Implement RetransformClasses
This CL implements basic support for the RetransformClasses function
and callbacks of the ClassFileLoadHook.
We do not yet support calling the ClassFileLoadHook events on first
load of class.
Bug: 32369913
Bug: 31684920
Test: mma -j40 test-art-host
Change-Id: I7959474f03f9903cc6f10ae3c06d9fd531ec7957
diff --git a/runtime/openjdkjvmti/OpenjdkJvmTi.cc b/runtime/openjdkjvmti/OpenjdkJvmTi.cc
index 90467db..32e3948 100644
--- a/runtime/openjdkjvmti/OpenjdkJvmTi.cc
+++ b/runtime/openjdkjvmti/OpenjdkJvmTi.cc
@@ -631,7 +631,17 @@
}
static jvmtiError RetransformClasses(jvmtiEnv* env, jint class_count, const jclass* classes) {
- return ERR(NOT_IMPLEMENTED);
+ std::string error_msg;
+ jvmtiError res = Transformer::RetransformClasses(ArtJvmTiEnv::AsArtJvmTiEnv(env),
+ art::Runtime::Current(),
+ art::Thread::Current(),
+ class_count,
+ classes,
+ &error_msg);
+ if (res != OK) {
+ LOG(WARNING) << "FAILURE TO RETRANFORM " << error_msg;
+ }
+ return res;
}
static jvmtiError RedefineClasses(jvmtiEnv* env,
@@ -1255,78 +1265,6 @@
*format_ptr = jvmtiJlocationFormat::JVMTI_JLOCATION_JVMBCI;
return ERR(NONE);
}
-
- // TODO Remove this once events are working.
- static jvmtiError RetransformClassWithHook(jvmtiEnv* env,
- jclass klass,
- jvmtiEventClassFileLoadHook hook) {
- std::vector<jclass> classes;
- classes.push_back(klass);
- return RetransformClassesWithHook(reinterpret_cast<ArtJvmTiEnv*>(env), classes, hook);
- }
-
- // TODO This will be called by the event handler for the art::ti Event Load Event
- static jvmtiError RetransformClassesWithHook(ArtJvmTiEnv* env,
- const std::vector<jclass>& classes,
- jvmtiEventClassFileLoadHook hook) {
- if (!IsValidEnv(env)) {
- return ERR(INVALID_ENVIRONMENT);
- }
- jvmtiError res = OK;
- std::string error;
- for (jclass klass : classes) {
- JNIEnv* jni_env = nullptr;
- jobject loader = nullptr;
- std::string name;
- jobject protection_domain = nullptr;
- jint data_len = 0;
- unsigned char* dex_data = nullptr;
- jvmtiError ret = OK;
- std::string location;
- if ((ret = GetTransformationData(env,
- klass,
- /*out*/&location,
- /*out*/&jni_env,
- /*out*/&loader,
- /*out*/&name,
- /*out*/&protection_domain,
- /*out*/&data_len,
- /*out*/&dex_data)) != OK) {
- // TODO Do something more here? Maybe give log statements?
- return ret;
- }
- jint new_data_len = 0;
- unsigned char* new_dex_data = nullptr;
- hook(env,
- jni_env,
- klass,
- loader,
- name.c_str(),
- protection_domain,
- data_len,
- dex_data,
- /*out*/&new_data_len,
- /*out*/&new_dex_data);
- // Check if anything actually changed.
- if ((new_data_len != 0 || new_dex_data != nullptr) && new_dex_data != dex_data) {
- jvmtiClassDefinition def = { klass, new_data_len, new_dex_data };
- res = Redefiner::RedefineClasses(env,
- art::Runtime::Current(),
- art::Thread::Current(),
- 1,
- &def,
- &error);
- env->Deallocate(new_dex_data);
- }
- // Deallocate the old dex data.
- env->Deallocate(dex_data);
- if (res != OK) {
- LOG(ERROR) << "FAILURE TO REDEFINE " << error;
- return res;
- }
- }
- return OK;
- }
};
static bool IsJvmtiVersion(jint version) {
@@ -1369,10 +1307,7 @@
// The actual struct holding all of the entrypoints into the jvmti interface.
const jvmtiInterface_1 gJvmtiInterface = {
- // SPECIAL FUNCTION: RetransformClassWithHook Is normally reserved1
- // TODO Remove once we have events working.
- reinterpret_cast<void*>(JvmtiFunctions::RetransformClassWithHook),
- // nullptr, // reserved1
+ nullptr, // reserved1
JvmtiFunctions::SetEventNotificationMode,
nullptr, // reserved3
JvmtiFunctions::GetAllThreads,
diff --git a/runtime/openjdkjvmti/art_jvmti.h b/runtime/openjdkjvmti/art_jvmti.h
index 5eadc5a..1c84d4d 100644
--- a/runtime/openjdkjvmti/art_jvmti.h
+++ b/runtime/openjdkjvmti/art_jvmti.h
@@ -47,6 +47,7 @@
namespace openjdkjvmti {
extern const jvmtiInterface_1 gJvmtiInterface;
+extern EventHandler gEventHandler;
// A structure that is a jvmtiEnv with additional information for the runtime.
struct ArtJvmTiEnv : public jvmtiEnv {
@@ -124,6 +125,29 @@
return ret;
}
+struct ArtClassDefinition {
+ jclass klass;
+ jobject loader;
+ std::string name;
+ jobject protection_domain;
+ jint dex_len;
+ JvmtiUniquePtr dex_data;
+ bool modified;
+
+ ArtClassDefinition() = default;
+ ArtClassDefinition(ArtClassDefinition&& o) = default;
+
+ void SetNewDexData(ArtJvmTiEnv* env, jint new_dex_len, unsigned char* new_dex_data) {
+ if (new_dex_data == nullptr) {
+ return;
+ } else if (new_dex_data != dex_data.get() || new_dex_len != dex_len) {
+ modified = true;
+ dex_len = new_dex_len;
+ dex_data = MakeJvmtiUniquePtr(env, new_dex_data);
+ }
+ }
+};
+
const jvmtiCapabilities kPotentialCapabilities = {
.can_tag_objects = 1,
.can_generate_field_modification_events = 0,
@@ -134,7 +158,7 @@
.can_get_current_contended_monitor = 0,
.can_get_monitor_info = 0,
.can_pop_frame = 0,
- .can_redefine_classes = 0,
+ .can_redefine_classes = 1,
.can_signal_thread = 0,
.can_get_source_file_name = 0,
.can_get_line_numbers = 0,
@@ -162,7 +186,7 @@
.can_get_owned_monitor_stack_depth_info = 0,
.can_get_constant_pool = 0,
.can_set_native_method_prefix = 0,
- .can_retransform_classes = 0,
+ .can_retransform_classes = 1,
.can_retransform_any_class = 0,
.can_generate_resource_exhaustion_heap_events = 0,
.can_generate_resource_exhaustion_threads_events = 0,
diff --git a/runtime/openjdkjvmti/events-inl.h b/runtime/openjdkjvmti/events-inl.h
index 1e07bc6..21ec731 100644
--- a/runtime/openjdkjvmti/events-inl.h
+++ b/runtime/openjdkjvmti/events-inl.h
@@ -115,9 +115,95 @@
}
template <typename ...Args>
+inline void EventHandler::DispatchClassFileLoadHookEvent(art::Thread*,
+ ArtJvmtiEvent event,
+ Args... args ATTRIBUTE_UNUSED) const {
+ CHECK(event == ArtJvmtiEvent::kClassFileLoadHookRetransformable ||
+ event == ArtJvmtiEvent::kClassFileLoadHookNonRetransformable);
+ LOG(FATAL) << "Incorrect arguments to ClassFileLoadHook!";
+}
+
+// TODO Locking of some type!
