXRoQ29uY3VycmVudFRocmVhZHMuamF2" +
+ "YQAkVGhyZWFkcyBkaWQgbm90IHRoZSBzYW1lIGNhbGwtc2l0ZXM6AAFWAANWQkIAA1ZDQwAD" +
+ "VkREAANWRkYAAlZJAANWSUkAA1ZKSgACVkwAA1ZMTAADVlNTAAJWWgAIV2lubmVycyAAAVoA" +
+ "AlpMABJbTGphdmEvbGFuZy9DbGFzczsAE1tMamF2YS9sYW5nL09iamVjdDsAE1tMamF2YS9s" +
+ "YW5nL1RocmVhZDsAHFtMamF2YS9sYW5nL2ludm9rZS9DYWxsU2l0ZTsALFtMamF2YS91dGls" +
+ "L2NvbmN1cnJlbnQvYXRvbWljL0F0b21pY0ludGVnZXI7AAthY2Nlc3NGbGFncwAGYXBwZW5k" +
+ "AA1hcmd1bWVudFR5cGVzAAxhc3NlcnRFcXVhbHMAEWFzc2VydEVxdWFscyBiMTogABFhc3Nl" +
+ "cnRFcXVhbHMgYzE6IAARYXNzZXJ0RXF1YWxzIGQxOiAAEWFzc2VydEVxdWFscyBmMTogABFh" +
+ "c3NlcnRFcXVhbHMgaTE6IAARYXNzZXJ0RXF1YWxzIGwxOiAAEWFzc2VydEVxdWFscyBzMTog" +
+ "ABJhc3NlcnRFcXVhbHM6IG8xOiAAD2Fzc2VydE5vdEVxdWFscwAVYXNzZXJ0Tm90RXF1YWxz" +
+ "OiBvMTogAAphc3NlcnRUcnVlABJhc3NlcnRUcnVlIHZhbHVlOiAABWF3YWl0AAJiMQACYjIA" +
+ "B2JhcnJpZXIAAmMxAAJjMgAGY2FsbGVkAAZjYWxsZXIAAmQxAAJkMgANZHJvcEFyZ3VtZW50" +
+ "cwASZW1pdHRlcjogamFjay00LjI1AA1lbmNsb3NpbmdUeXBlAAZlcXVhbHMAAmYxAAJmMgAK" +
+ "ZmluZFN0YXRpYwAGZm9ybWF0AANnZXQAD2dldEFuZEluY3JlbWVudAAOZ2V0VGhyZWFkSW5k" +
+ "ZXgAAWkAAmkxAAJpMgAFaW5kZXgADGluaXRpYWxWYWx1ZQAPaW5zZXJ0QXJndW1lbnRzAAxp" +
+ "bnN0YW50aWF0ZWQACGludFZhbHVlABJpbnZva2VNZXRob2RIYW5kbGUABGpvaW4ABGtpbmQA" +
+ "AmwxAAJsMgAMbGlua2VyTWV0aG9kAAptZXRob2RUeXBlAAJtaAAEbmFtZQAJbmV4dEluZGV4" +
+ "AAdub3RVc2VkAAFvAANvdXQAAXAADnBhcmFtZXRlckNvdW50AAdwcmludGxuAApyZXR1cm5U" +
+ "eXBlAANydW4AAnMxAAJzMgADc2V0AAlzZXRDYWxsZWQABXN0YXJ0AAl0YXJnZXR0ZWQABHRl" +
+ "c3QABHRoaXMAC3RocmVhZEluZGV4AAd0aHJlYWRzAAh0b1N0cmluZwAEdHlwZQAFdmFsdWUA" +
+ "B3ZhbHVlT2YABXZvdGVzAAd3aW5uZXJzAAF4ACcABw4CWjsAKgAHDgAoAAcOACQAByyJWDVN" +
+ "TU0CaXcAOgAHDgCuAQJtbgcOPACzAQJwcQcOPADMAQJ0dQcOWgDHAQJ6ewcOWgC9AQKCAYMB" +
+ "Bw48AMIBAowBjQEHDloA0QEClAGWAQcOPLQA3QECmwGcAQcOLSClIAC4AQKbAZwBBw48ANcB" +
+ "ApQBlgEHDjzSAKgBAacBBw4tARoQAD0ABw4AXANzkQGPAQcsTAMBowEFaQMAkAEeeLTDpbR8" +
+ "W9IAQQGrAQcOAFMBhAEHDni0AHEAB1kBAQMAgQEFLZaTQS0DAaQBKTx4V0E8WEAeAwOqAQUe" +
+ "AwKpAQU8h6UtkUMBJBIthzx4ARQNOkMthzx4ARQNOkE8PABGAAcOWgMAqwEFPAACCwGmARgH" +
+ "AgwCWwQIkAEeAg4BpgEcBBc3FwwXMRcPAg0BpgEcARgGAg8BpgEcARgaAAgEXRwBGASIARwB" +
+ "HQkEXRwDGB4YFRggdxgHigEbB5ABF42QARedmAEYBAEEEAMWABedFQEAAAECAICABJgQAQSw" +
+ "EAHEINwQBwATAQAaARoBGgEaARoBGgEaA4gg+BABiIAEkBEBgoAE7BEBCYQSAQnkEgEJxBMB" +
+ "CagUAQmMFQEJ7BUBCdAWAQnIFwEJwBgBCaAZAQmcGgEK6BoBCpQbAQnoHAIK/BwBCbQdFAGU" +
+ "IQAAABMAAAAAAAAAAQAAAAAAAAABAAAAqwAAAHAAAAACAAAAKwAAABwDAAADAAAAJQAAAMgD" +
+ "AAAEAAAACgAAAIQFAAAFAAAAOQAAANQFAAAHAAAAAQAAAJwHAAAGAAAAAgAAAKAHAAAIAAAA" +
+ "AQAAAOAHAAADEAAABQAAAOgHAAABIAAAFwAAABgIAAAGIAAAAgAAALgQAAABEAAAFwAAAPgQ" +
+ "AAACIAAAqwAAAMARAAADIAAAFgAAABwbAAAEIAAABgAAAD0cAAAFIAAAAgAAAJkcAAAAIAAA" +
+ "AgAAAKMcAAAAEAAAAQAAACAdAAA=";
+}
diff --git a/test/952-invoke-custom/src/TestDataLinkerMethodMinimalArguments.java b/test/952-invoke-custom/src/TestDataLinkerMethodMinimalArguments.java
new file mode 100644
index 0000000..443a7af
--- /dev/null
+++ b/test/952-invoke-custom/src/TestDataLinkerMethodMinimalArguments.java
@@ -0,0 +1,106 @@
+/* Generated by build-test.sh from TestLinkerMethodMinimalArguments.java */
+public class TestDataLinkerMethodMinimalArguments {
+ public static final String BASE64_DEX_FILE =
+ "ZGV4CjAzOADnZpVEc25JsNXLCW+vh64OuLf8RymAuINwFQAAcAAAAHhWNBIAAAAAAAAAAIgU" +
+ "AACBAAAAcAAAAB0AAAB0AgAAHAAAAOgCAAAHAAAAOAQAACIAAABwBAAAAQAAAIQFAADEDwAA" +
+ "rAUAAKAMAACjDAAApwwAAKoMAACyDAAAugwAAMIMAADKDAAA0gwAANoMAADiDAAA6gwAAPQM" +
+ "AAD8DAAA/wwAAAINAAAFDQAACA0AADENAABUDQAAZw0AAIoNAACbDQAAng0AAKMNAACyDQAA" +
+ "tQ0AALgNAAC8DQAAwA0AAMQNAADIDQAAzA0AANANAADWDQAA+g0AAP4NAAAzDgAAZg4AAJcO" +
+ "AACzDgAAyg4AAOsOAAAHDwAAGg8AAD4PAABSDwAAZg8AAIEPAACVDwAArA8AAMkPAADuDwAA" +
+ "DxAAADgQAABXEAAAgBAAAIMQAACqEAAA0RAAAAQRAAAHEQAADBEAABERAAAWEQAAGxEAACAR" +
+ "AAAmEQAAKxEAAC8RAAA0EQAAOREAAD0RAABAEQAARBEAAEcRAABMEQAAVBEAAGMRAABxEQAA" +
+ "hBEAAJcRAACqEQAAvREAANARAADjEQAA9hEAAAoSAAAWEgAAKhIAAC0SAAAxEgAANRIAADkS" +
+ "AAA9EgAARRIAAEkSAABNEgAAYRIAAHASAAB4EgAAfBIAAIASAACNEgAAmRIAAKsSAACvEgAA" +
+ "sxIAAMcSAADNEgAA0RIAANUSAADjEgAA/xIAAAsTAAATEwAAGRMAABwTAAAhEwAAJBMAAC0T" +
+ "AAA5EwAAPRMAAEETAABHEwAATRMAAFcTAABeEwAAYRMAAA0AAAAOAAAADwAAABAAAAAWAAAA" +
+ "GQAAACIAAAAkAAAAJQAAACYAAAAnAAAAKAAAACkAAAAqAAAAKwAAACwAAAAtAAAALgAAAC8A" +
+ "AAAwAAAAMQAAADIAAAAzAAAANAAAADUAAAA2AAAAOAAAADwAAABIAAAAFwAAAAQAAADsCwAA" +
+ "GgAAABEAAAAAAAAAGwAAABIAAAD0CwAAHAAAABIAAAD8CwAAHQAAABIAAAAEDAAAHgAAABIA" +
+ "AAAMDAAAHwAAABIAAAAUDAAAIAAAABIAAAAcDAAAIAAAABIAAAAkDAAAIwAAABIAAAAsDAAA" +
+ "IQAAABUAAAA0DAAAIQAAABcAAABADAAAPAAAABsAAAAAAAAAPQAAABsAAABMDAAAPgAAABsA" +
+ "AABUDAAAPwAAABsAAABcDAAAQAAAABsAAABkDAAAQQAAABsAAADsCwAAQgAAABsAAABsDAAA" +
+ "QwAAABsAAAB4DAAARAAAABsAAAAcDAAARQAAABsAAACADAAARAAAABsAAAAkDAAARQAAABsA" +
+ "AACIDAAARAAAABsAAACQDAAARgAAABsAAACYDAAARwAAABsAAAAsDAAASQAAABwAAAAcDAAA" +
+ "BgAEABEAAAAGAAQAEgAAAAYABAATAAAABgAEABQAAAAGAAQAaAAAAAkACQAYAAAAEwALAHUA" +
+ "AAAGAAwACwAAAAYADAAMAAAABgAAAEsAAAAGAA0ATgAAAAYADgBOAAAABgAPAE4AAAAGABAA" +
+ "TgAAAAYAEQBOAAAABgATAE4AAAAGABUATgAAAAYAFwBOAAAABgAZAE4AAAAGABoAVwAAAAYA" +
+ "CgBvAAAABgASAHsAAAALABYAdwAAAAwAFgAMAAAADQAUAAwAAAAPABYADAAAABAADAAMAAAA" +
+ "EAAbAGMAAAARABsAYwAAABIADAAMAAAAEgACAEwAAAASAAMATAAAABIABABMAAAAEgAFAEwA" +
+ "AAASAAYATAAAABIABwBMAAAAEgAIAEwAAAASAAkATAAAABIAAQB9AAAAFgAYAAwAAAAYAAsA" +
+ "ZwAAADIUAAAGAAAAAQAAABAAAAAAAAAAOQAAAMQLAAA5FAAAAAAAAAQAAAANAAAAAQAAAAIU" +
+ "AAABAAAAKhQAAAEAAAAAAAAAZBMAAA8AAAASAGcABABnAAIAEhBnAAAAEiBnAAEAEjBnAAMA" +