+template <>
+inline void EventHandler::DispatchClassFileLoadHookEvent(art::Thread* thread,
+ ArtJvmtiEvent event,
+ JNIEnv* jnienv,
+ jclass class_being_redefined,
+ jobject loader,
+ const char* name,
+ jobject protection_domain,
+ jint class_data_len,
+ const unsigned char* class_data,
+ jint* new_class_data_len,
+ unsigned char** new_class_data) const {
+ CHECK(event == ArtJvmtiEvent::kClassFileLoadHookRetransformable ||
+ event == ArtJvmtiEvent::kClassFileLoadHookNonRetransformable);
+ using FnType = void(jvmtiEnv* /* jvmti_env */,
+ JNIEnv* /* jnienv */,
+ jclass /* class_being_redefined */,
+ jobject /* loader */,
+ const char* /* name */,
+ jobject /* protection_domain */,
+ jint /* class_data_len */,
+ const unsigned char* /* class_data */,
+ jint* /* new_class_data_len */,
+ unsigned char** /* new_class_data */);
+ jint current_len = class_data_len;
+ unsigned char* current_class_data = const_cast<unsigned char*>(class_data);
+ ArtJvmTiEnv* last_env = nullptr;
+ for (ArtJvmTiEnv* env : envs) {
+ if (ShouldDispatch(event, env, thread)) {
+ jint new_len;
+ unsigned char* new_data;
+ FnType* callback = GetCallback<FnType>(env, event);
+ callback(env,
+ jnienv,
+ class_being_redefined,
+ loader,
+ name,
+ protection_domain,
+ current_len,
+ current_class_data,
+ &new_len,
+ &new_data);
+ if (new_data != nullptr && new_data != current_class_data) {
+ // Destroy the data the last transformer made. We skip this if the previous state was the
+ // initial one since we don't know here which jvmtiEnv allocated it.
+ // NB Currently this doesn't matter since all allocations just go to malloc but in the
+ // future we might have jvmtiEnv's keep track of their allocations for leak-checking.
+ if (last_env != nullptr) {
+ last_env->Deallocate(current_class_data);
+ }
+ last_env = env;
+ current_class_data = new_data;
+ current_len = new_len;
+ }
+ }
+ }
+ if (last_env != nullptr) {
+ *new_class_data_len = current_len;
+ *new_class_data = current_class_data;
+ }
+}
+
+template <typename ...Args>
inline void EventHandler::DispatchEvent(art::Thread* thread,
ArtJvmtiEvent event,
Args... args) const {
+ switch (event) {
+ case ArtJvmtiEvent::kClassFileLoadHookRetransformable:
+ case ArtJvmtiEvent::kClassFileLoadHookNonRetransformable:
+ return DispatchClassFileLoadHookEvent(thread, event, args...);
+ default:
+ return GenericDispatchEvent(thread, event, args...);
+ }
+}
+
+// TODO Locking of some type!
+template <typename ...Args>
+inline void EventHandler::GenericDispatchEvent(art::Thread* thread,
+ ArtJvmtiEvent event,
+ Args... args) const {
using FnType = void(jvmtiEnv*, Args...);
for (ArtJvmTiEnv* env : envs) {
if (ShouldDispatch(event, env, thread)) {
diff --git a/runtime/openjdkjvmti/events.h b/runtime/openjdkjvmti/events.h
index 7990141..08a8765 100644
--- a/runtime/openjdkjvmti/events.h
+++ b/runtime/openjdkjvmti/events.h
@@ -178,6 +178,15 @@
ALWAYS_INLINE
inline void RecalculateGlobalEventMask(ArtJvmtiEvent event);
+ template <typename ...Args>
+ ALWAYS_INLINE inline void GenericDispatchEvent(art::Thread* thread,
+ ArtJvmtiEvent event,
+ Args... args) const;
+ template <typename ...Args>
+ ALWAYS_INLINE inline void DispatchClassFileLoadHookEvent(art::Thread* thread,
+ ArtJvmtiEvent event,
+ Args... args) const;
+
void HandleEventType(ArtJvmtiEvent event, bool enable);
// List of all JvmTiEnv objects that have been created, in their creation order.
diff --git a/runtime/openjdkjvmti/ti_redefine.cc b/runtime/openjdkjvmti/ti_redefine.cc
index 6af51c4..28ea267 100644
--- a/runtime/openjdkjvmti/ti_redefine.cc
+++ b/runtime/openjdkjvmti/ti_redefine.cc
@@ -242,14 +242,12 @@
}
}
-// TODO This should handle doing multiple classes at once so we need to do less cleanup when things
-// go wrong.
jvmtiError Redefiner::RedefineClasses(ArtJvmTiEnv* env,
art::Runtime* runtime,
art::Thread* self,
jint class_count,
const jvmtiClassDefinition* definitions,
- std::string* error_msg) {
+ /*out*/std::string* error_msg) {
if (env == nullptr) {
*error_msg = "env was null!";
return ERR(INVALID_ENVIRONMENT);
@@ -263,46 +261,83 @@
*error_msg = "null definitions!";
return ERR(NULL_POINTER);
}
+ std::vector<ArtClassDefinition> def_vector;
+ def_vector.reserve(class_count);
+ for (jint i = 0; i < class_count; i++) {
+ ArtClassDefinition def;
+ def.dex_len = definitions[i].class_byte_count;
+ def.dex_data = MakeJvmtiUniquePtr(env, const_cast<unsigned char*>(definitions[i].class_bytes));
+ // We are definitely modified.
+ def.modified = true;
+ jvmtiError res = Transformer::FillInTransformationData(env, definitions[i].klass, &def);
+ if (res != OK) {
+ return res;
+ }
+ def_vector.push_back(std::move(def));
+ }
+ // Call all the transformation events.
+ jvmtiError res = Transformer::RetransformClassesDirect(env,
+ self,
+ &def_vector);
+ if (res != OK) {
+ // Something went wrong with transformation!