+ "DgAAAAEAAQABAAAAcBMAAAQAAABwEBMAAAAOAAQAAgACAAAAdRMAABoAAABgAAQAYAEDADMQ" +
+ "EwBiAAYAGwE6AAAAbiAPABAAIgAMABsBSwAAAHAgEAAQACcAkAACAw8ABQACAAIAAAB/EwAA" +
+ "KAAAADNDAwAOACIADQAiARIAcBAWAAEAGwJPAAAAbiAdACEADAFuIBoAMQAMARsCAwAAAG4g" +
+ "HQAhAAwBbiAaAEEADAFuEB8AAQAMAXAgEQAQACcABQACAAIAAACHEwAAKAAAADNDAwAOACIA" +
+ "DQAiARIAcBAWAAEAGwJQAAAAbiAdACEADAFuIBcAMQAMARsCBAAAAG4gHQAhAAwBbiAXAEEA" +
+ "DAFuEB8AAQAMAXAgEQAQACcACAAEAAMAAACPEwAAKgAAAC8ABAY5AAMADgAiAA0AIgESAHAQ" +
+ "FgABABsCUQAAAG4gHQAhAAwBbjAYAEEFDAEbAgUAAABuIB0AIQAMAW4wGABhBwwBbhAfAAEA" +
+ "DAFwIBEAEAAnAAUAAgACAAAAlxMAACoAAAAtAAMEOQADAA4AIgANACIBEgBwEBYAAQAbAlIA" +
+ "AABuIB0AIQAMAW4gGQAxAAwBGwIGAAAAbiAdACEADAFuIBkAQQAMAW4QHwABAAwBcCARABAA" +
+ "JwAFAAIAAgAAAJ8TAAAoAAAAM0MDAA4AIgANACIBEgBwEBYAAQAbAlMAAABuIB0AIQAMAW4g" +
+ "GgAxAAwBGwIHAAAAbiAdACEADAFuIBoAQQAMAW4QHwABAAwBcCARABAAJwAIAAQAAwAAAKcT" +
+ "AAAqAAAAMQAEBjkAAwAOACIADQAiARIAcBAWAAEAGwJUAAAAbiAdACEADAFuMBsAQQUMARsC" +
+ "CAAAAG4gHQAhAAwBbjAbAGEHDAFuEB8AAQAMAXAgEQAQACcABQACAAIAAACvEwAAMwAAADND" +
+ "AwAOADgDCwA4BAkAbiAUAEMACgA4AAMADgAiAA0AIgESAHAQFgABABsCVgAAAG4gHQAhAAwB" +
+ "biAcADEADAEbAgkAAABuIB0AIQAMAW4gHABBAAwBbhAfAAEADAFwIBEAEAAnAAAABQACAAIA" +
+ "AAC4EwAAMwAAADNDAwAOADgDCwA4BAkAbiAVAEMACgA4AAMADgAiAA0AIgESAHAQFgABABsC" +
+ "VQAAAG4gHQAhAAwBbiAdADEADAEbAgoAAABuIB0AIQAMAW4gHQBBAAwBbhAfAAEADAFwIBEA" +
+ "EAAnAAAABQACAAIAAADDEwAAKAAAADNDAwAOACIADQAiARIAcBAWAAEAGwJVAAAAbiAdACEA" +
+ "DAFuIBoAMQAMARsCCgAAAG4gHQAhAAwBbiAaAEEADAFuEB8AAQAMAXAgEQAQACcABAABAAIA" +
+ "AADLEwAAHQAAADkDHAAiAA0AIgESAHAQFgABABsCWAAAAG4gHQAhAAwBbiAeADEADAFuEB8A" +
+ "AQAMAXAgEQAQACcADgAAAAcAAwAEAAAA1RMAAGoAAABiAQYAIgISAHAQFgACABsDcAAAAG4g" +
+ "HQAyAAwCYAMEAG4gGgAyAAwCbhAfAAIADAJuIA8AIQAcAQYAbkAhABRlDABgAQQAYAIAADMh" +
+ "KABiAQYAIgISAHAQFgACABsDNwAAAG4gHQAyAAwCbiAdAFIADAIbAwAAAABuIB0AMgAMAm4g" +
+ "HABiAAwCbhAfAAIADAJuIA8AIQASAREBYAEEAGACAQAzIRMAYgEGABsCOwAAAG4gDwAhACIB" +
+ "DwAbAm8AAABwIBIAIQAnASIBFgBwICAAAQARAQYAAwACAAAA7RMAAFAAAAASERICYAACADQD" +
+ "SAABEHEQDAAAAGAAAwA2A0IAcRAMAAEAZwMEAJAABAX8IAAAVAAKAXEgBwAQAGIABgAiARIA" +
+ "cBAWAAEAGwIVAAAAbiAdACEADAFuIBoAMQAMARsCAQAAAG4gHQAhAAwBbiAaAEEADAFuIBoA" +
+ "UQAMARsCAgAAAG4gHQAhAAwBbhAfAAEADAFuIA8AEAAOAAEgKLoBISi/AAAAAAAAAAADAAAA" +
+ "AAAAAAIAAACsBQAADQAAALQFAAAOAAAAtAUAAAIAAAAEAAQAAQAAAAEAAAABAAAAAgAAAAEA" +
+ "AAADAAAAAQAAAAQAAAABAAAABQAAAAEAAAAQAAAAAQAAABEAAAABAAAAHAAAAAMAAAAYABEA" +
+ "GQAAAAMAAAAOABEAGQAAAAIAAAAAAAAAAgAAAAEAAQACAAAAAgACAAIAAAADAAMAAwAAAAQA" +
+ "BAAEAAAAAgAAAAUABQACAAAAEAAQAAIAAAARABEAAQAAABcAAAACAAAAGgAaAAEgAAIgKAAB" +
+ "KQAGLCBiMjogAAYsIGMyOiAABiwgZDI6IAAGLCBmMjogAAYsIGkyOiAABiwgbDI6IAAGLCBv" +
+ "MjogAAYsIHMyOiAACDxjbGluaXQ+AAY8aW5pdD4AAUIAAUMAAUQAAUYAJ0ZBSUxVUkVfVFlQ" +
+ "RV9MSU5LRVJfTUVUSE9EX1JFVFVSTlNfTlVMTAAhRkFJTFVSRV9UWVBFX0xJTktFUl9NRVRI" +
+ "T0RfVEhST1dTABFGQUlMVVJFX1RZUEVfTk9ORQAhRkFJTFVSRV9UWVBFX1RBUkdFVF9NRVRI" +
+ "T0RfVEhST1dTAA9GYWlsdXJlIFR5cGUgKyAAAUkAA0lJSQANSU5WT0tFX1NUQVRJQwABSgAB" +
+ "TAACTEMAAkxEAAJMRgACTEkAAkxKAAJMTAAETExMTAAiTFRlc3RMaW5rZXJNZXRob2RNaW5p" +
+ "bWFsQXJndW1lbnRzOwACTFoAM0xjb20vYW5kcm9pZC9qYWNrL2Fubm90YXRpb25zL0NhbGxl" +
+ "ZEJ5SW52b2tlQ3VzdG9tOwAxTGNvbS9hbmRyb2lkL2phY2svYW5ub3RhdGlvbnMvTGlua2Vy" +
+ "TWV0aG9kSGFuZGxlOwAvTGNvbS9hbmRyb2lkL2phY2svYW5ub3RhdGlvbnMvTWV0aG9kSGFu" +
+ "ZGxlS2luZDsAGkxkYWx2aWsvYW5ub3RhdGlvbi9UaHJvd3M7ABVMamF2YS9pby9QcmludFN0" +
+ "cmVhbTsAH0xqYXZhL2xhbmcvQXJpdGhtZXRpY0V4Y2VwdGlvbjsAGkxqYXZhL2xhbmcvQXNz" +
+ "ZXJ0aW9uRXJyb3I7ABFMamF2YS9sYW5nL0NsYXNzOwAiTGphdmEvbGFuZy9JbnN0YW50aWF0" +
+ "aW9uRXhjZXB0aW9uOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsA" +
+ "GUxqYXZhL2xhbmcvU3RyaW5nQnVpbGRlcjsAEkxqYXZhL2xhbmcvU3lzdGVtOwAVTGphdmEv" +
+ "bGFuZy9UaHJvd2FibGU7ABtMamF2YS9sYW5nL2ludm9rZS9DYWxsU2l0ZTsAI0xqYXZhL2xh" +
+ "bmcvaW52b2tlL0NvbnN0YW50Q2FsbFNpdGU7AB9MamF2YS9sYW5nL2ludm9rZS9NZXRob2RI" +
+ "YW5kbGU7ACdMamF2YS9sYW5nL2ludm9rZS9NZXRob2RIYW5kbGVzJExvb2t1cDsAHUxqYXZh" +
+ "L2xhbmcvaW52b2tlL01ldGhvZFR5cGU7ACdSZXR1cm5pbmcgbnVsbCBpbnN0ZWFkIG9mIENh" +
+ "bGxTaXRlIGZvciAAAVMAJVRlc3RMaW5rZXJNZXRob2RNaW5pbWFsQXJndW1lbnRzLmphdmEA" +
+ "JVRocm93aW5nIEFyaXRobWV0aWNFeGNlcHRpb24gaW4gYWRkKCkAMVRocm93aW5nIEluc3Rh" +
+ "bnRpYXRpb25FeGNlcHRpb24gaW4gbGlua2VyTWV0aG9kKCkAAVYAA1ZCQgADVkNDAANWREQA" +
+ "A1ZGRgADVklJAARWSUlJAANWSkoAAlZMAANWTEwAA1ZTUwACVloAAVoAAlpMAAFhAANhZGQA" +
+ "BmFwcGVuZAANYXJndW1lbnRUeXBlcwAMYXNzZXJ0RXF1YWxzABFhc3NlcnRFcXVhbHMgYjE6" +
+ "IAARYXNzZXJ0RXF1YWxzIGMxOiAAEWFzc2VydEVxdWFscyBkMTogABFhc3NlcnRFcXVhbHMg" +
+ "ZjE6IAARYXNzZXJ0RXF1YWxzIGkxOiAAEWFzc2VydEVxdWFscyBsMTogABFhc3NlcnRFcXVh" +
+ "bHMgczE6IAASYXNzZXJ0RXF1YWxzOiBvMTogAAphc3NlcnRUcnVlABJhc3NlcnRUcnVlIHZh" +
+ "bHVlOiAAAWIAAmIxAAJiMgACYzEAAmMyAAZjYWxsZXIAAmQxAAJkMgASZW1pdHRlcjogamFj" +
+ "ay00LjI1AA1lbmNsb3NpbmdUeXBlAAZlcXVhbHMAAmYxAAJmMgALZmFpbHVyZVR5cGUACmZp" +
+ "bmRTdGF0aWMAEGZvcmNlRmFpbHVyZVR5cGUAAmkxAAJpMgASaW52b2tlTWV0aG9kSGFuZGxl" +
+ "AARraW5kAAJsMQACbDIADGxpbmtlck1ldGhvZAAabGlua2VyTWV0aG9kIGZhaWx1cmUgdHlw" +
+ "ZSAACm1ldGhvZFR5cGUABm1oX2FkZAAEbmFtZQABbwADb3V0AAFwAAdwcmludGxuAApyZXR1" +
+ "cm5UeXBlAAJzMQACczIABHRlc3QABHRoaXMACHRvU3RyaW5nAAV2YWx1ZQABeAABeQAeAAcd" +
+ "Li08PAJ5OwAcAAcOAC8CS1oHDmmHlwBWAltcBw48AFsCXV4HDjwAdAJgYQcOWgBvAmVmBw5a" +
+ "AGUCamsHDjwAagJubwcOWgB5AnV3Bw48tAB/Anp7Bw4tIKUgAGACensHDjwAUAF/Bw4tARoQ" +
+ "ADkDX3RyBw4BGxBpAwBzGGkBJA8taYeXAEgDZ4ABgQEHLId4LZYBLw8CeywtAAAHBE0cAhgE" +
+ "GARrHAEdCARNHAMYGBgRGBliGAZsGwVzF29zF0t4GAQCCgF+HAEYFAMWABdLFQAFAA8AAAoB" +