+ return res;
+ }
+ return RedefineClassesDirect(env, runtime, self, def_vector, error_msg);
+}
+
+jvmtiError Redefiner::RedefineClassesDirect(ArtJvmTiEnv* env,
+ art::Runtime* runtime,
+ art::Thread* self,
+ const std::vector<ArtClassDefinition>& definitions,
+ std::string* error_msg) {
+ DCHECK(env != nullptr);
+ if (definitions.size() == 0) {
+ // We don't actually need to do anything. Just return OK.
+ return OK;
+ }
// Stop JIT for the duration of this redefine since the JIT might concurrently compile a method we
// are going to redefine.
art::jit::ScopedJitSuspend suspend_jit;
// Get shared mutator lock so we can lock all the classes.
art::ScopedObjectAccess soa(self);
std::vector<Redefiner::ClassRedefinition> redefinitions;
- redefinitions.reserve(class_count);
+ redefinitions.reserve(definitions.size());
Redefiner r(runtime, self, error_msg);
- for (jint i = 0; i < class_count; i++) {
- jvmtiError res = r.AddRedefinition(env, definitions[i]);
- if (res != OK) {
- return res;
+ for (const ArtClassDefinition& def : definitions) {
+ // Only try to transform classes that have been modified.
+ if (def.modified) {
+ jvmtiError res = r.AddRedefinition(env, def);
+ if (res != OK) {
+ return res;
+ }
}
}
return r.Run();
}
-jvmtiError Redefiner::AddRedefinition(ArtJvmTiEnv* env, const jvmtiClassDefinition& def) {
+jvmtiError Redefiner::AddRedefinition(ArtJvmTiEnv* env, const ArtClassDefinition& def) {
std::string original_dex_location;
jvmtiError ret = OK;
if ((ret = GetClassLocation(env, def.klass, &original_dex_location))) {
*error_msg_ = "Unable to get original dex file location!";
return ret;
}
- std::unique_ptr<art::MemMap> map(MoveDataToMemMap(original_dex_location,
- def.class_byte_count,
- def.class_bytes,
- error_msg_));
- std::ostringstream os;
char* generic_ptr_unused = nullptr;
char* signature_ptr = nullptr;
- if (env->GetClassSignature(def.klass, &signature_ptr, &generic_ptr_unused) != OK) {
- *error_msg_ = "A jclass passed in does not seem to be valid";
- return ERR(INVALID_CLASS);
+ if ((ret = env->GetClassSignature(def.klass, &signature_ptr, &generic_ptr_unused)) != OK) {
+ *error_msg_ = "Unable to get class signature!";
+ return ret;
}
- // These will make sure we deallocate the signature.
- JvmtiUniquePtr sig_unique_ptr(MakeJvmtiUniquePtr(env, signature_ptr));
JvmtiUniquePtr generic_unique_ptr(MakeJvmtiUniquePtr(env, generic_ptr_unused));
+ JvmtiUniquePtr signature_unique_ptr(MakeJvmtiUniquePtr(env, signature_ptr));
+ std::unique_ptr<art::MemMap> map(MoveDataToMemMap(original_dex_location,
+ def.dex_len,
+ def.dex_data.get(),
+ error_msg_));
+ std::ostringstream os;
if (map.get() == nullptr) {
- os << "Failed to create anonymous mmap for modified dex file of class " << signature_ptr
+ os << "Failed to create anonymous mmap for modified dex file of class " << def.name
<< "in dex file " << original_dex_location << " because: " << *error_msg_;
*error_msg_ = os.str();
return ERR(OUT_OF_MEMORY);
@@ -319,7 +354,7 @@
/*verify_checksum*/true,
error_msg_));
if (dex_file.get() == nullptr) {
- os << "Unable to load modified dex file for " << signature_ptr << ": " << *error_msg_;
+ os << "Unable to load modified dex file for " << def.name << ": " << *error_msg_;
*error_msg_ = os.str();
return ERR(INVALID_CLASS_FORMAT);
}
@@ -989,17 +1024,16 @@
// Performs updates to class that will allow us to verify it.
void Redefiner::ClassRedefinition::UpdateClass(art::ObjPtr<art::mirror::Class> mclass,
art::ObjPtr<art::mirror::DexCache> new_dex_cache) {
- const art::DexFile::ClassDef* class_def = art::OatFile::OatDexFile::FindClassDef(
- *dex_file_, class_sig_.c_str(), art::ComputeModifiedUtf8Hash(class_sig_.c_str()));
- DCHECK(class_def != nullptr);
- UpdateMethods(mclass, new_dex_cache, *class_def);
+ DCHECK_EQ(dex_file_->NumClassDefs(), 1u);
+ const art::DexFile::ClassDef& class_def = dex_file_->GetClassDef(0);
+ UpdateMethods(mclass, new_dex_cache, class_def);
UpdateFields(mclass);
// Update the class fields.
// Need to update class last since the ArtMethod gets its DexFile from the class (which is needed
// to call GetReturnTypeDescriptor and GetParameterTypeList above).
mclass->SetDexCache(new_dex_cache.Ptr());
- mclass->SetDexClassDefIndex(dex_file_->GetIndexForClassDef(*class_def));
+ mclass->SetDexClassDefIndex(dex_file_->GetIndexForClassDef(class_def));
mclass->SetDexTypeIndex(dex_file_->GetIndexForTypeId(*dex_file_->FindTypeId(class_sig_.c_str())));
}
diff --git a/runtime/openjdkjvmti/ti_redefine.h b/runtime/openjdkjvmti/ti_redefine.h
index 8626bc5..f8d51ad 100644
--- a/runtime/openjdkjvmti/ti_redefine.h
+++ b/runtime/openjdkjvmti/ti_redefine.h
@@ -72,13 +72,25 @@
public:
// Redefine the given classes with the given dex data. Note this function does not take ownership
// of the dex_data pointers. It is not used after this call however and may be freed if desired.
+ // The caller is responsible for freeing it. The runtime makes its own copy of the data. This
+ // function does not call the transformation events.
+ // TODO Check modified flag of the definitions.
+ static jvmtiError RedefineClassesDirect(ArtJvmTiEnv* env,
+ art::Runtime* runtime,
+ art::Thread* self,
+ const std::vector<ArtClassDefinition>& definitions,
+ /*out*/std::string* error_msg);
+
+ // Redefine the given classes with the given dex data. Note this function does not take ownership
+ // of the dex_data pointers. It is not used after this call however and may be freed if desired.
// The caller is responsible for freeing it. The runtime makes its own copy of the data.
+ // TODO This function should call the transformation events.
static jvmtiError RedefineClasses(ArtJvmTiEnv* env,
art::Runtime* runtime,
art::Thread* self,
jint class_count,
const jvmtiClassDefinition* definitions,
- std::string* error_msg);
+ /*out*/std::string* error_msg);
static jvmtiError IsModifiableClass(jvmtiEnv* env, jclass klass, jboolean* is_redefinable);
@@ -209,7 +221,7 @@
redefinitions_(),
error_msg_(error_msg) { }
- jvmtiError AddRedefinition(ArtJvmTiEnv* env, const jvmtiClassDefinition& def)
+ jvmtiError AddRedefinition(ArtJvmTiEnv* env, const ArtClassDefinition& def)
REQUIRES_SHARED(art::Locks::mutator_lock_);
static jvmtiError GetClassRedefinitionError(art::Handle<art::mirror::Class> klass,
diff --git a/runtime/openjdkjvmti/transform.cc b/runtime/openjdkjvmti/transform.cc
index f545125..2809cb6 100644
--- a/runtime/openjdkjvmti/transform.cc
+++ b/runtime/openjdkjvmti/transform.cc
@@ -38,6 +38,7 @@
#include "class_linker.h"
#include "dex_file.h"
#include "dex_file_types.h"
+#include "events-inl.h"
#include "gc_root-inl.h"
#include "globals.h"
#include "jni_env_ext-inl.h"
@@ -52,12 +53,76 @@
#include "scoped_thread_state_change-inl.h"
#include "stack.h"
#include "thread_list.h"
+#include "ti_redefine.h"
#include "transform.h"
#include "utf.h"
#include "utils/dex_cache_arrays_layout-inl.h"
namespace openjdkjvmti {
+jvmtiError Transformer::RetransformClassesDirect(
+ ArtJvmTiEnv* env,
+ art::Thread* self,
+ /*in-out*/std::vector<ArtClassDefinition>* definitions) {
+ for (ArtClassDefinition& def : *definitions) {
+ jint new_len = -1;
+ unsigned char* new_data = nullptr;
+ // Static casts are so that we get the right template initialization for the special event
+ // handling code required by the ClassFileLoadHooks.
+ gEventHandler.DispatchEvent(self,
+ ArtJvmtiEvent::kClassFileLoadHookRetransformable,
+ GetJniEnv(env),
+ static_cast<jclass>(def.klass),
+ static_cast<jobject>(def.loader),
+ static_cast<const char*>(def.name.c_str()),
+ static_cast<jobject>(def.protection_domain),
+ static_cast<jint>(def.dex_len),
+ static_cast<const unsigned char*>(def.dex_data.get()),
+ static_cast<jint*>(&new_len),
+ static_cast<unsigned char**>(&new_data));
+ def.SetNewDexData(env, new_len, new_data);
+ }
+ return OK;
+}
+
+jvmtiError Transformer::RetransformClasses(ArtJvmTiEnv* env,
+ art::Runtime* runtime,
+ art::Thread* self,
+ jint class_count,
+ const jclass* classes,
+ /*out*/std::string* error_msg) {
+ if (env == nullptr) {
+ *error_msg = "env was null!";
+ return ERR(INVALID_ENVIRONMENT);
+ } else if (class_count < 0) {
+ *error_msg = "class_count was less then 0";
+ return ERR(ILLEGAL_ARGUMENT);
+ } else if (class_count == 0) {
+ // We don't actually need to do anything. Just return OK.
+ return OK;
+ } else if (classes == nullptr) {
+ *error_msg = "null classes!";
+ return ERR(NULL_POINTER);
+ }
+ // A holder that will Deallocate all the class bytes buffers on destruction.
+ std::vector<ArtClassDefinition> definitions;
+ jvmtiError res = OK;
+ for (jint i = 0; i < class_count; i++) {
+ ArtClassDefinition def;
+ res = FillInTransformationData(env, classes[i], &def);
+ if (res != OK) {
+ return res;
+ }
+ definitions.push_back(std::move(def));
+ }
+ res = RetransformClassesDirect(env, self, &definitions);
+ if (res != OK) {
+ return res;
+ }
+ return Redefiner::RedefineClassesDirect(env, runtime, self, definitions, error_msg);
+}
+
+// TODO Move this somewhere else, ti_class?
jvmtiError GetClassLocation(ArtJvmTiEnv* env, jclass klass, /*out*/std::string* location) {
JNIEnv* jni_env = nullptr;
jint ret = env->art_vm->GetEnv(reinterpret_cast<void**>(&jni_env), JNI_VERSION_1_1);
@@ -73,42 +138,61 @@
return OK;
}
-// TODO Move this function somewhere more appropriate.
-// Gets the data surrounding the given class.
-jvmtiError GetTransformationData(ArtJvmTiEnv* env,
- jclass klass,
- /*out*/std::string* location,
- /*out*/JNIEnv** jni_env_ptr,
- /*out*/jobject* loader,
- /*out*/std::string* name,
- /*out*/jobject* protection_domain,
- /*out*/jint* data_len,
- /*out*/unsigned char** dex_data) {
- jint ret = env->art_vm->GetEnv(reinterpret_cast<void**>(jni_env_ptr), JNI_VERSION_1_1);
- if (ret != JNI_OK) {
- // TODO Different error might be better?
- return ERR(INTERNAL);
- }
- JNIEnv* jni_env = *jni_env_ptr;
- art::ScopedObjectAccess soa(jni_env);
- art::StackHandleScope<3> hs(art::Thread::Current());
- art::Handle<art::mirror::Class> hs_klass(hs.NewHandle(soa.Decode<art::mirror::Class>(klass)));
- *loader = soa.AddLocalReference<jobject>(hs_klass->GetClassLoader());
- *name = art::mirror::Class::ComputeName(hs_klass)->ToModifiedUtf8();
- // TODO is this always null?
- *protection_domain = nullptr;
- const art::DexFile& dex = hs_klass->GetDexFile();
- *location = dex.GetLocation();
- *data_len = static_cast<jint>(dex.Size());
- // TODO We should maybe change env->Allocate to allow us to mprotect this memory and stop writes.
- jvmtiError alloc_error = env->Allocate(*data_len, dex_data);
+// TODO Implement this for real once transformed dex data is actually saved.
+jvmtiError Transformer::GetDexDataForRetransformation(ArtJvmTiEnv* env,
+ art::Handle<art::mirror::Class> klass,
+ /*out*/jint* dex_data_len,
+ /*out*/unsigned char** dex_data) {
+ // TODO De-quicken the dex file before passing it to the agents.
+ LOG(WARNING) << "Dex file is not de-quickened yet! Quickened dex instructions might be present";
+ LOG(WARNING) << "Caching of initial dex data is not yet performed! Dex data might have been "
+ << "transformed by agent already";
+ const art::DexFile& dex = klass->GetDexFile();
+ *dex_data_len = static_cast<jint>(dex.Size());
+ unsigned char* new_dex_data = nullptr;
+ jvmtiError alloc_error = env->Allocate(*dex_data_len, &new_dex_data);
if (alloc_error != OK) {
return alloc_error;
}
// Copy the data into a temporary buffer.
- memcpy(reinterpret_cast<void*>(*dex_data),
- reinterpret_cast<const void*>(dex.Begin()),
- *data_len);
+ memcpy(reinterpret_cast<void*>(new_dex_data),
+ reinterpret_cast<const void*>(dex.Begin()),
+ *dex_data_len);
+ *dex_data = new_dex_data;
+ return OK;
+}
+
+// TODO Move this function somewhere more appropriate.