+ "CgEKAQoBCgCIgAS8CwGBgATsCwEKhAwBCcgMAQmoDQEJiA4BCewOAQnQDwEJsBABCZQRAQmM" +
+ "EgEJhBMBCeQTAQqwFAEJlBYAEwAAAAAAAAABAAAAAAAAAAEAAACBAAAAcAAAAAIAAAAdAAAA" +
+ "dAIAAAMAAAAcAAAA6AIAAAQAAAAHAAAAOAQAAAUAAAAiAAAAcAQAAAcAAAABAAAAgAUAAAYA" +
+ "AAABAAAAhAUAAAgAAAABAAAApAUAAAMQAAACAAAArAUAAAEgAAAPAAAAvAUAAAYgAAABAAAA" +
+ "xAsAAAEQAAAVAAAA7AsAAAIgAACBAAAAoAwAAAMgAAAPAAAAZBMAAAQgAAACAAAAAhQAAAUg" +
+ "AAABAAAAMhQAAAAgAAABAAAAORQAAAAQAAABAAAAiBQAAA==";
+}
diff --git a/test/952-invoke-custom/src/TestDataLinkerMethodMultipleArgumentTypes.java b/test/952-invoke-custom/src/TestDataLinkerMethodMultipleArgumentTypes.java
new file mode 100644
index 0000000..b96e184
--- /dev/null
+++ b/test/952-invoke-custom/src/TestDataLinkerMethodMultipleArgumentTypes.java
@@ -0,0 +1,108 @@
+/* Generated by build-test.sh from TestLinkerMethodMultipleArgumentTypes.java */
+public class TestDataLinkerMethodMultipleArgumentTypes {
+ public static final String BASE64_DEX_FILE =
+ "ZGV4CjAzOADmj8ccx56N3pWZ9IunuZvI0eWD+wmFmSnEFQAAcAAAAHhWNBIAAAAAAAAAANwU" +
+ "AACTAAAAcAAAAB0AAAC8AgAAHQAAADADAAADAAAAjAQAACIAAACkBAAAAQAAALgFAADkDwAA" +
+ "4AUAAEQMAABHDAAASgwAAFIMAABaDAAAYgwAAGoMAAByDAAAegwAAIIMAACKDAAAkgwAAJwM" +
+ "AACkDAAApwwAAKoMAACtDAAAsAwAAMYMAADNDAAA0AwAANUMAADkDAAA5wwAAOoMAADuDAAA" +
+ "8gwAAPYMAAD6DAAA/gwAAAINAAAIDQAAGA0AAEENAABFDQAAeg0AAKMNAADWDQAABw4AACYO" +
+ "AABCDgAATA4AAGMOAAB/DgAAkQ4AAKQOAAC6DgAAzg4AAOIOAAD9DgAAEQ8AACgPAABFDwAA" +
+ "ag8AAIsPAAC0DwAA0w8AANYPAAACEAAABRAAAAoQAAAPEAAAFBAAABkQAAAdEAAAIhAAACcQ" +
+ "AAArEAAAMBAAADUQAAA5EAAAPBAAAEUQAABJEAAATBAAAFEQAABZEAAAaBAAAHYQAACJEAAA" +
+ "nBAAAK8QAADCEAAA1RAAAOgQAAD7EAAADxEAABsRAAAvEQAAMhEAADYRAAA6EQAASBEAAFsR" +
+ "AABmEQAAahEAAG4RAAB2EQAAgREAAI0RAACREQAAlREAAKIRAAC2EQAAxREAAM0RAADREQAA" +
+ "1REAAOERAADtEQAA8REAAPURAAD/EQAAExIAABkSAAAdEgAAIRIAAC8SAAA6EgAAURIAAF0S" +
+ "AABlEgAAaxIAAG4SAABzEgAAdhIAAH8SAACLEgAAjxIAAJMSAACfEgAArBIAALISAAC4EgAA" +
+ "whIAAMYSAADLEgAAzxIAANMSAADXEgAA2xIAAN8SAADjEgAA5xIAAOsSAADyEgAA9RIAAA0A" +
+ "AAAOAAAADwAAABAAAAATAAAAFgAAACAAAAAiAAAAIwAAACQAAAAlAAAAJgAAACcAAAApAAAA" +
+ "KgAAACwAAAAuAAAALwAAADAAAAAxAAAAMgAAADMAAAA0AAAANQAAADYAAAA3AAAAOAAAADoA" +
+ "AABGAAAAEwAAAAQAAAAAAAAAFAAAAAQAAACICwAAFwAAABEAAAAAAAAAGAAAABIAAACQCwAA" +
+ "GQAAABIAAACYCwAAGgAAABIAAACgCwAAGwAAABIAAACoCwAAHAAAABIAAACwCwAAHQAAABIA" +
+ "AAC4CwAAHQAAABIAAADACwAAIQAAABIAAADICwAAHwAAABUAAADQCwAAHgAAABcAAADwCwAA" +
+ "OgAAABsAAAAAAAAAOwAAABsAAAD8CwAAPAAAABsAAAAEDAAAPQAAABsAAAAMDAAAPgAAABsA" +
+ "AAAUDAAAPwAAABsAAACoCwAAQAAAABsAAACICwAAQQAAABsAAAAcDAAAQgAAABsAAAC4CwAA" +
+ "QwAAABsAAAAkDAAAQgAAABsAAADACwAAQwAAABsAAAAsDAAAQgAAABsAAAA0DAAARAAAABsA" +
+ "AAA8DAAARQAAABsAAADICwAASAAAABwAAAC4CwAABgAEAFwAAAAKAAoAFQAAABMADQB7AAAA" +
+ "BgANAAsAAAAGAA0ADAAAAAYAAAARAAAABgABAEoAAAAGAA4ATQAAAAYADwBNAAAABgAQAE0A" +
+ "AAAGABEATQAAAAYAEwBNAAAABgAUAE0AAAAGABYATQAAAAYAGABNAAAABgAaAE0AAAAGABsA" +
+ "VgAAAAYACwB0AAAABgATAIMAAAANABIAfQAAAA0AFwB9AAAADgAVAAwAAAAQAA0ADAAAABAA" +
+ "HABoAAAAEQAcAGgAAAASAA0ADAAAABIAAwBLAAAAEgAEAEsAAAASAAUASwAAABIABgBLAAAA" +
+ "EgAHAEsAAAASAAgASwAAABIACQBLAAAAEgAKAEsAAAASAAIAhQAAABYAGQAMAAAAGAAMAGsA" +
+ "AABpFAAABgAAAAEAAAAQAAAAAAAAADkAAABgCwAAkhQAAAAAAAAEAAAADgAAAAEAAACpEwAA" +
+ "AgAAAEcUAABgFAAAAQAAAGAUAAABAAAAAAAAAPgSAAAEAAAAEgBnAAAADgABAAEAAQAAAP4S" +
+ "AAAEAAAAcBATAAAADgADAAIAAAAAAAMTAAADAAAAkAABAg8AAAAFAAIAAgAAAAoTAAAoAAAA" +
+ "M0MDAA4AIgAOACIBEgBwEBYAAQAbAk4AAABuIB0AIQAMAW4gGgAxAAwBGwICAAAAbiAdACEA" +
+ "DAFuIBoAQQAMAW4QHwABAAwBcCASABAAJwAFAAIAAgAAABITAAAoAAAAM0MDAA4AIgAOACIB" +
+ "EgBwEBYAAQAbAk8AAABuIB0AIQAMAW4gFwAxAAwBGwIDAAAAbiAdACEADAFuIBcAQQAMAW4Q" +
+ "HwABAAwBcCASABAAJwAIAAQAAwAAABoTAAAqAAAALwAEBjkAAwAOACIADgAiARIAcBAWAAEA" +
+ "GwJQAAAAbiAdACEADAFuMBgAQQUMARsCBAAAAG4gHQAhAAwBbjAYAGEHDAFuEB8AAQAMAXAg" +
+ "EgAQACcABQACAAIAAAAiEwAAKgAAAC0AAwQ5AAMADgAiAA4AIgESAHAQFgABABsCUQAAAG4g" +
+ "HQAhAAwBbiAZADEADAEbAgUAAABuIB0AIQAMAW4gGQBBAAwBbhAfAAEADAFwIBIAEAAnAAUA" +
+ "AgACAAAAKhMAACgAAAAzQwMADgAiAA4AIgESAHAQFgABABsCUgAAAG4gHQAhAAwBbiAaADEA" +
+ "DAEbAgYAAABuIB0AIQAMAW4gGgBBAAwBbhAfAAEADAFwIBIAEAAnAAgABAADAAAAMhMAACoA" +
+ "AAAxAAQGOQADAA4AIgAOACIBEgBwEBYAAQAbAlMAAABuIB0AIQAMAW4wGwBBBQwBGwIHAAAA" +
+ "biAdACEADAFuMBsAYQcMAW4QHwABAAwBcCASABAAJwAFAAIAAgAAADoTAAAzAAAAM0MDAA4A" +
+ "OAMLADgECQBuIBQAQwAKADgAAwAOACIADgAiARIAcBAWAAEAGwJVAAAAbiAdACEADAFuIBwA" +
+ "MQAMARsCCAAAAG4gHQAhAAwBbiAcAEEADAFuEB8AAQAMAXAgEgAQACcAAAAFAAIAAgAAAEMT" +
+ "AAAzAAAAM0MDAA4AOAMLADgECQBuIBUAQwAKADgAAwAOACIADgAiARIAcBAWAAEAGwJUAAAA" +
+ "biAdACEADAFuIB0AMQAMARsCCQAAAG4gHQAhAAwBbiAdAEEADAFuEB8AAQAMAXAgEgAQACcA" +
+ "AAAFAAIAAgAAAFETAAAoAAAAM0MDAA4AIgAOACIBEgBwEBYAAQAbAlQAAABuIB0AIQAMAW4g" +
+ "GgAxAAwBGwIJAAAAbiAdACEADAFuIBoAQQAMAW4QHwABAAwBcCASABAAJwAEAAEAAgAAAFsT" +
+ "AAAdAAAAOQMcACIADgAiARIAcBAWAAEAGwJXAAAAbiAdACEADAFuIB4AMQAMAW4QHwABAAwB" +
+ "cCASABAAJwAOAAAAFgAPAAQAAABmEwAAbAAAAGIDAgAiBBIAcBAWAAQAGwUoAAAAbiAdAFQA" +
+ "DARuIB0AhAAMBBsFAAAAAG4gHQBUAAwEbiAcAJQADARuEB8ABAAMBG4gEQBDAHEQDQAKABIT" +
+ "cSAIALMAEwNhAHEgBQDDABMDAARxIAgA0wASE3EgCADjABQDmpkxQXEgBwDzABgEmpmZmZmZ" +
+ "AUAFABAAcUAGAFQQGwMSAAAACAASAHEgCwADABwDBgAIABMAcSAKAAMAFwQVzVsHBQAUAHFA" +
+ "CQBUEBwDBgBuQCEAN5gMAiIDFgBwICAAIwARAwQAAgACAAAAmRMAABEAAACQAAID/CAAADIA" +
+ "CgFxIAgAEABiAAIAkAECA24gEAAQAA4AAAACAAEAAAAAAKQTAAADAAAAYAAAAA8AAAAAAAAA" +
+ "AAAAAAMAAAAAAAAAAwAAAOAFAAAOAAAA6AUAAA8AAAD0BQAAAgAAAAQABAABAAAAAQAAAAEA" +
+ "AAACAAAAAQAAAAMAAAABAAAABAAAAAEAAAAFAAAAAQAAABAAAAABAAAAEQAAAAEAAAAcAAAA" +