+// Gets the data surrounding the given class.
+// TODO Make this less magical.
+jvmtiError Transformer::FillInTransformationData(ArtJvmTiEnv* env,
+ jclass klass,
+ ArtClassDefinition* def) {
+ JNIEnv* jni_env = GetJniEnv(env);
+ if (jni_env == nullptr) {
+ // TODO Different error might be better?
+ return ERR(INTERNAL);
+ }
+ art::ScopedObjectAccess soa(jni_env);
+ art::StackHandleScope<3> hs(art::Thread::Current());
+ art::Handle<art::mirror::Class> hs_klass(hs.NewHandle(soa.Decode<art::mirror::Class>(klass)));
+ if (hs_klass.IsNull()) {
+ return ERR(INVALID_CLASS);
+ }
+ def->klass = klass;
+ def->loader = soa.AddLocalReference<jobject>(hs_klass->GetClassLoader());
+ def->name = art::mirror::Class::ComputeName(hs_klass)->ToModifiedUtf8();
+ // TODO is this always null?
+ def->protection_domain = nullptr;
+ if (def->dex_data.get() == nullptr) {
+ unsigned char* new_data;
+ jvmtiError res = GetDexDataForRetransformation(env, hs_klass, &def->dex_len, &new_data);
+ if (res == OK) {
+ def->dex_data = MakeJvmtiUniquePtr(env, new_data);
+ } else {
+ return res;
+ }
+ }
return OK;
}
diff --git a/runtime/openjdkjvmti/transform.h b/runtime/openjdkjvmti/transform.h
index 0ad5099..0ff2bd1 100644
--- a/runtime/openjdkjvmti/transform.h
+++ b/runtime/openjdkjvmti/transform.h
@@ -43,16 +43,30 @@
jvmtiError GetClassLocation(ArtJvmTiEnv* env, jclass klass, /*out*/std::string* location);
-// Gets the data surrounding the given class.
-jvmtiError GetTransformationData(ArtJvmTiEnv* env,
- jclass klass,
- /*out*/std::string* location,
- /*out*/JNIEnv** jni_env_ptr,
- /*out*/jobject* loader,
- /*out*/std::string* name,
- /*out*/jobject* protection_domain,
- /*out*/jint* data_len,
- /*out*/unsigned char** dex_data);
+class Transformer {
+ public:
+ static jvmtiError RetransformClassesDirect(
+ ArtJvmTiEnv* env, art::Thread* self, /*in-out*/std::vector<ArtClassDefinition>* definitions);
+
+ static jvmtiError RetransformClasses(ArtJvmTiEnv* env,
+ art::Runtime* runtime,
+ art::Thread* self,
+ jint class_count,
+ const jclass* classes,
+ /*out*/std::string* error_msg);
+
+ // Gets the data surrounding the given class.
+ static jvmtiError FillInTransformationData(ArtJvmTiEnv* env,
+ jclass klass,
+ ArtClassDefinition* def);
+
+ private:
+ static jvmtiError GetDexDataForRetransformation(ArtJvmTiEnv* env,
+ art::Handle<art::mirror::Class> klass,
+ /*out*/jint* dex_data_length,
+ /*out*/unsigned char** dex_data)
+ REQUIRES_SHARED(art::Locks::mutator_lock_);
+};
} // namespace openjdkjvmti
diff --git a/test/921-hello-failure/expected.txt b/test/921-hello-failure/expected.txt
index 1c1d4d9..9615e6b 100644
--- a/test/921-hello-failure/expected.txt
+++ b/test/921-hello-failure/expected.txt
@@ -21,3 +21,11 @@
Transformation error : java.lang.Exception(Failed to redefine classes <LTransform;, LTransform2;> due to JVMTI_ERROR_NAMES_DONT_MATCH)
hello - MultiRedef
hello2 - MultiRedef
+hello - MultiRetrans
+hello2 - MultiRetrans
+Transformation error : java.lang.Exception(Failed to retransform classes <LTransform2;, LTransform;> due to JVMTI_ERROR_NAMES_DONT_MATCH)
+hello - MultiRetrans
+hello2 - MultiRetrans
+Transformation error : java.lang.Exception(Failed to retransform classes <LTransform;, LTransform2;> due to JVMTI_ERROR_NAMES_DONT_MATCH)
+hello - MultiRetrans
+hello2 - MultiRetrans
diff --git a/test/921-hello-failure/src/Main.java b/test/921-hello-failure/src/Main.java
index 1fe2599..43d6e9e 100644
--- a/test/921-hello-failure/src/Main.java
+++ b/test/921-hello-failure/src/Main.java
@@ -25,6 +25,7 @@
MissingInterface.doTest(new Transform2());
ReorderInterface.doTest(new Transform2());
MultiRedef.doTest(new Transform(), new Transform2());
+ MultiRetrans.doTest(new Transform(), new Transform2());
}
// Transforms the class. This throws an exception if something goes wrong.