+ "DQAAABgAEQAZABwAAAABABoABAADAAIAEQAPAAUAAAADAAAADwARABkAAAACAAAAAAAAAAIA" +
+ "AAABAAEAAgAAAAIAAgACAAAAAwADAAIAAAAFAAUAAgAAABAAEAACAAAAEQARAAEAAAAXAAAA" +
+ "AgAAABoAGgABIAABKAAGLCBiMjogAAYsIGMyOiAABiwgZDI6IAAGLCBmMjogAAYsIGkyOiAA" +
+ "BiwgbDI6IAAGLCBvMjogAAYsIHMyOiAABjwqPjtKKQAIPGNsaW5pdD4ABjxpbml0PgABQgAB" +
+ "QwABRAABRgAUR2V0Qm9vdHN0cmFwUnVuQ291bnQABUhlbGxvAAFJAANJSUkADUlOVk9LRV9T" +
+ "VEFUSUMAAUoAAUwAAkxDAAJMRAACTEYAAkxJAAJMSgACTEwABExMTEwADkxMTExaQkNTSUZE" +
+ "TExKACdMVGVzdExpbmtlck1ldGhvZE11bHRpcGxlQXJndW1lbnRUeXBlczsAAkxaADNMY29t" +
+ "L2FuZHJvaWQvamFjay9hbm5vdGF0aW9ucy9DYWxsZWRCeUludm9rZUN1c3RvbTsAJ0xjb20v" +
+ "YW5kcm9pZC9qYWNrL2Fubm90YXRpb25zL0NvbnN0YW50OwAxTGNvbS9hbmRyb2lkL2phY2sv" +
+ "YW5ub3RhdGlvbnMvTGlua2VyTWV0aG9kSGFuZGxlOwAvTGNvbS9hbmRyb2lkL2phY2svYW5u" +
+ "b3RhdGlvbnMvTWV0aG9kSGFuZGxlS2luZDsAHUxkYWx2aWsvYW5ub3RhdGlvbi9TaWduYXR1" +
+ "cmU7ABpMZGFsdmlrL2Fubm90YXRpb24vVGhyb3dzOwAITGlua2luZyAAFUxqYXZhL2lvL1By" +
+ "aW50U3RyZWFtOwAaTGphdmEvbGFuZy9Bc3NlcnRpb25FcnJvcjsAEExqYXZhL2xhbmcvQ2xh" +
+ "c3MAEUxqYXZhL2xhbmcvQ2xhc3M7ABRMamF2YS9sYW5nL0NsYXNzPCo+OwASTGphdmEvbGFu" +
+ "Zy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAGUxqYXZhL2xhbmcvU3RyaW5nQnVpbGRl" +
+ "cjsAEkxqYXZhL2xhbmcvU3lzdGVtOwAVTGphdmEvbGFuZy9UaHJvd2FibGU7ABtMamF2YS9s" +
+ "YW5nL2ludm9rZS9DYWxsU2l0ZTsAI0xqYXZhL2xhbmcvaW52b2tlL0NvbnN0YW50Q2FsbFNp" +
+ "dGU7AB9MamF2YS9sYW5nL2ludm9rZS9NZXRob2RIYW5kbGU7ACdMamF2YS9sYW5nL2ludm9r" +
+ "ZS9NZXRob2RIYW5kbGVzJExvb2t1cDsAHUxqYXZhL2xhbmcvaW52b2tlL01ldGhvZFR5cGU7" +
+ "AAFTACpUZXN0TGlua2VyTWV0aG9kTXVsdGlwbGVBcmd1bWVudFR5cGVzLmphdmEAAVYAA1ZC" +
+ "QgADVkNDAANWREQAA1ZGRgACVkkAA1ZJSQADVkpKAAJWTAADVkxMAANWU1MAAlZaAAFaAAda" +
+ "QkNTSUZEAAJaTAABYQADYWRkAAZhcHBlbmQADWFyZ3VtZW50VHlwZXMADGFzc2VydEVxdWFs" +
+ "cwARYXNzZXJ0RXF1YWxzIGIxOiAAEWFzc2VydEVxdWFscyBjMTogABFhc3NlcnRFcXVhbHMg" +
+ "ZDE6IAARYXNzZXJ0RXF1YWxzIGYxOiAAEWFzc2VydEVxdWFscyBpMTogABFhc3NlcnRFcXVh" +
+ "bHMgbDE6IAARYXNzZXJ0RXF1YWxzIHMxOiAAEmFzc2VydEVxdWFsczogbzE6IAAKYXNzZXJ0" +
+ "VHJ1ZQASYXNzZXJ0VHJ1ZSB2YWx1ZTogAAFiAAJiMQACYjIADGJvb2xlYW5WYWx1ZQARYm9v" +
+ "dHN0cmFwUnVuQ291bnQACWJ5dGVWYWx1ZQACYzEAAmMyAAZjYWxsZXIACWNoYXJWYWx1ZQAK" +
+ "Y2xhc3NWYWx1ZQACZDEAAmQyAAtkb3VibGVWYWx1ZQASZW1pdHRlcjogamFjay00LjI1AA1l" +
+ "bmNsb3NpbmdUeXBlAAZlcXVhbHMAAmYxAAJmMgAKZmluZFN0YXRpYwAKZmxvYXRWYWx1ZQAC" +
+ "aTEAAmkyAAhpbnRWYWx1ZQASaW52b2tlTWV0aG9kSGFuZGxlAARraW5kAAJsMQACbDIADGxp" +
+ "bmtlck1ldGhvZAAJbG9uZ1ZhbHVlABVtZXRob2RIYW5kbGVFeHRyYUFyZ3MACm1ldGhvZFR5" +
+ "cGUABm1oX2FkZAAEbmFtZQABbwADb3V0AAFwAAdwcmludGxuAApyZXR1cm5UeXBlAAJzMQAC" +
+ "czIACnNob3J0VmFsdWUAC3N0cmluZ1ZhbHVlAAR0ZXN0AAR0aGlzAAh0b1N0cmluZwACdjEA" +
+ "A3YxMAACdjIAAnYzAAJ2NAACdjUAAnY2AAJ2NwACdjgAAnY5AAV2YWx1ZQABeAABeQAeAAcO" +
+ "OQAcAAcOADECSlkHDgBZAlpbBw48AF4CX2AHDjwAdwJkZQcOWgByAmprBw5aAGgCbm8HDjwA" +
+ "bQJzdAcOWgB8Ant9Bw48tACCAQKAAYEBBw4tIKUgAGMCgAGBAQcOPABTAZEBBw4tARoQADkN" +
+ "YXp4hwGJAYoBiwGMAY0BjgGPAQCIAQQTkAEQLgcOASQPPEtaWktppYd4iGkDAnkYAE4CkgGT" +
+ "AQcOlngASgAHDgAABwVMHAIYBBgEcBwBHQkETBwNGBgYERgZGBwYABgBGBoYBBgDGAIYERgP" +
+ "GAVnGAZxGwF5F3R2HAodCAFbHAE/HQgBXRwBAAEdCAFhHAEDYR0IAYEBHAEiAAQdCAFvHAEE" +
+ "AR0IAWwcAXCamTFBHQgBZRwB8ZqZmZmZmQFAHQgBggEcARcSHQgBYhwBGAYdCAF1HAFmFc1b" +
+ "B3kXSn4YBAILAZABHAkXARc2Fy8XNxdHFy8XKxcKFzMCDAGQARwBGBQNFgAXShUBBAEEAQRh" +
+ "JAAEBAFwmpkxQfGamZmZmZkBQBcSGAZmFc1bBwEADwEACgCIgAT8CwGBgASUDAIKrAwBCcQM" +
+ "AQmkDQEJhA4BCegOAQnMDwEJrBABCZARAQmIEgEJgBMBCeATAQqsFAEJlBYCAcgWEwAAAAAA" +
+ "AAABAAAAAAAAAAEAAACTAAAAcAAAAAIAAAAdAAAAvAIAAAMAAAAdAAAAMAMAAAQAAAADAAAA" +
+ "jAQAAAUAAAAiAAAApAQAAAcAAAABAAAAtAUAAAYAAAABAAAAuAUAAAgAAAABAAAA2AUAAAMQ" +
+ "AAADAAAA4AUAAAEgAAAQAAAA/AUAAAYgAAABAAAAYAsAAAEQAAAUAAAAiAsAAAIgAACTAAAA" +
+ "RAwAAAMgAAAQAAAA+BIAAAQgAAADAAAAqRMAAAUgAAABAAAAaRQAAAAgAAABAAAAkhQAAAAQ" +
+ "AAABAAAA3BQAAA==";
+}
diff --git a/test/Android.bp b/test/Android.bp
index d3244a6..00c890a 100644
--- a/test/Android.bp
+++ b/test/Android.bp
@@ -274,6 +274,7 @@
"933-misc-events/misc_events.cc",
"936-search-onload/search_onload.cc",
"944-transform-classloaders/classloader.cc",
+ "945-obsolete-native/obsolete_native.cc",
],
shared_libs: [
"libbase",
diff --git a/test/dexdump/invoke-custom.dex b/test/dexdump/invoke-custom.dex
new file mode 100644
index 0000000..67261ca
--- /dev/null
+++ b/test/dexdump/invoke-custom.dex
Binary files differ
diff --git a/test/dexdump/invoke-custom.lst b/test/dexdump/invoke-custom.lst
new file mode 100644
index 0000000..3540bd1
--- /dev/null
+++ b/test/dexdump/invoke-custom.lst
@@ -0,0 +1,6 @@
+#invoke-custom.dex
+0x000003fc 8 com.android.jack.java7.invokecustom.test004.Tests <init> ()V Tests.java 35
+0x00000414 6 com.android.jack.java7.invokecustom.test004.Tests add (II)I Tests.java 55
+0x0000042c 166 com.android.jack.java7.invokecustom.test004.Tests linkerMethod (Ljava/lang/invoke/MethodHandles$Lookup;Ljava/lang/String;Ljava/lang/invoke/MethodType;ZBCSIFDLjava/lang/String;Ljava/lang/Class;J)Ljava/lang/invoke/CallSite; Tests.java 62
+0x000004e4 24 com.android.jack.java7.invokecustom.test004.Tests main ([Ljava/lang/String;)V Tests.java 82
+0x0000050c 22 com.android.jack.java7.invokecustom.test004.Tests test ()V Tests.java 78
diff --git a/test/dexdump/invoke-custom.txt b/test/dexdump/invoke-custom.txt
new file mode 100644
index 0000000..e92549a
--- /dev/null
+++ b/test/dexdump/invoke-custom.txt
@@ -0,0 +1,254 @@
+Processing 'invoke-custom.dex'...
+Opened 'invoke-custom.dex', DEX version '038'
+DEX file header:
+magic : 'dex\n038\0'
+checksum : db57516f
+signature : 57be...ffc4
+file_size : 3276
+header_size : 112
+link_size : 0
+link_off : 0 (0x000000)
+string_ids_size : 82
+string_ids_off : 112 (0x000070)
+type_ids_size : 31
+type_ids_off : 440 (0x0001b8)
+proto_ids_size : 16
+proto_ids_off : 564 (0x000234)
+field_ids_size : 3
+field_ids_off : 756 (0x0002f4)
+method_ids_size : 18
+method_ids_off : 780 (0x00030c)
+class_defs_size : 1
+class_defs_off : 932 (0x0003a4)
+data_size : 2304
+data_off : 972 (0x0003cc)
+
+Class #0 header:
+class_idx : 10
+access_flags : 1 (0x0001)
+superclass_idx : 15
+interfaces_off : 0 (0x000000)
+source_file_idx : 38
+annotations_off : 1316 (0x000524)
+class_data_off : 3014 (0x000bc6)
+static_fields_size : 1
+instance_fields_size: 0
+direct_methods_size : 4
+virtual_methods_size: 1
+
+Class #0 annotations:
+Annotations on method #1 'add'
+ VISIBILITY_BUILD Lcom/android/jack/annotations/CalledByInvokeCustom; argumentTypes={ I I } invokeMethodHandle={ Lcom/android/jack/annotations/LinkerMethodHandle; argumentTypes={ Ljava/lang/invoke/MethodHandles$Lookup; Ljava/lang/String; Ljava/lang/invoke/MethodType; Z B C S I F D Ljava/lang/String; Ljava/lang/Class; J } enclosingType=Lcom/android/jack/java7/invokecustom/test004/Tests; kind=INVOKE_STATIC name="linkerMethod" } methodHandleExtraArgs={ Lcom/android/jack/annotations/Constant; booleanValue={ true } Lcom/android/jack/annotations/Constant; byteValue={ 1 } Lcom/android/jack/annotations/Constant; charValue={ 97 } Lcom/android/jack/annotations/Constant; shortValue={ 1024 } Lcom/android/jack/annotations/Constant; intValue={ 1 } Lcom/android/jack/annotations/Constant; floatValue={ 11.1 } Lcom/android/jack/annotations/Constant; doubleValue={ 2.2 } Lcom/android/jack/annotations/Constant; stringValue={ "Hello" } Lcom/android/jack/annotations/Constant; classValue={ Lcom/android/jack/java7/invokecustom/test004/Tests; } Lcom/android/jack/annotations/Constant; longValue={ 123456789 } } name="add" returnType=I
+Annotations on method #2 'linkerMethod'
+ VISIBILITY_SYSTEM Ldalvik/annotation/Signature; value={ "(" "Ljava/lang/invoke/MethodHandles$Lookup;" "Ljava/lang/String;" "Ljava/lang/invoke/MethodType;" "ZBCSIFD" "Ljava/lang/String;" "Ljava/lang/Class" "<*>;J)" "Ljava/lang/invoke/CallSite;" }
+ VISIBILITY_SYSTEM Ldalvik/annotation/Throws; value={ Ljava/lang/Throwable; }
+Annotations on method #4 'test'
+ VISIBILITY_SYSTEM Ldalvik/annotation/Throws; value={ Ljava/lang/Throwable; }
+ VISIBILITY_RUNTIME Lorg/junit/Test;
+
+Class #0 -
+ Class descriptor : 'Lcom/android/jack/java7/invokecustom/test004/Tests;'
+ Access flags : 0x0001 (PUBLIC)
+ Superclass : 'Ljava/lang/Object;'
+ Interfaces -
+ Static fields -
+ #0 : (in Lcom/android/jack/java7/invokecustom/test004/Tests;)
+ name : 'fieldCallSite'
+ type : 'Ljava/lang/invoke/CallSite;'
+ access : 0x0009 (PUBLIC STATIC)
+ Instance fields -
+ Direct methods -
+ #0 : (in Lcom/android/jack/java7/invokecustom/test004/Tests;)
+ name : '<init>'
+ type : '()V'
+ access : 0x10001 (PUBLIC CONSTRUCTOR)
+ code -
+ registers : 1
+ ins : 1
+ outs : 1
+ insns size : 4 16-bit code units
+0003ec: |[0003ec] com.android.jack.java7.invokecustom.test004.Tests.<init>:()V
+0003fc: 7010 0600 0000 |0000: invoke-direct {v0}, Ljava/lang/Object;.<init>:()V // method@0006
+000402: 0e00 |0003: return-void
+ catches : (none)
+ positions :
+ 0x0000 line=35
+ locals :
+ 0x0000 - 0x0004 reg=0 this Lcom/android/jack/java7/invokecustom/test004/Tests;
+
+ #1 : (in Lcom/android/jack/java7/invokecustom/test004/Tests;)
+ name : 'add'
+ type : '(II)I'
+ access : 0x000a (PRIVATE STATIC)
+ code -
+ registers : 3
+ ins : 2
+ outs : 0
+ insns size : 3 16-bit code units
+000404: |[000404] com.android.jack.java7.invokecustom.test004.Tests.add:(II)I
+000414: 9000 0102 |0000: add-int v0, v1, v2
+000418: 0f00 |0002: return v0
+ catches : (none)
+ positions :
+ 0x0000 line=55
+ locals :
+ 0x0000 - 0x0003 reg=1 (null) I
+ 0x0000 - 0x0003 reg=2 (null) I
+
+ #2 : (in Lcom/android/jack/java7/invokecustom/test004/Tests;)
+ name : 'linkerMethod'
+ type : '(Ljava/lang/invoke/MethodHandles$Lookup;Ljava/lang/String;Ljava/lang/invoke/MethodType;ZBCSIFDLjava/lang/String;Ljava/lang/Class;J)Ljava/lang/invoke/CallSite;'
+ access : 0x000a (PRIVATE STATIC)
+ code -
+ registers : 24
+ ins : 15
+ outs : 6
+ insns size : 83 16-bit code units
+00041c: |[00041c] com.android.jack.java7.invokecustom.test004.Tests.linkerMethod:(Ljava/lang/invoke/MethodHandles$Lookup;Ljava/lang/String;Ljava/lang/invoke/MethodType;ZBCSIFDLjava/lang/String;Ljava/lang/Class;J)Ljava/lang/invoke/CallSite;
+00042c: 7110 1100 0c00 |0000: invoke-static {v12}, Ljunit/framework/Assert;.assertTrue:(Z)V // method@0011
+000432: 1212 |0003: const/4 v2, #int 1 // #1
+000434: 7120 0d00 d200 |0004: invoke-static {v2, v13}, Ljunit/framework/Assert;.assertEquals:(II)V // method@000d
+00043a: 1302 6100 |0007: const/16 v2, #int 97 // #61
+00043e: 7120 0a00 e200 |0009: invoke-static {v2, v14}, Ljunit/framework/Assert;.assertEquals:(CC)V // method@000a
+000444: 1302 0004 |000c: const/16 v2, #int 1024 // #400
+000448: 7120 0d00 f200 |000e: invoke-static {v2, v15}, Ljunit/framework/Assert;.assertEquals:(II)V // method@000d
+00044e: 1212 |0011: const/4 v2, #int 1 // #1
+000450: 0200 1000 |0012: move/from16 v0, v16
+000454: 7120 0d00 0200 |0014: invoke-static {v2, v0}, Ljunit/framework/Assert;.assertEquals:(II)V // method@000d
+00045a: 1202 |0017: const/4 v2, #int 0 // #0
+00045c: 1403 9a99 3141 |0018: const v3, #float 11.1 // #4131999a
+000462: 0200 1100 |001b: move/from16 v0, v17
+000466: 7130 0c00 0302 |001d: invoke-static {v3, v0, v2}, Ljunit/framework/Assert;.assertEquals:(FFF)V // method@000c
+00046c: 1606 0000 |0020: const-wide/16 v6, #int 0 // #0
+000470: 1802 9a99 9999 9999 0140 |0022: const-wide v2, #double 2.2 // #400199999999999a
+00047a: 0504 1200 |0027: move-wide/from16 v4, v18
+00047e: 7706 0b00 0200 |0029: invoke-static/range {v2, v3, v4, v5, v6, v7}, Ljunit/framework/Assert;.assertEquals:(DDD)V // method@000b
+000484: 1b02 0700 0000 |002c: const-string/jumbo v2, "Hello" // string@00000007
+00048a: 0800 1400 |002f: move-object/from16 v0, v20
+00048e: 7120 1000 0200 |0031: invoke-static {v2, v0}, Ljunit/framework/Assert;.assertEquals:(Ljava/lang/String;Ljava/lang/String;)V // method@0010
+000494: 1c02 0a00 |0034: const-class v2, Lcom/android/jack/java7/invokecustom/test004/Tests; // type@000a
+000498: 0800 1500 |0036: move-object/from16 v0, v21
+00049c: 7120 0f00 0200 |0038: invoke-static {v2, v0}, Ljunit/framework/Assert;.assertEquals:(Ljava/lang/Object;Ljava/lang/Object;)V // method@000f
+0004a2: 1702 15cd 5b07 |003b: const-wide/32 v2, #float 1.6536e-34 // #075bcd15
+0004a8: 0500 1600 |003e: move-wide/from16 v0, v22
+0004ac: 7140 0e00 3210 |0040: invoke-static {v2, v3, v0, v1}, Ljunit/framework/Assert;.assertEquals:(JJ)V // method@000e
+0004b2: 7100 0900 0000 |0043: invoke-static {}, Ljava/lang/invoke/MethodHandles;.lookup:()Ljava/lang/invoke/MethodHandles$Lookup; // method@0009
+0004b8: 0c02 |0046: move-result-object v2
+0004ba: 1c03 0a00 |0047: const-class v3, Lcom/android/jack/java7/invokecustom/test004/Tests; // type@000a
+0004be: 6e40 0800 32ba |0049: invoke-virtual {v2, v3, v10, v11}, Ljava/lang/invoke/MethodHandles$Lookup;.findStatic:(Ljava/lang/Class;Ljava/lang/String;Ljava/lang/invoke/MethodType;)Ljava/lang/invoke/MethodHandle; // method@0008
+0004c4: 0c02 |004c: move-result-object v2
+0004c6: 2203 1400 |004d: new-instance v3, Ljava/lang/invoke/ConstantCallSite; // type@0014
+0004ca: 7020 0700 2300 |004f: invoke-direct {v3, v2}, Ljava/lang/invoke/ConstantCallSite;.<init>:(Ljava/lang/invoke/MethodHandle;)V // method@0007
+0004d0: 1103 |0052: return-object v3
+ catches : (none)
+ positions :
+ 0x0000 line=62
+ 0x0003 line=63
+ 0x0007 line=64
+ 0x000c line=65
+ 0x0011 line=66
+ 0x0017 line=67
+ 0x0020 line=68
+ 0x002c line=69
+ 0x0034 line=70
+ 0x003b line=71
+ 0x0043 line=72
+ 0x004d line=73
+ locals :
+ 0x0000 - 0x0053 reg=9 (null) Ljava/lang/invoke/MethodHandles$Lookup;
+ 0x0000 - 0x0053 reg=10 (null) Ljava/lang/String;