@@ -47,7 +48,20 @@
dex_files.toArray(new byte[0][]));
}
+ public static void addMultiTransformationResults(CommonClassDefinition... defs) throws Exception {
+ for (CommonClassDefinition d : defs) {
+ addCommonTransformationResult(d.target.getCanonicalName(),
+ d.class_file_bytes,
+ d.dex_file_bytes);
+ }
+ }
+
public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
byte[][] classfiles,
byte[][] dexfiles) throws Exception;
+ public static native void doCommonClassRetransformation(Class<?>... target) throws Exception;
+ public static native void enableCommonRetransformation(boolean enable);
+ public static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
}
diff --git a/test/921-hello-failure/src/MultiRetrans.java b/test/921-hello-failure/src/MultiRetrans.java
new file mode 100644
index 0000000..95aaf07
--- /dev/null
+++ b/test/921-hello-failure/src/MultiRetrans.java
@@ -0,0 +1,108 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+
+class MultiRetrans {
+
+ // class NotTransform {
+ // public void sayHi(String name) {
+ // throw new Error("Should not be called!");
+ // }
+ // }
+ private static CommonClassDefinition INVALID_DEFINITION_T1 = new CommonClassDefinition(
+ Transform.class,
+ Base64.getDecoder().decode(
+ "yv66vgAAADQAFQoABgAPBwAQCAARCgACABIHABMHABQBAAY8aW5pdD4BAAMoKVYBAARDb2RlAQAP" +
+ "TGluZU51bWJlclRhYmxlAQAFc2F5SGkBABUoTGphdmEvbGFuZy9TdHJpbmc7KVYBAApTb3VyY2VG" +
+ "aWxlAQARTm90VHJhbnNmb3JtLmphdmEMAAcACAEAD2phdmEvbGFuZy9FcnJvcgEAFVNob3VsZCBu" +
+ "b3QgYmUgY2FsbGVkIQwABwAMAQAMTm90VHJhbnNmb3JtAQAQamF2YS9sYW5nL09iamVjdAAgAAUA" +
+ "BgAAAAAAAgAAAAcACAABAAkAAAAdAAEAAQAAAAUqtwABsQAAAAEACgAAAAYAAQAAAAEAAQALAAwA" +
+ "AQAJAAAAIgADAAIAAAAKuwACWRIDtwAEvwAAAAEACgAAAAYAAQAAAAMAAQANAAAAAgAO"),
+ Base64.getDecoder().decode(
+ "ZGV4CjAzNQDLV95i5xnv6iUi6uIeDoY5jP5Xe9NP1AiYAgAAcAAAAHhWNBIAAAAAAAAAAAQCAAAL" +
+ "AAAAcAAAAAUAAACcAAAAAgAAALAAAAAAAAAAAAAAAAQAAADIAAAAAQAAAOgAAACQAQAACAEAAEoB" +
+ "AABSAQAAYgEAAHUBAACJAQAAnQEAALABAADHAQAAygEAAM4BAADiAQAAAQAAAAIAAAADAAAABAAA" +
+ "AAcAAAAHAAAABAAAAAAAAAAIAAAABAAAAEQBAAAAAAAAAAAAAAAAAQAKAAAAAQABAAAAAAACAAAA" +
+ "AAAAAAAAAAAAAAAAAgAAAAAAAAAFAAAAAAAAAPQBAAAAAAAAAQABAAEAAADpAQAABAAAAHAQAwAA" +
+ "AA4ABAACAAIAAADuAQAACQAAACIAAQAbAQYAAABwIAIAEAAnAAAAAQAAAAMABjxpbml0PgAOTE5v" +
+ "dFRyYW5zZm9ybTsAEUxqYXZhL2xhbmcvRXJyb3I7ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZh" +
+ "L2xhbmcvU3RyaW5nOwARTm90VHJhbnNmb3JtLmphdmEAFVNob3VsZCBub3QgYmUgY2FsbGVkIQAB" +
+ "VgACVkwAEmVtaXR0ZXI6IGphY2stNC4yMAAFc2F5SGkAAQAHDgADAQAHDgAAAAEBAICABIgCAQGg" +
+ "AgAADAAAAAAAAAABAAAAAAAAAAEAAAALAAAAcAAAAAIAAAAFAAAAnAAAAAMAAAACAAAAsAAAAAUA" +
+ "AAAEAAAAyAAAAAYAAAABAAAA6AAAAAEgAAACAAAACAEAAAEQAAABAAAARAEAAAIgAAALAAAASgEA" +
+ "AAMgAAACAAAA6QEAAAAgAAABAAAA9AEAAAAQAAABAAAABAIAAA=="));
+
+ // Valid redefinition of Transform2
+ // class Transform2 implements Iface1, Iface2 {
+ // public void sayHi(String name) {
+ // throw new Error("Should not be called!");
+ // }
+ // }
+ private static CommonClassDefinition VALID_DEFINITION_T2 = new CommonClassDefinition(
+ Transform2.class,
+ Base64.getDecoder().decode(
+ "yv66vgAAADQAGQoABgARBwASCAATCgACABQHABUHABYHABcHABgBAAY8aW5pdD4BAAMoKVYBAARD" +
+ "b2RlAQAPTGluZU51bWJlclRhYmxlAQAFc2F5SGkBABUoTGphdmEvbGFuZy9TdHJpbmc7KVYBAApT" +
+ "b3VyY2VGaWxlAQAPVHJhbnNmb3JtMi5qYXZhDAAJAAoBAA9qYXZhL2xhbmcvRXJyb3IBABVTaG91" +
+ "bGQgbm90IGJlIGNhbGxlZCEMAAkADgEAClRyYW5zZm9ybTIBABBqYXZhL2xhbmcvT2JqZWN0AQAG" +
+ "SWZhY2UxAQAGSWZhY2UyACAABQAGAAIABwAIAAAAAgAAAAkACgABAAsAAAAdAAEAAQAAAAUqtwAB" +
+ "sQAAAAEADAAAAAYAAQAAAAEAAQANAA4AAQALAAAAIgADAAIAAAAKuwACWRIDtwAEvwAAAAEADAAA" +
+ "AAYAAQAAAAMAAQAPAAAAAgAQ"),
+ Base64.getDecoder().decode(
+ "ZGV4CjAzNQDSWls05CPkX+gbTGMVRvx9dc9vozzVbu7AAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAN" +
+ "AAAAcAAAAAcAAACkAAAAAgAAAMAAAAAAAAAAAAAAAAQAAADYAAAAAQAAAPgAAACoAQAAGAEAAGIB" +
+ "AABqAQAAdAEAAH4BAACMAQAAnwEAALMBAADHAQAA3gEAAO8BAADyAQAA9gEAAAoCAAABAAAAAgAA" +
+ "AAMAAAAEAAAABQAAAAYAAAAJAAAACQAAAAYAAAAAAAAACgAAAAYAAABcAQAAAgAAAAAAAAACAAEA" +
+ "DAAAAAMAAQAAAAAABAAAAAAAAAACAAAAAAAAAAQAAABUAQAACAAAAAAAAAAcAgAAAAAAAAEAAQAB" +
+ "AAAAEQIAAAQAAABwEAMAAAAOAAQAAgACAAAAFgIAAAkAAAAiAAMAGwEHAAAAcCACABAAJwAAAAIA" +
+ "AAAAAAEAAQAAAAUABjxpbml0PgAITElmYWNlMTsACExJZmFjZTI7AAxMVHJhbnNmb3JtMjsAEUxq" +
+ "YXZhL2xhbmcvRXJyb3I7ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwAV" +
+ "U2hvdWxkIG5vdCBiZSBjYWxsZWQhAA9UcmFuc2Zvcm0yLmphdmEAAVYAAlZMABJlbWl0dGVyOiBq" +
+ "YWNrLTQuMjAABXNheUhpAAEABw4AAwEABw4AAAABAQCAgASYAgEBsAIAAAwAAAAAAAAAAQAAAAAA" +
+ "AAABAAAADQAAAHAAAAACAAAABwAAAKQAAAADAAAAAgAAAMAAAAAFAAAABAAAANgAAAAGAAAAAQAA" +
+ "APgAAAABIAAAAgAAABgBAAABEAAAAgAAAFQBAAACIAAADQAAAGIBAAADIAAAAgAAABECAAAAIAAA" +
+ "AQAAABwCAAAAEAAAAQAAACwCAAA="));
+
+ public static void doTest(Transform t1, Transform2 t2) {
+ t1.sayHi("MultiRetrans");
+ t2.sayHi("MultiRetrans");
+ try {
+ Main.addMultiTransformationResults(VALID_DEFINITION_T2, INVALID_DEFINITION_T1);
+ Main.enableCommonRetransformation(true);
+ Main.doCommonClassRetransformation(Transform2.class, Transform.class);
+ } catch (Exception e) {
+ System.out.println(
+ "Transformation error : " + e.getClass().getName() + "(" + e.getMessage() + ")");
+ } finally {
+ Main.enableCommonRetransformation(false);
+ }
+ t1.sayHi("MultiRetrans");
+ t2.sayHi("MultiRetrans");
+ try {
+ Main.addMultiTransformationResults(VALID_DEFINITION_T2, INVALID_DEFINITION_T1);
+ Main.enableCommonRetransformation(true);
+ Main.doCommonClassRetransformation(Transform.class, Transform2.class);
+ } catch (Exception e) {
+ System.out.println(
+ "Transformation error : " + e.getClass().getName() + "(" + e.getMessage() + ")");
+ } finally {
+ Main.enableCommonRetransformation(false);
+ }
+ t1.sayHi("MultiRetrans");
+ t2.sayHi("MultiRetrans");
+ }
+}
diff --git a/test/930-hello-retransform/build b/test/930-hello-retransform/build
new file mode 100755
index 0000000..898e2e5
--- /dev/null
+++ b/test/930-hello-retransform/build
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-build "$@" --experimental agents
diff --git a/test/930-hello-retransform/expected.txt b/test/930-hello-retransform/expected.txt
new file mode 100644
index 0000000..4774b81
--- /dev/null
+++ b/test/930-hello-retransform/expected.txt
@@ -0,0 +1,2 @@
+hello
+Goodbye
diff --git a/test/930-hello-retransform/info.txt b/test/930-hello-retransform/info.txt
new file mode 100644
index 0000000..875a5f6
--- /dev/null
+++ b/test/930-hello-retransform/info.txt
@@ -0,0 +1 @@
+Tests basic functions in the jvmti plugin.