+ 0x0000 - 0x0053 reg=11 (null) Ljava/lang/invoke/MethodType;
+ 0x0000 - 0x0053 reg=12 (null) Z
+ 0x0000 - 0x0053 reg=13 (null) B
+ 0x0000 - 0x0053 reg=14 (null) C
+ 0x0000 - 0x0053 reg=15 (null) S
+ 0x0000 - 0x0053 reg=16 (null) I
+ 0x0000 - 0x0053 reg=17 (null) F
+ 0x0000 - 0x0053 reg=18 (null) D
+ 0x0000 - 0x0053 reg=20 (null) Ljava/lang/String;
+ 0x0000 - 0x0053 reg=21 (null) Ljava/lang/Class;
+ 0x0000 - 0x0053 reg=22 (null) J
+
+ #3 : (in Lcom/android/jack/java7/invokecustom/test004/Tests;)
+ name : 'main'
+ type : '([Ljava/lang/String;)V'
+ access : 0x0009 (PUBLIC STATIC)
+ code -
+ registers : 4
+ ins : 1
+ outs : 2
+ insns size : 12 16-bit code units
+0004d4: |[0004d4] com.android.jack.java7.invokecustom.test004.Tests.main:([Ljava/lang/String;)V
+0004e4: 6200 0200 |0000: sget-object v0, Ljava/lang/System;.out:Ljava/io/PrintStream; // field@0002
+0004e8: 1221 |0002: const/4 v1, #int 2 // #2
+0004ea: 1232 |0003: const/4 v2, #int 3 // #3
+0004ec: fc20 0000 2100 |0004: invoke-custom {v1, v2}, call_site@0000
+0004f2: 0a01 |0007: move-result v1
+0004f4: 6e20 0500 1000 |0008: invoke-virtual {v0, v1}, Ljava/io/PrintStream;.println:(I)V // method@0005
+0004fa: 0e00 |000b: return-void
+ catches : (none)
+ positions :
+ 0x0000 line=82
+ 0x000b line=83
+ locals :
+ 0x0000 - 0x000c reg=3 (null) [Ljava/lang/String;
+
+ Virtual methods -
+ #0 : (in Lcom/android/jack/java7/invokecustom/test004/Tests;)
+ name : 'test'
+ type : '()V'
+ access : 0x0001 (PUBLIC)
+ code -
+ registers : 3
+ ins : 1
+ outs : 2
+ insns size : 11 16-bit code units
+0004fc: |[0004fc] com.android.jack.java7.invokecustom.test004.Tests.test:()V
+00050c: 1220 |0000: const/4 v0, #int 2 // #2
+00050e: 1231 |0001: const/4 v1, #int 3 // #3
+000510: fc20 0100 1000 |0002: invoke-custom {v0, v1}, call_site@0001
+000516: 0a00 |0005: move-result v0
+000518: 1251 |0006: const/4 v1, #int 5 // #5
+00051a: 7120 0d00 0100 |0007: invoke-static {v1, v0}, Ljunit/framework/Assert;.assertEquals:(II)V // method@000d
+000520: 0e00 |000a: return-void
+ catches : (none)
+ positions :
+ 0x0000 line=78
+ 0x000a line=79
+ locals :
+ 0x0000 - 0x000b reg=2 this Lcom/android/jack/java7/invokecustom/test004/Tests;
+
+ source_file_idx : 38 (Tests.java)
+
+Method handle #0:
+ type : invoke-static
+ target : Lcom/android/jack/java7/invokecustom/test004/Tests; linkerMethod
+ target_type : (Ljava/lang/invoke/MethodHandles$Lookup;Ljava/lang/String;Ljava/lang/invoke/MethodType;ZBCSIFDLjava/lang/String;Ljava/lang/Class;J)Ljava/lang/invoke/CallSite;
+Call site #0:
+ link_argument[0] : 0 (MethodHandle)
+ link_argument[1] : add (String)
+ link_argument[2] : (II)I (MethodType)
+ link_argument[3] : 1 (int)
+ link_argument[4] : 1 (int)
+ link_argument[5] : 97 (int)
+ link_argument[6] : 1024 (int)
+ link_argument[7] : 1 (int)
+ link_argument[8] : 11.1 (float)
+ link_argument[9] : 2.2 (double)
+ link_argument[10] : Hello (String)
+ link_argument[11] : Tests (Class)
+ link_argument[12] : 123456789 (long)
+Call site #1:
+ link_argument[0] : 0 (MethodHandle)
+ link_argument[1] : add (String)
+ link_argument[2] : (II)I (MethodType)
+ link_argument[3] : 1 (int)
+ link_argument[4] : 1 (int)
+ link_argument[5] : 97 (int)
+ link_argument[6] : 1024 (int)
+ link_argument[7] : 1 (int)
+ link_argument[8] : 11.1 (float)
+ link_argument[9] : 2.2 (double)
+ link_argument[10] : Hello (String)
+ link_argument[11] : Tests (Class)
+ link_argument[12] : 123456789 (long)
diff --git a/test/dexdump/invoke-custom.xml b/test/dexdump/invoke-custom.xml
new file mode 100644
index 0000000..2a29667
--- /dev/null
+++ b/test/dexdump/invoke-custom.xml
@@ -0,0 +1,89 @@
+<api>
+<package name="com.android.jack.java7.invokecustom.test004"
+>
+<class name="Tests"
+ extends="java.lang.Object"
+ interface="false"
+ abstract="false"
+ static="false"
+ final="false"
+ visibility="public"
+>
+<field name="fieldCallSite"
+ type="java.lang.invoke.CallSite"
+ transient="false"
+ volatile="false"
+ static="true"
+ final="false"
+ visibility="public"
+>
+</field>
+<constructor name="Tests"
+ type="com.android.jack.java7.invokecustom.test004.Tests"
+ static="false"
+ final="false"
+ visibility="public"
+>
+</constructor>
+<method name="main"
+ return="void"
+ abstract="false"
+ native="false"
+ synchronized="false"
+ static="true"
+ final="false"
+ visibility="public"
+>
+<parameter name="arg0" type="java.lang.String[]">
+</parameter>
+</method>
+<method name="test"
+ return="void"
+ abstract="false"
+ native="false"
+ synchronized="false"
+ static="false"
+ final="false"
+ visibility="public"
+>
+</method>
+</class>
+<method_handle index="0"
+ type="invoke-static"
+ target_class="Lcom/android/jack/java7/invokecustom/test004/Tests;"
+ target_member="linkerMethod"
+ target_member_type="(Ljava/lang/invoke/MethodHandles$Lookup;Ljava/lang/String;Ljava/lang/invoke/MethodType;ZBCSIFDLjava/lang/String;Ljava/lang/Class;J)Ljava/lang/invoke/CallSite;"
+>
+</method_handle>
+<call_site index="0">
+<link_argument index="0" type="MethodHandle" value="0"/>
+<link_argument index="1" type="String" values="add"/>
+<link_argument index="2" type="MethodType" value="(II)I"/>
+<link_argument index="3" type="int" value="1"/>
+<link_argument index="4" type="int" value="1"/>
+<link_argument index="5" type="int" value="97"/>
+<link_argument index="6" type="int" value="1024"/>
+<link_argument index="7" type="int" value="1"/>
+<link_argument index="8" type="float" value="11.1"/>
+<link_argument index="9" type="double" value="2.2"/>
+<link_argument index="10" type="String" value="Hello"/>
+<link_argument index="11" type="Class" value="Tests"/>
+<link_argument index="12" type="long" value="123456789"/>
+</call_site>
+<call_site index="1">
+<link_argument index="0" type="MethodHandle" value="0"/>
+<link_argument index="1" type="String" values="add"/>
+<link_argument index="2" type="MethodType" value="(II)I"/>
+<link_argument index="3" type="int" value="1"/>
+<link_argument index="4" type="int" value="1"/>
+<link_argument index="5" type="int" value="97"/>
+<link_argument index="6" type="int" value="1024"/>
+<link_argument index="7" type="int" value="1"/>
+<link_argument index="8" type="float" value="11.1"/>
+<link_argument index="9" type="double" value="2.2"/>
+<link_argument index="10" type="String" value="Hello"/>
+<link_argument index="11" type="Class" value="Tests"/>
+<link_argument index="12" type="long" value="123456789"/>
+</call_site>
+</package>
+</api>
diff --git a/test/etc/default-build b/test/etc/default-build
index e9e3886..3d7b7dd 100755
--- a/test/etc/default-build
+++ b/test/etc/default-build
@@ -60,6 +60,12 @@
HAS_SRC_DEX2OAT_UNRESOLVED=false
fi
+# Allow overriding ZIP_COMPRESSION_METHOD with e.g. 'store'
+ZIP_COMPRESSION_METHOD="deflate"
+# Align every ZIP file made by calling $ZIPALIGN command?
+WITH_ZIP_ALIGN=false
+ZIP_ALIGN_BYTES="-1"
+
DX_FLAGS=""
SKIP_DX_MERGER="false"
EXPERIMENTAL=""
@@ -73,6 +79,7 @@
JACK_EXPERIMENTAL_ARGS["default-methods"]="-D jack.java.source.version=1.8 -D jack.android.min-api-level=24"
JACK_EXPERIMENTAL_ARGS["lambdas"]="-D jack.java.source.version=1.8 -D jack.android.min-api-level=24"
JACK_EXPERIMENTAL_ARGS["method-handles"]="-D jack.java.source.version=1.7 -D jack.android.min-api-level=o-b1"
+JACK_EXPERIMENTAL_ARGS["java-8"]="-D jack.java.source.version=1.8 -D jack.android.min-api-level=24"
declare -A SMALI_EXPERIMENTAL_ARGS
SMALI_EXPERIMENTAL_ARGS["default-methods"]="--api-level 24"
@@ -118,6 +125,17 @@
DEFAULT_EXPERIMENT=""
EXPERIMENTAL="${EXPERIMENTAL} $1"
shift
+ elif [ "x$1" = "x--zip-compression-method" ]; then
+ # Allow using different zip compression method, e.g. 'store'
+ shift
+ ZIP_COMPRESSION_METHOD="$1"
+ shift
+ elif [ "x$1" = "x--zip-align" ]; then
+ # Align ZIP entries to some # of bytes.
+ shift
+ WITH_ZIP_ALIGN=true
+ ZIP_ALIGN_BYTES="$1"
+ shift
elif expr "x$1" : "x--" >/dev/null 2>&1; then
echo "unknown $0 option: $1" 1>&2
exit 1
@@ -146,6 +164,26 @@
JAVAC_ARGS="${JAVAC_ARGS} ${JAVAC_EXPERIMENTAL_ARGS[${experiment}]}"
done
+#########################################
+
+# Catch all commands to 'ZIP' and prepend extra flags.
+# Optionally, zipalign results to some alignment.
+function zip() {
+ local zip_target="$1"
+ local entry_src="$2"
+ shift 2
+
+ command zip --compression-method "$ZIP_COMPRESSION_METHOD" "$zip_target" "$entry_src" "$@"
+
+ if "$WITH_ZIP_ALIGN"; then
+ # zipalign does not operate in-place, so write results to a temp file.
+ local tmp_file="$(mktemp)"
+ "$ZIPALIGN" -f "$ZIP_ALIGN_BYTES" "$zip_target" "$tmp_file"
+ # replace original zip target with our temp file.
+ mv "$tmp_file" "$zip_target"
+ fi
+}
+
if [ -e classes.dex ]; then
zip $TEST_NAME.jar classes.dex
exit 0
@@ -234,7 +272,7 @@
fi
fi
-if [ "${HAS_SMALI}" = "true" ]; then
+if [ "${HAS_SMALI}" = "true" -a ${NEED_DEX} = "true" ]; then
# Compile Smali classes
${SMALI} -JXmx512m ${SMALI_ARGS} --output smali_classes.dex `find smali -name '*.smali'`
@@ -246,7 +284,7 @@
fi
fi
-if [ "${HAS_SMALI_MULTIDEX}" = "true" ]; then
+if [ "${HAS_SMALI_MULTIDEX}" = "true" -a ${NEED_DEX} = "true" ]; then
# Compile Smali classes
${SMALI} -JXmx512m ${SMALI_ARGS} --output smali_classes2.dex `find smali-multidex -name '*.smali'`
diff --git a/test/etc/run-test-jar b/test/etc/run-test-jar
index 186a151..7d218f1 100755
--- a/test/etc/run-test-jar
+++ b/test/etc/run-test-jar
@@ -64,6 +64,10 @@
APP_IMAGE="y"
VDEX_FILTER=""
+# if "y", run 'sync' before dalvikvm to make sure all files from
+# build step (e.g. dex2oat) were finished writing.
+SYNC_BEFORE_RUN="n"
+
while true; do
if [ "x$1" = "x--quiet" ]; then
QUIET="y"
@@ -262,6 +266,9 @@
option="$1"
VDEX_FILTER="--compiler-filter=$option"
shift
+ elif [ "x$1" = "x--sync" ]; then
+ SYNC_BEFORE_RUN="y"
+ shift
elif expr "x$1" : "x--" >/dev/null 2>&1; then
echo "unknown $0 option: $1" 1>&2
exit 1
@@ -491,6 +498,7 @@
vdex_cmdline="true"
mkdir_locations="${DEX_LOCATION}/dalvik-cache/$ISA"
strip_cmdline="true"
+sync_cmdline="true"
if [ "$PREBUILD" = "y" ]; then
@@ -530,6 +538,10 @@
strip_cmdline="zip --quiet --delete $DEX_LOCATION/$TEST_NAME.jar classes.dex"
fi
+if [ "$SYNC_BEFORE_RUN" = "y" ]; then
+ sync_cmdline="sync"
+fi
+
DALVIKVM_ISA_FEATURES_ARGS=""
if [ "x$INSTRUCTION_SET_FEATURES" != "x" ] ; then
DALVIKVM_ISA_FEATURES_ARGS="-Xcompiler-option --instruction-set-features=${INSTRUCTION_SET_FEATURES}"
@@ -589,7 +601,8 @@
LD_LIBRARY_PATH=$ANDROID_ROOT/$LIBRARY_DIRECTORY:$LD_LIBRARY_PATH
fi
- PUBLIC_LIBS=libart.so:libartd.so
+ # System libraries needed by libarttestd.so
+ PUBLIC_LIBS=libart.so:libartd.so:libc++.so:libbacktrace.so:libbase.so:libnativehelper.so
# Create a script with the command. The command can get longer than the longest
# allowed adb command and there is no way to get the exit status from a adb shell
@@ -607,6 +620,7 @@
$dex2oat_cmdline && \
$vdex_cmdline && \
$strip_cmdline && \
+ $sync_cmdline && \
$dalvikvm_cmdline"
cmdfile=$(tempfile -p "cmd-" -s "-$TEST_NAME")
@@ -679,7 +693,7 @@
fi
if [ "$DEV_MODE" = "y" ]; then
- echo "mkdir -p ${mkdir_locations} && $dex2oat_cmdline && $vdex_cmdline && $strip_cmdline && $cmdline"
+ echo "mkdir -p ${mkdir_locations} && $dex2oat_cmdline && $vdex_cmdline && $strip_cmdline && $sync_cmdline && $cmdline"
fi
cd $ANDROID_BUILD_TOP
@@ -689,6 +703,7 @@
$dex2oat_cmdline || { echo "Dex2oat failed." >&2 ; exit 2; }
$vdex_cmdline || { echo "Dex2oat failed." >&2 ; exit 2; }
$strip_cmdline || { echo "Strip failed." >&2 ; exit 3; }
+ $sync_cmdline || { echo "Sync failed." >&2 ; exit 4; }
# For running, we must turn off logging when dex2oat or patchoat are missing. Otherwise we use
# the same defaults as for prebuilt: everything when --dev, otherwise errors and above only.
diff --git a/test/run-test b/test/run-test
index 27c700e..c926c11 100755
--- a/test/run-test
+++ b/test/run-test
@@ -90,6 +90,22 @@
export JACK="$JACK -g -cp $JACK_CLASSPATH"
+# Zipalign is not on the PATH in some configs, auto-detect it.
+if [ -z "$ZIPALIGN" ]; then
+ if which zipalign >/dev/null; then
+ ZIPALIGN="zipalign";
+ else
+ # TODO: Add a dependency for zipalign in Android.run-test.mk
+ # once it doesn't depend on libandroidfw (b/35246701)
+ case "$OSTYPE" in
+ darwin*) ZIPALIGN="$ANDROID_BUILD_TOP/prebuilts/sdk/tools/darwin/bin/zipalign" ;;
+ linux*) ZIPALIGN="$ANDROID_BUILD_TOP/prebuilts/sdk/tools/linux/bin/zipalign" ;;
+ *) echo "Can't find zipalign: unknown: $OSTYPE" >&2;;
+ esac
+ fi
+fi
+export ZIPALIGN
+
info="info.txt"
build="build"
run="run"
@@ -495,7 +511,7 @@
run_args="${run_args} --runtime-option -Djava.library.path=${ANDROID_HOST_OUT}/lib${suffix64}:${ANDROID_HOST_OUT}/nativetest${suffix64}"
else
guess_target_arch_name
- run_args="${run_args} --runtime-option -Djava.library.path=/data/nativetest${suffix64}/art/${target_arch_name}:${android_root}/lib${suffix64}"
+ run_args="${run_args} --runtime-option -Djava.library.path=/data/nativetest${suffix64}/art/${target_arch_name}"
run_args="${run_args} --boot /data/art-test/core${image_suffix}${pic_image_suffix}${multi_image_suffix}.art"
fi
if [ "$relocate" = "yes" ]; then
diff --git a/test/testrunner/env.py b/test/testrunner/env.py
index 1dc8ce5..0b69718 100644
--- a/test/testrunner/env.py
+++ b/test/testrunner/env.py
@@ -100,7 +100,7 @@
ART_TEST_JIT = getEnvBoolean('ART_TEST_JIT', ART_TEST_FULL)
# Do you want optimizing compiler tests run?
-ART_TEST_OPTIMIZING = getEnvBoolean('ART_TEST_OPTIMIZING', True)
+ART_TEST_OPTIMIZING = getEnvBoolean('ART_TEST_OPTIMIZING', ART_TEST_FULL)
# Do you want to test the optimizing compiler with graph coloring register allocation?
ART_TEST_OPTIMIZING_GRAPH_COLOR = getEnvBoolean('ART_TEST_OPTIMIZING_GRAPH_COLOR', ART_TEST_FULL)
@@ -129,13 +129,13 @@
ART_TEST_RUN_TEST_RELOCATE = getEnvBoolean('ART_TEST_RUN_TEST_RELOCATE', ART_TEST_FULL)
# Do you want run-tests with prebuilding?
-ART_TEST_RUN_TEST_PREBUILD = getEnvBoolean('ART_TEST_RUN_TEST_PREBUILD', True)
+ART_TEST_RUN_TEST_PREBUILD = getEnvBoolean('ART_TEST_RUN_TEST_PREBUILD', ART_TEST_FULL)
# Do you want run-tests with no prebuilding enabled run?
ART_TEST_RUN_TEST_NO_PREBUILD = getEnvBoolean('ART_TEST_RUN_TEST_NO_PREBUILD', ART_TEST_FULL)
# Do you want run-tests with a pregenerated core.art?
-ART_TEST_RUN_TEST_IMAGE = getEnvBoolean('ART_TEST_RUN_TEST_IMAGE', True)
+ART_TEST_RUN_TEST_IMAGE = getEnvBoolean('ART_TEST_RUN_TEST_IMAGE', ART_TEST_FULL)
# Do you want run-tests without a pregenerated core.art?
ART_TEST_RUN_TEST_NO_IMAGE = getEnvBoolean('ART_TEST_RUN_TEST_NO_IMAGE', ART_TEST_FULL)
@@ -148,7 +148,7 @@
ART_TEST_RUN_TEST_NO_DEX2OAT = getEnvBoolean('ART_TEST_RUN_TEST_NO_DEX2OAT', ART_TEST_FULL)
# Do you want run-tests with libartd.so?
-ART_TEST_RUN_TEST_DEBUG = getEnvBoolean('ART_TEST_RUN_TEST_DEBUG', True)
+ART_TEST_RUN_TEST_DEBUG = getEnvBoolean('ART_TEST_RUN_TEST_DEBUG', ART_TEST_FULL)
# Do you want run-tests with libart.so?
ART_TEST_RUN_TEST_NDEBUG = getEnvBoolean('ART_TEST_RUN_TEST_NDEBUG', ART_TEST_FULL)
diff --git a/test/testrunner/testrunner.py b/test/testrunner/testrunner.py
index 81b7953..a5bfcff 100755
--- a/test/testrunner/testrunner.py
+++ b/test/testrunner/testrunner.py
@@ -95,12 +95,15 @@
# The mutex object is used by the threads for exclusive access of test_count
# to make any changes in its value.
test_count_mutex = threading.Lock()