diff --git a/test/930-hello-retransform/run b/test/930-hello-retransform/run
new file mode 100755
index 0000000..4379349
--- /dev/null
+++ b/test/930-hello-retransform/run
@@ -0,0 +1,19 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-run "$@" --experimental agents \
+ --experimental runtime-plugins \
+ --jvmti
diff --git a/test/930-hello-retransform/src/Main.java b/test/930-hello-retransform/src/Main.java
new file mode 100644
index 0000000..12194c3
--- /dev/null
+++ b/test/930-hello-retransform/src/Main.java
@@ -0,0 +1,70 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+public class Main {
+
+ /**
+ * base64 encoded class/dex file for
+ * class Transform {
+ * public void sayHi() {
+ * System.out.println("Goodbye");
+ * }
+ * }
+ */
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+ "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
+ "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
+ "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
+ "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" +
+ "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
+ "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0=");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+ "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+ "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
+ "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+ "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
+ "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
+ "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
+ "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
+ "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
+ "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
+ "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+ "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+ "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
+
+ public static void main(String[] args) {
+ System.loadLibrary(args[1]);
+ doTest(new Transform());
+ }
+
+ public static void doTest(Transform t) {
+ t.sayHi();
+ addCommonTransformationResult("Transform", CLASS_BYTES, DEX_BYTES);
+ enableCommonRetransformation(true);
+ doCommonClassRetransformation(Transform.class);
+ t.sayHi();
+ }
+
+ // Transforms the class
+ private static native void doCommonClassRetransformation(Class<?>... target);
+ private static native void enableCommonRetransformation(boolean enable);
+ private static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/930-hello-retransform/src/Transform.java b/test/930-hello-retransform/src/Transform.java
new file mode 100644
index 0000000..8e8af35
--- /dev/null
+++ b/test/930-hello-retransform/src/Transform.java
@@ -0,0 +1,28 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Transform {
+ public void sayHi() {
+ // Use lower 'h' to make sure the string will have a different string id
+ // than the transformation (the transformation code is the same except
+ // the actual printed String, which was making the test inacurately passing
+ // in JIT mode when loading the string from the dex cache, as the string ids
+ // of the two different strings were the same).
+ // We know the string ids will be different because lexicographically:
+ // "Goodbye" < "LTransform;" < "hello".
+ System.out.println("hello");
+ }
+}
diff --git a/test/Android.run-test.mk b/test/Android.run-test.mk
index e604c93..38b88e4 100644
--- a/test/Android.run-test.mk
+++ b/test/Android.run-test.mk
@@ -309,6 +309,7 @@
927-timers \
928-jni-table \
929-search \
+ 930-hello-retransform \
ifneq (,$(filter target,$(TARGET_TYPES)))
ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,target,$(RUN_TYPES),$(PREBUILD_TYPES), \
diff --git a/test/ti-agent/common_helper.cc b/test/ti-agent/common_helper.cc
index 2c6d3ed..8799c91 100644
--- a/test/ti-agent/common_helper.cc
+++ b/test/ti-agent/common_helper.cc
@@ -18,6 +18,7 @@
#include <stdio.h>
#include <sstream>
+#include <deque>
#include "art_method.h"
#include "jni.h"
@@ -60,17 +61,17 @@
return true;
}
-namespace common_redefine {
-static void throwRedefinitionError(jvmtiEnv* jvmti,
- JNIEnv* env,
- jint num_targets,
- jclass* target,
- jvmtiError res) {
+template <bool is_redefine>
+static void throwCommonRedefinitionError(jvmtiEnv* jvmti,
+ JNIEnv* env,
+ jint num_targets,
+ jclass* target,
+ jvmtiError res) {
std::stringstream err;
char* error = nullptr;
jvmti->GetErrorName(res, &error);
- err << "Failed to redefine class";
+ err << "Failed to " << (is_redefine ? "redefine" : "retransform") << " class";
if (num_targets > 1) {
err << "es";
}
@@ -92,6 +93,16 @@
env->ThrowNew(env->FindClass("java/lang/Exception"), message.c_str());
}
+namespace common_redefine {
+
+static void throwRedefinitionError(jvmtiEnv* jvmti,
+ JNIEnv* env,
+ jint num_targets,
+ jclass* target,
+ jvmtiError res) {
+ return throwCommonRedefinitionError<true>(jvmti, env, num_targets, target, res);
+}
+
static void DoMultiClassRedefine(jvmtiEnv* jvmti_env,
JNIEnv* env,
jint num_redefines,
@@ -161,7 +172,138 @@
dex_files.data());
}
-// Don't do anything
+// Get all capabilities except those related to retransformation.
+jint OnLoad(JavaVM* vm,
+ char* options ATTRIBUTE_UNUSED,
+ void* reserved ATTRIBUTE_UNUSED) {
+ if (vm->GetEnv(reinterpret_cast<void**>(&jvmti_env), JVMTI_VERSION_1_0)) {
+ printf("Unable to get jvmti env!\n");
+ return 1;
+ }
+ jvmtiCapabilities caps;
+ jvmti_env->GetPotentialCapabilities(&caps);
+ caps.can_retransform_classes = 0;
+ caps.can_retransform_any_class = 0;
+ jvmti_env->AddCapabilities(&caps);
+ return 0;
+}
+
+} // namespace common_redefine
+
+namespace common_retransform {
+
+struct CommonTransformationResult {
+ std::vector<unsigned char> class_bytes;
+ std::vector<unsigned char> dex_bytes;
+
+ CommonTransformationResult(size_t class_size, size_t dex_size)
+ : class_bytes(class_size), dex_bytes(dex_size) {}
+
+ CommonTransformationResult() = default;
+ CommonTransformationResult(CommonTransformationResult&&) = default;
+ CommonTransformationResult(CommonTransformationResult&) = default;
+};
+
+// Map from class name to transformation result.