+
# The set contains the list of all the possible run tests that are in art/test
# directory.
RUN_TEST_SET = set()
+
# The semaphore object is used by the testrunner to limit the number of
# threads to the user requested concurrency value.
semaphore = threading.Semaphore(1)
+
# The mutex object is used to provide exclusive access to a thread to print
# its output.
print_mutex = threading.Lock()
@@ -112,7 +115,6 @@
test_count = 0
total_test_count = 0
verbose = False
-last_print_length = 0
dry_run = False
build = False
gdb = False
@@ -166,12 +168,12 @@
TARGET_TYPES.add('host')
TARGET_TYPES.add('target')
- if env.ART_TEST_RUN_TEST_PREBUILD:
- PREBUILD_TYPES.add('prebuild')
if env.ART_TEST_RUN_TEST_NO_PREBUILD:
PREBUILD_TYPES.add('no-prebuild')
if env.ART_TEST_RUN_TEST_NO_DEX2OAT:
PREBUILD_TYPES.add('no-dex2oat')
+ if env.ART_TEST_RUN_TEST_PREBUILD or not PREBUILD_TYPES: # Default
+ PREBUILD_TYPES.add('prebuild')
if env.ART_TEST_INTERPRETER_ACCESS_CHECKS:
COMPILER_TYPES.add('interp-ac')
@@ -179,42 +181,39 @@
COMPILER_TYPES.add('interpreter')
if env.ART_TEST_JIT:
COMPILER_TYPES.add('jit')
-
- if env.ART_TEST_OPTIMIZING:
- COMPILER_TYPES.add('optimizing')
- OPTIMIZING_COMPILER_TYPES.add('optimizing')
if env.ART_TEST_OPTIMIZING_GRAPH_COLOR:
COMPILER_TYPES.add('regalloc_gc')
OPTIMIZING_COMPILER_TYPES.add('regalloc_gc')
+ if env.ART_TEST_OPTIMIZING or not COMPILER_TYPES: # Default
+ COMPILER_TYPES.add('optimizing')
+ OPTIMIZING_COMPILER_TYPES.add('optimizing')
- if not RELOCATE_TYPES:
- RELOCATE_TYPES.add('no-relocate')
if env.ART_TEST_RUN_TEST_RELOCATE:
RELOCATE_TYPES.add('relocate')
if env.ART_TEST_RUN_TEST_RELOCATE_NO_PATCHOAT:
RELOCATE_TYPES.add('relocate-npatchoat')
+ if not RELOCATE_TYPES: # Default
+ RELOCATE_TYPES.add('no-relocate')
- if not TRACE_TYPES:
- TRACE_TYPES.add('ntrace')
if env.ART_TEST_TRACE:
TRACE_TYPES.add('trace')
if env.ART_TEST_TRACE_STREAM:
TRACE_TYPES.add('stream')
+ if not TRACE_TYPES: # Default
+ TRACE_TYPES.add('ntrace')
- if not GC_TYPES:
- GC_TYPES.add('cms')
if env.ART_TEST_GC_STRESS:
GC_TYPES.add('gcstress')
if env.ART_TEST_GC_VERIFY:
GC_TYPES.add('gcverify')
+ if not GC_TYPES: # Default
+ GC_TYPES.add('cms')
- if not JNI_TYPES:
- JNI_TYPES.add('checkjni')
if env.ART_TEST_JNI_FORCECOPY:
JNI_TYPES.add('forcecopy')
+ if not JNI_TYPES: # Default
+ JNI_TYPES.add('checkjni')
- if env.ART_TEST_RUN_TEST_IMAGE:
- IMAGE_TYPES.add('picimage')
if env.ART_TEST_RUN_TEST_NO_IMAGE:
IMAGE_TYPES.add('no-image')
if env.ART_TEST_RUN_TEST_MULTI_IMAGE:
@@ -223,22 +222,23 @@
IMAGE_TYPES.add('npicimage')
if env.ART_TEST_RUN_TEST_MULTI_IMAGE:
IMAGE_TYPES.add('multinpicimage')
+ if env.ART_TEST_RUN_TEST_IMAGE or not IMAGE_TYPES: # Default
+ IMAGE_TYPES.add('picimage')
- if not PICTEST_TYPES:
- PICTEST_TYPES.add('npictest')
if env.ART_TEST_PIC_TEST:
PICTEST_TYPES.add('pictest')
+ if not PICTEST_TYPES: # Default
+ PICTEST_TYPES.add('npictest')
- if env.ART_TEST_RUN_TEST_DEBUG:
- RUN_TYPES.add('debug')
if env.ART_TEST_RUN_TEST_NDEBUG:
RUN_TYPES.add('ndebug')
-
- if not DEBUGGABLE_TYPES:
- DEBUGGABLE_TYPES.add('ndebuggable')
+ if env.ART_TEST_RUN_TEST_DEBUG or not RUN_TYPES: # Default
+ RUN_TYPES.add('debug')
if env.ART_TEST_RUN_TEST_DEBUGGABLE:
DEBUGGABLE_TYPES.add('debuggable')
+ if not DEBUGGABLE_TYPES: # Default
+ DEBUGGABLE_TYPES.add('ndebuggable')
if not ADDRESS_SIZES:
ADDRESS_SIZES_TARGET['target'].add(env.ART_PHONY_TEST_TARGET_SUFFIX)
@@ -445,8 +445,6 @@
test_variant: The set of variant for the test.
test_name: The name of the test along with the variants.
"""
- global last_print_length
- global test_count
global stop_testrunner
if is_test_disabled(test, test_variant):
test_skipped = True
@@ -456,42 +454,88 @@
script_output = proc.stdout.read().strip()
test_passed = not proc.wait()
- # If verbose is set to True, every test information is printed on a new line.
- # If not, the information is printed on the same line overriding the
- # previous test output.
- if not verbose:
- suffix = '\r'
- prefix = ' ' * last_print_length + '\r'
- else:
- suffix = '\n'
- prefix = ''
- test_count_mutex.acquire()
- test_count += 1
- percent = (test_count * 100) / total_test_count
- out = '[ ' + str(percent) + '% ' + str(test_count) + '/' + str(total_test_count) + ' ] '
- test_count_mutex.release()
- out += test_name + ' '
if not test_skipped:
if test_passed:
- out += COLOR_PASS + 'PASS' + COLOR_NORMAL
- last_print_length = len(out)
+ print_test_info(test_name, 'PASS')
else:
failed_tests.append(test_name)
- out += COLOR_ERROR + 'FAIL' + COLOR_NORMAL
- out += '\n' + command + '\n' + script_output
if not env.ART_TEST_KEEP_GOING:
stop_testrunner = True
- last_print_length = 0
+ print_test_info(test_name, 'FAIL', ('%s\n%s') % (
+ command, script_output))
elif not dry_run:
- out += COLOR_SKIP + 'SKIP' + COLOR_NORMAL
- last_print_length = len(out)
+ print_test_info(test_name, 'SKIP')
skipped_tests.append(test_name)
- print_mutex.acquire()
- print_text(prefix + out + suffix)
- print_mutex.release()
+ else:
+ print_test_info(test_name, '')
semaphore.release()
+def print_test_info(test_name, result, failed_test_info=""):
+ """Print the continous test information
+
+ If verbose is set to True, it continuously prints test status information
+ on a new line.
+ If verbose is set to False, it keeps on erasing test
+ information by overriding it with the latest test information. Also,
+ in this case it stictly makes sure that the information length doesn't
+ exceed the console width. It does so by shortening the test_name.
+
+ When a test fails, it prints the output of the run-test script and
+ command used to invoke the script. It doesn't override the failing
+ test information in either of the cases.
+ """
+ global test_count
+ info = ''
+ if not verbose:
+ # Without --verbose, the testrunner erases passing test info. It
+ # does that by overriding the printed text with white spaces all across
+ # the console width.
+ console_width = int(os.popen('stty size', 'r').read().split()[1])
+ info = '\r' + ' ' * console_width + '\r'
+ print_mutex.acquire()
+ test_count += 1
+ percent = (test_count * 100) / total_test_count
+ progress_info = ('[ %d%% %d/%d ]') % (
+ percent,
+ test_count,
+ total_test_count)
+
+ if result == "FAIL":
+ info += ('%s %s %s\n%s\n') % (
+ progress_info,
+ test_name,
+ COLOR_ERROR + 'FAIL' + COLOR_NORMAL,
+ failed_test_info)
+ else:
+ result_text = ''
+ if result == 'PASS':
+ result_text += COLOR_PASS + 'PASS' + COLOR_NORMAL
+ elif result == 'SKIP':
+ result_text += COLOR_SKIP + 'SKIP' + COLOR_NORMAL
+
+ if verbose:
+ info += ('%s %s %s\n') % (
+ progress_info,
+ test_name,
+ result_text)
+ else:
+ total_output_length = 2 # Two spaces
+ total_output_length += len(progress_info)
+ total_output_length += len(result)
+ allowed_test_length = console_width - total_output_length
+ test_name_len = len(test_name)
+ if allowed_test_length < test_name_len:
+ test_name = ('%s...%s') % (
+ test_name[:(allowed_test_length - 3)/2],
+ test_name[-(allowed_test_length - 3)/2:])
+ info += ('%s %s %s') % (
+ progress_info,
+ test_name,
+ result_text)
+ print_text(info)
+ print_mutex.release()
+
def get_disabled_test_info():
"""Generate set of known failures.
@@ -588,7 +632,12 @@
def print_analysis():
if not verbose:
- print_text(' ' * last_print_length + '\r')
+ # Without --verbose, the testrunner erases passing test info. It
+ # does that by overriding the printed text with white spaces all across
+ # the console width.
+ console_width = int(os.popen('stty size', 'r').read().split()[1])
+ eraser_text = '\r' + ' ' * console_width + '\r'
+ print_text(eraser_text)
if skipped_tests:
print_text(COLOR_SKIP + 'SKIPPED TESTS' + COLOR_NORMAL + '\n')
for test in skipped_tests:
@@ -612,8 +661,12 @@
variants required to run the test. Again, it returns the test_name
without the variant information like 001-HelloWorld.
"""
- if test_name in RUN_TEST_SET:
- return {test_name}
+ test_set = set()
+ for test in RUN_TEST_SET:
+ if test.startswith(test_name):
+ test_set.add(test)
+ if test_set:
+ return test_set
regex = '^test-art-'
regex += '(' + '|'.join(VARIANT_TYPE_DICT['target']) + ')-'
@@ -645,6 +698,7 @@
DEBUGGABLE_TYPES.add(match.group(11))
ADDRESS_SIZES.add(match.group(13))
return {match.group(12)}
+ raise ValueError(test_name + " is not a valid test")
def parse_option():
@@ -788,10 +842,10 @@
sys.exit(0)
except SystemExit:
pass
- except:
+ except Exception, e:
print_analysis()
+ print_text(str(e))
sys.exit(1)
-
if __name__ == '__main__':
main()
diff --git a/test/ti-agent/common_load.cc b/test/ti-agent/common_load.cc
index c5a9356..351857d 100644
--- a/test/ti-agent/common_load.cc
+++ b/test/ti-agent/common_load.cc
@@ -122,6 +122,7 @@
{ "942-private-recursive", common_redefine::OnLoad, nullptr },
{ "943-private-recursive-jit", common_redefine::OnLoad, nullptr },
{ "944-transform-classloaders", common_redefine::OnLoad, nullptr },
+ { "945-obsolete-native", common_redefine::OnLoad, nullptr },
};
static AgentLib* FindAgent(char* name) {
diff --git a/tools/cpp-define-generator/presubmit-check-files-up-to-date b/tools/cpp-define-generator/presubmit-check-files-up-to-date
index 67a702a..0301a3e 100755
--- a/tools/cpp-define-generator/presubmit-check-files-up-to-date
+++ b/tools/cpp-define-generator/presubmit-check-files-up-to-date
@@ -22,7 +22,11 @@
GEN_TOOL=cpp-define-generator-data
if ! which "$GEN_TOOL"; then
- echo "ERROR: Please build cpp-define-generator-data or source build/envsetup.sh" >&2
+ if [[ -z $ANDROID_BUILD_TOP ]]; then
+ echo "ERROR: Can't find '$GEN_TOOL' in \$PATH. Perhaps try 'source build/envsetup.sh' ?" >&2
+ else
+ echo "ERROR: Can't find '$GEN_TOOL' in \$PATH. Perhaps try 'make $GEN_TOOL' ?" >&2
+ fi
exit 1
fi