+std::map<std::string, std::deque<CommonTransformationResult>> gTransformations;
+
+extern "C" JNIEXPORT void JNICALL Java_Main_addCommonTransformationResult(JNIEnv* env,
+ jclass,
+ jstring class_name,
+ jbyteArray class_array,
+ jbyteArray dex_array) {
+ const char* name_chrs = env->GetStringUTFChars(class_name, nullptr);
+ std::string name_str(name_chrs);
+ env->ReleaseStringUTFChars(class_name, name_chrs);
+ CommonTransformationResult trans(env->GetArrayLength(class_array),
+ env->GetArrayLength(dex_array));
+ if (env->ExceptionOccurred()) {
+ return;
+ }
+ env->GetByteArrayRegion(class_array,
+ 0,
+ env->GetArrayLength(class_array),
+ reinterpret_cast<jbyte*>(trans.class_bytes.data()));
+ if (env->ExceptionOccurred()) {
+ return;
+ }
+ env->GetByteArrayRegion(dex_array,
+ 0,
+ env->GetArrayLength(dex_array),
+ reinterpret_cast<jbyte*>(trans.dex_bytes.data()));
+ if (env->ExceptionOccurred()) {
+ return;
+ }
+ if (gTransformations.find(name_str) == gTransformations.end()) {
+ std::deque<CommonTransformationResult> list;
+ gTransformations[name_str] = std::move(list);
+ }
+ gTransformations[name_str].push_back(std::move(trans));
+}
+
+// The hook we are using.
+void JNICALL CommonClassFileLoadHookRetransformable(jvmtiEnv* jvmti_env,
+ JNIEnv* jni_env ATTRIBUTE_UNUSED,
+ jclass class_being_redefined ATTRIBUTE_UNUSED,
+ jobject loader ATTRIBUTE_UNUSED,
+ const char* name,
+ jobject protection_domain ATTRIBUTE_UNUSED,
+ jint class_data_len ATTRIBUTE_UNUSED,
+ const unsigned char* class_dat ATTRIBUTE_UNUSED,
+ jint* new_class_data_len,
+ unsigned char** new_class_data) {
+ std::string name_str(name);
+ if (gTransformations.find(name_str) != gTransformations.end()) {
+ CommonTransformationResult& res = gTransformations[name_str][0];
+ const std::vector<unsigned char>& desired_array = IsJVM() ? res.class_bytes : res.dex_bytes;
+ unsigned char* new_data;
+ jvmti_env->Allocate(desired_array.size(), &new_data);
+ memcpy(new_data, desired_array.data(), desired_array.size());
+ *new_class_data = new_data;
+ *new_class_data_len = desired_array.size();
+ gTransformations[name_str].pop_front();
+ }
+}
+
+extern "C" JNIEXPORT void Java_Main_enableCommonRetransformation(JNIEnv* env,
+ jclass,
+ jboolean enable) {
+ jvmtiError res = jvmti_env->SetEventNotificationMode(enable ? JVMTI_ENABLE : JVMTI_DISABLE,
+ JVMTI_EVENT_CLASS_FILE_LOAD_HOOK,
+ nullptr);
+ if (res != JVMTI_ERROR_NONE) {
+ JvmtiErrorToException(env, res);
+ }
+}
+
+static void throwRetransformationError(jvmtiEnv* jvmti,
+ JNIEnv* env,
+ jint num_targets,
+ jclass* targets,
+ jvmtiError res) {
+ return throwCommonRedefinitionError<false>(jvmti, env, num_targets, targets, res);
+}
+
+static void DoClassRetransformation(jvmtiEnv* jvmti_env, JNIEnv* env, jobjectArray targets) {
+ std::vector<jclass> classes;
+ jint len = env->GetArrayLength(targets);
+ for (jint i = 0; i < len; i++) {
+ classes.push_back(static_cast<jclass>(env->GetObjectArrayElement(targets, i)));
+ }
+ jvmtiError res = jvmti_env->RetransformClasses(len, classes.data());
+ if (res != JVMTI_ERROR_NONE) {
+ throwRetransformationError(jvmti_env, env, len, classes.data(), res);
+ }
+}
+
+// TODO Write something useful.
+extern "C" JNIEXPORT void JNICALL Java_Main_doCommonClassRetransformation(JNIEnv* env,
+ jclass,
+ jobjectArray targets) {
+ DoClassRetransformation(jvmti_env, env, targets);
+}
+
+// Get all capabilities except those related to retransformation.
jint OnLoad(JavaVM* vm,
char* options ATTRIBUTE_UNUSED,
void* reserved ATTRIBUTE_UNUSED) {
@@ -170,9 +312,16 @@
return 1;
}
SetAllCapabilities(jvmti_env);
+ jvmtiEventCallbacks cb;
+ memset(&cb, 0, sizeof(cb));
+ cb.ClassFileLoadHook = CommonClassFileLoadHookRetransformable;
+ if (jvmti_env->SetEventCallbacks(&cb, sizeof(cb)) != JVMTI_ERROR_NONE) {
+ printf("Unable to set class file load hook cb!\n");
+ return 1;
+ }
return 0;
}
-} // namespace common_redefine
+} // namespace common_retransform
} // namespace art
diff --git a/test/ti-agent/common_helper.h b/test/ti-agent/common_helper.h
index 642ca03..8599fc4 100644
--- a/test/ti-agent/common_helper.h
+++ b/test/ti-agent/common_helper.h
@@ -27,6 +27,10 @@
jint OnLoad(JavaVM* vm, char* options, void* reserved);
} // namespace common_redefine
+namespace common_retransform {
+jint OnLoad(JavaVM* vm, char* options, void* reserved);
+} // namespace common_retransform
+
extern bool RuntimeIsJVM;
diff --git a/test/ti-agent/common_load.cc b/test/ti-agent/common_load.cc
index 521e672..1b11442 100644
--- a/test/ti-agent/common_load.cc
+++ b/test/ti-agent/common_load.cc
@@ -64,8 +64,9 @@
{ "916-obsolete-jit", common_redefine::OnLoad, nullptr },
{ "917-fields-transformation", common_redefine::OnLoad, nullptr },
{ "919-obsolete-fields", common_redefine::OnLoad, nullptr },
- { "921-hello-failure", common_redefine::OnLoad, nullptr },
+ { "921-hello-failure", common_retransform::OnLoad, nullptr },
{ "926-multi-obsolescence", common_redefine::OnLoad, nullptr },
+ { "930-hello-retransform", common_retransform::OnLoad, nullptr },
};
static AgentLib* FindAgent(char* name) {